Supratim's Report

Detection of Rotavirus in acute

gastroenteritis cases

A Dissertation work submitted to Barkatullah University,

Bhopal in partial fulfillment of the requirement for the award of

the Degree of Master of Science in Microbiology

By Supratim Biswas

Enrolment no: R7-37032

Department of Microbiology Extol Faculty of Life Sciences

Division of Virology

National Institute of Cholera & Enteric Diseases

Indian Council for Medical Research

P33 CIT Road, Scheme XM, Beliaghata, Kolkata-700010

Supervised by:

Dr. Triveni Krishnan

Submitted by:

Supratim Biswas

This watermark does not appear in the registered version - http://www.clicktoconvert.com

http://www.clicktoconvert.com

I dedicate this work

Of mine to my best

Friend Insha



Acknowledgement



Acknowledgement

At the very onset I would thank my parents for their

constant support, motivation and endless faith they had on

me though they had been doing the same right from my

birth till date and its useless thanking them cause its

impossible for anyone to repay ones parents.

I thank the almighty for blessing me and giving me all

strength to move on.

I want to thank Dr.G.B Nair, Director of the

National Institute of Cholera and Enteric Disease, for

allowing me for carrying out my dissertation work in his

research institution.

I am grateful to my guide Dr. Triveni Krishnan

Assistant Director Dept. of Virology National Institute of

Cholera and Enteric Diseases Kolkata for her guidance.

I am grateful and like to extend immense gratitude

towards Dr. Mamta Chawla Sarkar Senior Research

Officer Dept. of Virology National Institute of Cholera

and Enteric Diseases Kolkata for her support and co-

operation.

I am thankful to Mr. B Ganesh Research Officer

National Institute of Cholera and Enteric Diseases

Kolkata.



I thank Dr. Shaswati Bhattacharya Head of the

Department, Department of Life Sciences Extol Institute

Of Manangement.

I am thankful from the deepest core of my heart to

Anupamda, Shiladityada, Debaratidi, and Pariksitda.

They had been always there with their valuable comments

and suggestion which really helped me a lot. I also take the

opportunity to thanks Dipajanda, Mehulidi, Anurodhda.

I am thankful to Narayanda,Berada,Shayamalda for

their help.

Last but not the least I would like to thank my

friends Prantik,Priyam,Souvik,Pravat,Joyee,Deepti and

Richa for their constant unconditional love and support.

Date:

Place: Supratim Biswas



List of abbreviation



List of Abbreviations

Kbp Kilo base pair KD Kilo Dalton LA Latex agglutination M Molar mA Miliampere MBA N,N’-methylene bisacrylamide mg Milligram Mg2+ Magnesium ion ml Milliliter mM Millimolar mRNA messenger RNA N Normality nm Nanometer NSP Non-structural protein

A Adenine APS Ammonium persulphate Bisacrylamide N,N’-methylene-bisacrylamide bp Base pair BPB Bromophenol blue C Cytosine Ca2+ Calcium ion cDNA Complementary DNA dATP Deoxy adenosine tri phosphate. dCTP Deoxy cytosine tri phosphate dGTP Deoxy guanosine tri phosphate dH2O Double distilled water DLP Double layer particle DMSO Dimethyle sulfoxide DNA Deoxy ribonucleic acid dNTP Deoxy nucleotide tri phosphate dsRNA Double stranded RNA DTT Dithiothreitol dTTP Deoxy thymine tri phosphate EDTA Ethylenediaminetetraacetic acid ELISA Enzyme link immuno sorbent assay EM Electron microscopy ER Endoplasmic reticulum EtBr Ethidium bromide G Guanine gm Gram



O.D. Optical density ORF Open reading frame ORS Oral rehydration salts ORT Oral rehydration therapy PAGE Poly acrylamide gel electrophoresis PBS Phosphate buffer saline PCR Polymerase chain reaction RdRp RNA dependent RNA polymerase RH Random hexamer RNA Ribonucleic acid. RPHA Reverse passive hemagglutination assay rpm Revolution per minutes RT PCR Reverse transcription polymerase chain reaction SDS Sodium dodecyl sulfate SPACE Solid phase agglutination of coated erythrocytes T Thymine TBE Buffer Tris-Borate-EDTA BUFFER TEMED N,N,N,N'-tetramethylethylene diamine Taq DNA pol Thermus aquaticus DNA polymerase Tris Tris (hydroxy methyl) aminomethane U Uracil UV light Ultra violet light V Volt VP Viral protein Degree Celsius



Contents



Contents

Sl. No. Topic Page no.

1 Introduction 1-27

1.1 Virology 1-2

1.2 Viral gastroenteritis 3-10

1.3 Rotavirus 11-27

2 Materials and

methods 30-46

3 Results & discussions 47-52

4 Appendix 53-56

5 References 57-58



Introduction



VIROLOGY

Study of viruses is known as Virology. Viruses are infectious agents so

small that they can only be seen at magnification provided by the electron

microscope. The distinctiveness of viruses resides in their simple,

acellular organization and pattern of reproduction; they are 10 to 100

times smaller than most bacteria with an approximate size range of 20-

300 nm. A complete virus particle or virion consists of one or more

molecules of DNA or RNA enclosed in a coat of protein and sometimes

also have lipid bilayer membrane (or envelope). But this is acquired from

host cell, usually by budding through a host cell membrane. Viruses are

incapable of independent growth in artificial media. They can grow only

in animal and plant cell or in microorganism. They reproduce in the cell

by replication. Thus virus is referred to as obligate intracellular parasites.

The difference between viruses and living cells can be inferred by

at least three points

1. Their simple acellular organization 2. The presence of DNA or RNA but not both in almost all virions and 3. Their inability to reproduce independently and carry out cell division

as prokaryotes and eukaryotes do. Actually virus in transit from one host cell to another are small packet of genes

The nucleic acid is enclosed in a highly specialized protein coat of a

varying design. The coat protects genetic materials when the virus is

outside of host cells and serves as a vehicle for entry into another specific

host cell.

Structure of virus:

Virus morphology has been intensively studied over the past decades

because of the importance of viruses. Virions range in size from about 10

to 300 or 400 nm in diameter. All virions , even if they possess other

constituents are constructed around a nucleocapsid core (indeed some

viruses consists only of a nucleocapsid). The nucleocapsid is composed

of a nucleic acid either DNA or RNA held within a protein coat called the

capsid, which protectsviral genetic material and acids in its transfer

between host cells. There are four general morphological types of capsid

and virions structure.



1. Some capsid is icosahedral in shape. An icosahedron is a regular polyhedron with 20 equilateral triangular faces and 12 vertices. This capsid appears spherical when viewed at low power in the electron microscope.

2. Other capsids are helical and shaped like hollow protein cylinders which may be either rigid or flexible.

3. Many viruses have an envelope ie. an outer membranous layer surrounding the nucleocapsid. Enveloped viruses have a roughly spherical but somewhat variable shape even though their nucleocapsid can be either icosahedral or helical.

4. Complex viruses have capsid symmetry that is neither purely icosahedral nor helical. They may possess tails and other structure (e.g many bacteriophages) or have complex multilayered walls surrounding the nucleic acid (e.g pox virus such as vaccinia)



Viral gastroenteritis

Gastroenteritis caused usually by infection with one of these viruses:

Rotavirus, Adenovirus, Astrovirus, Calicivirus etc are called viral

gastroenteritis.

These viruses are found all over the world and are

particularly problematic where sanitation is poor.

Typical exposure to these viruses occurs through

the fecal-to-oral route, by ingesting food that is

contaminated with fecal material or by coming in

contact with an infected person's vomit or

diarrhea and then inadvertently bringing the

contaminant to the mouth. Other routes of

transmission are quite likely, because exposure to

as few as 100 virus particles can cause an

infection. Viral gastroenteritis is a common

infection of the stomach and intestine that results

in vomiting, diarrhea. It can be caused by

different viruses. Viral gastroenteritis is highly

contagious. Anyone can get viral gastroenteritis

and most people recover without complication.

Gastroenteritis typically lasts about three days.

However viral gastroenteritis can be serious when

people cannot drink enough fluid to replace what

is lost through vomiting and diarrhea. Especially infants, young children,

the elderly and people with weak immune system are the most susceptible

ones.

Symptoms: The main symptoms of viral gastroenteritis are vomiting and

watery diarrhea. Other symptoms may include nausea, fever, abdominal

pain, headache, and muscle aches, dehydration can follow. For most

people, gastroenteritis is not a serious illness. It typically resolves within

two to three days and there are usually no long-term effects. If

dehydration occurs, recovery is extended by a few days. If symptoms do

not resolve within one week, an infection or disorder more serious than

gastroenteritis may be involved. Prompt medical attention is required if

the child has any of these symptoms:

The digestive system



· a high fever of 102°F (38.9°C) or above · blood or mucus in the diarrhea · blood in the vomit · bloody stools or black stools · confusion · severe abdominal pain or swelling · inability to keep liquids down

Gastroenteritis is not an anatomical or structural defect, nor is it an identifiable physical or chemical disorder. Symptoms can be observed between one to three days or sometime longer. A diagnosis of viral gastroenteritis is based on the person’s symptoms laboratory confirmation is rarely sought except in outbreak when testing of vomit or feces is important.

Causes: The viruses that cause viral gastroenteritis damage the cells in

the lining of the small intestine. As a result fluid leaks from the cells into

the intestine and produces watery diarrhea. Four types of viruses cause

most viral gastroenteritis.

· Rotavirus is the leading cause among the children 3 to 15 months old and the most common cause of diarrhea. In children under age of 5 years symptoms of Rotavirus infection appears 1 to 2 days after exposure. Rotavirus typically causes vomiting and watery diarrhea 3 to 8 days along with fever and abdominal pain. Rotavirus can also infect adults who are in close contact with infected children.

· Adenovirus occurs mainly in children under the age of 2 years. Of the different types of Adenoviruses, types 40, 41 of subgenus F affects the gastrointestinal tract causing vomiting and diarrhea symptoms that typically appear 1 week after exposure. Adenovirus infection occurs year round.

· Caliciviruses cause infection in people of all ages. This family of viruses is divided into four types, the noroviruses being the most common and most responsible for infecting people. The noroviruses are usually responsible for epidemics of viral gastroenteritis and occur more frequently in food borne gastroenteritis. Infected people experience vomiting and diarrhea, fatigue headache and sometimes muscle aches. The symptoms appear after one to three days of exposure.

· Astrovirus also infects primarily infants, young children and elderly. This virus is mostly active during the winter months. Vomiting and diarrhea appear within 1 to 3 days of exposure.


http://www.answers.com/topic/mucus


· Picobirnavirus a novel group of viruses recently detected in children and several species of animals including chickens.



Adenovirus

Electron microscopic image of Adenovirus

Adenoviruses are icosahedral particles measuring 70 to 100 nm

diameter. The particles contains DNA, protein no membrane or lipid,

and trace amounts of carbohydrates because the virion fiber protein is

modified by addition of glucosamine. Virions consist of a protein shell

surrounding a DNA – containing core. The protein shell (capsid) is

composed of 252 subunits (capsomers) of which 240 are hexons and

12 are pentons. As suggested by their names, penton and hexon

subunits are surrounded by five six neighbors respectively. Each

penton contains a base which forms part of the surface of the capsid

and a projecting fiber whose length varies among different serotypes.

Several different serotypes of human Adenoviruses cause infections of

the upper respiratory tract, however depending on the serotypes they

can cause gastroenteritis, conjunctivitis, tonsillitis etc. Most people

recover from Adenovirus infection by themselves but people with

immune-system problems sometimes die of Adenovirus infection and

very rarely even previously healthy people can die of these infections.

Classification: The Adenoviruses constitute the Adenoviridae family

of viruses which is divided into two genera. Mastadenovirus and

Aviadenovirus. The Aviadenovirus genus is limited to viruses of birds,

the Mastadenovirus genus includes human, simian, bovine, equine,

porcine, ovine, canine and opossum viruses.



Calicivirus

Electron microscopic image of calicivirus

The family Caliciviridae is composed of small non enveloped icosahedral

viruses that possess a linear Positive – sense single-stranded RNA

genome. The capsid appears hexagonal/spherical with a diameter of 35-

39nm. Caliciviruses have a broad host range and can cause various

disease syndromes. Calicivirus infections commonly cause acute

gastroenteritis, which is the inflammation of the stomach and intestines.

Symptoms can include vomiting and diarrhoea.

These symptoms emerge after an incubation time of 2 days and the

symptoms only generally last for 3 days. Most calicivirus infections

do not call for medical attention, but those who are immuno

compromised may need to be hospitalized for rehydration therapy.

Transmission of caliciviruses is generally by the fecal-oral route, but

they can also be transmitted via the respiratory route.

The Caliciviridae family includes the following genera:

Genus Vesivirus; type species: Swine vesicular exanthema virus

Genus Lagovirus; type species: Rabbit hemorrhagic disease virus

Genus Norovirus; type species: Norwalk virus

Genus Sapovirus; type species: Sapporo virus



Classification: The two groups of human

Caliciviruses have been classified into distinct genera within the family

Caliciviridae and they have been provisionally named the “Noroviruses”

and the “Sapo viruses”. Although all Calicivirus share a common

ancestor in phylogenetic analysis, the “Noroviruses” and “Sapoviruses”

forms distinct genetic clades within the Caliciviridae. In addition certain

features of their RNA genome organization distinguished them from each

other genera in the Caliciviridae. The family has two additional genera

Lagovirus and Vesivirus each of which includes Caliciviruses of

veterinary importance such as RHDV and FCV respectively.



Astrovirus

Astrovirus were first described in 1975 as a result of electron microscopic

studies of an outbreak of diarrhea. Astrovirus is characteristically star

shaped.

There are human as well as animal Astroviruses. They are icosahedral

viruses and non-enveloped. Astrovirus contains positive sense single-

stranded RNA. Astroviruses are small 28nm in diameter round shape

virus particles. They are found in stool of infants hospitalized with

diarrhea. Surveys conducted using electron microscopy showed that

Astrovirus infection occurs worldwide and accounts for 2 to 8 % cases of

diarrheas in infants. A major advance in the abilities of laboratory to

diagnose Astrovirus came as results of the findings that they could be

propagated in a continuous line of colon carcinoma cell CaCo2

(Willcocks et. al, Arch-Virol, 1990; 113; 73-81). The development of

enzyme immunoassay (EIA) in the late 1980s for detecting viruses in

stool showed that Astrovirus is significant cause of diarrhea in developing

countries. There are 8 serotypes of human Astroviruses; they are stable at

pH 3, resistant to cholofrom and detergents and lipid solvent. The single

stranded RNA is approximately 6800 nucleotides in length excluding

polyA tail at the 3’ end. Viral genome comprises of 3 ORFs. 2ORFs at 5’

end of the genome designated as ORF 1a and ORF 1b encodes

nonstructural protein. The third ORF designated as ORF 2 encodes for

structural protein and is found at 3’ end of the genome. This ORF is

common to both the genomic and sub genomic RNA.

The transmission of Astrovirus takes the fecal-oral route. Astrovirus

replication occurs in intestinal tissues in humans usually children under 3

years age mostly gets affected. Actinomycin D, an inhibitor of DNA

transcription did not inhibit Astrovirus infection in these systems. Among

the 8 serotypes of Astrovirus the serotype 1 appears to be the most

prevalent. Human Astrovirus infection includes a mild watery diarrhea

that lasts for 2 to 3 days associated with vomiting, fever, anorexia,

abdominal pain and various constitutional symptoms.



Picobirnavirus

Picobirnavirus was first described by Pereira et al when they detected the

bands of bisegmented double stranded RNA by polyacrylamide gel

electrophoresis (PAGE) in feacal samples from children. The virus

particles are of icosahedral symmetry. Picobirnaviruses are unclassified,

non-enveloped, small spherical viruses 35 to 41 nm in diameter. They

have bisegmented dsRNA genome. The genome is of two types and the

types are large profile and small profile. The size of the genomic

segments for the large genome profile is 2.3 to 2.6 kb for segment 1 &

1.5 to 1.9 kb for segment 2. Picobirnavirus with small genome profile

have two genome segments of 1.75 to 1.55 kbp for segment 1 & 2

respectively. Picobirnaviruses are opportunistic diarrhreagenic

pathogens. Other than human Picobirnaviruses has been identified in

other hosts such as rats, guinea pigs, rabbits, horses and sheep.

Picobirnaviruses are also identified in calves causing outbreaks of

diarrhea. Picobirnaviruses belong to the family Picobirnaviridae. They

differ in several important respects from birnaviruse which is another

group of viruses with a bisegmented double stranded RNA genome.

Picobirnaviruses were classified as opportunistic diarrhoeagenic

pathogens. As far a UK based epidemiological study it was said that

human Picobirnaviruses were detected among patients with or without

gastroenteritis. Picobirnavirus strains have been classified into two

genogroups represented by the Chinese strain 1-CHN-97 and the US

strain 4-GA-91 based on RT-PCR experiments. Inference drawn from

various epidemiological data human picobirnavirus infects population

with low immunity.



ROTAVIRUS

A double-capsid particle is shown on the left, and the single (inner) capsid on its right.

Rotaviruses are the single most important cause of severe diarrheal illness

in infants and young children in both developing and developed

countries. It is a member of Reoviridae family. It was first identified by

Bishop et. al. in 1975. Later Flewett et. al observed Rotavirus particles

under the electron microscope. The name Rotavirus comes from

characteristics wheel-like appearance of the virus particles when viewed

under electron microscope (the name Rotavirus is derived from the Latin

word Rota, meaning “wheel”).

Although diarrheal diseases are one of the most common illnesses in the

age group throughout the world they assume special significance in

developing countries where they constitute a major cause of mortality

among the young. Pediatric diarrhoea remains one of the major causes of

death in young children. This is especially so in Asia, Africa, Latin

America where it causes millions of deaths in the age group 0-5years. A

number of different viruses cause diarrhoea of which the most important

is the family of ROTAVIRUSES. Rotaviruses have been estimated to be

associated with 30-50% of all cases of severe diarrheal disease in man.

Rotaviruses are the single most important cause of severe diarrhoeal

illness in infants and young children in both developed and developing



countries worldwide. Although diarrhoeal diseases are one of the most

common illnesses in this age group throughout the world they assume a

special significance in developing countries where they constitute a major

cause of mortality among the young. Human Rotavirus was first

discovered in Australia by thin section microscopic examination of

duodenal biopsies obtained from children with acute diarrhea and was

observed by electron microscopy soon afterwards in diarrhoeal stool

specimens from various parts of the world. The virus particle is

approx.70nm in diameter and contains eleven segmented double –

stranded RNA as its genome and has an inner and outer capsid but no

envelope.

Rotavirus: Negatively stained Electron Micrograph

Morphology and Morphogenesis:

Rotaviruses have a distinctive morphologic appearance by negative stain

EM. Complete particles measures about 70nm in diameter and have a

distinctive double-layered icosahedral protein capsid that consists of an

outer and an inner layer when viewed by transmission EM. Within the

inner capsid is a third layer, the core that contains the viral genome

consisting of eleven segments of double-stranded RNA [dsRNA]. The

complete particles are also designated smooth particles because the



outermost margin of the outer capsid layer has a well defined, smooth

circular appearance. Particles lacking the outer capsid layer measure

about 55nm in diameter and are designated rough particles because

without the smooth outer layer the capsomeres of the inner capsid

projects to the periphery giving a circular “bristly” appearance. The term

Rota which means wheel was suggested because the sharply defined

circular outline of the outer capsid gives the appearance of the rim of a

wheel placed on short spokes radiating from a wide hub. The viral

particle contains RNA-dependent RNA polymerase and other enzymes

capable of synthesizing capped but non-polyadenylated mRNA

transcripts. Viral replication occurs in the cytoplasm of the infected cell.

Due to the segmented nature of the genome, Rotavirus can undergo

genetic reassortment.

The Rotavirus genome encodes 6 structural and 6 non-structural

proteins with each gene essentially encoding a single polypeptide except

gene 11 which codes for an additional protein from, an out of phase open

reading frame. The proteins that contribute to the structure of the virion

are called viral proteins whereas the proteins that are encoded by the virus

but do not contribute to the structure in the mature virion are called non-

structural proteins. The outer capsid layer is made of two proteins VP7

and VP4. VP7 encoded by one of the gene segments 7,8 and 9 depending

on the rotavirus strain, forms the outermost layer consisting of 780

molecules and VP4 (encoded by genome segment 4) is represented by the

60 spikes (dimers) emanating from the surface. The intermediate layer is

composed of 780 molecules (260 trimers) of a single protein VP6

(encoded segment 6) which represents about 51% of the virion protein.

The inner layer is formed by 120 molecules of VP2 (the gene product of

segment 2) and it encloses the core consisting of VP1, VP3, and the

eleven segments of dsRNA.

Viral structural protein:

VP1:

1. VP1 is one of three proteins comprising the innermost of three viral

layers.



2. It is the RNA-Dependent RNA Polymerase for rotavirus, a core

replication intermediate.

3. Associates with VP2 at its icosahedral vertices.

VP2:

1. This protein is the main structural component of the innermost layer.

2. It associates with VP1 and VP3 at its 12 vertices, and is a replication

intermediate.

VP3:

1. VP3 is a hemagglutinin protein, the third part of the inner core of the

virus.

2. VP3 acts as the mRNA capping enzyme.

3. It also associates with VP2 and is a replication intermediate.

VP4:

1. Along with VP7, VP4 makes up the outer capsid of virus.

2. It contributes 1.5% of total virion protein.

3. It is an 88 kD protein that dimerizes to form 60 spikes on the virus

capsid.

4. VP4 is cleaved at the ‘cleavage site’ by the pancreatic enzyme

trypsin to form VP5 and VP8.

5. VP4 and its cleavage products are associated with cell attachment

[adsorption] as invasion and cleavage is necessary for infectivity.

6. VP4 is antigenic and induces neutralizing antibodies.

7. The specific structure of this protein is used to determine the

rotavirus P genotype, as well as host specificity, virulence and

protective immunity.

8. It has also been associated with heat shock cognate protein, hsc70

during cell entry.



VP5:

1. VP5 is cleaved from the outer capsid protein, VP4, in the presence

of trypsin.

2. It remains bound to virion post cleavage, and can be bound by

neutralizing antibodies made towards VP4.

3. It is membrane associated and functions to permeabilize host cell

membranes to facilitate cell invasion.

VP6:

1. Molecular weight is 41 kD.

2. Contributes 51% of the total virion protein.

3. Immunodominant sites of VP6 have been localized in the four

regions on VP6 (amino acid residue 32 to 64; 155 to 167; 208 to

294; 308 to 396 ;)

4. Amino acid residues 172, 305, 315 & region 296 to 299 were

reported as contributing to subgroup epitopes.

5. VP6 is a structural component that comprises the middle capsid.

6. The specificity of this protein is used to determine the A-G

groupings of rotaviruses, and I, II sub-groupings of Group A

rotaviruses.

7. It has also been linked to the enterotoxin NSP4.

VP7:

1. Contributing 30% of the virion protein.

2. This 37 kD glycoprotein makes up the smooth portion of the outer

capsid.

3. It contains three potential sites for N-linked glycosylation. [viz.

NIS]

4. It can induce neutralizing antibodies and determines the G

serotype.



5. It has been classified into 15 distinct G- genotypes.

6. Comparison of amino acid sequence of all 15 genotypes indicates

that there are nine regions that are highly divergent. Each of these

regions is highly conserved among Rotavirus strains within the

same genotypes/serotypes.

7. It is also a highly variable portion of the virus, capable of

reassortment and possible crossover with animal strains of the

virus.

8. VP7 also has associations with heat shock cognate protein (hsc

70), and some integrins, both related to viral entry of the cell.

VP8:

1. VP8 is the second cleavage product of VP4.

2. Like VP5, remains virion associated post cleavage and is bound by

VP4 neutralizing antibodies.

3. It functions to bind sialic acid and acts as the virus hemagglutinin.

Figure showing the different structural proteins. Indicating the

Positions of VP4, VP6, VP7and VP1.



Viral non-structural protein:

NSP1:

1. NSP1 binds Interferon Regulatory Factor 3 and may inhibit

interferon response during rotavirus infection.

NSP2:

1. In conjunction with NSP5, NSP2 is involved in synthesis and

packaging of viral RNA and creation of viroplasms.

2. NSP2 is a replication intermediate and having two domains which

are separated by deep cleft.

NSP3:

1. NSP3, a 36kD protein, binds viral mRNA at the 3’ end and

promotes viral protein synthesis.

2. It also represses host cell protein synthesis.

3. This protein is a possible target for a new class of antivirals.

NSP4:

1. NSP4 has been seen to act as an enterotoxin and cause diarrhea

during infection.

2. There is also correlation between VP6 virus subgroup and NSP4

genotype.

NSP5:

1. This phosphoprotein works with NSP2 in RNA synthesis and

packaging, and to induce viroplasms. It is also a replication

intermediate.

NSP6:

1. Little information is available on NSP6; it is associated with NSP5

and its function.



Genome:

1. Genome contains segmented dsRNA (11 segments).

2. Total genome size is 18.5 kb.

3. Containing RNA dependent RNA polymerase.

4. Containing other enzymes for producing capped RNA.

5. Capable of genetic reassortment.

6. AU rich (58%-67%) genome.

7. Each positive (+ve) sense RNA segment starts with a 5΄-guanidine

followed by a set of conserved sequence that is part of 5 -́

noncoding sequence.

8. Next to the 5΄-noncoding sequence an open reading frame (ORF)

coding for protein product is present.

9. ORF ends with stop codon followed by another set of noncoding

sequence which contains a subset of conserved terminal 3΄

sequence. It contains two 3΄ terminal cytidines. Almost all mRNAs

end with the consensus sequence - 5΄UGU GACC 3΄.

10. The length of the 5΄ and 3΄ noncoding sequence varies for different

genes.



Electrophoresis of the genomes of reovirus type 3 (REO), human

rotavirus (HR), calf rotavirus (CR), and the orbivirus D'Aguilar

(DAG) on 7.5% polyacrylamide gels. Migration wasfrom top to

bottom.

11. No polyadenylation signal is found at the 3΄ end of the gene. All

11 mRNA share common cis-acting signals because they all

replicate by the same polymerase and these signals are likely to

be formed by secondary structures rather than by primary

sequence. In addition each mRNA must also contain a signal that

is unique to it alone because the 11 mRNA must be distinguished

from one another during packaging. Generally, the conserved

terminal sequence in genome segments contain cis acting signals

important for transcription, RNA translation, RNA transport,



replication, assembly or encapsidation of the viral genome

segments.

Figure shows the 11 segments of dsRNA along with the

corresponding encoded protein and protein position at the Rotavirus

capsid.

Replication in host cell:

Attachment/ entry into host cell:

Rotavirus entry into cells appears to be a multistep process that requires

both VP4 and VP7. Recent studies indicate that rotaviruses can initiate

infection by two either of the modes- I) sialic acid dependent pathway

and II) sialic acid independent pathway. Sialic acid dependent virus

initiates infection of polarized intestinal epithelial cells efficiently only by

the apical membrane, whereas sialic acid independent virus can

efficiently infect polarized cells by either the apical or basolateral

surfaces. These results indicate that sialic acid dependent and sialic acid

independent rotavirus are likely to use different receptors, although

studies in non-polarized cells have suggested that they may share a

second receptor. Further studies indicate that infectious virus pretreated

with trypsin apparently gain entry into cells by direct penetration of

particles through the cell membrane into the cell cytoplasm. In contrast,

non-trypsin treated particles were taken up by phagcytosis and such

virion are seen to sequester into lysosomes, 20 minutes after virus



attachment to the cell membrane. Experimental result shows that trypsin

activated rotavirus is internalized with a half-time of 3 to 5 minutes,

whereas non-activated virus disappears from the cell surface with a half

time of 30 to 50 minutes. Endocytosis inhibitor (for example-

cytochalasin D or the vacular protein-ATPase inhibitor bafilonycin A1)

also does not block Rotavirus entry. These results indicate that neither

endocytosis nor an intraendosomal acidic pH or a proton gradient is

required for rotavirus entry into cells.

Replication:The rotavirus replication cycle may be viewed as having

three subsequent major stages: I) translation and synthesis of the viral

proteins; II) replication, genome packaging and DLP assembly; III)

budding of the newly formed DLPs into ER and assembly of the outer

layer to form mature TLPs. The positive strand RNA transcripts encode

the rotavirus proteins and functions as a template for production of

negative strand to make the progeny dsRNA. Recent studies with siRNA

have indicated that there are likely to be separate pools of mRNA for the

distinct functions (Silvestri et al. 2004).

Figure showing the general scheme for replication of rotavirus

The process by which 11 segments of dsRNA get encapsidated into each

virion remains unclear. Each mRNA has to occupy different vertices to



associate with a transcription enzyme complex; as per the current model

of genome organization, it is unlikely that the dsRNA genome segments

are encapsidated into preformed empty capsids as in some of the

bacteriophages. Instead, the encapsidation could be concurrent with the

capsid assembly as proposed by Pesavento et al. 2003. In this model, the

capsid assembly begins with the association of 12 units, each unit

consisting of pentamers of VP2 dimers in complex with a transcription

enzyme complex (VP1-VP3) and a genome segment, to form the SLP and

provide a scaffold for the subsequent assembly of VP6 trimers leading to

the assembly of a DLP. Replication, genome packaging and assembly of

the DLP occur in perinuclear, nonmembrane-bound, electron dense

inclusions called viroplasms, which appear 2-3 hours after infection.

Several in vivo and in vitro studies have strongly implicated two of the

nonstructural proteins NSP2 and NSP5, not only in formation of

viroplasm, but also in genome replication and packaging (Aponet et al.

1996; Gallegos and Patton 1989; Petrie et al. 1984).

Maturation:

Maturation and release represent the final step of the rotavirus replication

cycle. Once formed, DLPs bud from the viroplasms into the proximally

localized ER (Estes2001). The mechanism of acquiring outer layer

consisting of VP7 and VP4 is not clear. This budding process is

facilitated by the NSP4, which has a binding site for VP6 (Au et al. 1989,

1993; Tian et al. 1996). Both NSP4 and VP7 are synthesized on the ER

associated ribosomes and co-translationally inserted into the ER

membrane. Recent studies using RNA interference have shown that

accumulation of rotavirus proteins and indeed, DLPs and TLPs, are

blocked by silencing the expression of the NSP4 gene

(Lopez et al. 2005). This result indicates that NSP4 may have previously

unexpected functions related to virus maturation. A likely possibility is

that assembly of VP4 onto viral particles may take place at the plasma

membrane shortly before particles release and that VP4 may be involved

in the early stage of release. VP4 is synthesized on free plasma membrane

of the infected cells (Nejmeddine et al. 2000; Sapin et al. 2002). Virus

released by cell lysis or by nonclassic vesicular transport in polarized

epithelial cells.



Classification of Rotavirus:

Classification of Rotavirus is based on antigenic and genetic structure

derived from VP6 (group A-E), VP7 and VP4 surface proteins. The VP7

serotype is designated as G (VP7 is glycoprotein) and VP4 serotypes as P

(VP4 is protease enzyme). Most human Rotaviruses belong to group A.

The Rotaviruses have been divided into groups, subgroups and

serotypes based on the types of proteins that constitute their outer and

inner capsid. There are seven groups identified A, B, C, D, E, F and G.

Groups A, B and C Rotaviruses are those currently found in both human

and animals. The viruses of group D, E, F and G have been found only in

non human sources till date. Group A Rotaviruses have clearly been

established as causing significant diarrhoeal disease in the young. Group

B Rotaviruses have been associated with annual epidemics of severe

diarrhea primarily in adults. The group A Rotavirus is further divided into

four different types of subgroups [1] SGI, [2] SGII, [3] SGI & SGII, [4]

non SGI-non SGII, depending on the nature of the VP6 protein present in

the inner capsid and into 26 P-genotypes based on the variable nature of

VP4 protein in the outer capsid.

The major antigenic properties of Rotavirus group, subgroups and

genotypes are determined by the viral capsid proteins. Rotavirus has

seven major groups (A-G); most human strains belong to group A,

although group B and C have occasionally been associated with human

illness. The product of the 6th gene of group A Rotaviruses encodes VP6

which is the most abundant viral protein and the major determinant of

group reactivity -the target of common diagnostic assays and contains the

antigen that is used to further classify Rotaviruses into subgroups I and II.

The outer capsid proteins VP7 is the glycoprotein or G- protein (encoded

by gene 7, 8 or 9 depending on the strain) and VP4 the protease- cleaved

o r P -protein (encoded by gene segment 4) determine the genotype

specificity and form the basis of the binary classification (G and P type)

of Rotaviruses. Both G and P proteins induce neutralizing antibodies and

may be involved in protective immunity. Fifteen G genotypes of

Rotavirus or 10 G serotypes which occur in humans, have been defined

by gross – neutralization studies with polyclonal animal serum samples;

these serotypes correlate with antigenic specificity of the VP7



glycoprotein. The characterization of P serotypes has been difficult

because adequate reagents are not available. Eight P serotypes of human

Rotaviruses have been characterized. Additional VP4 gene variants have

been identified, so ultimately the number of P serotypes may exceed 20.

Theoretically 80 different strains of Rotavirus could result from different

combinations of known 10G and 8P serotypes of human Rotaviruses. For

vaccine development purposes, it is fortunate that only four common

strains (G1, G2, G3 and G4) of Rotavirus predominate globally.

Epidemiology of Rotavirus:

Until the discovery of the Rotaviruses only a small proportion of severe

diarrhoeal illness of infants and young children could be linked to an

etiologic agent. However as data from epidemiologic studies in the

developed and developing countries have accumulated, it has become

clear that Rotaviruses are the major etiologic agents of serious diarrhoeal

illness in infants and children under 2 year of age throughout the world.

In developing countries, Rotaviruses are the major cause of life –

threatening diarrhea in infants and young children. The burden of

Rotavirus diarrhoeal disease in infants and young children under 5 years

of age in developing countries has been estimated to be 130 million cases;

over 18 million of these were considered moderately severe or severe. In

addition it has been estimated 8,73,000 infants and children under 5 years

old die from Rotavirus diarrhoeal illness each year in developing

countries. Thus during the first 5 years of life in the developed countries

almost every child will experience an episode of Rotavirus diarrhea but

the consequence will be quite different in the developing countries: 1 of 8

will develop moderately severe illness and 1 in 160 will die.

In developed countries the widespread distribution of Rotaviruses

in the community is indicated by the universal acquisition of serum

antibodies to these viruses at an early age. For example in the

Washington D.C area over 90% of infants and young children acquire

Rotavirus antibodies by the end of the third year of life a pattern similar

to that observed for respiratory syncytial and para influenza type 3

viruses.



Epidemiology of Rotavirus in India:

It is estimated that close to 100,000 annual deaths are caused by rotavirus

in India, that is, 1 in every 250 children born in India will die from

rotavirus by the age of 5 years. India accounts for 17 per cent of the world

estimated rotavirus associated deaths (Indan J Pediatr 2001; 68: 855-62.).

A number of studies have been conducted on the prevalence of childhood

rotavirus diarrhea in various parts of the country in which rotavirus was

detected in 5 - 71 percent of the hospitalized children less than 5 years of

age with acute gastroenteritis (Emerg Infect Dis 1998; 4: 561-70; Indan J

Pediatr 2001; 68: 855-62; J Diarrhoeal Dis Res 1992; 10: 21-4.). The

prevalence of childhood rotavirus in the north Indian cities of Delhi,

Chandigarh and Aligarh has been reported to vary from 6-45 per cent (J

Diarrhoeal Dis Res 1992; 10: 21-4; J Diarrhoeal Dis Res 1993; 11: 14-8;

Indian J Med Res 1997; 106: 508-12.). In the western states of India, in

Pune, rotavirus was detected in 28-30 per cent of children 5 yr of age

with acute diarrhea (Indian J Med Res 1999; 109: 131-5.) In eastern

India, in Kolkata the incidence of rotavirus associated diarrhea varied

from 5-22 per cent (Trans R Soc Trop Med Hyg 1991; 85: 796-8; Indian J

Med Res 1984; 80: 620-2.). On the other hand, in Manipur the incidence

was as high as 41 per cent (Indan J Pediatr 2001; 68: 855-62).



Esti

mated global distribution of the 800,000 annual deaths due to

rotavirus diarrheas. Each point signifies five hundred deaths

(Emerging Infectious Diseases Volume 4 Number 4 Oct-Dec 1998.)

Rotaviruses infection and diarrheal disease:

Mode of transmission:

Rotavirus infection is highly contagious. The transmission of Rotavirus is

mainly through the fecal oral route. There has not been enough evidence

to show any air borne transmission. Children can transmit the virus when

they forget to wash their hands after using the toilets or before eating.

Touching a surface that has been contaminated with Rotavirus and then

touching the mouth area can result in infection. Person to person spread

through contaminated hands is probably the most important means by

which Rotaviruses are transmitted in close communities such as pediatric

and geriatric wards, day care centers and family homes.

Infected food handlers may contaminate foods which do not

require cooking such as salad fruits etc. Rotaviruses are quite stable in the

environment and have been found in estuary sample at levels as high as

1-5 infections particles/gallon, sanitary measures adequate for bacteria

and parasites seem to be ineffective in endemic control of Rotavirus as

similar incidence of Rotavirus infection is observed in countries with high

and low health standards.



Mode of infection:

Rotaviruses tend to affect gastrointestinal epithelial cells that are at the tip

of the villus. Following infection, the cells at the villus tip die and the

villus becomes denuded which result in shortening and stunting of the

villi. In the underlying lamina propria, mononuclear cell information is

observed. Their triple protein coat makes them very resistant to the

normally prohibitive pH of the stomach and also digestive enzymes

(lipase and protease) in the gastrointestinal tract.

Symptoms:

Symptoms usually begin within 2 days after exposure with the rotavirus

and it shows following symptoms-

1. Anorexia.

2. Low grade fever.

3. Watery, bloodless diarrhea.

4. Vomiting.

5. Abdominal cramps.

Symptoms generally persist for three to nine days.

Rotavirus infection can be associated with severe dehydration in infants

and children.

Symptoms of dehydration included-

1. Lethargy.

2. Dry and cool skin.

3. Dry or sticky mouth.

4. Absence of tears when crying.

5. Sunken eye or sunken fontanelle (the soft spot on the head of infants)

6. Extreme thirst.



Laboratory diagnosis:

Different diagnostic methods are in use for the detection of Rotavirus

which differs in sensitivity and are based on different ideas. Rotaviruses

can be identified easily by Electron microscopy. Direct EM examination

of stool samples can reveal the presence of Rotavirus. Rotavirus can be

detected by commercial assays like Latex Agglutination (LA), Reverse

Passive Haemagglutination assay (RPHA), Solid Phase Agglutination

of coated erythrocytes (SPACE). Detection of Rotavirus is also done by

PAGE followed by silver staining in some laboratories in addition or as

an alternative to EIA. But PAGE lacks sensitivity that is it requires a

minimum of 3 to 4 ng of viral RNA for the detection. So the widely used

method is ELISA which is more sensitive than PAGE. The latest

techniques like Dot Blot Hybridization using radio labeled cDNA

probes and Reverse Transcriptase Polymerase Chain reaction (RT-

PCR) are now being used as confirmatory test for detecting Rotavirus in

stool samples from patients with acute gastroenteritis.

Treatment:

Rotavirus gastroenteritis is a self limiting illness lasting for only a few

days. For persons with healthy immune system, treatment is non- specific

and consists of oral rehydration therapy to prevent dehydration.

Fortunately most people develop an immune response that is eventually

adequate to clear the virus from the body. A majority of patients affected

are infants; for them the disease state can be dangerous. About 1 in 40

children with Rotavirus gastroenteritis will require hospitalization for

administration of intravenous fluids. The most common symptom is

diarrhea and this alone can cause severe dehydration and electrolytic

imbalance. Antidiarrheal medicines are recommended.

In developing nations treatment for dehydration is oral rehydration

therapy (ORT). ORTs are available in packets and can be prepared at

home. The ingredients consist of one liter of water, one level teaspoon of

salt, and eight level teaspoons of sugar. Proper measurement is important

because too much sugar (more than 3%) can worsen diarrhea due to

osmotic effects.



Contents of oral rehydration salts (ORS) recommended by

WHO:

Reduced osmolarity ORS (1 liter):

Sodium chloride 02.60 gm

Glucose, anhydrous 13.50 gm

Potassium chloride 01.50 gm

Trisodium citrate, dehydrate 02.90 gm

Total weight 20.50 gm

Reduced osmolarity ORS (1 liter):

Sodium 75.00 mMol

Chloride 65.00 mMol

Glucose, anhydrous 75.00 mMol

Potassium 20.00 mMol

Citrate 10.00 mMol

Total osmolarity 245.00 mMol

Rotavirus vaccines:

From the hospital based epidemiological studies on Rotavirus lead to the

urgency of development of a vaccine effective against Rotaviral

gastroenteritis. The basic aim of the Rotavirus vaccines is preventing

children worldwide from being infected by Rotavirus during the first two

years of life, when Rotavirus disease can be most serious and takes its

greatest toll. Studies suggest that the effectiveness of Rotavirus vaccines

will depend in large part on its ability to stimulate intestinal -IgA

antibodies and other forms of local immunity. The recent strategies taken

for the development of Rotavirus vaccines range from cell culture

cultivation of strains obtained from human or animals to the application

of recently developed molecular biologic techniques. A rotavirus vaccine

(RotaShield) was released for general use in 1998-1999. Despite



promising initial results, vaccination was withdrawn because of a causal

relationship between the vaccine and several cases of intussusceptions.

The risk was observed 3-14 days following administration of the first

dose of the RotaShield vaccine in infants older than 3 months. In 2006,

two vaccines against Rotavirus infection were shown to be safe and

effective in children: Rotarix by GlaxoSmithKline and RotaTeq by

Merck. Both are taken orally and contain disabled live virus. In February

2006, the U.S. Food and Drug Administration approved RotaTeq for use

in the United States.


http://en.wikipedia.org/wiki/GlaxoSmithKline

http://en.wikipedia.org/wiki/Merck_&_Co.,_Inc.

http://en.wikipedia.org/wiki/U.S._Food_and_Drug_Administration


Detection of Rotavirus

In acute gastroenteritis

Cases



Objective of work

Detection of Rotavirus in acute gastroenteritis is the specific area of my

work. Hereafter the illustrations of the techniques by which Rotavirus

detection is done are being given followed by the inference drawn at end

of the experiments.



Materials and methods



Screening of Rotavirus by PolyAcrylamide Gel

Electrophoresis (PAGE) Technique:

RNA Extraction for PAGE:

1. 150µl of processed sample was taken and 50µl SDS/Na-Acetate

was added followed by 200µl phenol-chloroform-isoamyl alcohol

mixture [note - phenol-chloroform-isoamyl alcohol mixture was

shaken properly before use].

2. That mixed sample was vortexed and centrifuged at 10,000 rpm

for 10 minutes.

3. Upper transparent layer containing RNA (three layers were

formed) was taken out for gel loading.

Phenol-Chloroform mixture:

Solution I:

Redistilled phenol 50.00 gm

8-hydroxy quinoline 00.05 gm

Double distilled water 20.00 ml

Then solution I was mixed with Chloroform and Isoamyl alcohol as

following volume to prepare the

Phenol-Chloroform mixture.

Chloroform 41.60 ml

Isoamyl alcohol 01.74 ml

Solution I 65.00 ml

[Note – the final mixture must be shaken properly before every time it is

used]



SDS/Na-acetate solution (pH-5.0):

Solution I:

17N Glacial Acetic acid 01.15 ml

Double distilled water volume up to 200 ml

Solution II:

Sodium acetate (Na+CH3COO-) 01.15 gm

Double distilled water volume upto 140 ml

The 60ml solution I (0.1M glacial acetic acid solution) was mixed with

140 ml of solution II and pH was adjusted to 5.0. 2.00 gm of SDS was

added to that mixture and mixed properly. The final solution was the

SDS/Na-acetate solution. [Note – pH adjustment is prior to SDS

addition.]

Gel Casting for PAGE:

1. Glass plates, spacer and comb was properly cleaned by using

soap and then dried into a drier.

2. Glass plates and spacer was properly placed and fixed in the

casting strand. [Note- fixing of glass plates and spacer must be

done carefully so that no leakage of gel can happen as well as

glass plate does not break]

3. 7.5 % acrylamide gel solution was prepared and then poured into

casting plates and appropriate comb was fixed in the gel.

4. Comb was removed after gel got solidified and the gel plates

were fixed with the electrode equipment part of the apparatus.

Acrylamide solution:

Acrylamide 30.00 gm

N,N’-methylene bisacrylamide (MBA) 00.80 gm




Separation gel buffer (4X):

Tris HCl 18.17 gm


The pH was adjusted to 8.8 with 12 N HCl (about 2.75 ml was required).

Finally the volume was adjusted to 100 ml with double distilled water.

Ammonium persulphate solution (2% APS):

Ammonium persulfate (APS) 02.00 gm


7.5% polyacrylamide gel composition (for 46 ml):


Separation gel buffer 11.25 ml

Acrylamide solution 11.25 ml

TEMED 200 µl

2% APS 600 µl

Sample Loading and Running the Gel:

1. Approximately 120µl sample RNA (collected from the extraction) was

taken and mixed with 40µl bromophenol blue (gel loading buffer) and

loaded into the gel well. A positive control (contained Rotavirus RNA)

also was loaded.

2. The whole setup was transferred into the reservoir containing 1X

trisglycine running buffer (pH-8.3) and connected with its power

pack.

3. 14mA current was set for 1 gel plate or at 28mA current was set for

2 gel plates and it was run for 16-18 hours.



Tris-Glycine reservoir buffer (10X):

TRIZMA 32.20 gm

Glycine 188.00 gm

The pH was adjusted to 8.3 with 12N HCl. Finally the volume was

adjusted upto 1000 ml with double distilled water.(this buffer was diluted

to 1X for working solution)

Stacking gel buffer (4X):

TRIZMA 06.06 gm


The pH was adjusted to 6.8 with 12N HCl (about 03.95 ml was required).

Finally the volume was adjusted to 100 ml with double distilled water.

Gel loading buffer for PAGE (Bromophenol blue solution):

Stacking gel buffer (4X) 07.50 ml

Glycerol 02.50 ml

Bromophenol blue 10.00 mg

Staining of the Gel:

1. After gel running was completed (almost after 18 hours) the gel

was carefully removed from the glass plates, cut at the bottom-left

for orientation.

2. Then the gel was stained by silver staining. The staining process

was composed of three parts – a) fixation b) staining c) developing.

3. Fixation- was the first step of staining where the gel was kept in

fixing solution for 30 minutes

Fixing solution (400 ml):

Ethanol (C2H5OH) 40.00 ml

Acetic acid (CH3COOH) 20.00 ml




[Ethanol: acetic acid: double distilled water = 2: 1: 17]

4. Silver staining- after the completion of fixation process, the gel

was then Kept in silver nitrate staining solution for 30 minutes.

Silver stain solution (0.011M; 400 ml):

Silver nitrate (AgNO3) 00.74 gm


5. Developing- after the staining, the gel was washed with double

distilled water (few drops of developing solution was also added) for 3

to 4 times. Then the gel was kept in only developing solution [N. B-

developing solution must be prepared freshly.]

6. Developing solution (500 ml):

Sodium hydroxide (NaOH) 15.00 gm

Formaldehyde (38 %) 02.00 ml


6. Stabilizing- after colour developed the gel kept in stabilizing

solution.

Stabilizing solution (5%; 200 ml):

Acetic acid (CH3COOH) 10.00 ml


7. The gel photograph was taken by gel doc equipment.



Ethanol precipitation method: (For concentration of RNA)

Step 1:

150µl of sodium acetate – SDS buffer

+

450µl of viral suspension

+

600µl of phenol-chloroform

Mixed thoroughly and vortexed for 5 mins

Centrifuged at 10,000 rpm for 15 mins

Viral RNA supernatant

Step 2:

300µl viral RNA

+

30µl sodium acetate

+

Ethanol (3 times volume) [chilled] 990µl

Kept at -20°c for overnight

Centrifuge at 10,000 rpm for 15 mins

Discard supernatant

Add 70% ethanol (1ml)

Centrifuge at 10,000rpm for 15 mins

Gently decant supernatant and slightly tap on a tissue paper

Dry in speed vaccum centrifuge

Dissolve in 50µl of Tdw



Kept in 4°c for 5 mins

Kept in water bath 56°c for warming

Loading in gel



RNA Extraction for Reverse Transcription by Using

QIAGEN Kit:

1. 200µl of processed suspension was taken from each sample.

2. 580µl of AVL buffer (from kit) was added.

3. Mixed by vortexing for 15 seconds and incubated at room

temperature for 10 minutes and centrifuged briefly.

4. 560µl of ethanol (96 to100 %) was added to the mixture and mixed

by vortexing and centrifuged briefly.

5. Then 630µl of the solution was carefully applied to the QIAamp

spin column in a 2ml collection tube.

6. Centrifuged at 8,000 rpm for 1 minute. [Step 5 and 6 was repeated

to complete the total volume]

7. Then QIAamp spin column was placed into a clean 2 ml collection

tube and discarded the filtrate.

8. 500µl of buffer AW1 was then added and centrifuged at 8,000rpm

for 1 minute and the filtrate was discarded.

9. 500µl of buffer AW2 was added and centrifuged at 14,000rpm for

3 minutes.

10. Another round of centrifugation was carried out at 14,000 rpm for

1 minute to remove the traces of alcohol (in AW2 buffer) from the

column.

11. The QIAamp spin column was then placed in a fresh 1.5 ml

eppendrof tube and 60µl of buffer AVE was added; incubated at

room temperature for 1minute and centrifuged at 8,000 rpm for 1

minute.

12. The filtrate was extracted RNA sample which was used for RT

PCR.



Figure: showing the diagram of RNA extraction by using QIAamp Kit.



Reverse Transcription of Extracted RNA Sample:

1. Eppendorf was marked with proper sample number and its gene

type VP7 gene or VP4 gene.

2. Extracted dsRNA was heated at 56 ºC for 5 minutes in water bath.

3. Then DMSO and each RNA sample was separately added in VP7

and VP4 marked eppendorf corresponding to its sample number.

VP7 amplification primer SC1 and SC2 (VP7-F and VP7-R primer

can also be used) was added in each VP7 marked eppendorf

whereas VP4 amplification primer RH I (random hexamer I) was

added in each VP4 marked eppendorf. [The amount of addition is

given in the following table]

For VP7:

DMSO 01.25 µl

RNA sample 04.00 µl

SC1 (primer) 00.50 µl

SC2 (primer) 00.50 µl

Total 06.25 µl

For VP4:

DMSO 01.25 µl

RNA sample 04.00 µl

RH I (primer) 01.00 µl

Total 06.25 µl

4. After addition it was mixed by vortexing and then briefly

centrifuged.



5. The mixture was then taken for heat shock in PCR machine at 98

ºC for 5 minutes. Then snap-chilled in ice bath for 5 minutes.

6. Next buffer, dNTPs, DTT and reverse transcriptase enzyme (SSII

RT) was added according to the following table-

1st strand buffer 02.00 µl

0.1M DTT 01.00 µl

10mM dNTPs 00.50 µl

SS II RT (enzyme) 00.25 µl

Total 03.75 µl

[Total volume became 6.25 µl + 3.75 µl = 10 µl]

7. After addition it was mixed by gentle vortexing and briefly

centrifuged.

Then the RT (reverse transcription) was done according to the

following condition-

RT condition:

Temperature Time

25 ºC 10 minutes

42 ºC 50 minutes

72 ºC 15 minutes

04 ºC hold



a b c d e f

˘ ˘ ˘ ˘ ˘ ˘

Temp^

Time›

a=94ºC, 3 mins; b= 94ºC, 45 secs; c=50ºC, 45 secs; d=72ºC, 1 mins 20

secs; e=72ºC, 7 mins; f=4ºC, kept refrigerated in hold

8. After RT was completed the cDNA (of the RNA sample) was

amplified by polymerase chain reaction (PCR).

1 cycle

1 cycle

35 cycles



Polymerase Chain Reaction of the cDNA Product:

1. PCR buffer, MgCl2, dNTPs, H2O was added in each eppendorf. 2. For each sample’s VP7 gene amplification, VP7 gene cDNA and

VP7 gene primer SC1 and SC2 was added separately. 3. For each sample’s VP4 gene amplification, VP4 gene cDNA and

VP4 gene primer Con 2 and Con 3 was added separately. 4. Then the Taq DNA polymerase was added in each eppendorf and

mixed by vortexing and briefly centrifuged. [Amount of addition is given as follows].

For VP7:

10 X PCR buffer 05.00 µl

50mM MgCl2 01.50 µl


Distilled water 30.00 µl

cDNA 10.00 µl

SC 1(forward) 01.00 µl

SC 2(reverse) 01.00 µl

Taq DNA polymerase 00.50 µl

Total 50.00 µl

For VP4:

10 X PCR buffer 05.00 µl

50mM MgCl2 01.50 µl


Distilled water 30.00 µl

cDNA 10.00 µl

Con 2(reverse) 01.00 µl



Con 3(forward) 01.00 µl

Taq DNA polymerase 00.50 µl

Total 50.00 µl

5. Then the PCR reaction was continued. VP7 and VP4 gene

amplification required different PCR condition (conditions are given as

follows). Total

35 cycles of amplification was done.

PCR

Condition for VP7 gene amplification:

Temperature Time

95 ºC 03:00 minute

Start of cycle

94 ºC 00:30 minute

48 ºC 00:30 minute

72 ºC 01:10 minute

Repeat these three steps of cycle for 35 times

72 ºC final extension 07:00 minute

04 ºC hold

Condition for VP4 gene amplification:

Temperature Time

95 ºC 03:00 minute

Start of cycle

94 ºC 00:30 minute

48 ºC 00:30 minute



72 ºC 01:00 minute

Repeat the three steps of cycle 35 times

72 ºC final extension 07:00 minute

04 ºC hold

Primer Sequence 5’ to 3’

SC1[+] 5’GGTCCACATCTTACAATTCTAATCTAG3’

SC2[-] 5’GGCTTTAAAAGAGAGAATTTCCGTCTGG3’

Con3[+] 5’TGGCTTCGCCATTTTATAGACA3’

Con2[-] 5’ATTTCGGACCATTTATAACC3’



Agarose gel electrophoresis of PCR amplicon:

1. Gel casting- 02.00 gm of agarose was measured and mixed into 100

ml 0.5X TBE buffer. Heating was done to dissolve the agarose, and then

it was cooled to approx 450C.

2. 03.00 µl of EtBr solution (10 mg/ml) was added to it and it was shaken

well for mixing. Then it was poured into casting tray (appropriate comb

already placed) and it was solidified.

3. After gel got solidified, comb was removed and gel was put into

electrophoresis apparatus chamber containing 0.5X TBE buffer.

4. Gel loading- 10.00µl of each sample was mixed with 03.00µl of gel

loading dye solution and loaded in gel. 00.60µl of 100bp DNA ladder or

1kb DNA ladder (mixed with gel loading dye) also loaded.

5. Gel running- after loading, it was connected with its power pack and

run at 100 volt (for almost 1 hour). After running was complete, the gel

photograph was taken by gel doc equipment.

0.5M Ethylenediaminetetra-acetic acid (EDTA) solution (pH-8.0):

EDTA 186.10 gm


Sodium Hydroxide (NaOH) 20.00 gm

Finally the total volume was adjusted to 1000 ml with double distilled

water.

Tris-Borate-EDTA (TBE) buffer (5X):

The prepared 0.5M EDTA solution was used to prepare TBE buffer by

mixing with tris base and boric acid as follows:.

Tris base 54.00 gm

Boric acid 27.50 gm

0.5M EDTA solution (pH-8.0) 20.00 ml



Double distilled water volume up to 1000 ml

Ethidium Bromide (EtBr) solution (10mg/ml):

Ethidium bromide 20.00 mg


Gel loading dye (Bromophenol Blue) solution (6X):

Glycerol 11.50 ml

0.5M EDTA solution (pH-8.0) 02.00 ml


Bromophenol blue (BPB) one pinch

Purification of PCR products and Sequencing:

[1] Purification of PCR products:

[a] Added 5 volumes of buffer PB (150µ l ) to 1 volume of PCR product

(~30µ l ) and mixed. Buffer PB allowed efficient binding of PCR

products as small as 100bp and quantitative removal of primers

up to 40 nucleotides.

[b] QIAquick spin column is placed in the 2ml collection tube

provided. The sample was added to the column membrane and

centrifuged at 13,000rpm for 1 minute.

[c] Flow through was discarded. Next 750µ l of buffer PE was added to

the spin column and centrifuged at 13,000rpm for 1 minute. This



step efficiently removed unwanted primers, salts, enzymes, and

unincorporated nucleotides as flow through.

[d] Additional spin at 13,000rpm for 1 minute removed residual

buffer PE.

[e] Added 30µ l of EB (Elution buffer; 10mM Tris-Cl; pH: 8.5) to the

membrane of the spin column. The column was kept for 2 minutes

above a new 1.5ml eppendorf tube and then centrifuged at

13,000 rpm for 1 minute to ensure the elution of the PCR

amplicon.

[2] Quantization of the purified products:

Each purified product was quantitated using a GeneQuant pro

UV/vis spectrophotometer (Amersham, Pharmacia Biotech, UK).

Approximately 200ng of the purified product (6µ l ) was taken for

sequencing PCR.

[3] Sequencing PCR:

6µ l of the purified product was taken for sequencing PCR with 2µ l

of Big Dye Terminator ready reaction mix (ABI Prism Big Dye Terminator

Cycle Sequencing Ready Reaction Kits. Version 3.1) 1µ l of Big Dye

sequencing Buffer (5X stock conc.), 1µ l of Forward primer, stock 10

pmo1) /Reverse primer Stock 10 pmol) to a total volume of 10µ l . The

sequencing PCR reaction was carried out with an initial denaturation

step at 95oC for 5 minutes, 25 cycles of step [1] denaturation at 96oC for

10 seconds, step [2] annealing at 50oC for 5 seconds and step [3]

extension at 60oC for 4 minutes with a final hold at 4oC.

[4] Precipitation of the PCR products:



Precipitation of the Sequencing PCR products was carried out following

instructions in the ABI Prism Big Dye Terminator Cycle sequencing kit

version 3.1, with slight modification in reaction conditions. The steps

were as follows:

[1] To the 10µ l of sequencing PCR product, added 2µ l of 3M sodium

acetate, 2µ l of 125mM EDTA, and 50µ l of absolute ethanol;

vortexed and incubated in ice for 15 minutes.

[2] The reaction tubes were centrifuged at 13,000rpm for 20 minutes.

Flow through was discarded.

[3] Now 70µ l of 70% ethanol was added to the pellet, centrifuged at

13,000 for 20 minutes. Flow through was discarded.

[4] The tubes were then vacuum dried in Eppendorf concentrator

(Model 5310), parafilm wrapped and kept at –20oC.

[5] Reconstitution Using HiDi Formamide and sequencing:

The precipitated product was treated with a denaturant,

HiDiFormamide (P/N 431120; ABI Prism), before loading onto the

sequencer. For each pellet, 19µ l of HiDiFormamide was added and

incubated at 95oC for 2 minutes. The samples were then snap chilled on

ice and kept on ice for 5 minutes, vortexed and then pulsed down. They

were then kept on ice until loading onto the automated sequencer (16

capillary DNA Sequencer (Model 3100) Applied Biosystems, HITACHI

(Version 3.1 Data Extraction Software).



Sequence analysis

After completion of sequencing PCR, the sample is loaded in an

automated sequencer machine (Model 3100 genetic analyzer). A

chromatogram is obtained at the end of the process which is retrieved in

a note pad file. The sequence is read using software called sequencher

program (Gene codes corporation version 4.0.5). The sequence

obtained is compared with other cognate sequences in the database of

GenBank using BLAST (basic local alignment search tool) program

(Altschul et.al, 1997). The amino acid sequence obtained and

transformed into probable proteins by software called DNASIS program

(version 2.1). CLUSTALW (version 1.81) program was used for multiple

alignments of all the sequences (Higgins et al 1994).

DNASIS;

DNASIS (version) is a general DNA/RNA and protein analysis package. It

has been developed by Hitachi software engineering company ltd. The

list of features is given below.

Features:

DNA/RNA analysis Protein analysis

Custom plasmid map drawing Secondary structure

prediction

Circular and linear restriction map Chou – fasman & chou

– fasman rose

Customized enzymes tablets and

selection criteria

Robson

Primer design Coiling structure

graphics



RNA folding Hydrophobicity

ORF analysis Amino acid content

Contig manager (automatic and

manual fragment assembly, contig

editor, consensus sequence)

Isoelectric point

calculation

Fully featured sequence editor,

digitzer interface

Molecular weight

determination

Multiple sequence alignment Higgins

algorithms

Reverse translation of

DNA

Phylogenetic trees, dot matrix plots. Database searching

Database searching Sequence editor

Trace display of ABI, SCF formats

BLAST (Basic local alignment system tool):

BLAST 2.0 (Basic local alignment system tool) the core of NCBI’s BLAST

service is otherwise called as “Gapped BLAST”. It is widely used tool for

finding matches to a query sequence within a large sequence database,

such as GenBank EMBL and DDBJ etc. the BLAST algorithm was written

for balancing speed and increased sensitivity for distant sequence

relationship instead of relying on global alignments (commonly seen in

multiple sequence alignment programs).BLAST emphasizes regions of

local alignment to detect relationships among sequence which shares

only isolated regions of similarity (Altschul et al, 1990). Therefore BLAST

is more than a tool to view sequences aligned with each other or to find

homology, but a program to locate regions of sequence similarity with a

view to comparing structure and function.

The BLAST search pages allows one to select from several different

programs.



Program Description

Blast p Compares an amino acid query sequence against a

protein sequence database.

Blast n Compares a nucleotide query sequence against a

nucleotide sequence database

Blast x Compares a nucleotide query sequence translated in

all reading frames against a protein sequence

database. You could use this option to find potential

translation products of an unknown nucleotide

sequence.

T blast n Compares a protein query sequence against a

nucleotide sequence database dynamically translated

in all reading frames

T blast x Compares the six frame translation of a nucleotide

query sequence against the six frame translation of a

nucleotide sequence database

CLUSTALW:

ClustalW is a widely used system for aligning any

number of homologous nucleotide or protein sequences. For multi-

sequence alignments, ClustalW uses progressive alignment methods. In

these, the most similar sequences, that is, those with the best alignment

score are aligned first. Then progressively more distant group of

sequences are aligned until a global alignment is obtained. This heuristic

approach is necessary because finding the global optimal solution is

prohibitive in both memory and time requirements. ClustalW performs

very well in practice. The algorithm starts by computing a rough distance

matrix between each pair of sequences based on pairwise sequence

alignment scores. These scores are computed using the pairwise

alignment parameters for DNA and Protein sequences. Next, the

algorithm uses the neighbor-joining method with midpoint rooting to



create a guide tree, which is used to generate a global alignment. The

guide tree serves as a rough template for clades that tend to share

insertion and deletion features. This generally provides a close-to-

optimal result, especially when the data set contains sequences with

varied degrees of divergence, so the guide tree is less sensitive to noise.

Parameters for Pairwise and Multiple Sequence Alignment (for both

DNA and Protein):

Gap Opening Penalty:

There is a penalty for opening a gap in the alignment.

Increasing this value makes the gap less frequent.

Gap Extension Penalty:

There is a penalty for extending a gap by one residue.

Increasing this value will make the gap shorter. Terminal gaps are not

penalized.



Results and discussion



Stool samples from children with acute gastroenteritis were collected

and were screened. After screening both short and long patterns of

Rotavirus was obtained. The experiments distinctly show the dsRNA

patterns of Rotavirus.

Results of Rotavirus screening by polyacrlamide gel

electrophoresis:

Screening of Rotavirus by PAGE is a rapid method of detection; in the

following table the screening results of the test samples and their

electropherotypes are mentioned.

Date of

Experiment

lane no. Rotavirus screening results

Electropherotypes

Gel1 Gel2

5/9/07 10 Positive Rota long Gr A

1,2,3,4, 5-6, 789, 10,11

13 Positive ”

6/9/07

8 Positive ”

3 Positive ”

7/9/07 10 Positive ”

4 Positive ”

10/9/07 5 Positive ”

14 Positive Rota long Gr C

1,2,3,4, 5-6, 789, 10,11

11/9/07 14 Faint Rota Rota long Gr A

1,2,3,4, 5-6, 789, 10,11

12/9/07

1 Faint Rota ”

11 Positive ”

12 Positive ”



13 Positive ”

12/9/07 14 Positive Rota long Gr A

1,2,3,4, 5-6, 789, 10,11

13/9/07 2 Faint Rota ”

3 Faint Rota ”

14/9/07 7 ” ”

10 ” ”

26/9/07

18 ” ”

19 ” ”

18 ” ”

5/10/07 2 ” ”

8/10/07 16 ” ”

11/10/07 1 ” ”

27/10/07 19 Positive ”

10 positive Rota short Gr A

1,2,3,4,5,6(wider)7,8,9,10,11



Figure showing the polyacrylamide gel after silver nitrate staining.

Figure analysis: In this gel photograph we can see distinctly visible 11

bands of Rotavirus dsRNA. Here all the bands are separate except 7 & 8

which are fused.

ROTA

1

2,3

4

5,6

10

11

7-8-9

10

11



Figure showing the polyacrylamide gel after silver nitrate staining.

Figure analysis: In this gel photograph we can see distinctly visible 11

bands of Rotavirus dsRNA as ‘long’ and ‘short’ electropherotype. Here

some of the bands are separate while 2-3, and 7-8-9 are fused in some

of the lanes.

ROTA

1

2,3,

4

5,6

7-8-9

10

11

L0NG

SHORT



Results of agarose gel electrophoresis:

All the PCR products of the positive sample were analyzed through

agarose gel electrophoresis for determining the genotype.

For VP4 gene:

1 2 3 4 5 6

Figure showing the EtBr stained PCR product in

agarose gel

Lane 1 & lane 6 contains 1kb+ ladder, lane 2, 3, 4 & 5contains PCR

product of VP4 gene. All showed bands above 850 bp (actual VP4

gene product is 876 bp). This is a representative gel figure. All

Positive samples showed similar band for VP4 gene amplification



VP7 gene:

1 2 3 4 5 6

Figure showing EtBr stained PCR product in agarose gel

Lane 1 & lane 6 the 1kb+ DNA ladder. Lane 2, 3, 4 & 5 contains PCR

product of VP7. All showed bands near 1 kb (actual VP7 Gene product is

881 bp). This is a representative gel figure. All Positive samples showed

similar band for VP7 gene amplification.



Figure showing phylogenetic tree based on the deduced

amino acid sequence of the VP4 encoding gene of

different strains of Group A rotaviruses. [P- genotype].

The Group C rotavirus [Bristol strain] has been defined

as the outgroup to construct the bootstrapped

phylogenetic tree by the neighbor joining method.





Appendix



Reagents used

Reagent Company Agarose powder Sigma

Ammonium persuphate Sigma

Acrylamide Sigma Acetic acid glacial 5% Anala R merck india

Bromophenol blue Sigma

Boric acid Sigma chloroform Sigma Calcium chloride Merck India Ethidium bromide Sigma Ethanol Bengal chemical EDTA Sigma Formaldehyde Sigma

Glycine Sigma Glycerol Sigma Glacial acetic acid Anala R merck india Hydrochloric acid Merck India 8 hydroxy quinoline Sigma

Isoamyl alcohol Sigma Isopropanol Sigma Sodium dodecyl sulphate Sigma Magnesium chloride Sigma Methylene bisacrlamide Sigma Potassium chloride Sigma Redistilled phenol Sigma Sodium chloride Sigma Sodium hydroxide 98% Sigma & Aldrich

Sodium acetate Sigma

Sodium dihydrogen orthophosphate Anala R merck india

Silver nitrate Sigma ultra Tris-base Merck TEMED Sigma



Kits used

Name of kit Company QIAmp Viral RNA minikit QIAGEN QIAquick purification kit QIAGEN Big dye terminator cycle sequencing

ABIprism

HiDi formamide ABIprism



Instruments used

Name Company Refrigerated centrifudge Kubota Biofuge stratos Heraeus Vaccum centrifudge 5301 Eppendrop concentrator High speed micro-centrifudge Model- MX-301

Powerpac basic Biorad Vortex Maxi mixII Electrophoretic bath Biorad 3100 genetic analyzer(for sequencing) Applied biosystems GeneAmp PCR system 9700 Applied biosystems Master cycler Eppendrop Thermal cycler PTC-200 Biorad Thermo magnetic stirrer MGH-320 Sibata Gel doc Biorad Water bath NTB-221 Eyela



References



References

1. Fields virology volume -1 fourth edition

2. Fields virology volume -2 fourth edition

3. Virology a practical approach edited by B.W.J Mahy

4. Diarrhoeal diseases current status, research trends and field

studies editor D. Raghunath, R. Nayak. The third Sir Dorabji

Tata symposium

5. Electron microscope in Diagnostic Virology A practical guide and atlas Frances W.Doane and Nan Anderson

6. Bhattacharya, R., Sahoo, G.C., Nayak, M.K., Saha, D.R., Sur, D., Naik, T.N., Bhattacharya, S.K., Krishnan, T., 2006. Molecular epidemiology of human picobirnaviruses among children of a slum community in Kolkata, India. Infect. Genet. Evol., April 6 (Equb ahead of print) PMID : 16616879 (PubMed – as supplied by publisher).

7. www.oligo.net/dnasis.htm

8. www.ncbi.nlm.nih.gov/

9. www.cdc.gov/nicdod/dvrd/renb/gastro/rotavirus

10. http://mhcs.health.nsw.gov.au

11. http://digestive.niddk.nig.gov/index.htm

12. http://pathmicro.med.sc.edu/book/welcome.htm

13. http://wikimediafonudation.org/

14. http://www.answer.com/topic/diarrhea


http://www.oligo.net/dnasis.htm

http://www.oligo.net/dnasis.htm

http://www.ncbi.nlm.nih.gov/

http://www.cdc.gov/nicdod/dvrd/renb/gastro/rotavirus

http://mhcs.health.nsw.gov.au/

http://mhcs.health.nsw.gov.au/

http://digestive.niddk.nig.gov/index.htm

http://pathmicro.med.sc.edu/book/welcome.htm

http://wikimediafonudation.org/

http://www.answer.com/topic/diarrhea


Documents

Supratim's Report