Supporting Information

Production of the Bengamide Class of Marine Natural Products inMyxobacteria: Biosynthesis and Structure–Activity RelationshipsSilke C. Wenzel, Holger Hoffmann, Jidong Zhang, Laurent Debussche, Sabine Haag-Richter,Michael Kurz, Frederico Nardi, Peer Lukat, Irene Kochems, Heiko Tietgen, Dietmar Schummer,Jean-Paul Nicolas, Loreley Calvet, Valerie Czepczor, Patricia Vrignaud, Agnes M�hlenweg,Stefan Pelzer, Rolf M�ller,* and Mark Brçnstrup*

anie_201508277_sm_miscellaneous_information.pdf

S1

SUPPORTING INFORMATION

Table of contents

Production and characterization of bengamides from Myxococcus virescens ST200611 ......... 3

Cultivation of M. virescens ST200611 ................................................................................... 3

Figure S1. Growth of M. virescens ST200611 on an agar plate. ........................................... 3

Figure S2. HPLC-MS chromatograms ................................................................................... 4

Isolation of bengamides ......................................................................................................... 4

Structure elucidation of 3-6 by NMR ..................................................................................... 5

Figure S3. 1H and 13C-NMR spectra of bengamides 3-6 in DMSO at 300K. ........................ 6

Table S1. 1H and 13C-NMR spectroscopic data of bengamides 3-6 in DMSO at 300 K. .... 10

Table S2. Antiproliferative activity of bengamides 1-5 ....................................................... 12

Subcloning, identification and sequencing of the bengamide biosynthetic gene cluster ......... 12

Generation and screening of a cosmid library ...................................................................... 12

Identification of the bengamide biosynthetic gene cluster by gene inactivation ................. 13

Sequencing and sequence analysis ....................................................................................... 13

Figure S4. The bengamide biosynthetic gene cluster. .......................................................... 14

Table S3. Genes and encoded proteins of the M. virescens ST200611 chromosomal

fragment from cosmid 3815-7P16 ........................................................................................ 14

Table S4. In silico analysis of AT domains from PKS modules 2 and 3 ............................. 15

Feeding studies ......................................................................................................................... 16

Feeding study with [2-13C] glycerol ..................................................................................... 16

Figure S5. Analysis of the [2-13C] glycerol feeding experiment. ......................................... 16

Generation and modification of bengamide gene cluster expression constructs ..................... 17

Construction of a PacI-zeo-mx9-PacI transfer cassette for site-directed integration into the

mx9 attachment site present in several myxobacterial genomes .......................................... 17

Generation of the expression construct via Red/ET recombination ..................................... 17

Figure S6. Generation of an expression construct for the entire bengamide biosynthetic

gene cluster. .......................................................................................................................... 18

Deletion of the Hydroxymalonyl-CoA biosynthetic operon and heterologous expression of

the modified biosynthetic gene cluster ................................................................................. 18

Figure S7. Deletion of benE-benH and promoter insertion ................................................. 19

Construction of Myxococcus xanthus DK1622 mutants harboring bengamide gene cluster

expression constructs and bengamide production analysis ...................................................... 19

Transfer of the expression constructs into M. xanthus DK1622 .......................................... 19

S2

Analysis of heterologous bengamide production ................................................................. 19

Figure S8. HPLC-MS profiles from extracts of the M. xanthus DK1622::pBen32 mutant . 20

Resistance-conferring function of BenI ................................................................................... 20

Generation of expression constructs for BenI (native) and BenI (L154C) and

overexpression in E. coli TolC in the presence/absence of bengamide ............................... 20

Figure S9. In silico analysis of BenI .................................................................................... 21

Figure S10. Clashes of possible L154 rotamers with bengamides. ...................................... 22

Figure S11. Structures of bengamide inhibitors Y02, Y08, Y10, Y16 and LAF153. .......... 23

Semisynthesis ........................................................................................................................... 23

Scheme S1. Semisynthesis of bengamide analogs through N-benzylation of 3. ................. 23

Total synthesis .......................................................................................................................... 26

Scheme S2. Total synthesis of bengamide analogs. ............................................................. 26

Compound profiling ................................................................................................................. 28

Cell lines ............................................................................................................................... 28

Thymidine pulse proliferation assay .................................................................................... 28

Viability ATP assay ............................................................................................................. 28

Viability FDA/PI assay ........................................................................................................ 28

Cellular activities of bengamides 3-5 ................................................................................... 28

Table S2. Antiproliferative activity of bengamides 1-5 ....................................................... 29

Table S5: Antiproliferative activities against HCT116 of bengamide analogs 3, 7a-e, and

8a-e ....................................................................................................................................... 29

Table S6: Antiproliferative activities of bengamide analogs 8a, 8d and 2 against a panel of

14 cancer cell lines ............................................................................................................... 29

MetAP2 enzymatic assay ..................................................................................................... 30

Metabolic labilities assessment ............................................................................................ 30

Pharmacokinetic study in male C57BL mice ....................................................................... 30

In vivo antitumor activity assay ............................................................................................ 31

Figure S12. ........................................................................................................................... 32

Table S7: In vivo efficacy of 8a and docetaxel in a B16 melanoma model ......................... 33

References ................................................................................................................................ 33

S3

Production and characterization of bengamides from Myxococcus

virescens ST200611 [1]

Cultivation of M. virescens ST200611 Myxococcus virescens ST200611 (DSM15898; Figure S1) was isolated from a soil sample.

Precultures of the strain were prepared in a medium containing 1 % fresh baker’s yeast, 1 %

CaCl2 2 H2O, 20 mM HEPES, 0.00005 % cyanocobalamin, pH 7.2 in 300 ml Erlenmeyer

flasks and incubated for 4 days at 30 °C and 180 rpm on a rotating shaker. 5 ml of this

preliminary culture are then used for preparing the main cultures. The medium for production

of bengamides contained the following nutrients: 0.5% yeast extract, 0.5 % casitone, 0.1 %

CaCl2 2 H2O, 0.2 % MgSO4 7 H2O, 0.00005 % cyanocobalamin, pH 7.4. 300 ml

Erlenmeyer flasks containing 100 ml medium were inoculated with 10 % (v/v) of the above

preculture and incubated at 30 °C and 180 rpm on a rotary shaker. The maximum production

of the bengamides is reached after 72-96 hours.

Bengamides can also be produced in fermenters. For example, a 30 l fermenter was

operated under the following conditions: 5% Inoculum ; nutrient medium as described above;

incubation temperature 30 °C; stirrer speed 112 rpm; aeration: 8 l/min; pH regulation from pH

7.8 to pH 7.5; no pO2 regulation. The pH was regulated with 10 % KOH or 10 % H2SO4, Anti-

foam: Clerol FBA 265 (Cognis Deutschland GmbH). Bengamides were produced after

approx. 72 to 96 hours.

The fermentation broth of Myxococcus virescens ST200611 (DSM 15898) was freeze dried

and the lyophilizate was extracted with methanol (2 5 l). Bengamides were isolated by

successive chromatographic steps and the structures were elucidated by 1H and 13C NMR

spectroscopy (see below).

Figure S1. Growth of M. virescens ST200611 on an agar plate.

S4

Figure S2. HPLC-MS chromatograms a) HPLC-UV/Vis chromatogram of a methanol

extract of M. virescens ST200611. The peaks corresponding to compounds 3 - 4 are indicated (Agilent 1100, Bruker microTOF, column: Luna 2.5 µ C18(2) 100A 100 x 2 mm, Solvent A: 95 % 6.5 mM NH4Ac; 5 % CAN, Solvent B: 5 % 6.5 mM NH4Ac; 95 % CAN,

Gradient: B 10 % (0 min) → 100 % (24 min), 100 % (29 min) → 10 % (30 min), Flow rate: 0.5

mL/min, Temperature: 40 C°). b) Cut-out of the MS trace from 3.0 to 9.0 min to identify all bengamides 3 - 6 in the methanol extract.

Isolation of bengamides The methanol extract was reduced to 1.2 L under vacuum and then loaded onto a MCI

column (CHP-20P, 75-150 μm, ~1.5 L, Mitsubishi Chemical Corporation). The column was eluted with 95% methanol at a flow rate of 120 ml/min. The eluate was collected, reduced

down to a volume of 1.5 l and loaded onto a Phenomenex Luna column (C18 (2), 10 μm,

dimension: 50 250 mm) possessing a Luna precolumn (C18 (2), 10 μm, dimension: 21 60 mm). The compounds were eluted with a gradient from 5% to 95% acetonitrile in water over 60 min (0.1% ammonium acetate, pH 4.6, adjusted with acetic acid; flow rate: 150 ml/min; fraction size: 200 ml). Bengamides 3-6 were present in fractions 5-9, 10-11 and 12-14. Each fraction was lyophilized and purified once more by HPLC on a Phenomenex

Luna column (C18 (2), 10 μm, dimension: 21 250 mm) possessing a Waters XTerra

precolumn (Prep MS C18, 10 μm, dimension: 19 10 mm). The column was eluted using a gradient from 5% to 40% acetonitrile in water over 40 min (0.1% ammonium acetate, pH 8.8, adjusted with aqueous ammonia; flow rate: 50 ml/min, fraction size: 7.5 ml). Column I gave bengamide E (5, 86 mg), column II gave bengamide 3 (145 mg, diasteromeric mixture: ratio 75:25) and bengamide F (6, <1 mg) and column III gave bengamide 4 (35 mg, diastereomeric mixture: ratio 70:30). The diastereomeric mixture of compound 3 was separated on a chiral column (AD/H, Daicel,

20 200 mm, 0.5 ml flow, mobile phase: acetonitrile:methanol 4:1 + 0.1% NH4Ac). The

optical purity was checked on an analytical AD/H column (Daicel) (4.6 250 mm, 30°C,

a

b

S5

mobile phase: acetonitrile:methanol 4:1 + 0.1% NH4Ac, 0.75 ml flow, Rt peak 1: 9.9 min, Rt peak 2: 10.9 min). For a characterization of 3-5 by high resolution LC/MS, an Agilent 1200 HPLC (column: Kinetex 1.7µ C18 100A 50 x 2.1mm; flow rate: 0.8 mL/min; temperature: 45 C°; solvent A: 95 % 6.5 mM NH4Ac; 5 % ACN; solvent B: 5 % 6.5 mM NH4Ac; 95 % ACN; gradient: B 5 %

(0 min) →%100 % (5.6 min), 100 % (7.3 min) → 5 % (7.5 min)) coupled to an Agilent 6220

ESI-TOF MS was utilized.

Compound 3: RT = 1.40 min; UV = end; [α]23D = +46.7 (c = 0.54, MeOH); HR-MS found for

[M+H]+: m/z 373.2347; calc.: m/z 373.2333 for C18H33N2O6; found for [M-H]-: m/z 371.2198; calc.: m/z 371.2188; 1H-NMR and 13C-NMR: see Table S1.

Compound 4: RT = 1.66 min; UV = end; found for [M+H]+: m/z 387.2487 Calc.: m/z 387.2490 for C19H35N2O6; found for [M-H]-: m/z 385.2328; calc.: m/z 385.2344; 1H-NMR and 13C-NMR: see Table S1.

Compound 5: RT = 1.08 min; UV = end; [α]23D = +38.5 (c = 0.55, MeOH); HR-MS found for

[M+H]+: m/z 359.2170; calc.: m/z 359.2177 for C17H31N2O6; found for [M-H]-: m/z 357.2041; calc.: m/z 357.2031; 1H-NMR and 13C-NMR: see Table S1. Compound 6 was isolated in minor quantities and only characterized by its nominal mass ESI-MS found for [M+H]+: m/z 373 and its 1H-NMR spectrum (see Table S1).

Structure elucidation of 3-6 by NMR Proton, DQF-COSY, ROESY, HMQC and HMBC spectra were recorded on a Bruker DRX 500 spectrometer operating at 500 MHz equipped with a 5mm TXI cryo probehead with z gradients. Carbon-13 spectra were recorded on a Bruker DRX 600 spectrometer operating at 150 MHz for 13C equipped with a 5mm dual probehead. All experiments were carried out at 300K in DMSO-d6. NMR spectra were referenced to the solvent resonance signal (DMSO-

d6: 1H ppm 2.50, 13C ppm 39.5). Homonuclear experiments, DQF-COSY and ROESY, were performed with a spectral width of 9 ppm. Spectra were recorded with 512 increments in t1 and 4096 complex data points in t2. For each t1 value 8 transients were averaged. For the ROESY spectrum a mixing time of 150 ms was used. For HMQC spectra 512 increments (8 scans) with 2048 complex data points in t2 were collected using a sweep width of 9 ppm in the proton and 150 ppm in the carbon dimension. The HMBC spectra were acquired with a sweep width of 9 ppm in the proton and 190 ppm in the carbon dimension. A total of 16 transients were averaged for each of 512 increments in t1, and 4096 complex points in t2 were recorded. The structures of 3 - 6 were elucidated by multidimensional NMR, as exemplified for the main component 3 (Figure 1; Figure S3 and Table S1): The ESI-HRMS spectra showed a molecular ion at m/z = 373.2347 Da for [M+H]+, corresponding to the molecular formula C18H33N2O6 for the protonated molecule (calc. m/z = 373.2333 Da). Based on the analysis of DQF-COSY and HMQC spectra, two large substructures could be assigned. The first fragment covered carbons C3 to C7 (including the amide protons 2-NH and 8-NH), while the second fragment covered carbons C10 to C18. The position of the methoxy group was indicated by a correlation between C10 and the protons of the methoxy group in the HMBC spectrum. The correlations in the HMBC spectrum were also used to connect the two remaining quaternary carbons at 173.99 and 169.61 ppm with the two large fragments. C1 experienced correlations to 2-NH and H3 on one side of fragment 1 and H7 and H6 on the other side of fragment 1 leading to the 7-membered ring system. C9 experienced correlations to the amide proton 8-NH and H8 of fragment 1 and H10 and H11 of fragment 2, thereby connecting the two fragments. A literature search revealed that 3 - 6 belong to the class of bengamides. Compounds 5 and 6 correspond to bengamide E and F, respectively, while 3 and 4 carry an additional methyl group (C18). The absolute stereochemistry of bengamides has been established previously;[2] Due to the almost identical chemical shifts at C7, C10, C11, C12 and C13 and matching chiroptical values for 5, the same configuration was assumed for 3 - 6. As the

S6

chemical shifts of the major and minor diastereomers of 3 and 4 were almost identical, with the exception of a small splitting of signals at C11-C18, it seems most likely that the two diastereomers differ in their configuration at C-16. A threefold difference in activity between the two diastereomers of 3 was reported, and the minor diastereoisomer was more active. However, the configuration at C16 could not be assigned.

Figure S3. 1H and 13C-NMR spectra of bengamides 3-6 in DMSO at 300K.

1H-NMR spectrum of 3 in DMSO at 300 K.

S7

13C-NMR spectrum of 3 in DMSO at 300 K.

1H-NMR spectrum of 4 in DMSO at 300 K.

S8

13C-NMR spectrum of 4 in DMSO at 300 K.

1H-NMR spectrum of 5 in DMSO at 300 K.

S9

13C-NMR spectrum of 5 in DMSO at 300 K.

1H-NMR spectrum of 6 in DMSO at 300 K.

S10

Table S1. 1H and 13C-NMR spectroscopic data of bengamides 3-6 in DMSO at 300 K.

Table S1a: 1H and 13C-NMR spectroscopic data of bengamide (3) in DMSO at 300 K.

(ratio main/minor is ca. 75%:25%)

1H 13C

main minor main minor

1 - - 174.0 174.0

2 7.91 7.91 - -

3 3.19/3.06 3.19/3.06 40.56 40.56

4 1.74/1.20 1.74/1.20 28.75 28.75

5 1.87/1.64 1.87/1.64 27.55 27.55

6 1.87/1.36 1.87/1.36 30.72 30.72

7 4.39 4.39 51.27 51.27

8 7.78 7.78 - -

9 - - 169.6 169.6

10 3.69 3.69 81.60 81.60

10-OMe 3.25 3.25 57.32 57.32

11 3.58 3.58 70.72 70.77

11-OH 4.46 4.47 - -

12 3.33 3.33 72.80 72.85

12-OH 4.36 4.36 - -

13 3.97 3.97 72.46 72.37

13-OH 4.56 4.56 - -

14 5.37 5.38 129.1 129.0

15 5.48 5.49 136.6 136.4

16 1.99 1.99 37.41 37.28

16-Me 0.93 0.92 19.90 19.86

17 1.26 1.26 29.15 29.06

18 0.81 0.82 11.58 11.48

Table S1b: 1H and 13C-NMR spectroscopic data of bengamide (4) in DMSO at 300 K.

(ratio main/minor is ca. 70%:30%)

1H 13C

main minor main minor

1 - - 172.0 172.0

2 2.91 2.91 35.28 35.28

3 3.61/3.21 3.61/3.21 49.20 49.20

4 1.71/1.31 1.71/1.31 26.13 26.13

5 1.82/1.67 1.82/1.67 27.11 27.11

6 1.84/1.32 1.84/1.32 30.80 30.80

7 4.55 4.55 51.14 51.14

8 7.84 7.84 - -

9 - - 169.5 169.5

S11

10 3.69 3.69 81.55 81.55

10-OMe 3.25 3.25 57.28 57.28

11 3.57 3.57 70.69 70.74

11-OH 4.45 4.45 - -

12 3.33 3.33 72.77 72.83

12-OH 4.37 4.37 - -

13 3.97 3.97 72.47 72.39

13-OH 4.56 4.56 - -

14 5.37 5.38 129.0 129.0

15 5.48 5.49 136.6 136.4

16 1.99 1.99 37.41 37.28

16-Me 0.934 0.928 19.89 19.85

17 1.26 1.26 29.15 29.06

18 0.81 0.82 11.58 11.48

Table S1c: 1H and 13C-NMR spectroscopic data of 5, and 1H-NMR spectroscopic data of 6 in

DMSO at 300 K. Bengamide E 5 Bengamide F 6

Position 1H 13C 1H

1 - 174.0 -

2 7.91 - 2.91

3 3.19/3.06 40.56 3.62/3.21

4 1.74/1.20 28.75 1.69/1.33

4-OH - - -

5 1.87/1.64 27.56 1.84/1.69

6 1.87/1.36 30.72 1.84/1.33

7 4.39 51.27 4.56

8 7.78 - 7.84

9 - 169.6 -

10 3.69 81.61 3.70

10-OMe 3.25 57.30 3.25

11 3.56 70.74 3.57

11-OH 4.49 -

12 3.33 72.78 3.33

12-OH 4.38 -

13 3.96 72.38 3.97

13-OH 4.57 -

14 5.38 127.7 5.38

15 5.58 137.9 5.59

16 2.24 30.08 2.25

16-Me 0.95 22.17 0.95

17 0.95 22.27 0.95

18 - - -

S12

Table S2. Antiproliferative activity of bengamides 1-5 This Table is inserted further below in the section on compound profiling.

Subcloning, identification and sequencing of the bengamide biosynthetic gene cluster According to a retro-biosynthetic analysis, we expected a hybrid of a polyketide synthase (PKS)/nonribosomal peptide synthetase (NRPS) to be responsible for bengamide formation. As core enzymatic activities of such megasynthetases[3] are usually highly conserved, degenerated primers were used to amplify PKS and NRPS encoding regions from genomic DNA of the bengamide producer strain M. virescens ST200611. A cosmid library of this strain was constructed and screened with the generated homologous PKS/NRPS probes (see below). After identification of the putative biosynthetic gene cluster, a gene transfer protocol for M. virescens ST200611 was developed and employed to unambiguously identify the genomic region involved in bengamide biosynthesis (see below). Shotgun sequencing of an identified cosmid harboring the entire gene cluster (cosmid 3815-7P16) was performed followed by in silico analysis of the deciphered chromosomal fragment (see below). Comparison with gene arrangements of orf3-orf9 homologues identified in the Myxococcus xanthus DK1622 genome[4] indicated that the bengamide biosynthetic gene cluster consists of nine genes, benA-I (Figure S4, Table S3). The 25 kb gene cluster appears to be integrated into orf7 via a recombination event (possibly after horizontal gene transfer), which enables M. virescens to produce bengamides - in contrast to its relative M. xanthus (Figure S4).Detailed in silico analysis of the encoded pathway was performed (Table S3, Table S4) to propose a scenario for bengamide biosynthesis as described in the main text (Figure 2). Interestingly, no putative N-methyl transferase encoding gene could be identified within the bengamide gene cluster region, suggesting that the required enzyme activity is encoded elsewhere in the genome. However, shotgun genome sequencing of the producer revealed the presence of many homologues of N-methyl transferases (N-MT) and thus did not allow for the identification of the bengamide N-MT.

Generation and screening of a cosmid library A genomic library of M. virescens was generated by using pOJ436[5] as cosmid vector according to previously established protocols (e.g. as described by Xu et al.[6]). Robotically produced high-density colony arrays (Hybond N+; Amersham Pharmacia) were utilized for the screening of 4608 cosmid clones with strain specific PKS and NRPS probes, which were labeled using the Roche PCR DIG Probe Synthesis Kit. PCRs were performed with Taq polymerase (Qiagen) and chromosomal DNA from M. virescens ST200611 as template. To generate the PKS probe degenerated oligonucleotides (KSII-For: 5’-CTSGGSGACCCSATCGAG-3’ and AT-I-Rev: 5’-GCSGCSGCGATCTCSCC CTGSSWGTGSCC-3‘) were used for the amplification of ~ 850 bp fragments specific for KS-AT domains. For the generation of the NRPS probes degenerated oligonucleotides (olig5: 5'-ATCGAGCTSGGSGAGATCGAG-3' and olig6: 5'-SGAGTGSCCSCCSAGCTCGAA-3'),[7] were used to amplify ~ 450 bp fragments specific for A-PCP domains, and another set of degenerated oligonucleotides (A3: 5’-GCSTACSYSATSTACACSTCSGG-3’ and A7R: 5’-SASGTCVCCSGTSCGGTAS-3’),[8] was used to amplify 700-800 bp fragments specific for A domains. Hybridization and detection experiments were performed under standard conditions. 48 cosmids hybridizing with all three probes could be identified, which were divided into eight different groups based on restriction analysis. DNA fragments > 1 kb (encoding internal PKS and/or NRPS gene fragments) from one representative of each group were subcloned into vector pHN15 (Werner BioAgents), which can be used as suicide vector for gene inactivation studies to identify the bengamide biosynthetic gene cluster in M. virescens (see below).

S13

Identification of the bengamide biosynthetic gene cluster by gene inactivation The pHN15 derivatives containing homologous PKS and/or NRPS encoding gene fragments (see above) were transformed into M. virescens ST200611 by electroporation using the following procedure: Cells from a 50 ml M. virescens ST200611 culture grown in HK medium (100 ml HK medium contains: 0.5% yeast extract; 0.5% casitone; 0.1% CaCl2 x 2H2O; 0.2% MgSO4 x 7H2O, 0.00005% cyanocobalamin, pH7.4) at 28 °C for 2-3 days were spun down, washed four times with distilled water and finally resuspended in 1 ml distilled water. 40 µl of this cell suspension (approx. 108 cells) was mixed with 1-2 µl alkali treated DNA and using a 0.1 mm cuvette the following electroporation conditions were applied: 400 Ω, 25 µFD, 0.65 kV. Immediately after electroporation 1 ml of HK medium was added to the cuvette and the cells were transferred to a 20 ml flask containing 10 ml HK medium and incubated at 28 °C for approx. 19 h. After centrifugation (3000 rpm, 5 min) the cells were resuspended in 0.5 ml HK medium and different dilutions were transferred in 3 ml CY soft agar to a CY agar plate (both supplemented with 50 µg/ml nourseothricin). Transformants appeared after 7 d incubation at 28 °C. The transformants obtained from the electroporation of different pHN15 derivatives were cultivated in parallel to M. virescens wildtype strain and subsequently analyzed for the production of bengamides. It turned out that a representative of cosmid group four, cosmid 3815-2L11, harbors a chromosomal region, which is clearly involved in bengamide biosynthesis. All cosmids assigned to this group were analyzed by end-sequencing to finally select cosmid 3815-7P16 for shot gun sequencing.

Sequencing and sequence analysis Shot gun sequencing of cosmid 3815-7P16 was performed at GATC Biotech (Konstanz, Germany) revealing a 37 kb chromosomal fragment. Putative ORFs identified by FramePlot,[9] were analyzed by BlastP,[10] and Pfam database searches.[11] The catalytic domains of the PKS and NRPS encoding genes were assigned based on Pfam searches and the PKS/NRPS analysis tool developed by Raque Ravel.[12] In addition, whole genome shotgun sequencing of the bengamide producer was performed at SeqIT (Kaiserslautern, Germany) using the 454 technology to obtain 14 sequence scaffolds harboring together 1333 sequence contigs. The sequence data was screened for PKS and NRPS coding sequence using a complete genome scanning pipeline provided by Jacques Ravel (available at: http://nrps.igs.umaryland.edu/nrps/2metdb/Genome_scanning_download.html). tBlastn searches were performed to identify MetAp ecoding genes. Substrate specificity of acyl transferase (AT) domains from modules 2 and 3 Substrate specificity of AT domains was analyzed based on an alignment of the AT domains to a reference AT from E. coli FAS, 1MLA (PDB 1MLA, UniProtKB P0AA19) using the Geneious alignment tool integrated into Geneious version7.1.[13] This analysis revealed that the AT domain from module 2 of the bengamide megasynthetase (Ben-M2) contains the GxSxG consensus motif with the catalytic residue in the center, whereas in the AT from module 3 (Ben-M3) the catalytic serine residue is replaced by a glycine. According to Yadav et al.[14] the 13 residue signatures shown in Table S4 can be used for the prediction of AT substrate specificities. Comparison with AT domains from other myxobacterial PKS modules, which are assumed or known to incorporate glycolate units (‘hydroxymalonyl’ or ‘methoxymalonyl’ units), revealed an almost identical signature between the AT domains from Ben-M2 and Cnd-M5 (module 5 from the chondrochloren megasynthetase[15]). For the AT domain from Ben-M3, no significant similarity to other AT domain patterns shown in Table S4 could be detected. The AT domain did neither show sequence motifs characteristic for malonyl-CoA or methylmalonyl-CoA specific AT domains. Therefore, no putative substrate specificity for the Ben-M3 AT domain could be predicted.

S14

Figure S4. The bengamide biosynthetic gene cluster. Organization of genes within

the M. virescens ST200611 chromosomal fragment of cosmid 3815-7P16 harboring the bengamide biosynthetic gene cluster in comparison to a chromosomal region of M. xanthus DK1622 (mxan3 = mxan_2793, mxan4 = mxan_2792, mxan5 = mxan_2791, mxan6 = mxan_2790, mxan7 = mxan_2789, mxan8 = mxan_2788, mxan9 = mxan_2787). In the lower part of the figure a putative insertion site of the bengamide gene cluster into the genome of a M. xanthus DK1622 predecessor strain is shown according to homologies of genes up- and downstream of the cluster.

Table S3. Genes and encoded proteins of the M. virescens ST200611 chromosomal fragment from cosmid 3815-7P16 harboring the bengamide

biosynthetic gene cluster (GenBank accession number: KP143770).

Gene/Protein Name

Location Length [nt/aa]

Putative Function Homolog in M. xanthus †

orf1/Orf1 1879-872 1008/335 Regulator -

orf2/Orf2 2279-2959 681/226 Regulator -

orf3/Orf3 4093-2975 1119/372 Lipoprotein MXAN_2793 (YP_631010)

orf4/Orf4 5463-4294 1170/389 Lipoprotein MXAN_2792 (YP_631009)

orf5/Orf5 5889-6686 798/265 Protease B MXAN_2791 (YP_631008)

orf6/Orf6 6690-7463 774/257 Protease A MXAN_2790 (YP_631007)

orf7-1/Orf7-1 7748-9157 1410/469 Efflux protein (truncated) MXAN_2789 (YP_631006)

benE/BenE 10308-9238 1071/356 FkbH like protein -

benF/BenF 11457-10315 1143/380 Acyl-CoA dehydrogenase -

benG/BenG 11713-11477 237/78 Acyl carrier protein -

benH/BenH 12640-11723 918/305 Acyl-CoA dehydrogenase -

benA/BenA 13149-19373 6225/2074 PKS (CP-KS-AT-AT-DH-KR-CP)

-

benB/BenB 19375-24144 4770/1589 PKS (KS-AT-KR-CP) -

benC/BenC 24170-29350 5181/1726 PKS (KS-AT-KR-CP-MT) -

benD/BenD 29374-33429 4056/1351 NRPS (C-A-CP-TE) -

benI/BenI 34497-33496 1002/333 Methionine aminopeptidase - ‡

orf7-2/Orf7-2 34563-35159 597/198 Efflux protein (truncated) MXAN_2789

S15

(YP_631006)

orf8/Orf8 35670-35287 384/127 Rieske (2Fe-2S) domain-containing protein

MXAN_2788 (YP_631005)

orf9/Orf9 37015-35678 1338/445 Homogentisate 1,2-dioxygenase

MXAN_2787 (YP_631004)

† Genome sequence of M. xanthus DK1622 (GenBank: CP000113)12 ‡ M. xanthus and other myxobacteria usually harbor two Methionine aminopeptidase (MetAP) encoding genes (see Figure S9); BenI represents a third (and mutated) MetAP.

Table S4. In silico analysis of AT domains from PKS modules 2 and 3 (M2 and

M3) from the bengamide (Ben) megasynthetase compared to other myxobacterial AT

domains, which are assumed or known to incorporate glycolate units. The GxSxG AT domain

consensus motif is shown in red. Cnd: Chondrochloren megasynthetase,[15] Msc:

Microsclerodermin megasynthetase,[16] Sor: Soraphen megasynthetase.[17]

AT from Active site residues (numbering confers to 1MLA)

11 63 90 91 92 93 94 117 200 201 231 250 255

Ben-M2 L Q G Y S L G R F H N H V

Ben-M3 E H G V G L G R H H P H A

Cnd-M4 H H G H S V G R S H S H V

Cnd-M5 L Q G Y S I G R F H N H V

Msc-M3 Q Q G H S I G R F H N H V

Sor-M3 Q Q G H S Q G R S H T N V

Sor-M7 Q Q G H S Q G R S H T N V

S16

Feeding studies

Feeding study with [2-13C] glycerol To elucidate the biosynthetic origin of the bengamide polyketide units a feeding experiment with [2-13C] glycerol was performed. In parallel M. virescens ST200611 was grown in absence of labelled precursors to generate a control sample for later comparison of 13C-NMR spectra. Cultivations were performed in 200 ml bengamide production medium (see page S3), which was inoculated with a well grown pre-culture (1:50). The labelled precursor was fed in equal portions after 3, 4, 5 and 6 days to supply a total amount of 2 mmol of [2-13C] glycerol. After 7 days XAD-16 adsorber resin (2 %) was added to the cultures and 6 h later cells and XAD were harvested by centrifugation. After extraction with 200 ml methanol, the solvent was removed in vacuo to yield 80 mg raw extract from each culture. By successive chromatographic steps 2-3 mg of the bengamide derivative 3 was isolated for NMR analysis. Carbon-13 spectra were recorded in DMSO-d6 on a Bruker AVANCE DMX-600 spectrometer operating at 150 MHz and 300 K. Comparison of the 13C-NMR spectra of bengamide isolated from the control culture and the culture fed with [2-13C] glycerol shows that carbons C-10 and C-12 were significantly 13C-enriched (Figure S5). This result indicates that both carbons originate from C-2 of glycerol, which is in accordance with the incorporation of two glycolate units in position C9/C10 and C11/C12 of the bengamide polyketide chain (Figure 2).

% 13C ‡ (referenced to C-15)

% 13C excess † (referenced to C-15)

C-9 1.03 0 (-0.07)

C-10 1.92 0.82

C-11 1.22 0.12

C-12 2.12 1.02

C-13 1.32 0.22

C-14 1.27 0.17

C-15* 1.10 0 ‡ 1.1 % x (signal intensity after [2-13C]glycerol feeding / signal intensity control) † % 13C - 1.1 % * not labeled by glycerol; natural 13C abundance of 1.1%

Figure S5. Analysis of the [2-13C] glycerol feeding experiment. Comparison of

the 13C-NMR spectra of the control sample (no precursor feeding) with the 13C-enriched bengamide sample (isolated from the culture supplied with [2-13C] glycerol) and quantification of 13C enrichment in the three PKS extender units (C-9-C-14, see table).

C-15

C-15

S17

Generation and modification of bengamide gene cluster expression constructs

Construction of a PacI-zeo-mx9-PacI transfer cassette for site-directed integration into the mx9 attachment site present in several myxobacterial genomes

The oligonucleotides MyxET3 (5’-TTATCAAAAAGAGTATTGACTTAAAGTCTAACCTATAGGATACTTACAGCCATCGAGAGGAAGGAGGTACAGATTATGGCGCTCAGGGGTGCGTCG-3’) and MyxET4 (5’-GAATTCTAGAGCAATATAGTCCTACAATGTCAAGCTCGACCGATGCTTAATTAATCATTTGCCACCCCGCTTC-3’) were used to amplify the ~1.7 kb Mx9 int gene[18] from pKOS375-151.1[19] using Triple Master polymerase according to the manufacturer’s protocol (Eppendorf). The PCR product was subcloned into the pJET1/blunt vector (Fermentas) to generate construct pMyx10. As the sequence of the T7A1 promotor (GenBank: A15404), which should be introduced via the oligonucleotide MyxET3 was not correct, the Ptn5-promotor driven kanamycin resistance gene was integrated upstream of the Mx9 int gene (mx9) to construct a Ptn5-kan-mx9 operon. This modification step was performed by Red/ET cloning: A linear ~ 1 kb Ptn5-kan fragment was amplified by PCR from CMch37 [20] using the oligonucleotides MyxET5 (5’- TTCGGTATTATCTCTATTTTTAACTTGGAGCAGGTTCCATGAATTCCGATCCGGCGCGCCAATAGTCATGCCCCGCGCCCACCGGATGGACAGCAAGCGAACCG-3’) and MyxET9 (5’- CGTCCGACGCACCCCTGAGCGCCATAATCTGTACCTCCTTGCTAGCTCAGAAGAACTCGTCAAGAAG-3’) and was recombined with pMyx10 in the Red/ET-proficient strain HS996/pSC101BADγβαA-Tet (GeneBridges). Recombinant clones were selected on LB medium supplemented with kanamycin (50 µg/ml) as well as ampicillin (50 µg/ml) and verified by restriction digests. Based on the kan-mx9 cassette, a zeo-mx9 cassette was constructed. First, a Ptn5-zeo fragment was generated by an overlap extension (OE)-PCR approach, in which all PCR reactions were performed with Taq polymerase according to the manufacturer’s protocol. The ~ 150 bp Ptn5 fragment was generated using oligonucleotides Mch71 (5’-TGGACAGCAAGCGAACCGG-3’) and Mch72 (5’-CATAATCTGTACCTCCTTATCCTGTCTCTTGATCAG-3’) and pCR2.1TOPO (Invitrogen) as template. The zeocin resistance gene (zeo) was amplified from pcDNA3.1/Zeo (Invitrogen) using the oligonucleotides Myx18 (5’-GATAAGGAGGTACAGATTATGGCCAAGTTGACCAGTGCC-3’) and Myx19 (5’-TAGATCACTAGTTCAGTCCTGCTCCTCGGC-3’). To stitch both fragments an OE-PCR using the oligonucleotides Myx15 (5’-CATGCTAGCTCTAGATTAATTAAGAATTCTGGACAGCAAGCGAACCGG-3’) and Myx19 was performed. The resulting Ptn5-zeo fragment was digested with NheI/SpeI and ligated into pMyx12 hydrolyzed with NheI. The resulting construct, pMyx12-zeo, harbors the Ptn5-zeo-mx9 cassette flanked by PacI sites.

Generation of the expression construct via Red/ET recombination The E. coli/Streptomyces shuttle cosmid 3815-7P16 harboring the entire bengamide biosynthetic gene cluster was modified by Red/ET recombination (ET cloning),18,19 to integrate a chloramphenicol (cmR) resistance gene flanked by PacI restriction sites. For this, a ~ 900 bp PCR product was amplified from a rpsL-cm cassette (GeneBridges) using the oligonucleotides BenET19 (5’-GTCCAAGGTGCATGAAGCCTCCAGTCCGCGCCCAGTGTAGTTAATTAAAAGGGCACCAATAACTGC-3’) and BenET20 (5’- TTGCCGGCGTGTCTTGATTCCGTGGTGTGCGCGACACCGCCTGAGCAGCGTTAATTAATCTAGATACCTGTGACGG-3’), and Taq polymerase according to the manufacturer’s protocol. ET cloning was performed using the strain E. coli HS996/pSC101BADγβαA-Tet (GeneBridges) harboring the target cosmid 3815-7P16 according to the GeneBridges

S18

protocol. The obtained recombinant cosmid, pBen31, was verified by restriction analysis and sequencing using the primers Cmint3 (5’- GCAAATATTATACGCAAGGC-3’) and Cmint5 (5’- GAATTCCGGATGAGCATTC-3’). Subsequently, pBen31 was hydrolyzed with PacI to add the PacI-mx9-zeoR-PacI transfer cassette (see above) for integration into the Mx9 attachment site [18] of the Myxococcus xanthus DK1622 chromosome to obtain the expression construct pBen32.

Figure S6. Generation of an expression construct for the entire bengamide biosynthetic gene cluster. Starting from cosmid 3815-7P16 the chloramphenicol

resistance gene (cmR) flanked by PacI restriction sites was added to the expression construct via Red/ET recombination to generate pBen31. In the next step, the PacI-zeo-mx9-PacI cassette was introduced by conventional restriction and ligation to generate the expression construct pBen32.

Deletion of the Hydroxymalonyl-CoA biosynthetic operon and heterologous expression of the modified biosynthetic gene cluster The expression construct pBen32 harboring the entire bengamide biosynthetic gene cluster was modified by Red/ET recombination (ET cloning, [21]) to integrate the Ptn5 driven kanamycin (kanR) resistance gene upstream of benA by deletion of benE-benH (see Figure S7). For this, a ~ 1 kb PCR product was amplified from pTpS-mchS,[22] using the oligonucleotides BenET22 (5’- GCGGTGTCGCGCACACCACGGAATCAAGACACGCCGGCAATGGACAGCAAGCGAACCGG-3’) and BenET23 (5’- ATCTATCCAGGAACCACCGCTGTAGATCGTTTGCCACGCTCATAATCTGTACCTCCTTAAG-3’), and Taq polymerase according to the manufacturer’s protocol. ET cloning was performed using the strain E. coli HS996/pSC101BADγβαA-Tet (GeneBridges) harboring the target plasmid pBen32 according to the GeneBridges protocol. The obtained recombinant construct, pBen34, was verified by restriction analysis and sequencing using the oligonucleotide Kanint3 (5’-CTTGCCGAATATCATGGTG-3’).

7-1 7-2

7-2

7-2

S19

Figure S7. Deletion of benE-benH and promoter insertion on the expression

construct pBen32 (an artificial operon Ptn5-kanR-benA-D was constructed).

Construction of Myxococcus xanthus DK1622 mutants harboring bengamide gene cluster expression constructs and bengamide production analysis

Transfer of the expression constructs into M. xanthus DK1622 The generated expression constructs pBen32 and pBen34 (Figures S6 and S7) were electroporated into the host strain Myxococcus xanthus DK1622[4] according to previously established protocols.[22] The transformants were selected on CTT medium (10 g Casitone (Difco), 10 ml 0.8 M MgSO4, 10 ml 1 M Tris-HCl pH 8.0, 1 ml K2HPO4 pH 7.6 and distilled water up to 1 L, pH adjusted to 7.6)[23] amended with 25 µg/ml zeocin. Genomic DNA of the obtained transformants was isolated (Gentra Puregene Yeast/Bact. Kit from Qiagen) and used as template to verify integration into the Mx9 attachment site as described previously.[24]

Analysis of heterologous bengamide production Production cultures of verified M. xanthus DK1622 mutants and the wildtype were grown in 50 ml CTT medium amended with 25 µg/ml zeocin at 30 °C for 3-4 days. After sonication for 15 min, the supernatant was harvested by centrifugation (5 min at 8.000 rpm) and subsequently freeze-dried. The lyophilized extracts were dissolved in 2 ml methanol/ammonia water (30% MeOH : 70% ammonia water (2%); v/v). HPLC-MS measurements were carried out on a Agilent 1100 system coupled to an HCTultra ESI-MS ion trap mass spectrometer (Bruker Daltonics) operating in positive ionization mode. Compounds were separated on a Luna RP-C18 column (125 x 2 mm; 2.5 μm dp Phenomenex), at a flow rate of 0.4 mL/min and 35 °C with a mobile phase consisting of water (solvent A) and acetonitrile (solvent B), each containing 0.1% formic acid. The mobile phase gradient was linear from 5% B at 2 min to 95% B at 32 min, followed by 3 min with 95% B. Results from the HPLC-MS analysis of the crude extracts from the M. xanthus

7-2

7-2

S20

DK1622::pBen32 mutant in comparison to the wildtype host strain M. xanthus DK1622 as well as the native bengamide producer M. virescens ST200611 are shown in Figure S8. In addition to the native producer strain, bengamide production was detected in the heterologous host harboring expression construct pBen32, but not in the host harboring expression construct pBen34 (data not shown) and, as expected, not in extracts of M. xanthus DK1622 wildtype. All four bengamide derivatives (compounds 3-6, see Figure 1) were detected in M. xanthus DK1622::pBen32 with a total yield of around 5-10 mg/L. Quantification was carried out by HPLC-MS under the same conditions mentioned above, but a two-step mobile phase gradient ranging from 15-60% B over 8 min and from 60-95% B over 1 min followed by 2 min with 95% B was applied. Quantification of 3, which elutes at 6.7 min, was carried out in manual MS2 mode. The in-source fragmentation product [M-H2O+H]+ with m/z 355.2 was subjected to MS/MS analysis and integration of characteristic fragment ions (m/z 337.1, 319.1, 228.1 and 196.8) was carried out by using the Bruker Quant-Analysis software package. A calibration curve was established from serial dilutions of 3 down to 0.02 mg/ml.

Figure S8. HPLC-MS profiles from extracts of the M. xanthus DK1622::pBen32 mutant in comparison to the wildtype host strain M. xanthus DK1622

as well as the native bengamide producer M. virescens ST200611. Extracted ion chromatograms of m/z 355.2 ([M-H2O+H]+ of compound 3 and 6); m/z 369.2 ([M-H2O+H]+ of compound 4) and m/z 341.2 ([M-H2O+H]+ of compound 5) are shown.

Resistance-conferring function of BenI

Generation of expression constructs for BenI (native) and BenI (L154C) and overexpression in E. coli TolC in the presence/absence of bengamide All PCR reactions were performed with the Taq polymerase (Fermentas) according to the manufacturer’s protocol. Using the oligonucleotides Ben24 (5’-GAGTCAGCTAGCATGAGTA CGTCGAGTGCG-3’) and Ben25 (5’-GAGTCAGGATCCCTATGCAGGCAGGGCAGA-3’) the ~ 1kb native benI gene was amplified from cosmid 3815-7P16, digested with NheI/BamHI and subcloned into pET28b (Novagen) hydrolyzed with NheI/BamHI to obtain the expression construct pBen45. For construction of the BenI (L154C) variant a point mutation was

S21

introduced by overlap extension PCR (OE-PCR): two fragments were amplified from pBen45 in separate PCR reactions using the primer sets Ben25/Ben22 (5’-TGAGATCATCTGCCACG GGATTCCCGACAGTC-3’) and Ben24/Ben23 (5’-GAATCCCGTGGCAGATGATCTCATTGA CAGAC-3’). After gel purification, the two PCR products were used as template for the OE-PCR using oligonucleotides Ben24/Ben25 yielding a mutated (L154C) benI gene, which was subcloned into pET28b via NheI/BamHI restriction sites to construct pBen46. The corresponding expression constructs pBen45 and pBen46 as well as the original expression vector pET28 were electroporated in E. coli TolC according to established procedures[25] and selected on LB medium amended with 60 µg/ml kanamycin. Recombinant clones of E. coli TolC/pET28, E. coli TolC/pBen45 and E. coli TolC/pBen46 were grown in LB medium amended with 60 µg/ml kanamycin at 37 °C until an OD600 of approx. 0.15 was reached. Subsequently, protein expression was induced with IPTG (0.3 mM final conc.) and the culture of each clone was divided into two sets of triplicates (six eppis, each containing 1 ml culture volume). One of these triplicate sets of each clone was amended with 100 µg/ml bengamide (compound 3). After continued cultivation overnight on a thermomixer at 900 rpm and 37 °C the OD600 was measured. As illustrated in Figure 9, E. coli TolC/pBen46 expressing the mutated BenI (Leu154Cys) and E. coli TolC/pET28 harboring the empty expression vector are significantly inhibited in their growth in the presence of bengamide, whereas E. coli TolC/pBen45 with native BenI is only slightly affected.

HsMetAP2 AFPTGCSLNNCAAHYTPN

MmMetAP2 AFPTGCSLNNCAAHYTPN

ScMetAP2 GFPTGLSLNHCAAHFTPN

HsMetAP1 PKSCCTSVNEVICHGIPD

MmMetAP1 PKSCCTSVNEVICHGIPD

ScMetAP1 PKSLCTSVNEVICHGVPD

EcMetAP1 PKSVCISINEVVCHGIPD

MtMetAP1a PASICASINDRVVHGIPS

MtMetAP1c PKSCCTSLNEVICHGIPD

SaMetAP1a PATVCTSRNQVVCHGIPR

SaMetAP1b PKSLCTSVNEVICHGIPD

MxMetAP1a PATVCTSRNHIVCHGIPN

MxMetAP1b PKSLCTSVNEVICHGIPD

MvMetAP1a PATVCTSRNHIVCHGVPN

MvMetAP1b PKSLCTSVNEVICHGIPD

MvBenI PKSICTSVNEIILHGIPD

MvBenI(L154C) PKSICTSVNEIICHGIPD

MvBenI(L154A) PKSICTSVNEIIAHGIPD

Figure S9. In silico analysis of BenI compared to other methionine aminopeptidases

(MetAPs) and functional analysis of BenI and mutated versions thereof in E. coli TolC. a: Alignment of a conserved region of eukaryotic and prokaryotic MetAPs. Amino acid (aa) position and accession number in brackets: HsMetAP1 (aa 190-207, NP_055958) and HsMetAP2 (aa 218-235, NP_006829) from Homo sapiens, MmMetAP1 (aa 190-207, NP_780433) and MmMetAP2 (aa 218-235, NP_062622) from Mus musculus, ScMetAP1 (aa 189-206, Q01662) and ScMetAP2 (aa 161-178, P38174) from Saccharomyces cerevisiae S288c, EcMetAP1 (aa 66-83, NP_414710) from Escherichia coli strain K-12 substr. MG1655, MtMetAP1a (aa 75-92, CAE55314) and MtMetAP1c (aa 101-118, CAE55527) from Mycobacterium tuberculosis H37Rv, SaMetAP1a (aa 65-82, YP_003951328) and SaMetAP1b (aa 146-163, ZP_01461236) from Stigmatella aurantiaca DW4/3-1, MxMetAP1a (aa 65-82, YP_634831) and MxMetAP1b (aa 147-167, ABF88710) from Myxococcus xanthus DK1622, MvMetAP1a (aa 65-82, ALK43774) and MvMetAP1b (aa 149-166, ALK43775) and MvBenI (aa 142-159, AJY78095) from Myxococcus virescens ST200611. b: Growth of recombinant clones of E. coli TolC harboring plasmids pET28 (original expression vector), pBen45 (BenI) and pBen46 (BenI(L154C)) in absence (-) and presence (+) of 100 µg/ml bengamide.

b a

pET28 pBen45 pBen46

S22

Figure S10. Clashes of possible L154 rotamers with bengamides. Phyre2[26]

generated homology model of BenI WT (blue) with bengamide inhibitors (green) Y02, Y08, Y10, Y16 (from M. tuberculosis MetAP structures, PDB: 3PKA -3PKE,[27]) and LAF153 (from human MetAP structure, PDB: 1QZY,[28]); inhibitor structures are shown in Figure S11. L154 is shown in stick representation. All possible rotamers of L154 are shown and are labelled with their corresponding probability. Steric clashes with the methoxy group of the bengamide inhibitors or the protein itself are symbolized as disks coloured from green to red to visualize the degree of the clashes.

S23

Figure S11. Structures of bengamide inhibitors Y02, Y08, Y10, Y16 and LAF153.

Semisynthesis General procedure

Scheme S1. Semisynthesis of bengamide analogs through N-benzylation of 3.

S24

Synthesis of 9 (N-[(S)-1-H-2-oxoperhydroazepin-3-yl]-(E)-(2R,3R, 4S, SR)-3, 4, 5 triacetoxy-2-methoxy-8-methyldec-6-enamide)

1 ml of CH2Cl2 (on siliporite) and 47.7 mg (0.128 mmol) of Bengamide 3 were successively introduced into a 10 ml round-bottomed flask equipped with a magnetic stirrer under an argon atmosphere. 57 µL of pyridine, 8.1 mg of DMAP and 60.4 µl of acetic anhydride were added to the solution. The solution was stirred at room temperature under argon. After 2.5 hours, the reaction medium was hydrolyzed with aqueous 10% NaHSO4 solution and extracted with a 4/1 (v/v) EtOAc/heptane mixture. The organic phase was dried over MgSO4, filtered and concentrated under reduced pressure. The residue was purified by chromatography on silica SiO2 60 (25-40 pm, Merck) with CH2Cl2/MeOH (96/4 (v/v)) as the eluent. 56 mg (88%) of the expected product 9 were collected in the form of a white solid.

1H NMR (CDCl3, 400MHz), mixture of isomers, in ppm: 0.86 (m, 3H); 0.98 (d, J=6. 5 Hz, 3H); from 1.25 to 1.60 (m, 4H); 1.90 (m, 2H); from 2.00 to 2.18 (m,12H); from 3.25 to 3.44 (m, 2H); 3.45 (s, 3H); 3. 84 (d, J=5.0 Hz, 0.2H) and 3. 86 (d, J=5. 0 Hz, 0.8H); 4. 53 (m, 1H); from 5.28 to 5.72 (m, 5H); 5.97 (m, 1H); 7.88 (d, J=6.0 Hz, 1H). ESI-MS+: m/z = 499 (M+H); 521(M+Na); 439 (M+H-AcOH); 997=(2M+H) General procedure for the synthesis of 10a-e 1.5 ml of 4-methyl-2-pentanone and 60 mg (120 µmol) of compound 9 600 µmol of requisite aryl bromide and 196 mg (600 µmol) of anhydrous cesium carbonate were successively introduced into a 10 ml round-bottomed flask equipped with a magnetic stirrer under an argon atmosphere. The reaction medium was heated for 20 hours at 50°C. It was allowed to cool to room temperature and was then poured into a suspension of 10 ml of ethyl acetate and 5 ml of saturated aqueous ammonium chloride solution. After separation of the phases by settling, the aqueous phase was re-extracted with ethyl acetate. The organic phases were combined and dried over sodium sulfate. After filtering and evaporating to dryness, the crude product was purified by preparative chromatography (SiO2 60, 8 g 40-60 pm Biotage cartridge, eluent: EtOAc/ heptane (50/50), to give expected products 10a-e in crude yields between 31 and 79%. The products have been utilized without further characterization. General procedure for the synthesis of 7a-e 3.5 ml of methanol, 61 µmol of compounds 10a-e and 26 mg (189 µmol, 3.1 eq.) of potassium carbonate were successively introduced into a 10 ml round-bottomed flask equipped with a magnetic stirrer. The reaction medium was stirred for 2 hours at room temperature and then taken up in 10ml of ethyl acetate and 5 ml of saturated aqueous ammonium chloride solution. After separation of the phases by settling, the aqueous phase was re-extracted with ethyl acetate. The organic phases were combined and dried over sodium sulfate. After filtering and evaporating to dryness, the expected products 7a-e were obtained in yields between 75 and 99%.

7a: N-[(S)-1-(4-benzyl)-2-oxoperhydroazepin-3-yl]-(E)-(2R, 3R, 4S, SR)-3, 4, 5-trihydroxy-2-methoxy-8-methyl dec-6-enamide

1H NMR (CDCl3, 400MHz), mixture of isomers, in ppm: 0.86 (m, 3H); 1.00 (d, J=6.5 Hz, 0.8H) and 1.02 (d, J=6.5 Hz, 2.2H); from 1.15 to 2.15 (m, 9H); from 3.00 to 3.30 (broad m, 3H); 3.48 (dd, J=11.5 and 14.5 Hz, 1H); 3.58 (s, 3H); 3.65 (broad m, 1H); 3.81 (d, J=6.5 Hz, 1H); 3.88 (broad d, J=6.5 Hz, 1H); from 4.22 to 4.80 (m, 5H); 5.49 (dd, J=6.5 and 15.5 Hz, 1H); 5.72 (m, 1H); from 7.22 to 7.39(m, 5H); 8. 20 (broad d, J=6.0 Hz, 1H). HRMS: 463.2802 (M+H)(+); 463.28026 calcd.

7b: N-[(S)-2-oxo-1-(3, 5-difluorobenzyl)perhydroazepin-3-yl]-(E)-(2R, 3R, 4S, SR)-3, 4, 5-trihydroxy-2-methoxy-8-methyldec-6-enamide

1H NMR (DMSO-d6, 400MHz), mixture of isomers (70%-30%), in ppm: 0.81 (t, J=7.5 Hz, 2.1H); 0.82 (t, J=7.5 Hz, 0.9H); 0.92 (d, J=7.0 Hz, 0.9H); 0. 93 (d, J=7.0 Hz, 2.1H); from 1.08 to 1.46 (m, 4H); 1.67 (m, 2H); from 1.77 to 1.92 (m, 2H); 1. 99 (m, 1H); from 3.19 to 3.39

S25

(masked m, 2H); 3.27 (s, 3H); 3.59 (dd, J=2.5 and 7.5 Hz, 1H); 3.64 (dd, J=11.0 and 15.0 Hz, 1H); 3.71 (d, J=7.5 Hz, 1H); 3.98 (t, J=7.0 Hz, 1H); from 4.13 to 4.73 (very broad m, 3H); 4.43 (d, J=15.5 Hz, 1H); 4.66 (m, 1H); 4.70 (d, J=15.5 Hz, 1H); 5.38 (m, 1H); 5.48 (dd, J=7.5 and 15.5 Hz, 1H); 6.99 (m, 2H); 7.13 (tt, J=2.5 and 9.5 Hz, 1H); 7.92 (d, J=6.5 Hz, 1H). HRMS: 499.2802 (M+H)(+); 499.26142 calcd.

7c: N [(S)-2-oxo-1 -(2, 3, 5, 6-tetrafluorobenzyl)perhydroazepin-3-yl]-(E)-(2R, 3R, 4S, SR)-3, 4, 5-triacetoxy-2-methoxy-8-methyldec-6-enamide

1H NMR (DMSO-d6, 400MHz), mixture of isomers (70%-30%), in ppm: 0.76 (t, J=7.5 Hz,3H); 0.87 (t, J=7.0 Hz, 0.9H); 0.88 (d, J=7.0 Hz, 2.1H); from 1.06 to 1.41 (m, 4H); from 1.51 to 1.87 (masked m, 4H); from 1 91 to 2.05 (m, 7H); 1.92 (s, 3H); from 3.15 to 3.55 (partially masked m, 1H); 3.29 (s, 3H); 3.64 (m, 1H); 3.81 (d, J=4.5 Hz, 1H); 4.52 (m, 1H); from 4.67 to 4.76 (m, 2H); from 5.19 to 5.37 (m, 4H); 5.51 (m, 1H); 7.84 (m, 1H); 7.94 (d, J=6.5 Hz,1H). HRMS: 535.2438 (M+H)(+); 535.2431 calcd.

7d: N [(S)-1-(4-cyano-3-fluorobenzyl)-2-oxoperhydroazepin-3-yl]-(E)-(2R, 3R, 4S, SR)-3, 4, 5-trihydroxy-2-methoxy-8-methyldec-6-enamide

1H NMR (DMSO-d6, 400MHz), mixture of isomers (80%-20%), in ppm: 0.80 (t, J=7.5 Hz, 2.4H); 0.82 (t, J=7.5 Hz, 0.6H); 0.92 (d, J=7.0 Hz, 0.6H); 0.93 (d, J=7.0 Hz, 2.4H); from 1.11 to 1.32 (m, 3H); 1.42 (m, 1H); from 1.60 to 1.74 (m, 2H); from 1.77 to 1.92 (m, 2H); 1.98 (m,1H); from 3.21 to 3.38 (partially masked m, 2H); 3.21 (s, 3H); from 3.55 to 3.74 (m, 2H); 3.71 (d, J=7.5 Hz, 1H); 3.97 (m,1H); 4.37 (d, J=6.0 Hz, 1H); 4.42 (m, 1H); 4.50 (d, J=16.0 Hz, 1H); 4.55 (d, J=4.5 Hz, 1H); 4.68 (m, 1H); 4.79 (d, J=16.0 Hz, 1H); 5.37 (m, 1H); 5.48 (dd, J=7.5 and 15.5 Hz, 1H); 7.30 (dd, J=1.5 and 8.0 Hz, 1H); 7.70 (dd, J=1.5 and 10.5 Hz, 1H); from 7. 87 to 7. 93 (m, 2H) HRMS: 506.2661 (M+H)(+); 506.26609 calcd. 7e: N [(S)-1-(3-cyano-4-fluorobenzyl)-2-oxoperhydroazepin-3-yl]-(E)-(2R, 3R, 4S, SR)-3, 4, 5-trihydroxy-2-methoxy-8-methyldec-6-enamide

1H NMR (DMSO-d6, 400MHz), mixture of isomers (80%-20%), in ppm: 0.80 (t, J=7.5 Hz, 2.4H); 0.82 (t, J=7.5 Hz, 0.6H); 0.92 (d, J=7.0 Hz, 0.6H); 0. 93(d, J=7.0 Hz, 2.4H); 1.14 (m, 1H); from 1.20 to 1.30 (m, 2H); 1.40 (m, 1H); from 1.60 to 1.71 (m, 2H); from 1.76 to 1.94 (m, 2H); 1.98 (m, 1H); from 3.24 to 3.37 (partially masked m, 2H); 3.27 (s, 3H); from 3.55 to 3.67 (m, 2H); 3.71 (d, J=7.5 Hz, 1H); 3.98 (m, 1H); 4.32 (d, J=4.0 Hz, 0.2H); 4. 39 (broad m, 1H); 4.45 (partially masked m, 1H); 4.46 (d, J=15.0 Hz, 1H); 4. 57 (broadm, 0.8H); 4.65 (m, 1H); 4.69 (d, J=15.0Hz, 1H); 5.37 (m, 1H); 5.49 (dd, J=7.5 and 15.5 Hz, 1H); 7.50 (t, J=9.0 Hz, 1H); 7.68 (ddd, J=2.5-5.5 and 9.0 Hz, 1H); 7.81 (dd, J=2.5 and 6.5 Hz, 1H); 7.90 (d, J=6.5 Hz, 1H) HRMS: 506.2680 (M+H)(+); 506.2666 calcd.

S26

Total synthesis General procedure

Scheme S2. Total synthesis of bengamide analogs. Compound 12: (3R, 4R, SS)-4-hydroxy-5-((E)-(R)-1-hydroxy-4, 4-dimethylpent-2-enyl)-3-methoxydihydrofuran-2-one 17 ml of TFA in 10 ml of water were added to a 250 ml round-bottomed flask containing 40 ml of water and 3.6 g of 11, which can be prepared according to the procedures described in Ref [29].. The medium was stirred for 1.5 h at rt. Then, the medium was diluted with 290 ml of water, frozen and lyophilized. 4 g of an oil were obtained, which was recrystallized from 20 ml of isopropyl ether at rt. After filter-drying, washing with isopropyl ether and vacuum drying at 40°C, 2.46 g of expected product 12 (white crystals) were obtained. Mp: 123°C. MS: m/z=262 M+NH4+

1H NMR (DMSO-d6, 400MHz), in ppm: 1.00 (s,9H); 3.41 (s, 3H); 3.93 (dd, J=2.5 Hz, 9.0 Hz, 1H); 4.22 - 4.31 (m, 3H); 5.19 (d, J=5.0 Hz, 1H); 5.42 (dd, J=5.0 Hz, 16.0 Hz, 1H); 5.43 (d, J=4.5 Hz, 1H); 5. 87 (d, J=16.0 Hz, 1H) IR (KBr): 3239; 2964; 2914; 1701; 1499; 1312;1253; 1047 & 751 cm-1. General procedure for the synthesis of compounds 8a-f Into 10ml of round-bottomed flask containing 1.0 ml of THF, 0.19 mmol of 12 (57mg), 0.37 mmol of requisite amine hydrochloride, and 0.84 mmol of sodium 2-ethylhexanoate monohydrate (140mg) were successively introduced under stirring in an argon atmosphere, The mixture was stirred at room temperature for 24 h. 30 ml of ethyl acetate was added to the reaction medium. The mixture was successively washed with 20ml of aqueous hydrochloride acid solution (0.1N), and then with 20ml of saturated aqueous NaCl solution. The organic phase was dried over anhydrous magnesium sulphate, filtered and evaporated to dryness. The crude products were chromatographed on a silica cartridge (25g, eluent CH2Cl2/MeOH-in a 5 to 20% MeOH) to give the expected compounds in yields between 30 and 55%.

Compound 8a: N-((S)-2-oxo-2,3,4,5-tetrahydro-1H-1-benzazepin-3-yl)-(E) (2R,3R,4S,5R)-3,4,5-Trihydroxy-2-methoxy-8,8-dimethyl-non-6-enamide

1H-NMR (300 MHz ,DMSO-d6), (ppm): 0,96 (s, 9H) ; 2,07 (m, 1H) ; 2,33 (m, 1H) ; 2,63 - 2,80 (m, 2H) ; 3,23 (s, 3H) ; 3,25 - 3,36 (m, 1H) ; 3,53 (m, 1H) ; 3,68 (d, J = 7,5 Hz, 1H) ; 3,95 (m, 1H) ; 4,17 - 4,32 (m, 2H) ; 4,40 (d, J = 6,5 Hz, 1H) ; 4,53 (m, 1H) ; 5,31 (dd, J = 7,0 Hz, 16,0 Hz, 1H) ; 5,63 (d, J = 16,0 Hz, 1H) ; 7,02 (d, J = 7,5 Hz, 1H) ; 7,14 (t, J = 7,5 Hz, 1H) ; 7,23 - 7,32 (m, 2H) ; 8,97 (d, J = 8,0 Hz, 1H) ; 9,89 (s, 1H). HRMS: 421.2334 (M+H)(+); 421.23331 calcd.

Compound 8b: N-((S)-4-oxo-2,3,4,5-tetrahydro-1,5-benzothiazepin-3-yl)-(E)-(2R,3R,4S,5R)-3,4,5-trihydroxy-2-methoxy-8,8-dimethyl-non-6-enamide

1H-NMR (400 MHz DMSO-d6), (ppm): 0,95 (s, 9H) ; 3,14 (m, 1H) ; 3,20 (s, 3H) ; 3,45 - 3,57 (m, 2H); 3,67 (d, J = 7,5 Hz, 1H) ; 3,92 (m, 1H) ; 4,23 - 4,34 (m, 2H) ; 4,42 (m, 1H) ; 4,54 (d, J = 5,0 Hz, 1H) ; 5,28 (dd, J = 7,0 Hz, 16,0 Hz, 1H) ; 5,62 (d, J = 16,0 Hz, 1H) ; 7,16

S27

(dd, J = 1,5 Hz, 8,0 Hz, 1H) ; 7,21 (dt, J = 1,5 Hz, 8,0 Hz, 1H); 7,45 (dt, J = 1,5 Hz, 8,0 Hz, 1H) ; 7,61 (dd, J = 1,5 Hz, 8,0 Hz, 1H) ; 8,21 (d, J = 8,0 Hz, 1H) ; 10,15 (s, 1H). HRMS: 439.1901 (M+H)(+); 439.18973 calcd.

Compound 8c: N-((S)-8-oxo-6,7,8,9-tetrahydro-5-oxa-9-aza-benzocyclohepten-7-yl)-(E) (2R,3R,4S,5R)-3,4,5-trihydroxy-2-methoxy-8,8-diméthyl-non-6-enamide

1H-NMR (400 MHz, DMSO-d6), (ppm): 0,96 (s, 9H) ; 3,24 (s, 3H) ; 3,25 - 3,32 (m, 1H) ; 3,52 (m, 1H) ; 3,71 (d, J = 8,0 Hz, 1H) ; 3,94 (m, 1H) ; 4,28 - 4,39 (m, 4H) ; 4,55 (d, J = 4,5 Hz, 1H) ; 4,68 (m, 1H) ; 5,30 (dd, J = 7,0 Hz, 16,0 Hz, 1H) ; 5,63 (d, J = 16,0 Hz, 1H) ; 7,07 - 7,16 (m, 4H) ; 8,14 (d, J = 8,0 Hz, 1H) ; 10,05 (s, 1H). HRMS: 423.213 (M+H)(+); 423.21258 calcd. IR (KBr): 3420; 2958; 1667; 1499; 1419; 1364; 1111; 978 & 757 cm-1

D : -64 (c=0,11; MeOH)

Compound 8d: N -((S)-9-methyl-8-oxo-6, 7, 8, 9-tetrahyclro-5-oxa-9-azabenzocyclohepten-7-yI)-(E )-(2R,3R, 4S, 5R)-3,4,5-trihydroxy-2-methoxy-8,8-dimethylnon-6-enamide

1H-NMR (400 MHz, DMSO-d6), (ppm):: 0,96 (s, 9H) ; 3,21 (s, 3H) ; de 3,24 à 3,32 (m, 1H) ; 3,30 (s, 3H) ; 3,49 (m, 1H) ; 3,69 (d, J = 8,0 Hz, 1H) ; 3,92 (m, 1H) ; 4,28 - 4,37 (m, 4H) ; 4,54 (d, J = 4,5 Hz, 1H) ; 4,71 (m, 1H) ; 5,29 (dd, J = 7,0 Hz, 16,0 Hz, 1H) ; 5,62 (d, J = 16,0 Hz, 1H) ; 7,21 (dd, J = 2,0 Hz, 7,5 Hz, 1H) ; 7,24 - 7,34 (m, 2H) ; 7,48 (dd, J = 2,0 Hz, 7,5 Hz, 1H) ; 8,15 (d, J = 8,0 Hz, 1H) . HRMS: 437.2287 (M+H)(+); 437.22823 calcd.

D : -94 (c=0,32; MeOH)

Compound 8e: N-((S)-1-methyl-4-oxo-2,3,4,5-tetrahydro-1H-1,5-bezodiazepin-3-yl)-(E)-(2R,3R,4S,5R)-3,4,5-trihydroxy-2-methoxy-8,8-dimethylnon-6-enamide

1H-NMR (400 MHz, DMSO-d6), (ppm): 0,96 (s, 9H) ; 2,73 (s, 3H) ; 3,23 (s, 3H) ; 3,24 - 3,35 (m, 2H) ; 3,43 (m, 1H) ; 3,51 (m, 1H) ; 3,69 (d, J = 8,0 Hz, 1H) ; 3,94 (m, 1H) ; 4,30 (m, 2H) ; 4,39 (m, 1H) ; 4,52 (d, J = 4,5 Hz, 1H) ; 5,30 (dd, J = 7,0 Hz, 16,0 Hz, 1H) ; 5,62 (d, J = 16,0 Hz, 1H) ; 6,95 - 7,04 (m, 2H) ; 7,10 (d, J = 8,0 Hz, 1H) ; 7,17 (m, 1H) ; 7,98 (d, J = 7,5 Hz, 1H) ; 9,82 (s, 1H). HRMS: 436.2446 (M+H)(+); 436.24421 calcd.

D : +51,4 (c=0,35; MeOH)

Compound 8f: (2R,3R,4S,5R,6E)-N-[(3S)-1,5-dimethyl-2-oxo-2,3,4,5-tetrahydro-1H-1,5-benzodiazepin-3-yl]-3,4,5-trihydroxy-2-methoxy-8,8-dimethylnon-6-enamide

1H-NMR (400 MHz, DMSO-d6), (ppm): 0,95 (s, 9H) ; 2,71 (s, 3H) ; 3,11 (dd, J = 7,5 Hz, 10,0 Hz, 1H) ; 3,21 (s, 3H) ; 3,24 (s, 3H) ; 3,25 - 3,33 (m, 1H) ; 3,37 (dd, J = 10,0 Hz, 12,0 Hz, 1H) ; 3,49 (m, 1H) ; 3,69 (d, J = 8,0 Hz, 1H) ; 3,92 (m, 1H) ; 4,32 (m, 2H) ; 4,40 (m, 1H) ; 4,54 (m, 1H) ; 5,29 (dd, J = 7,0 Hz, 16,0 Hz, 1H) ; 5,61 (d, J = 16,0 Hz, 1H) ; 7,12 - 7,19 (m, 2H) ; 7,28 (dt, J = 1,5 Hz, 7,5 Hz, 1H) ; 7,37 (dd, J = 1,5 Hz, 7,5 Hz, 1H) ; 8,03 (d, J = 8,0 Hz, 1H). HRMS: 450.2602 (M+H)(+); 450.25986 calcd.

[]23D : +40,1 (c=0.51; MeOH).

S28

Compound profiling

Cell lines HCT-116, A-549, B16-F10, H-460, HCT15, HT-29, MCF-7, MDA-MB-231, PC-3, CCRF-CEM, HL-60 were purchased from ATCC. MDA-A1 is a multi-drug resistant clone derived from MDA-MB-231, which overexpresses PgP efflux pump. Normal Human Dermal Fibroblasts (NHDF) and Peripheral blood lymphocytes (PBL) were purchased from Cambrex. Cells were grown in humidified cell culture incubator at 37°C under 5% CO2.

Thymidine pulse proliferation assay Depending on cell line tested, 2500 – 15000 cells are seeded in 96-well cytostar microplates (Amersham) in 0.2 ml Dubelco’s modified Eagle medium (DMEM) containing 10 % fetal bovine serum and supplemented with 2 mM glutamine. Serial dilutions of compound to be tested were performed from 10 mM DMSO stock solution. After 4 h, series of compound dilutions were then added to microwells. Compound final concentrations ranged from 10 µM to 0.3 nM, and the final DMSO concentration was 0.1%. After 72h, 0.1µCi of Thymidine [methyl-14C] (specific activity ~ 50 mCi/mmol, NEN Technologies) was added to each well and after an additional 24h incubation time, 14C-thymidine incorporation was measured on a Micro-beta counter (Perkin-Elmer) and is linearly proportional to DNA synthesis as well as cell proliferation during incubation with radiolabelled thymidine.

Viability ATP assay 15000 (HL-60 and CCRF-CEM) or 2000 (NDHF) cells were seeded in 96-well fluoronunc microplates (Nunc) in 0.15 ml Roswell Park Memorial Institute (RPMI) medium or DMEM, respectively, containing 10% fetal bovine serum and supplemented with 2 mM glutamine. Serial dilutions of compound to be tested were performed from 10 mM DMSO stock solution. Series of compound dilutions were then added to cell containing wells. Compound final concentrations ranged from 10 µM to 0.3 nM and final DMSO concentration was 0.1%. After 96h, 0.1 ml reagent from Celltiter-Glo Luminescent Kit (PROMEGA) was added per well. After 1h incubation at room temperature, luciferase activity was measured on a Micro-beta counter (Perkin-Elmer) and is linearly proportional to the amount of ATP as well as to the number of cells present in the well.

Viability FDA/PI assay In 96 well cell culture microplate, 100 000 PBL were incubated in Roswell Park Memorial Institute RPMI medium containing 10 % fetal bovine serum and supplemented with 2 mM glutamine and series of compound dilution in a 0.2 ml total volume. Compound final concentrations ranged from 10 µM to 0.5 nM and final DMSO concentration was 0.1%. After 96h, 50 µl of phosphate buffer solution containing fluoresceine di-acetate (1.25 µg/ml), propidium iodide (50 µg/ml) and 0.65 µl of fluorescent microbead solution (10μm Polybead polystyrene, Polysciences, Biovalley) was added to each well. 5 to 10 min after, samples are automatically analyzed by fluorescence assisted cell sorter (FACS) using a FC500 cytometer (Beckman Coulter) to count viable cells labelled by fluorescein probe, dead cells labelled by propidium iodide as well as microbeads which serve to run inter-well normalization.

Cellular activities of bengamides 3-5 The bioactivities of 3, 4 and 5 were assessed in proliferation assays in 8 cell lines. Most IC50’s were in the low micromolar range (Table S2). For example, growth of the HCT15 and

the H460 cell lines were inhibited at IC50 values of 4, 2 and 9 M and of 0.4, 0.9 and 2 M by 3, 4 and 5, respectively. A consistent difference in activities between 3 and 4, which differ by

S29

an N-methyl group at the caprolactam ring, was not observed, in line with literature reports[30] on the equipotency of 5 and 6.

Table S2. Antiproliferative activity of bengamides 1-5

Cell line

Cmpd MDA-MB231 a) MDA-MB435 d) SF268 a) HCT15 a) HCT116 H460 a) PC3 a) DU145 a) K562 a)

1 0,0024 0,002b)

2 0,04 0,04c)

3 0,4 1 4 3 0,4 1 4 6

4 0,4 2 2 0,4 0,9 4 0,8 3

5 0,6 3,3 5 9 1a) /0,06c) 2 >10 0,5 >10

All data are given as IC50’s in µM. a) This work; b) Thale et al., J. Org. Chem. 2001, 66, 1733; c) data obtained from NCI developmental therapeutics program (DTP); d) Kindler et al. J. Med. Chem. 2001, 44, 3692.

Table S5: Antiproliferative activities against HCT116 of bengamide analogs 3, 7a-e, and 8a-e

Cmpd IC50 in nM Data rangea) Nb)

3 4511 3604, 5646 2

7a 18 25, 14 2

7b 75 47, 119 2

7c 27 24, 30 2

7d 19 32, 11 2

7e 30 19, 45 2

8b 19 8, 49 6

8c 55 32, 93 5

8e 27 17, 43 5

8f 94 114, 77 2

8a 35 25, 47 25

8d 46 38, 56 26

a) Individual IC50's in nM (for N = 2), or 95% confidence interval (for N > 2). b) N = Number of experiments.

Table S6: Antiproliferative activities of bengamide analogs 8a, 8d and 2 against a panel of 14 cancer cell lines

8a 8d 2

Protocol Cell-Line Average

IC50 in nM s.d. Average

IC50 in nM s.d. Average

IC50 in nM s.d.

Thymidine Pulse

A549 9 7 39 23 13 10

B16-F10 33 22 47 24 29 8

H460 59 24 42 26 9 6

HCT116 44 29 51 24 23 27

HCT15 550 510 45 9 1 300 1 500

HT29 120 46 100 100 27 11

MCF-7 110 16 19 22

S30

MDA-A1 4 800 2 200 1 100 500 >10 000

MDA-MB-231 110 73 140 88 22 8

PC3 270 77 270 85 20 5

CCRF-CEM 350 210 290 170 65 20

Viability ATP

HL60 280 200 370 100 58 22

NHDF 260 130 140 43

Viability FDA/PI PBL >5900 4 400 >7900 3 800

All data are given as IC50’s in nM. s.d. = standard deviation; the incubation time was 96h in all cases.

MetAP2 enzymatic assay Human MetAP2 protein was obtained from a culture supernatant of insect cells (sf9) infected with MetAP2 recombinant baculovirus coming from Invitrogen. Before performing the experiment, dialysis of the MetAP2 supernatant is performed over 24 hours at 4°C in a buffer (10 mM Hepes, 100 mM KCl, 10% glycerol, pH 7.4) in the presence of EDTA (1mM) over the first 12 hours. The dialysis supernatant is recovered and manganese (Prolabo), used as cofactor, is added to a final concentration of 300 µM. The enzyme assay was performed in a 384-well format. Various concentrations of the inhibitors were incubated with the dialysed MetAP2 protein and the substrate (Met-Pro-Arg-pNa peptide synthesized by Neosystem). The substrate was added to a final concentration of 0.5mM and incubated at 37°C during 4 hours. The second step consists in reacting the peptides cleaved in the preceding step with cathepsin at 100mU/ml (TagZyme “DAPase” kit from Qiagen) at room temperature during 90 minutes. The MetAP2 activity is proportional to the amount of para-nitroaniline released, which is measured by absorbance at 405 nm (EnVision – PerkinElmer).

Metabolic labilities assessment Samples containing 1 mg/ml of human, rat or mouse liver microsomes (pool of different donors) in 0.1 M phosphate buffer (pH 7.4), 0.1 % bovine serum albumin and 1 mM NADPH (for cytochromes P450 and Flavin-Mono-Oxygenase dependent reactions) were pre-incubated 5 minutes at 37°C. To initiate the reaction, bengamides analogues were added at an initial concentration of 5 µM. Acetonitrile was used to stop the reaction immediately or after 20 minutes. After centrifugation, supernatants were analyzed by LC/MS and the unchanged compound (UC) was quantified. Samples were performed in duplicate. The percent of metabolism was calculated as followed: Total metabolism = [1 – (UC with cofactor T20/UCT0)]*100 In human liver microsomes, incubations were done in absence and presence of 1.5 µM ketoconazole or 8 µM quinidine, in order to assess the contribution of CYP3A4 and CYP2D6, respectively, to the total metabolism. The metabolic lability of 7a was reduced from 94% to 49% upon addition of ketoconazole, a CYP3A4 inhibitor, to the human liver microsomes incubation; in contrast, the lability was 86% and thus hardly altered when quinidine, a Cyp2D6 inhibitor was added. This indicates that the CYP3A4 isoform, but not the CYP2D6 isoform, contributed to the degradation of 7a. A similar effect was observed for 8d (labilities of 15%/5%/15% for w/o /ketoconazole/quinidine). For 8a, metabolism could not be observed under the experimental conditions (0%/0%/0% for w/o /ketoconazole/quinidine).

Pharmacokinetic study in male C57BL mice Mice (8-10-week-old males) were obtained from either Charles River or Janvier Laboratories in France. They were housed in chip-bedded cages and, prior to experiments, acclimatized for one week in the air-conditioned institutional animal care unit. The animals were kept on a

S31

12 hours light/dark circadian cycle, with free access to water (drinking bottle) and fed ad libitum. Animal experiments were approved by the local ethics committee and performed in accordance with national legislation on the protection of animals. Three mice were used per time point. The following formulations were selected: 7a : 1mg/kg, in 2%N NMP, 0.2% PS80 in glucose 5%; 8a : 30mg/kg in 5% EtOH, 5% PS80 in glucose 5%; 8d : 30mg/kg in 40% sulfobutyl-beta-cyclodextrine in H2O. Bengamide analogues were administrated, by intravenous bolus as single dose, in the tail vein, in solution. Blood was collected for plasma analysis on heparinised vials, by the orbitary plexus, at the following sampling times: 0.03, 0.25, 0.5, 1, 2, 4, 6, 8, 24 hours. The plasma fractions were separated by centrifugation and stored at -20°C until analysis by LC/MS-MS. Pharmacokinetics parameters were estimated by non-compartmental analysis using WinNonLin, version 5.2.1 (Pharsight). The areas under the concentration time curve to the last observable point (AUClast) and to infinity (AUCinf) were estimated by trapezoidal rule; C0, clearance, volume of distribution and terminal elimination half-life were obtained from the terminal linear portion of the concentration-time curve.

In vivo antitumor activity assay 6 to 8 weeks­old female C57BL/6 mice (Charles River France, Les Oncins, France) were used for in vivo evaluation of antitumor activity. Mice were housed, cared and maintained in accordance with institutional guidelines, as well as european laws and regulations, and all experiments were carried out under the conditions established by the European Community directive (no.86/609/CCE) and in accordance with the national charter on the ethics of animal experimentation. Tumor fragments of B16 melanoma (~50mm3) were grafted subcutaneously on mice. 8a (5% ethanol, 5% PS80, 90% glucose 5% in water) was administered by IV route, twice a day at 48.4 mg/kg/inj and daily at 60.0, 37.2, 23.1 and 14.3 mg/kg/inj, from days 4 to 11 post tumor implantation. Post 6 IV injections, the mice tails were damaged, leading to switch to IP route. Docetaxel (5% ethanol, 5% PS80, 90% glucose 5% in water) was administered by IV route, at 39.0, 24.2, 15.0, 9.3, 5.8 mg/kg/inj on days 4, 7 and 10 post tumor implantation. Animal body weights and mortality were checked daily. Tumor perpendicular diameters were measured with a calliper and solid tumor volumes were estimated from 2 dimensional tumor measurements and calculated according to the following equation: Tumor volume (mm3) = Length (mm) x Width² (mm²)/2 Antitumor activity was expressed according to two criteria, first the tumor growth inhibition ratio (T/C), where T and C are the median tumor volume for treated and control groups, respectively. A T/C value of 42% is considered as the minimum level of antitumor activity by the National Cancer Institute. The second criterium was the log cell kill value (lck) derived from the tumor growth delay (T-C in days) using the following formula: log cell kill = (T-C value in days)/(3.32 x Td) where T and C are the median time in days required for the treatment group (T) and the control group (C) to reach 1000 mm3, respectively, and Td is the tumor doubling time in days (1 day in this assay). An lck value of 0.7 is considered as the minimum level of antitumor activity (Southern Research Institute criteria). Using a twice-daily administration schedule to avoid immediate toxicity, the dosage of 48.4 mg/kg/injection of 8a induced a cumulative toxicity with 2/5 drug deaths occurring on days 9 and 10 post implantation (Table S6, Figure S12). Using a 60.0 and 37.2 mg/kg once daily administration schedule, mice were very shocked, prostrated and lethargic post each administration. The highest nontoxic dose (HNTD = 60 mg/kg/inj, total dose 480 mg/kg) induced 14 % body weight loss (bwl) and exhibited a modest antitumor activity with a T/C value of 31%, and 0.8 log cell kill. The two lowest doses were inactive. Docetaxel, given at the highest dose tested (HDT) of 24.2 mg/kg/injection induced 11.6% bwl on day 14 and

S32

was active with a T/C value of 1%, and 2.7 log cell kill. An antitumor activity was maintained at the 2 dosages below the HDT. Activity was also maintained at the dosage below, 37.2 mg/kg/inj with a T/C value of 26% and 0.9 log cell kill.

Figure S12. In vivo anti-tumor efficacy evaluation of 8a and docetaxel against early stage

B16 melanoma in female C57BL/6 mice

10

100

1000

10000

0 5 10 15 20 25

Days post implantation

Tu

mo

r vo

lum

e (

mm

3)

13A 60mg/kg/adminstration 13A 37,2mg/kg/adminstration 13A 23,1mg/kg/adminstration 13A 14,3mg/kg/adminstration Docetaxel 24,2mg/kg/adminstration Docetaxel 15mg/kg/adminstration Control limit of palpation 13A treatment Docetaxel treatment

10

100

1000

10000

0 5 10 15 20 25

Days post implantation

Tu

mo

r vo

lum

e (

mm

3)

8A 60mg/kg/adminstration 8A 37,2mg/kg/adminstration 8A 23,1mg/kg/adminstration 8A 14,3mg/kg/adminstration Docetaxel 24,2mg/kg/adminstration Docetaxel 15mg/kg/adminstration Control limit of palpation 8A treatment Docetaxel treatment

S33

Table S7: In vivo efficacy of 8a and docetaxel in a B16 melanoma model Abbreviation used : HNTD = highest non toxic dose, HDT = highest dose tested.

References

[1] H. Hoffmann, S. Haag-Richter, M. Kurz, H. Tietgen, 2005, WO 2005/044803.

[2] a) M. Adamczeski, E. Quiñoà, P. Crews, J. Org. Chem. 1990, 55, 240-242; b) F.

Sarabia, F. Martín-Gálvez, S. Chammaa, L. Martín-Ortiz, A. Sánchez-Ruiz, J. Org.

Chem. 2010, 75, 5526-5532.

[3] a) C. Hertweck, Angew. Chem. Int. Ed. Engl. 2009, 48, 4688-4716; b) M. A. Marahiel,

J. Pept. Sci. 2009, 15, 799-807.

[4] B. S. Goldman, W. C. Nierman, D. Kaiser, S. C. Slater, A. S. Durkin, J. A. Eisen, C.

M. Ronning, W. B. Barbazuk, M. Blanchard, C. Field, C. Halling, G. Hinkle, O.

Iartchuk, H. S. Kim, C. Mackenzie, R. Madupu, N. Miller, A. Shvartsbeyn, S. A.

Sullivan, M. Vaudin, R. Wiegand, H. B. Kaplan, Proc. Nat. Acad. Sci. USA 2006, 103,

15200-15205.

[5] M. Bierman, R. Logan, K. O'Brien, E. T. Seno, R. Nagaraja Rao, B. E. Schoner, Gene

1992, 116, 43-49.

[6] Z. Xu, K. Jakobi, K. Welzel, C. Hertweck, Chem. Biol. 2005, 12, 579-588.

[7] E. Heinzelmann, S. Berger, O. Puk, B. Reichenstein, W. Wohlleben, D. Schwartz,

Antimicrob. Agents Chemother. 2003, 47, 447-457.

[8] A. Ayuso-Sacido, O. Genilloud, Microb. Ecol. 2005, 49, 10-24.

[9] J. Ishikawa, K. Hotta, FEMS Microbiol Lett 1999, 174, 251-253.

[10] S. F. Altschul, W. Gish, W. Miller, E. W. Myers, D. J. Lipman, J. Mol. Biol. 1990,

215, 403-410.

Dosage in mg/kg per injection

(total dose)

Schedule

Drug death (day of death)

Average body weight change in % per

mouse at nadir

(day of nadir) Average body weight

T/C in % (day 11)

log cell kill

gross

Comments

8A

48.4 (580.8) 4-10 (BID) 2/5 (9,10) -15. 8 (10) - - Toxic

60.0 (480) 4-11 (QD) 0/7 -14.0 (10) 31 0.8 HNTD Modestly active

37.2 (297.6) 4-11 (QD) 0/7 -9.3 (8) 26 0.9 Modestly active

23.1 (184.8) 4-11 (QD) 0/7 -7.5 (8) 60 0.5 Inactive

14.3 (114.4) 4-11 (QD) 0/7 -7.7 (11) 62 0.5 Inactive

Docetaxel

24.2 (72.6) 4, 7, 10 0/5 -11.6 (14) 1 2.7 HDT Active

15.0 (45.0) 4, 7, 11 0/5 -11.3 (14) 19 1.1 Active

9.3 (27.9) 4, 7, 12 0/5 -8.0 (14) 38 0.8 Active

5.8 (17.4) 4, 7, 13 0/5 -6.8 (14) 83 0.1 Inactive

S34

[11] R. D. Finn, J. Mistry, J. Tate, P. Coggill, A. Heger, J. E. Pollington, O. L. Gavin, P.

Gunasekaran, G. Ceric, K. Forslund, L. Holm, E. L. Sonnhammer, S. R. Eddy, A.

Bateman, Nucleic Acids Res. 2010, 38, D211-222.

[12] B. O. Bachmann, J. Ravel, Methods Enzymol. 2009, 458, 181-217.

[13] Geneious v7.1 created by Biomatters. Available from http://www.geneious.com/.

[14] G. Yadav, R. S. Gokhale, D. Mohanty, J. Mol. Biol. 2003, 328, 335-363.

[15] S. Rachid, M. Scharfe, H. Blocker, K. J. Weissman, R. Muller, Chem. Biol. 2009, 16,

70-81.

[16] T. Hoffmann, S. Muller, S. Nadmid, R. Garcia, R. Muller, J. Am. Chem. Soc. 2013,

135, 16904-16911.

[17] J. Ligon, S. Hill, J. Beck, R. Zirkle, I. Molnar, J. Zawodny, S. Money, T. Schupp,

Gene 2002, 285, 257-267.

[18] B. Julien, J. Bacteriol. 2003, 185, 6325-6330.

[19] C. D. Reeves, B. Julien, R. C. Reid, 2005, US 2005/0266434.

[20] S. C. Wenzel, F. Gross, Y. Zhang, J. Fu, A. F. Stewart, R. Muller, Chem. Biol. 2005,

12, 349-356.

[21] a) J. P. Muyrers, Y. Zhang, A. F. Stewart, Genet. Eng. 2000, 22, 77-98; b) Y. Zhang,

F. Buchholz, J. P. Muyrers, A. F. Stewart, Nat. Genet. 1998, 20, 123-128.

[22] J. Fu, S. C. Wenzel, O. Perlova, J. Wang, F. Gross, Z. Tang, Y. Yin, A. F. Stewart, R.

Muller, Y. Zhang, Nucleic Acids Res. 2008, 36, e113.

[23] L. Kroos, A. Kuspa, D. Kaiser, Dev. Biol. 1986, 117, 252-266.

[24] C. Osswald, G. Zipf, G. Schmidt, J. Maier, H. S. Bernauer, R. Muller, S. C. Wenzel,

ACS Synth. Biol. 2014, 3, 759-772.

[25] J. Sambrook, E. F. Fritsch, T. Maniatis, 1989, Molecular cloning: A laboratory

manual; 2 ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY.

[26] L. A. Kelley, M. J. Sternberg, Nat. Protoc. 2009, 4, 363-371.

[27] J. P. Lu, X. H. Yuan, H. Yuan, W. L. Wang, B. Wan, S. G. Franzblau, Q. Z. Ye,

ChemMedChem 2011, 6, 1041-1048.

[28] H. Towbin, K. W. Bair, J. A. DeCaprio, M. J. Eck, S. Kim, F. R. Kinder, A. Morollo,

D. R. Mueller, P. Schindler, H. K. Song, J. Van Oostrum, R. W. Versace, H. Voshol,

J. Wood, S. Zabludoff, P. E. Phillips, J. Biol. Chem. 2003, 278, 52964-52971.

[29] D. D. Xu, O. Repič, T. J. Blacklock, L. Waykole, J. V. Calienni, L. Ciszewski, G. T.

Lee, W. Liu, J. Szewczyk, K. Vargas, K. Prasad, Org. Process Res. Dev. 2003, 7, 856-

865.

[30] F. R. Kinder Jr, R. W. Versace, K. W. Bair, J. M. Bontempo, D. Cesarz, S. Chen, P.

Crews, A. M. Czuchta, C. T. Jagoe, Y. Mou, R. Nemzek, P. E. Phillips, L. D. Tran, R.

Wang, S. Weltchek, S. Zabludoff, J. Med. Chem. 2001, 44, 3692-3699.