SHORT COMMUNICATION

tsbcpakDfeZcseiawsarttbt8qsmpiq©

EA

1

All articles available online at http://www.idealibrary.com on

GA0CA

The Genomic Structure of ZNF198 and Location of Breakpointsin the t(8;13) Myeloproliferative Syndrome

Shashikant Kulkarni,* Andreas Reiter,* Damian Smedley,†John M. Goldman,* and Nicholas C. P. Cross* ,1

*Department of Haematology, Imperial College School of Medicine, Hammersmith Hospital, Du Cane Road, London W12 0NN,United Kingdom; and †Molecular Carcinogenesis Section, Institute of Cancer Research,

Haddow Laboratories, Belmont, Surrey SM2 5NG, United Kingdom

Received September 8, 1998; accepted October 19, 1998

The 8p11 myeloproliferative syndrome is a rare con-dtbcbFtcm

dkiKgKf(mmZ

cZw(uratrdibAbip

The t(8;13)(p11;q12) is the most common transloca-ion associated with the 8p11 myeloproliferativeyndrome and results in an identical mRNA fusionetween ZNF198 at 13q12 and FGFR1 at 8p11 in allases thus far reported. ZNF198 is a widely ex-ressed gene that is predicted to encode a 1377-mino-acid protein with five Zn finger-related motifsnown as MYM domains. To determine the genomicNA structure of ZNF198, we employed bubble PCR

rom PAC clones with a panel of gene-specific prim-rs. Sequencing of these products revealed thatNF198 consists of 26 exons with the initiationodon located in exon 4. The t(8;13) results in a con-istent mRNA fusion of ZNF198 exon 17 to FGFR1xon 9. Notable features of the structure of ZNF198nclude three noncanonical GC donor splice sitesnd the presence of an alternatively spliced intronithin exon 4. Amplification of genomic DNA from

ix t(8;13) patients with primers to ZNF198 exon 17nd FGFR1 exon 9 yielded patient-specific productsanging in size from 500 bp to 2.5 kb, indicating thathe positions of the breakpoints in the t(8;13) areightly clustered. The positions of the six t(8;13)reakpoints were determined and found to be dis-ributed across ZNF198 intron 17 and FGFR1 intronwith no apparent subclustering. No consistent se-

uence motifs, repeats, or topoisomerase II cleavageites were found at or near the breakpoints. It re-ains unclear why the t(8;13) translocation break-

oints occur within such small genomic regions, andt is possible that strict ZNF198–FGFR1 coding re-uirements restrict the positions of the breakpoints.1999 Academic Press

Sequence data from this article have been deposited with theMBL/GenBank Data Libraries under Accession Nos. AJ007675–J007697.

1 To whom correspondence should be addressed. Telephone: 14481 383 3302. Fax: 144 181 740 9679. E-mail: ncross@rpms.ac.uk.

enomics 55, 118–121 (1999)rticle ID geno.1998.5634

118

888-7543/99 $30.00opyright © 1999 by Academic Pressll rights of reproduction in any form reserved.

ition associated with chromosomal rearrangements ofhe short arm of chromosome 8, the most commoneing the t(8;13)(p11;q12) (6). We and others have re-ently cloned this translocation and found a fusionetween a novel gene, ZNF198 (also called RAMP orIM), at 13q12 and the fibroblast growth factor recep-or-1 (FGFR1) gene at 8p11 (7, 8, 10, 13). In all t(8;13)ases thus far examined, an identical ZNF198–FGFR1RNA fusion has been observed.ZNF198 is a widely expressed gene that is pre-

icted to encode a 1377-amino-acid protein of 155Da. The protein sequence of ZNF198 shows signif-cant homology to the DXS6673E/KIAA0385 andIAA0426 gene products. The function of theseenes remains to be identified, but DXS6673E/IAA0385 has been implicated as being responsible

or one of the form of X-linked mental retardation12). Each of these proteins contains five MYM do-ains, a novel octocysteine (C8) zinc finger-relatedotif (8, 10). These domains are retained in theNF198 –FGFR1 fusion.ZNF198 is located at the pericentromeric region of

hromosome 13. We have previously shown that theNF198 breakpoint cluster region in the t(8;13) isithin PAC 20-G12, a clone that contains D13S141

8). At least two inherited disorders for which thenderlying pathogenesis is unknown map to thisegion: Clouston hidrotic ectodermal dysplasia (4)nd a variant of Kabuki syndrome (5). As a preludeo determining whether mutations of ZNF198 may beesponsible for either of these conditions, we haveetermined the genomic structure of ZNF198 and thentron sequences flanking the coding exons usingubble PCR. PAC 20-G12 was digested with HaeIII,luI, or RsaI and ligated to the double-strandedubble oligo as described (14). Strand synthesis wasnitiated by a series of overlapping gene-specificrimers and a second primer, NVAMP1, complemen-

tusZAeqfcit

FitbwZteRvPG

E5s

119SHORT COMMUNICATION

ary to the unique sequence of the bubble. PCR prod-cts were gel-purified using standard techniques,equenced, and compared with the full-lengthNF198 cDNA sequence (GenBank Accession No.J224901) to localize the positions of introns andxons. We were unable to amplify 59 ZNF198 se-uences from PAC 20-G12, but were able to do sorom the overlapping PAC 2-B10 (not shown). Thislone contains D13S1114 and is distal to 20-G12 (8),ndicating that the orientation of ZNF198 is fromelomere to centromere.

The structure and sequence of ZNF198 are shown in

FIG. 1. Intron/exon structure of ZNF198. Intron and exonxon positions refer to the cDNA sequence (GenBank Accession No9 –127, and 128 –174, respectively. The position of the alternativeequences have been deposited with the GenBank/EMBL databas

ig. 1. The gene is organized into 26 exons with thenitiation codon located in the exon 4. The sequence ofhe first exon in our cDNA sequence differs from theeginning of the full-length sequence reported else-here (7) and may indicate the use of alternativeNF198 promoters. For this reason we have referred tohe first exon here as exon 1a and the alternative firstxon as exon 1b. RT-PCR of peripheral blood leukocyteNA indicated that the noncoding exons 2 and 3 areariably incorporated into the mature transcript. RT-CR with primers DET15 (59-TTGGCATCTCAGAAG-GAAGTG-39) and DET7 (59-ACTGGGAGATCCAAG-

quences are shown in lowercase and uppercase, respectively.J224901). The positions of noncoding exons 1a, 2, and 3 are 1–58,t exon 1b is 1– 64 (GenBank Accession No. Y13472). The completeunder Accession Nos. AJ007676 –AJ007696.

se. Afirses

Atsatcptp(

ifmsjf1picbt

m

consistent fusion between ZNF198 exon 17 and FGFR1ef1FAsttgwbrw1

bwDtiAtbSdstp

wN

PZFPZFPZF

PZ AAAACF

PZF

PZFPZFPZF

l

peotZGA

120 SHORT COMMUNICATION

ATCAGGA-39) also revealed an unusual alterna-ively spliced intron within exon 4. The smaller tran-cript lacked 261 bp, predicting a protein that is 87mino acids shorter. It is unlikely that the largerranscript was derived from an incompletely pro-essed pre-mRNA since RT-PCR of both total andoly(A)1 RNA yielded the two splice variants inhe same proportion, with the smaller transcript ap-roximately twofold less abundant than the largerFig. 2a).

All intron/exon boundaries, including the alternativentron within exon 4, satisfied the GT/AG rule exceptor introns 11, 12, and 13, which, remarkably, com-enced with a GC. Similar nonconsensus donor splice

ites have been described previously and may be sub-ect to distinct modes of regulation (9). However, weound no evidence for alternative splicing of exons 11,2, or 13, at least in peripheral blood leukocytes. Theositions of most of the introns are precisely conservedn the related gene DXS6673E/KIAA0385, but in thisase no noncanonical splice sites were found (12). Inoth genes, the five MYM domains are each encoded bywo exons.

Comparison with the previously reported fusionRNAs indicated that the t(8;13)(p11;q12) results in a

FIG. 2. (A) RT-PCR of poly(A)1 and total RNA demonstrates theresence of an alternatively spliced intron entirely within ZNF198xon 4. (B) Amplification of genomic breakpoint fragments from fivef the six patients with a t(8;13)(p11;q12). (C) Schematic represen-ation of the positions of t(8;13) breakpoints. The sequences ofNF198 intron 17 and FGFR1 intron 8 have been deposited with theenBank/EMBL databases under Accession Nos. AJ007675 andJ007697, respectively.

xon 9. Unexpectedly, amplification of genomic DNArom six t(8;13) patients with primers to ZNF198 exon7 (DET13: 59-GTTCCTATGCACATGTACAGTC-39) andGFR1 exon 9 (F9: 59-GAGGGTCTTCGGGAAGCTC-TA-39) yielded patient-specific products ranging inize from approximately 500 bp to 2.5 kb, indicatinghat the positions of the breakpoints in the t(8;13) areightly clustered (Fig. 2b). Reciprocal FGFR1–ZNF198enomic products were not obtained in any individualith several different primer combinations. This maye due to the fact that the t(8;13) is a complex rear-angement with an intrachromosomal inversion asell as the translocation between chromosomes 8 and3 (8).To determine the precise position of the t(8;13)

reakpoints, ZNF198 intron 17 and FGFR1 intron 8ere PCR-amplified from normal human genomicNA, sequenced, and compared to the sequence of

he patient-specific genomic PCR products. ZNF198ntron 17 is 1488 bp and contains one MER and twolu repeats. FGFR1 intron 8 is 1160 bp and con-

ains a THE1 repeat. The positions of the six t(8;13)reakpoints and two further breakpoints (SX1 andX2) that have been published elsewhere (13) wereistributed across these introns with no apparentubclustering (Fig. 2b). No consistent sequence mo-ifs or repeats were found at or near the break-oints (Table 1). In four cases it was not possible to

TABLE 1

Genomic DNA Breakpoints in the Eight Patientsith a ZNF198–FGFR1 Fusion Aligned with theormal ZNF198 and FGFR1 Sequences

atient EC acatatgtggatgatttttt/gcaaagagtcaggagaacagNF198 acatatgtggatgatttttt/ttttgcccaataaatatgggGFR1 taagctaaggcaaagtattt/gcaaagagtcaggagaacagatient JL ttttaatgtttagtaaacct/catctcagccataccataccNF198 ttttaatgtttagtaaacct/aactcaaaatgatttggttaGFR1 gggtggggacacagccaaac/catctcagccataccataccatient PR Tgtaagtcacattttaagtt/gagatttgggtggggacacaNF198 Tgtaagtcacattttaagtt/ctttctcattttgagatttaGFR1 taacacgtgggaattcaaga/gagatttgggtggggacaca

7 bpatient JB TTACAATGACGGATATGATG∧ tgggaaggagtcaccccgtcNF198 TTACAATGACGGATATGATG/AGTGAAGACGAGGGGGFR1 tgggaagccctgactaagaa/tgggaaggagtcaccccgtc

650 bpatient ML tgagatagcgccattgcact ∧ tttcacactgctgagaaagaNF198 tgagatagcgccattgcact/ccagcctgggcaacaagagtGFR1 aactgtttgtattagtccat/tttcacactgctgagaaaga

36 bpatient DS tcaaaatgatttggttaatt ∧acagaatgtgcagccaatagNF198 tcaaaatgatttggttaatt/agGTGCCAGTTCCTGTTTTTGFR1 tgggaggaagtcctatttgg/acagaatgtgcagccaatagatient SX1 aatttgaattccaaaagtag/acactgcaagtcctccggacNF198 aatttgaattccaaaagtag/atgcttgtattctagggcttGFR1 tttcctgcaccctccatatc/acactgcaagtcctccggacatient SX2 ccagcactttaggaggctga/cggactcctgggacatggatNF198 ccagcactttaggaggctga/catgggcagatcacctgaggGFR1 atatcacactgcaagtcctc/cggactcctgggacatggat

Note. ZNF198 is underlined, intron and exon sequences are inowercase and uppercase, respectively.

identify precisely the breakpoint positions due tovZZtsot

mti2mcebcotTtf(tmlitobbgptitelwptdemeZt

D

point cluster region induced by topoisomerase II inhibitors.

1

1

1

1

1

121SHORT COMMUNICATION

ery short (1–3 bp) regions of homology betweenNF198 and FGFR1. In one patient (patient JB), theNF198 breakpoint occurred within exon 18. Inhree cases (patients JB, DS, and ML), unique in-erts (7, 36, and 655 bp, respectively) of unknownrigin were found between ZNF198 and FGFR1 in-ron sequences.

In secondary leukemias following previous treat-ent with topoisomerase II inhibitors, it is well es-

ablished that translocation breakpoints may clustern the vicinity of topoisomerase II cleavage sites (1,). For primary myeloid malignancies, however, theechanism by which chromosomal translocations oc-

ur is not known. It has been suggested that Alulements may play a role in the illegitimate recom-ination between the BCR and the ABL genes inhronic myeloid leukemia (3), but the high frequencyf these sequences in the genome makes it unlikelyhat these elements are the sole cause of the t(9;22).here is no evidence that the 8p11 myeloprolifera-ive disorder is a secondary malignancy, and weound no consensus topoisomerase II cleavage sitesRNYNNCNNGYNGKTNYNY) (11) in ZNF198 in-ron 17 or FGFR1 intron 8. Although repetitive ele-ents were found in both introns, it is hard to be-

ieve that they may have played a major causal rolen the genesis of the t(8;13). It remains unclearherefore why the t(8;13) translocation breakpointsccur within such small genomic regions. It is possi-le that strict coding restraints with respect to theiological activity of the ZNF198 –FGFR1 fusionene severely restrict the positions of the break-oints. For example, in FGFR1, the beginning of theyrosine kinase domain is encoded by exon 9, and sot is likely that this exon is required for transforma-ion of hemopoietic cells. Inclusion of the FGFR1xon 8-encoded transmembrane region may result inocalization of the fusion gene to a compartment inhich its activity is compromised. In ZNF198 it isossible that all five MYM domains, and thereforehe first 14 exons of the gene, are required to enableimerization of the fusion protein. However, ZNF198xon 15 is also in-frame with FGFR1 exon 9, whichay indicate that sequences encoded by ZNF198

xon 16 or 17 are also necessary for activity ofNF198 –FGFR1. We are currently performingransformation assays to test these possibilities.

ACKNOWLEDGMENTS

This work was supported by the Leukaemia Research Fund andr. Mildred Scheel Stiftung.

REFERENCES

1. Aplan, P. D., Chervinsky, D. S., Stanulla, M., and Burhans,W. C. (1996). Site-specific DNA cleavage within the MLL break-

Blood 87: 2649–2658.2. Broeker, P. L., Super, H. G., Thirman, M. J., Pomykala, H.,

Yonebayashi, Y., Tanabe, S., Zeleznik Le, N., and Rowley, J. D.(1996). Distribution of 11q23 breakpoints within the MLLbreakpoint cluster region in de novo acute leukemia and intreatment-related acute myeloid leukemia: correlation withscaffold attachment regions and topoisomerase II consensusbinding sites. Blood 87: 1912–1922.

3. Chen, S. J., Chen, Z., d’Auriol, L., Le Coniat, M., Grausz, D.,and Berger, R. (1989). Ph11bcr2 acute leukemias: Implication ofAlu sequences in a chromosomal translocation occurring in thenew cluster region within the BCR gene. Oncogene 4: 195–202.

4. Kibar, Z., Der Kaloustian, V. M., Brais, B., Hani, V., Fraser,F. C., and Rouleau, G. A. (1996). The gene responsible forClouston hidrotic ectodermal dysplasia maps to the pericen-tromeric region of chromosome 13q. Hum. Mol. Genet. 5:543–547

5. Lynch, S. A., Ashcroft, K. A., Zwolinski, S., Clarke, C., andBurn, J. (1995). Kabuki syndrome-like features in monozygotictwin boys with a pseudodicentric chromosome 13. J. Med.Genet. 32: 227–230.

6. Macdonald, D., Aguiar, R. C. T., Mason, P. J., Goldman, J. M.,and Cross, N. C. P. (1995). A new myeloproliferative disorderassociated with chromosomal translocations involving 8p11: Areview. Leukemia 9: 1628–1630.

7. Popovici, C., Adelaide, J., Ollendorff, V., Chaffanet, M., Guasch,G., Jacrot, M., Leroux, D., Birnbaum, D., and Pebusque, M. J.(1998). Fibroblast growth factor receptor 1 is fused to FIM instem-cell myeloproliferative disorder with t(8;13). Proc. Natl.Acad. Sci. USA 95: 5712–5717.

8. Reiter, A., Sohal, J., Kulkarni, S., Chase, A., Macdonald,D. H. C., Aguiar, R. C. T., Goncalves, C., Hernandez, J. M.,Jennings, B. A., Goldman, J. M., and Cross, N. C. P. (1998).Consistent fusion of ZNF198 to the fibroblast growth factorreceptor-1 in the t(8;13)(p11;q12) myeloproliferative syndrome.Blood 92: 1735–1742.

9. Shapiro, M. B., and Senapathy, P. (1987). RNA splice junctionsof different classes of eukaryotes: Sequence statistics and func-tional implications in gene expression. Nucleic Acids Res. 15:7155–7174.

0. Smedley, D., Hamoudi, R., Clark, J., Warren, W., Abdul Rauf,M., Somers, G., Venter, D., Fagan, K., Cooper, C., and Shipley,J. (1998). The t(8;13)(p11;q11–12) rearrangement associatedwith an atypical myeloproliferative disorder fuses the fibroblastgrowth factor receptor 1 gene to a novel gene RAMP. Hum. Mol.Genet. 7: 637–642.

1. Spitzner, J. R., and Muller, M. T. (1988). A consensus sequencefor cleavage by vertebrate DNA topoisomerase II. Nucleic AcidsRes. 16: 5533–5556.

2. van der Maarel, S. M., Scholten, I. H., Huber, I., Philippe, C.,Suijkerbuijk, R. F., Gilgenkrantz, S., Kere, J., Cremers, F. P.,and Ropers, H. H. (1996). Cloning and characterization ofDXS6673E, a candidate gene for X-linked mental retardation inXq13.1. Hum. Mol. Genet. 5: 887–897.

3. Xiao, S., Nalabolu, S. R., Aster, J. C., Ma, J., Abruzzo, L., Jaffe,E. S., Stone, R., Weissman, S. M., Hudson, T. J., and Fletcher,J. A. (1998). FGFR1 is fused with a novel zinc-finger gene,ZNF198, in the t(8;13) leukaemia/lymphoma syndrome. Nat.Genet. 18: 84–87.

4. Zhang, J. G., Goldman, J. M., and Cross, N. C. P. (1995).Characterization of genomic BCR-ABL breakpoints in chronicmyeloid leukaemia by PCR. Br. J. Haematol. 90: 138–146.