THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1989 by The American Society for Biochemistry and Molecular Biology, Inc. Vol. 264, No. 35, Issue of December 15, pp. 21376-21380,1989

Printed in ff.S.A.

A Frameshift Mutation in a Patient with Tay-Sachs Disease Causes Premature Termination and Defective Intracellular Transport of the a-Subunit of @-Hexosaminidase*

(Received for publication, July 10, 1989)

Michele M. H. Lau and Elizabeth F. NeufeldS From the Department of Biological Chemistry and Brain Research Institute, School of Medicine, and Molecular Biology Institute, University of California, Los Angeles, California 90024

Mutations of the gene encoding the a-subunit of the lysosomal enzyme, &hexosaminidase, are the cause of Tay-Sachs disease. We previously showed that fibro- blasts from one patient (WGlU5l) synthesized an un- stable a-subunit that was smaller than normal and appeared to be trapped in an early biosynthetic com- partment (Zokaeem, G., Bayleran, J., Kaplan, P., Hechtman, P., and Neufeld, E. F. (1987) Am. J. Hum. Genet. 40, 537-547). We now have identified the mu- tation as a deletion of cytosine at position 1510 of the coding sequence. We first determined that the struc- tural abnormality was at the carboxyl terminus of the protein and then sequenced the corresponding regions of the cDNA and genomic DNA after amplification by the polymerase chain reaction. The frameshift muta- tion, which is present on both alleles, causes premature termination four codons downstream, and the loss of a very hydrophilic stretch of 22 amino acids. Expression of a-subunit cDNA with the cytosine deletion in Cos-1 cells reproduced the WG1051 phenotype, i.e. a trun- cated a-subunit that was retained and degraded in an early compartment, presumably the endoplasmic retic- ulum. Loss of the cysteine residue at position 522 was not the sole cause of instability and defective transport.

Tay-Sachs disease is a catastrophic neurodegenerative dis- order, inherited in an autosomal recessive manner. Affected infants do not attain early milestones such as sitting or crawling, suffer seizures, and lose most cognitive functions by the second year. The underlying defect is the absence of the A isoenzyme of lysosomal @-hexosaminidase, caused by mu- tation of the gene encoding its a-subunit. The A isoenzyme, an a@ dimer, is essential for the degradation of GM2 ganglio- side;’ for this specific function, it. cannot. be replaced by the B (@&) isoenzyme, which is not affected in Tay-Sachs disease. The lysosomal accumulation of GW2 ganglioside that results from the lack of A isoenzyme is particularly damaging to neurons, which become ballooned or otherwise deformed. The reader is referred to a recent review for clinical, biochemical, and pathological aspects of the disease (1).

* This work was supported in part by United States Public Health Service Grant NS 22376. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

$ To whom correspondence should be addressed, Dept. of Biological Chemistry, UCLA School of Medicine, Los Angeles, CA 90024-1737. ’ The abbreviations used are: G M ~ ganglioside, N-acetylgalactosa- 1ninyl-@-~-t4-(N-acetylneuraminyl-~u2~3)-galactosyl-@l~-gluco- syl-@l+l-ceramide; PCR, polymerase chain reaction: ER, endo- plasmic reticulum.

Tay-Sachs disease is heterogeneous at the molecular level (reviewed in Ref. 2 ) . Whereas some mutations result in pro- found deficiency of the mature a-subunit mRNA as well as of the polypeptide (3-8), others give rise to a defective a-poly- peptide that does not form functional @-hexosaminidase A (9, 10). Tay-Sachs patients may be homozygous for a particular mutation if the mutant allele occurs at high frequency (as is the case for an insertion in exon 11 in the Ashkenazi Jewish population [SI), or if their parents are related through con- sanguinity; but often patients are compound heterozygotes who have two different mutant alleles. Mutations that permit expression of residual @-hexosaminidase A activity give rise to neurologic disorders of later onset and milder course than Tay-Sachs disease (11, 12).

We previously described a defective a-subunit synthesized by a strain of fibroblasts, WG1051, derived from an Italian patient with Tay-Sachs disease (13). The a-subunit appeared smaller than normal, and although it was inserted into the lumen of the endoplasmic reticulum, as evidenced by the presence of high mannose oligosaccharides, it did not undergo the subsequent post-translational processing characteristic of the normal a-subunit. It did not acquire the mannose 6- phosphate recognition marker for targeting to lysosomes, did not associate with the @-subunit, and was not proteol~ical~y converted to the mature lysosomal form. Although the absence of the mannose 6-phosphate marker might have been expected to result in secretion, as occurs in I-Cell disease (14), the WG1051 subunit was retained intracellularly and disappeared within a day. These observations suggested that the mutant a-subunit was trapped in an early biosynthetic compartment, presumably the endoplasmic reticulum, in which it was rapidly degraded. Both the biochemical results and the family history indicated that the patient was homozygous for the mutation (13).

As a first step in relating defective transport to protein structure, we have identified the WG1051 mutation. Our strategy was to localize the defect to a small segment of the a-polypeptide, sequence the corresponding regions of the mRNA and genomic DNA, and verify the identification by expressing mutagenized a-subunit cDNA in Cos-1 cells. A preliminary account of this work has been presented 115).

MATERIALS AND METHODS

Reagents-Goat antisera against the monomeric mubunit and against the B (06) isoenzyme of @-hexosaminidase had been raised (IS) and characterized (17) previously, as had affinity purified anti- bodies against the carboxy-terminal 15 amino acids of the a-subunit (18). Goat antiserum against fibronectin and fixed, protein A-bearing Staphylococcus aureus cells (Pansorhin) were purchased from Calbi- ochem. Rabbit reticulocyte lysate was from Promega Corp; Thermo- philus aquaticus (Taq) DNA polymerase was from New England

21376

Premature Termination of a-Subunit of &Hexosaminidase 21377

Biolabs; avian myeloblastosis virus reverse transcriptase was from Seikagaku America; RNase A (DNase-free) was from Pharmacia LKB Biotechnology Inc., as were M13mp19 and pSVL vectors. The Alligro HGH Immunoassay System, which contains the pXGH5 vector en- coding human growth hormone as well as reagents for its radio- immunoassay, was from the Nichols Institute. ~-[3,4,5-'H]Leucine, 150 Ci/mmol was from Du Pont-New England Nuclear, L-[?'S~] selenomethionine, 20-50 Ci/mmol, ~-[~'S]methionine, >lo00 Ci/ mmol, and deoxyadenosine 5'-a-[''SS]thiotriphosphate, >lo00 Ci/ mmol, were from Amersham, Corp., and [yR2P]ATP, 7000 Ci/mmol, from ICN. 4-Methylumbelliferyl-6-sulfo-2-acetamido-2-deoxy-@-~- glucopyranoside was obtained from Calbiochem. Oligonucleotides were synthesized by Dr. Dohn Glitz (UCLA). The bacterial strain CJ236 was provided by Dr. Catherine Joyce of Yale University.

Cell Culture-Skin fibroblasts derived from a Tay Sachs patient (WG1051) and from her parents (WG1053 and WG1054) were ob- tained from the Repository for Mutant Cell Strains, Montreal, Can- ada. Normal human fetal lung fibroblasts, IMR90, were obtained from the Corriell Institute for Medical Research, Camden, NJ. Fibro- blasts were cultured a t 35 "C in 5% Con, in Eagle's minimal essential medium supplemented with 15% fetal bovine serum, pyruvate, non- essential amino acids, and antibiotics. Cos-I cells were cultured a t 37 "C in 5% C02, in Dulbecco's minimal essential medium supple- mented with 5% fetal bovine serum, pyruvate, nonessential amino acids, and antibiotics. The fetal bovine serum was from Irvine Sci- entific, and other tissue culture reagents were from GIBCO.

Radiolabeling of Cells-To prepare radioactive a-subunit for analy- sis of the amino or carboxyl residues, IMR9O and WG1051 fibroblasts were labeled with ['H]leucine, 5 mCi/plate; isolation of the a-subunit from cells or medium by immunoprecipitation, polyacrylamide gel electrophoresis and electroelution, and detection of radioactive bands were performed as described previously (18).

For studies of a-subunit biosynthesis, Cos-1 cells were radiolabeled approximately 48 h after transfection with ["S]methionine, 0.25 mCi/ plate, in methionine-free Dulbecco's minimal essential medium; sub- sequent procedures for isolation and visualization of the radioactive a-subunit were performed as described (13), except that all the samples were heated in 1% sodium dodecyl sulfate a t 90 "C for 5 min prior to immunoprecipitation, then diluted to 0.3%, and the mono- meric a- and @-subunits precipitated separately.

Enzyme Assay-Activity of the @-hexosaminidase S isoenzyme (the aa dimer) was measured with a fluorogenic sulfated N-acetylglucos- aminide, as described in Ref. 19 for the A isoenzyme.

Cell-free Translation-RNA was isolated from fibroblasts with guanidinium isothiocyanate and pelleted through a cushion of CsCl (20). Total RNA, 20 pg, was translated in the presence of rabbit reticulocyte lysate and ['%]methionine according to the manufactur- er's specifications. Multiple translation reactions were pooled for immunoprecipitation and electrophoresis. Translation in the pres- ence of SP6 a-subunit mRNA has been described (18).

Amplification by the Polymerase Chain Reaction-Amplification of target sequences from RNA templates was accomplished in the fol- lowing three-step process: (a) reverse transcription of RNA (20 pg of total RNA), primed by the anti-sense oligonucleotide 5"GGCCAG- GATGCAGTGGAAGCCT, (b) digestion with RNase A; (c) PCR

primer and the sense primer, 5"GTTGACATCTGACCTGACAT. amplification (21) of the resulting cDNA, using the above anti-sense

Amplification was carried out manually for 50 cycles. Genomic DNA was isolated from fibroblasts after digestion of cell

pellets with proteinase K and RNase A (22), or by lysis in 200 mM KOH, followed by neutralization and extraction with phenol/chloro- form. PCR amplification was carried out in a Perkin-Elmer/Cetus DNA Thermal Cycler in the presence of the above sense primer and of the intronic anti-sense primer, 5"CTGACTATAAGCCTCTG- TAA, using the following program: 2 min of denaturation a t 94 "C, 3 min annealing a t 43 "C, 5' extension a t 72 "C, for 35 cycles.

Sequence Analysis of PCR Products-The target fragments ampli- fied by PCR were purified by polyacrylamide gel electrophoresis and subjected to sequence analysis by the dideoxynucleotide termination method (23), using reverse transcriptase a t 42 "C and the above primers.

Allele-specific Oligonucleotide Hybridization-PCR-amplified DNA, 30 ng, was applied to Hybond-N membrane (Amersham Corp.), denatured, and prehybridized in 50 mM Tris, pH 8.0,5 X Denhardts, 3 M tetramethylammonium chloride at 42 'C (24, 25). The blot was then probed with allele-specific 5'-['2P]oligonucleotides in the same buffer a t 42 "C, and washed in 50 mM Tris, pH 8.0, 3 M tetamethy- lammonium chloride a t 57 "C.

Site-specific Mutagenesis-Normal a-subunit cDNA was excised from pSP65a (18) and subcloned into M13mp19. Mutagenesis was performed by the method of Kunkel et al. (26). The dut-ung- strain of Escherichia coli, CJ236, was used for the production of the uracil- containing parental antisense templates. The mutagenic (sense) primers used were 5"TCACACTTCGCTGTGGAGTTG and 5'- GTAGGCTTCTCTGAGCAGGAG. Products of the mutagenesis were verified by DNA sequencing.

Expression of Normal and Mutant a-Subunit cDNAs in Cos-I Cells-Normal and mutagenized a-subunit cDNAs were excised from the M13 vectors and cloned into the expression vector pSVL. Cos-1 cells were seeded a t a density of 8.5 X lo5 cells/lOO-mm plate and transfected approximately 16 h later using DEAE-dextran (27). The plasmid pXGH5, which contains the human growth hormone gene, was co-transfected to measure transfection efficiency; approximately 48 h after transfection, the amount of growth hormone present in the medium was determined by radioimmunoassay, as specified by the supplier of the kit.

RESULTS

The Defect of the WG1051 Subunit Is at the Carboxyl Terminus-To determine if the apparently smaller size of the WG1051 a-subunit which had been observed previously (13) was due to some post-translational modification, we examined the polypeptide synthesized in cell-free translation. Total RNA from fibroblasts derived from the patient and the pa- tient's father, and from normal fibroblasts (IMRSO), was translated in the presence of rabbit reticulocyte lysate and ["S]methionine. The a-polypeptide was isolated by immu- noprecipitation and polyacryamide gel electrophoresis. As shown in Fig. 1, the a-polypeptide translated from the WG1051 RNA migrated faster than that translated from the normal RNA. Both the normal and abnormal a-polypeptides were produced when the RNA was derived from the cells of the father, an obligate heterozygote. Thus, the apparent size difference does not result from post-translational changes but is encoded in the mutant mRNA.

The amino terminus of the radiolabeled a-subunit synthc- sized by WG1051 fibroblasts was found by Edman degradation to be Leu-23 (data not shown); this is identical to the terminus of the normal a-subunit after removal of the signal peptide (18). However, a stretch of amino acids was found missing from the carboxyl terminus, as shown by failure of the anti- bodies raised against the last 15 amino acids to immunopre- cipitate the abnormal a-subunit (Fig. 2).

The WG1051 Mutation Is a Deletion of Cyt~sine'~'~-The difference in molecular mass between the normal and WG1051 a-subunits was estimated from the difference in electrophoretic migration to be 2-3 kDa, corresponding to 20- 30 amino acids. To amplify the region at the 3' end of the

0 w m , *

FIG. 1. Electrophoretic mobility of a-subunits synthesized in cell-free translation. Translation was performed in the presence of RNA from normal fibroblasts (IMRgO), from fibroblasts of the patient (1051) and of the patient's father (1054). Normal a-subunit translated in the presence of SP6 mRNA (18) is shown for compari- son. The STD lane shows bovine serum albumin and ovalbumin as molecular weight markers.

21378 Premature Termination of a-Subunit of @-Hexosaminidase

Anti-a - + - - - - - - + - Anti-COOH - - + + + + + + - -

FIG. 2. Immunoprecipitation of a-subunits with antibodies against the carboxyl terminus. a-Subunit was biosynthetically radiolabeled with ['Hlleucine in the patient's (1051) and in normal (IMR90) fibroblasts, and isolated by immunoprecipitation, polyacryl- amide gel electrophoresis, and electroelution. The isolated a-subunit was then subjected to electrophoresis either directly (outer lanes), or after reprecipitation with antibodies against the monomeric a-subunit (Anti-a) or the terminal 15 amino acids (Anti-COOH). The anticar- boxyl antibodies were used in increasing amounts from left to right: 8,14, and 24 pg. The STD lanes show bovine serum albumin.

A IMRSO 1051 B Z 3 A T G C A T G C 0 B 0 0 Probe

~~

1 normal

0 .* 0 e * 1 AC'5'0

- - 5 1 1 3 I 14 < - d

FIG. 3. Analysis of the WG1051 mutation in mRNA and genomic DNA. Panel A, sequence analysis of cDNA fragments derived from normal (IMR90) and patient (1051) fibroblasts; these were obtained by reverse transcription of RNA followed by PCR amplification, as shown schematically at the bottom of the figure. The arrows point to cytosine at positions 1509 and 1510 in the normal cDNA, and at position 1509 in the patient's DNA. Panel B, dot blot analysis of PCR amplified fragments of DNA derived from normal fibroblasts (IMRgO), from fibroblasts of the patient (1051) or of the patient's mother (1053) and father (1054), shown in duplicate. The

tide 1501-1520 sequence (5'-TCACACTTCCGCTGTGAGT) or the oligonucleotide probes used for hybridization had the normal nucleo-

sequence with the deleted cytosine1510 (5"TCACACTTCGCTGT- GAGTTTG), as indicated.

mRNA where the mutation was expected to lie, oligonucleo- tides hybridizing to nucleotides 1464-1483 (sense) and 1662- 1641 (antisense) of the known sequence (28) were used to prime reverse transcription and PCR amplification. Direct sequencing of the PCR product showed a deletion of the cytosine at position 1510 (Fig. 3A). This residue is located within exon 13 (29). A similar amplification of the correspond- ing region of genomic DNA was carried out with primers corresponding to nucleotides 1464-1483 and to a region in intron 13; sequencing of the PCR product showed a cytosine deletion at the same position (not shown). Finally, amplified genomic DNA fragments were hybridized to allele-specific oligonucleotide probes; Fig. 3B shows that the DNA from fibroblast strains WG1053 and WG1054, derived from the patient's parents, hybridized to both normal and mutant (cytosine deleted) probes, and that the DNA of WG1051 hybridized to the mutant probe only. The patient is therefore a proven homozygote for the deletion of cytosine'51o.

The deletion causes a frame shift that results in the substi- tution of the sequence Arg-Cys-Glu-Leu (504-507) by Ala-

Val-Ser-Cys, followed by termination:

Normal = SerHisPheArgCysGluLeuLeuArgArgGlyValGlnAlaGln-

TCACACWCCGCTGTGAGTTGCTGAGGCGAGGTGTCCAGGCCCAA-

WG1051 = SerHisPhe AlaValSerCys...

Normal = ProLeuAsnValGlyPheCysGluGlnGluPheGluGlnThr***

C C C C T C A A T G T A G G C T T C T G T G A G C A G G A G A C A

As a result of the premature termination, the WG1051 a- subunit is truncated by 22 amino acids.

Expression of cDNA with the Cytosine'51o Deletion Repro- duces the WG1051 Phenotype in Cos-1 Cells-To verify that the deletion could account for the altered fate in addition to the smaller size of the WG1051 a-subunit, the normal a- subunit cDNA was mutagenized in vitro to contain the

deletion, and the cDNAs, pSVLa and pSVLaAC, respectively, were expressed in Cos-1 cells. As can be seen in Fig. 4, the resulting normal and truncated a-subunits were synthesized in a 2-h pulse in similar amount (lanes 2 and 3)

lntraccllulor Secreted - Pulse Chose Chose

M t 2 3 4 5 6 7 0 9

am -

FIG. 4. Expression in Cos-1 cells of cDNAs encoding the normal sequence and the cyt~s ine '"~ deletion. Cos-1 cultures in 100-mm Petri dishes were either mock-transfected (M), or trans- fected with the parent plasmid (pSVL, lanes 1 , 4 , and 7), the plasmid encoding the normal a-subunit sequence (pSVLa, lanes 2,5, and 8) or the plasmid encoding the deletion (pSVLAC, lanes 3, 6, and 9). Cells were exposed to ["S]methionine for a 2-h pulse, followed by a 12-h chase. Intracellular a-subunit, corresponding to Y3 plate, was analyzed at the end of the pulse or chase, as indicated; secreted a- subunit, representing the entire plate, was examined at the end of the chase. ap = normal precursor a-subunit; a',, = truncated precursor a-subunit; a,,, = normal mature a-subunit.

TABLE I Quantitative determination of human a-subunit synthesized in

transfected Cos-I cells Radioactive bands corresponding to the a-subunit were excised

from polyacrylamide gels, solubilized, and the radioactivity deter- mined by scintillation spectrometry. To correct for efficiency of transfection, radioactivity in the a-subunit was normalized to the amount of growth hormone secreted in the same plate; radioactivity in the endogenous a-subunit, obtained from the lane corresponding to the parent plasmid-transfected plate, was then subtracted from this normalized value. Experiment l a is the one shown in Fig. 4. ap = precursor; a,,, = mature; ND = not determined.

Radioactivity in a-subunit

NH:

l a pSVLa

l b pSVLa

2a pSVLa

2b pSVLa

pSVLaAC

pSVLaAC

pSVLaSer5"

~ S v L a S e r ~ "

Pulse Chase

(cell) a P

12,200 11,200

ND ND 5,300 3,300 ND ND

(cell) (cell) (medium) a, an) a P

cpm, corrected 3,400 4,500 6,400

940 0 0 9,700 2,500 11,700 1,300 0 0 1,300 1,900 2,400 1,500 0 860 3,900 1,500 4,400 2.400 0 930

Premature Termination of a-Subunit of @-Hexosaminidase 21379

and in great excess over the endogenous a-subunit made in mock-transfected or parent plasmid-transfected cells (lanes M and 1 ) . However, the normal and truncated wsubunits had different fates during a subsequent 12-h chase: the former was either processed to the mature form or secreted (lanes 5 and 8), whereas the latter disappeared almost entirely, indicating that it had been degraded (lanes 6 and 9). These results are expressed quanti~tively in Table I (Experiment la). The degradation of the truncated a-subunit was not prevented by the presence of 10 mM NH: in the medium during the pulse and chase (Experiment lb).

As loss of the last cysteine residue (C~S"~) and disruption of a disulfide bond seemed a possible cause for the altered fate of the truncated a-subunit, we also expressed in Cos-1 cells a cDNA with the cysteine codon, TGT, replaced by a serine codon, TCT (pSVLaSer"'). However, the resulting Ser5Z2 a-subunit was found to differ from both its normal and truncated counterparts. As shown in Table I (Experiments 2, a and b), it was relatively stable over the 12-h period of chase and it could be secreted, although not nearly as well as the normal a-subunit, but it was not processed to the mature form. It did not dimerize to give active S isoenzyme (not shown). Thus, the absence of the last cysteine residue gives rise to an a-subunit which is abnormal but which does not display the lack of secretion and instability that characterize the truncated a-subunit.

DISCUSSION

Deletion of one nucleotide, cytosine'510, was found in homo- zygous form in WG1051, a fibroblast strain derived from a patient with Tay-Sachs disease. The patient's family came from a small town in Italy, and her parents were related to each other on both the maternal and the paternal side. Al- though there is no information on the frequency of the mutant allele in the general population of Italy or North America, we presume that it is very rare.

As the a-subunit synthesized by WG1051 fibroblasts was smaller than normal, our strategy was to localize the protein abnormality and then to focus on the corresponding region of the nucleic acids. To ascertain that the mutation discovered in this manner would account not only for the truncation but also for the other abnormal properties of the WG1051 CY- subunit, the cytosine deletion was introduced into the a- subunit cDNA and the construct, pSVLaAC, was expressed in Cos-1 cells. The truncated a-subunit made by the trans- fected cells showed the functional abnormalities of the WG1051 a-subunit: it was neither processed to the mature form nor secreted, but was rapidly degraded. Thus, even though additional mutations in the WG1051 a-subunit gene cannot be excluded, the deletion of cytosine1510 is sufficient to account for the observed abnormalities of the protein, and by implication, for the absence of @-hexosaminidase A activity and for the resulting disease.

In the course of biosynthetic labeling experiments, we noted that transfected Cos-1 cells secreted about half of the normal a-subunit made from pSVLa, a much greater fraction than is secreted by nontransfected Cos-1 cells or by human fibro- blasts. Perhaps overexpression of the a-subunit in transfected cells is so great that the mannose 6-phosphate receptor or some other component(s) of the transport machinery become limiting and newly synthesized lysosomal proteins are di- verted to the default (secretory) pathway. We also noted that incubation of Cos-1 cells in the presence of NH: did not increase the fraction secreted, as would occur in human fibro- blasts, but nearly doubled the synthesis of the a-subunit (or

increased its stability during the 2-h pulse). The reason for this response of Cos-1 cells to NH: is not known. However, the differences between transfected Cos-1 cells and human fibroblasts in the metabolism of the normal a-subunit do not affect the findings and conclusions with respect to the trun- cated a-subunit made from pSVLaAC. The results also con- firm the value of the Cos-1 expression system for studying the cellular consequences of mutations of @-hexosaminidase subunits (30).

The absence of secretion and of maturation indicates that the truncated a-subunit made in transfected Cos-1 cells was not transported through biosynthetic organelles but was re- tained in an early compartment (13). This had been previously suggested for the truncated a-subunit made in WG1051 fibro- blasts. The biosynthetic compartment in which the truncated a-subunit is retained is likely to be the ER,2 and its NH:- insensitive degradation would likewise occur in or near that compartment, as has been proposed for aberrant proteins in general (32). Other mutations of 0-hexosaminidase subunits that result in retention in an early compartment are replace- ment of glutamic acid at position 482 by lysine (33) that gives rise to an insoluble a-subunit (34) and insertion of an intronic sequence that gives rise to a @-subunit elongated near the carboxyl terminus (35, 36).

Retention of many other mutant proteins in the ER has been observed, including membrane and secretory proteins (37). For example, some mutant forms of the low density lipoprotein receptor (38, 39) and of the influenza virus he- magglutinin (40) are retained in the ER instead of moving to the cell surface, as is a truncated al-antitrypsin, normally a secretory protein, that is caused by frame-shift and premature termination (41). The 2 variant of al-antitrypsin, which differs from the normal by substitution of lysine for glutamic acid at position 342, precipitates within the ER in aggregates easily seen by light microscopy (42).

The reason for the retention of the WG1051 or the p S V L d C a-subunit in the ER is not known. The truncated polypeptide does not have the carboxy-terminal Lys-Asp-Glu- Leu (KDEL) retention signal that is carried by resident ER proteins (43), and it does not appear to be insoluble. It is unlikely that the absence of the terminal 22 amino acids results in the loss of some specific linear signal for transport to the Golgi cisternae, as no such signal seems required (44). We examined the role of cysteine522 because of the possibility that its loss might disrupt a disulfide bond and leave a SH group free to react with a putative "gatekeeper" protein (38, 39); however, we found that replacement of cysteine"' by serine did not prevent (although it reduced) the secretion of the resulting protein. In spite of this negative result, the involvement of a sulfhydryl residue in ER retention of the truncated a-subunit cannot be ruled out, since the frameshift also moves a cysteine residue from position 505 to the terminal position, 507.

Examination of the sequence by visual inspection or by hydrophobicity plot (45) shows that the carboxyl terminus of the truncated a-subunit is hydrophobic, whereas that of the normal a-subunit is strongly hydrophilic. Retention of the

We will refer to the compartment in which the truncated (Y-

subunit is retained as ER, even though this has not yet been deter- mined in rigorous fashion. A commonly used criterion for discrimi- nating between ER and Golgi is sensitivity or resistance to endo-hi- acetylglucosaminidase H. This criterion is not useful for localizing 0- hexosaminidase subunits, which normally remain sensitive even after they have been secreted (16). In one instance, when electron micros- copy was used to localize a chimeric protein, the retaining compart-

the Golgi (31). ment was identified as a structure lying between the rough ER and

21380 Premature Termination of a-Subunit of ~ - ~ e ~ o s a m i n ~ ~ e

mutant a-subunit in the ER may therefore depend on uncov- 19- ering this hydrophobic region that would cause i t to adhere 20. nonspecifically to other ER proteins. There may be additional conformational changes and misfolding, as have been invoked 21, to explain the failure of other abnormal proteins to exit from t h e ER (40). It is apparent that understanding the behavior of mutant subunits, whether discovered in patients or engi- 22. neered in the laboratory, would be greatly facilitated by struc- tural studies of normal ~-hexosaminidase. 23.

Acknowledgments-We thank Dr. Audree Fowler and Janice Blei- 24. baum (UCLA Protein Microsequencing Facility) for performing the Edman degradation, Dr. Dohn Glitz (UCLA) for synthesis of oligo- 25. nucleotides, Dr. Catherine Joyce (Yale University) for providing the E. coli strain CJ236. and Larry Tabata for illustrations.

1.

2. 3.

4.

5.

6.

7.

8.

9. 10.

11. 12.

13.

REFERENCES Sandhoff, K., Conzelmann, E., Neufeld, E. F., Kaback, M. M.,

and Suzuki, K. (1989) in The M e t a ~ l ~ c Basis of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W . S., and Valle, D., eds) pp. 1807-1842, McGraw-Hill, Inc., New York

Neufeld, E. F. (1989) J . Biol Chem. 264 , 10927-10930 Myerowitz, R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 3955-

3959 Arpaia, E., Dumbrille-Ross, A., Maler, T., Neote, K., Tropak, M.,

Troxel, C., Stirling, J . L., Pitts, J. S., Bapat, B., Lamhonwah, A. M., Mahuran, D. J., Schuster, S. M., Clarker, J. T. R., Lowden, J. A., and Gravel, R. A. (1988) Nature 3 3 3 , 8 5 4 6

Ohno. K., and Suzuki, K. (1988) Biochem. Biophys. Res. Commun. 153,463-469

Mverowitz. R.. and Costipan, F. C. (1988) J. Biol. Chem. 263 , I .

18587-18589 Myerowitz, R., and Hogikyan, N. D. (1986) Science 2 3 2 , 1646-

1648 Myerowitz, R., and Hogikyan, N. D. (1987) J . Biol. Chem. 2 6 2 ,

Ohno, K., and Suzuki, K. (1988) J. Neurochem. 50,316-318 Nakano, T., Muscillo, M., Ohno, K., Hoffman, A. J., and Suzuki,

Navon, R., and Proia, R. L. (1989) Science 243,1471-1474 Paw, B. H., Kaback, M. M., and Neufeld, E. F. (1989) Proc. Natl.

Zokaeem, G.. Bayleran, J., Kaplan, P., Hechtman, P., and Neu-

15396-15399

K. (1988) J. Neurochem. 51, 984-987

Acad. Sci. U. S. A. 8 6 , 2413-2417

26.

27.

28.

29. 30.

31.

32.

33.

34.

35.

36.

37. 38.

39.

40. feld, E.’F. (1987) Am. J. Hum. Genet. 40, 537-547

14. von Figura, K., and Hasilik, A. (1986) Annu. Reu. Biochem. 55 , 41.

15. Lau, M. M., and Neufeld, E. F. (1988) J. Cell Biol. 107 , 342A 42. 16. Hasilik, A., and Neufeld, E. F. (1980) J. Biol. Chem. 255 , 4937-

17. Proia, R. L., d’Azzo, A., and Neufeld, E. F. (1984) J. Biol. Chem. 43.

18. Little, L. E., Lau, M. M. H., Quon, D. V. K., Fowler, A. V., and

167-193

4945

259,3350-3354 44.

Neufeld, E. F. (1988) J. Biol. Chem. 263,4288-4292 45.

Bayleran, J., Hechtman, P., and Saray, W . (1984) Clin. Chim.

Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, Acta 143, 73-89

W. J. (1979) Biochemistry 18,5294-5299 Saiki, R. K., Gelfand, D. I%., Stoffel, S., Scharf, S. J., Higuchi,

R., Horn, G. T., Mullis, K. B., and Ehrlich, H. A. (1988) Science

Davis, L. G., Dibner, M. D., Battey, J. F. (1986) Basic Methods in Molecular Biology, pp. 44-46, Elsevier Scientific Publishing Co., New York

Sanger, F., Nicklen, S., and Coulson, R. (1977) Proc. Natl. Aead. Sci. U. S. A. 74,5463-5467

Wood, W . I., Gitschier, J., Lasky, L. A., and Lawn, R. M. (1985) Proc. Natl. Acad. Sci. U. S. A. 8 2 , 1585-1588

Farr, C. J., Saiki, R. K., Ehrlich, H. A., McCormick, F., and Marshall, C. J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,1629- 1633

Kunkel, T. A., Roberts, J. D., and Zakour, R. A. (1987) Methods Enzymol. 154,367-382

Oshima, A,, Nolan, C. M., Kyle, J. W., Grubb, J. H., and Sly, W. S. (1988) J. Biol. Chem. 263,2553-2562

Myerowitz, R., Piekarz, R., Neufeld, E. F., Shows, T. B., and Suzuki, K. (1985) Proc. Natl. Acad. Sci. U. S. A. 82,7830-7834

Proia, R. L. (1988) Proc. Natl. Acad. Sci. U. S. A. 8 5 , 1883-1887 Sonderfeld-Fresko, S., and Proia, R. L. (1989) J. Biol. Chem.

Rizzolo, L. J., Finidori, J., Gonzalez, A,, Arpin, M., Ivanov, I. E., Adesnik, M., and Sabatini, D. D. (1985) J. Cell Biol. 101,1351- 1362

Lippincott-Schwartz, J., Bonifacino, J. S., Yuan, L., and Klaus- ner, R. D. (1988) Cell 54,209-220

Nakano, T., Muscillo, M., Ohno, K., Hoffman, A. J., and Suzuki, K. (1988) J. Neurochem. 51,984-987

Proia, R. L., and Neufeld, E. F. (1982) Proc. Natl. Acad. Sei. U.

Dlott, B., Quon, D., D’Azzo, A,, and Neufeld, E. F. (1988) Am. J .

Nakano, T., and Suzuki, K. (1989) J. Biol. Chem. 2 6 4 , 5155-

Lodish, H. F. (1988) J. Biol. Chem. 263,2107-2110 Yamamoto, T., Bishop, R. W., Brown, M. S., Goldstein, J. L.,

and Russell, D. W . (1986) Science 232,1230-1237 Lehrman, M. A., Schneider, W . J., Brown, M. S., Davis, C. G.,

Elhammer, A., Russell, D. W., and Goldstein, J. L. (1987) J. Biol. Chem. 262,401-410

Gething, M. J., McCammon, K., and Sambrook, J. (1986) Cell

Sifers, R. N., Brashears-Macatee, S., Kidd, V. J., Muensch, H., and Woo, S. L. C. (1988) J. Biol. Chem. 263,7330-7335

Cox, D. W . (1989) in The Metabolic Basis of Inherited Disease (Scriver, C. R., Beaudet, A. L., Sly, W. S., and Valle, D., eds) pp. 2409-2437, McGraw-Hill, New York

239,487-491

264,7692-7697

S. A. 79,6360-6364

Hum. Genet. 4 3 , A5

5158

46,939-950

Munro, S., and Pelham, H. R. B. (1987) Cell 48,899-907 Pfeffer. S. R.. and Rothman, J. E. (1987) Annu. Reu. Biochem. .. . ~ ~ ~ ~

56,829-852 Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157 , 105-132