The History of Evolutionary The History of Evolutionary ThoughtThought

• Lamarck believed that organisms had the ability to evolve when needed; animal evolved during its lifetime and passed those changes onto its offspring

The inheritance of acquired traits

Darwin and Natural SelectionDarwin and Natural Selection

• Where did he get his ideas from?

Darwin visited the Galapagos Islands of the coast of S. America

-different islands, each with slightly different environments

-Darwin noticed that were differences between the finches of each island

-Finch ancestors camefrom S. America mainland

-these observations led to the formation of Darwin’sTheory of Natural Selection

Natural Selection in a Natural Selection in a NutshellNutshell

1. Overpopulation: Greater number of offspring produced than can survive to reproduce

2. Struggle for Existence: overpopulation causes organisms to compete for limited resources (food, water, place to live)

3. Variation: No two individuals exactly alike, some are better suited to their environment than others

4. Survival of the Fittest (N. Selection): Organisms that are better adapted to their environment are better able to compete, survive, and reproduce. Others die and do not reproduce

5. Origin of Species (Speciation): Over numerous generations, new species can develop by accumulated inherited variations

Current views of evolutionCurrent views of evolution

-current evolutionary theory looks at the gene as a unit of evolutionary change

ATCG

Bases

Phosphate

Sugar

Bases

Review of Review of DNADNA

Nucleotide= 1 Base 1

Sugar

1 Phosphate

ATCG

Sugar/Phosphate Backbone

Bases

DNADNA

Sides Sides of of

ladderladder

Rungs Rungs of of

ladderladder

ATCGGCATTTCAGCATATCCATGCATGCTGCTCCCGATG

TAGCCGTAAAGTCGTATAGGTACGTACGACGAGGGCTAC

DNA->Gene->ChromosomeDNA->Gene->Chromosome

DNA strand

Gene: small section of DNA

There are many genes along the length of 1 DNA chain

Can fold into x-shaped structures

= 1 Chromosome

ATCGGCATTTCAGCATATCCATGCATGCTGCTCCCGATGCTGCTTTCAGCATATCGGCAATGCATGCTATCGACGACG

TCGGCATTTCAGCATATCCATGCATGCTGCTCCCGATGCTGCTTTCAGCATATCGGCAATGCATGCTATCGACGACGC

We now know that four distinct mechanisms generate evolution (change in allelic frequency in populations over time):

1. mutation 2. gene flow 3. genetic drift 4. selection (natural and

“artificial”)

Genetics with Playing CardsGenetics with Playing Cards

• Cards Activity • Gene: each card # is a gene• Allele: each card # has 4 suits or

alleles• Gene Pool: all cards in the deck (20)• Population: 4 people holding cards• Genetic Variation: different types of

A-5 combinations• Allelic Frequency: # of times a suit

appears vs # of time for all alleles• Sexual Reproduction: changes the

combinations of suits (alleles)DOES NOT change allelic frequency

Consider how the amount of genetic divergence (change) forms

a continuum:

Microevolution Macroevolution small changes large changes

Microevolution = adaptationMacroevolution = speciation

1. 1. MutationMutation = a heritable change in the nucleotide sequence of the genetic nucleic acid, resulting in an alteration in the products coded for by the gene

 

T A AC C C G C G

2. Gene flow2. Gene flow = introduction or loss of new alleles into the population through immigration or emigration.

 

 

3.3. Genetic driftGenetic drift =shifts in allele frequencies in small populations; a particular allele may not be passed on very well simply by chance

 

 

4. Selection =4. Selection = change in allele frequencies over generations due to differential survival and reproductive success of genotypes

 

Darwinian evolution is evolution by natural selection

Adaptation and Natural Selection Adaptation and Natural Selection in Actionin Action

• In 19th century England prior to the Industrial revolution, it was very common to see white Peppered Moths with very few black moths.

• The difference between the white and black moths was a single mutation. Even though the mutation was dominant very few black moths were present

White Moth: wwBlack Moth: Ww or WW

After PollutionAfter Pollution

• Pollution from factories killed lichen covering trees and covered bark in black soot

• Now white moths were visible to predators and quickly disappeared leaving black form as most common

Types Of EvolutionTypes Of Evolution

• Divergent evolution• Convergent evolution• Co-evolution

*see overhead