The Potential Neuroprotective Role

of Chemokine Receptor GPR75

byChristopher Parker

christopher.parker09@imperial.ac.uk

Leukocyte Biology Section, Faculty of Medicine,

Sir Alexander Fleming Building, Imperial College London,

London, SW7 2AZ

Thesis for Masters of Research in Biomedical Research

August 2010

Supervisor: Dr James Pease

Words 4,988

Abstract

Chemokine receptors typically elicit chemotaxis of leukocytes, mediating

homeostatic and pro-inflammatory migration. Abnormal chemokine function is

found in several inflammatory disorders, including multiple sclerosis and other

neurological disorders with inflammatory pathology, such as Alzheimer’s

disease. Our understanding of the role of the chemokine system in these

disorders is incomplete and recent evidence obtained by in vitro studies

suggest that chemokines may also have a neuroprotective role. G protein-

coupled receptor 75 (GPR75) is a deorphanised receptor for the chemokine

RANTES/CCL5. GPR75 activation by CCL5 was reported to protect the

mouse hippocampal cell line HT22 from amyloid-β induced toxicity. It is

hypothesised that GPR75 provides endogenous protection from oxidative

stress in the brain. An established in vitro model of oxidative stress was used

to test this hypothesis in HT22 cells. Cells were pre-treated with varying

concentrations of CCL5 before addition of glutamate and cell viability

recorded. Increasing concentrations of CCL5 had no significant effect on

mean cell viability. GPR75 was then investigated using transient transfection.

GPR75 was poorly expressed on the cell surface of the murine pre-B

lymphoma cell line L1.2, precluding further study. Characterisation of

endogenous cell types expressing GPR75 is warranted to form further

functional hypotheses.

Abbreviations

AD Alzheimer's disease

AIDS Acquired Immune Deficiency Syndrome

bp (s) Base Pair(s)

ddH2O Double distilled H2O

DMEM Dulbeccos' Modified Eagle Medium

FBS Fetal Bovine Serum

FC Flow Cytometry

FITC Fluorescein Isothiocyanate

GPCR G protein-coupled receptor

GPR75 G protein-coupled receptor 75

HA Haemagglutinin

hGPR75 Human GPR75

HIV Human Immunodeficiency Virus

IC50 Half Maximal inhibitory Concentration

IP3 Inositol Triphosphate

kb Kilobase

LB Luria Broth

MAb Monoclonal Antibody

MAPK Mitogen activated protein kinase

MEM Minimal Essential Media

mGPR75 Murine GPR75

mCCL5 Murine CCL5

MIP-1α Macrophage Inflammatory Protein-1-α

MS Multiple Sclerosis

PBS Phosphate Buffered Saline

PCR Polymerase Chain Reaction

PD Parkinson’s disease

PKC Protein kinase C

PLC Phospholipase C

RANTES Regulated upon Activation, Normally T-cell Expressed and

presumably Secreted

ROS Reactive Oxygen Species

RPMI Roswell Park Memorial Institute

RT Reverse Transcription

SE Standard Error

Introduction

G protein-coupled receptor 75 (GPR75) reportedly belongs to the chemokine

receptor family of G protein-coupled receptors (GPCRs) [1]. GPCR’s are

seven-transmembrane proteins involved in signal transduction of extracellular

stimuli to intracellular environments. Chemokine receptors are activated by

binding of chemotactic cytokines, or chemokines; a superfamily of protein

ligands which are highly conserved, plurifunctional and involved in the

modulation of cellular activities such as chemotaxis, phagocytosis, cell

activation, proliferation and apoptosis [2]. Chemokines are divided into two

main sub-families: CXC and CC; based on the number and spacing of N-

terminal cysteine residues. Receptors are divided into two main sub-families:

CXCR and CCR; based on the family of chemokine to which they bind. In

chemokine annotation, the letter ‘X’ denotes the relative position of an amino

acid interspersed with conserved N-terminal cysteine residues. A single

chemokine may bind many chemokine receptors, whilst a single receptor may

have multiple chemokine ligands, which is often termed promiscuity. The

cellular immune response to circulating chemokines is determined by the

complement of chemokine receptors present on their cell surface.

The primary function of chemokines is to guide the migration of circulating

leukocytes [2]. Chemokines elicit migration through a process called

chemotaxis, whereby chemokine-chemokine receptor interaction promotes

cell movement along an increasing chemokine concentration gradient [2].

Migration can be considered homeostatic, i.e. cell movement during normal

tissue maintenance or development, or pro-inflammatory, i.e. chemotaxis of

effector cells from the blood to sites of infection.

Our understanding of the role of the chemokine system in normal

physiological and pathophysiological conditions is incomplete. In addition to

the already established role in HIV-infection and AIDS [4], increasing

evidence suggests that the chemokine system may play an important role in

neuroinflammatory diseases such as multiple sclerosis (MS) and neurological

diseases with an inflammatory component such as Alzheimer’s disease and

cerebral ischemia [3].

In the human central nervous system, chemokine receptors such as CCR3,

CCR5, CX3CR1, CXCR2, CXCR3 and CXCR4 are constitutively expressed

by microglia, astrocytes, oligodendrocytes and neurons [3]. Under normal

physiological conditions, studies show that these chemokine receptors can

function in neuronal migration during brain development [5], cell proliferation

and trophic support [6] and in modulation of neurotransmission [7].

MS is an inflammatory disease of the central nervous system, characterised

by myelin sheath destruction, axonal pathology and progressive neurological

dysfunction [8]. Evidence suggests that several chemokine receptors, such as

CCR3 and CCR5, can promote the pathological response, by attracting

leuckocytes to sites of inflammation [9-11]. Interestingly, in the experimental

autoimmune encephalitis (EAE) mouse model of the disease, CCR1 knockout

mice develop a far less severe form of the disease [12] and administration of

anti- Macrophage Inflammatory Protein-1-α (MIP-1α)/CCL3 antibody has been

shown to reduce disease severity [13].

Alzheimer’s disease (AD) is a neurodegenerative disorder that causes

progressive memory impairment and dementia [14]. The AD brain is

characterised by extracellular plaques composed of the neurotoxic amyloid-β

protein [14]. These extracellular plaques are commonly enclosed by activated

microglia and astrocytes, forming the neuritic plaque [15]. The disease results

in neuronal loss and inflammation is a key component of the disease [43].

There is evidence that the chemokine system may contribute to inflammatory

pathology in AD. Receptors such as CCR3, CCR5, CXCR2 and CXCR3 are

expressed in areas of the AD brain including the hippocampus [3] - the

primary site of degeneration in AD [16]. CCR3 and CCR5 are detected on

astrocytes, microglia and endothelial cells and expression is increased in the

AD brain compared to controls [17]. Amyloid-β and oxidative stress, which are

present at the lesion site, can promote the release of chemokines such as

CCL3 and RANTES (Regulated upon Activation, Normally T-cell Expressed

and presumably Secreted)/CCL5 from surrounding tissue [18, 19].

Accordingly, CCL5 expression is upregulated in the cerebral microcirculation

of the AD brain [20]. The brains high metabolic rate and reduced ability for

cellular regeneration makes it particularly susceptible to insults accompanying

chronic inflammation such as oxidative damage.

Recent evidence suggests that CCL5 and other inflammatory proteins could

have a neuroprotective role [21, 22]. Treatment of primary cortical neuronal

cultures with CCL5 enhances survival. Also, exposure of neuronal cultures to

CCL5 prior to treatment with neurotoxic agents causes a significant reduction

in neuronal cell death [20]. These reports provide promise that therapies

aiming to exploit the neuroprotective mechanisms of the chemokine system

could counter the detrimental inflammatory processes caused by its

upregulation.

Recently, a novel CC chemokine receptor G protein-coupled receptor 75

(GPR75) has been identified with a potential role in neuroprotection [1].

GPR75 is a deorphanised receptor for chemokines CCL5 and CCL3. GPR75

is located on chromosome 2p16, is transcribed from a single exon and

produces a 540 amino acid protein [23]. Several characteristics distinguish

GPR75 as an atypical chemokine receptor. (1) GPR75 shares 12-16%

homology with chemokine receptors of the same class, compared to 50% in

the majority of chemokine receptors [24]. (2) Signalling is coupled to the

intracellular Gαq protein [1, 24], compared to Gαi in other chemokine

receptors [25]. (3) GPR75 is not expressed in typical chemokine receptor

locations such as leukocytes and spleen, instead expression is almost

exclusively in the central nervous system [1, 23, 26]. In attempting to identify

endogenous ligands for the receptor using GPR75 transfectants, Ignatov et

al. (2006) found that CCL5 and CCL3 activated intracellular signalling

pathways that resulted in activation of inositol triphosphate (IP3),

phospholipase C (PLC), p44/p42 mitogen-activated protein kinase (MAPK)

and Akt, ultimately triggering a rise in intracellular calcium. Importantly, the

same study reported that activation of murine GPR75 (mGPR75) is protective

against amyloid-β induced cell death in the mouse hippocampal cell line

HT22, which express mGPR75 endogenously. This report provides evidence

for a neuroprotective role for GPR75 in vivo and perhaps the chemokine

system in cases of neurological stress.

Despite these recent findings, little is known regarding the mechanism of

neuroprotection or the cell types in which GPR75 is found. It is hypothesised

that GPR75 provides endogenous defence from neuronal oxidative stress.

This study tests this hypothesis using an established in vitro model for brain

oxidative stress and attempts to investigate the typical chemokine receptor

characteristics of GPR75 in vitro.

Materials and Methods

Materials

Glutamate, oligonucleotide primers, mouse genomic DNA and TOPO

plasmids were obtained from Invitrogen (Paisley, UK). Glutamate was

dissolved in simple DMEM to a concentration of 250mM. Oligonucleotide

primers for murine CCR1, CCR3, CCR5 and GPR75 were re-suspended in

ddH20 to a concentration of 100µM and 20µM aliquots made for polymerase

chain reaction (PCR).

Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS),

simple RPMI, phosphate buffered saline (PBS), IgG1 MAb and fluorescein

isothiocyanate–conjugated (FITC)-conjugated goat anti-mouse F(abI)2

antibodies were obtained from Sigma-Aldrich Company Limited (Dorset,

England). HT22 cells, a gift from Dr Peter Clark, were suspended in PBS and

stored in liquid nitrogen until use in this study. Simple RPMI was

supplemented with 10% FBS, 100 units/ml penicillin, 0.1 mg/ml streptomycin,

1mM sodium pyruvate, 50ml MEM and 50µM mercaptoethanol (all from

Sigma-Aldrich Company Ltd.) to make complete RPMI. DMEM was

supplemented with 10% FBS and 100 units/ml penicillin plus 0.1mg/ml

streptomycin (all from Sigma Aldrich Company Ltd.) to make complete

DMEM.

Taq polymerase, Pfu polymerase, Taq buffer (NH4SO4), Pfu buffer (with

MgSO4), deoxyribonucleotide trisphosphate (dNTP) bases (10mM) and MgCl2

(25mM) were obtained from Fermentas (York, UK). The IMAGE plasmid

pT7T3D-Pac, containing human GPR75 (hGPR75) cDNA, was a gift from Dr

Gregory Evans and was re-suspended in ddH20. Murine CCL5 (mCCL5) was

obtained from Peprotech EC Ltd. (London, UK) and suspended in ddH20 to a

concentration of 10μM. Anti-HA MAb was obtained from Covance (Crawley,

UK). Cell Titer Glo was obtained from Promega (Southampton, UK). All other

reagents were purchased from Sigma Aldrich Company Ltd. unless otherwise

stated.

Cell Culture

The immortal mouse hippocampal cell line HT22 were gently thawed and

transferred to a 75ml cell culture flask (Corning Incorporated, USA) containing

13 ml complete DMEM. Cells were maintained at or below 4 x 105 cells/ml

and were passaged by trypsinising.

The murine pre-B lymphoma cell line L 1.2 were cultured in complete RPMI

and maintained at a concentration of 5 x 105 cells/ml. HT22 and L1.2 cells

were kept at 37oC in a humidified 5% CO2 incubator. A haemocytometer was

used for cell counting.

Reverse Transcription Polymerase Chain Reaction (RT-PCR)

Murine CCR1, CCR3, CCR5 and GPR75 are known receptors for mCCL5.

Primers for these receptor sequences were obtained to determine mCCL5

receptor expression in HT22 cells (Table 1). Amplification was first

demonstrated on mouse genomic DNA, using Taq-based PCR and following

concentrations of PCR ingredients recommended by Fermentas. DNA was

amplified in a Peltier PTC-200 thermocycling machine (GMI, USA) by

denaturing at 94oC for 3 mins, followed by 39 cycles of: 94oC for 1 min, 55oC

for 30 s and 72oC for 1 min 30 s; followed by a final extending stage at 72oC

for 10 mins.

RNA was extracted from HT22 cells following the standard protocol of the

RNeasy Mini Kit from Qiagen (Crawley, UK). Prior to RT, DNA was digested

using the RNAse-Free Dnase I solution (Qiagen), to prevent contamination.

cDNA was obtained by RT of HT22 RNA following procedures in the

Superscript First-strand Synthesis System for RT-PCR (Invitrogen). Receptor

expression in HT22 cells was determined by PCR amplification of HT22 cDNA

using primers for murine CCR1, CCR3, CCR5 and GPR75, following identical

thermocycling parameters used for mouse genomic DNA amplification. As a

negative control RT-PCR was performed using HT22 RNA without the RT

enzyme. DNA was analysed using 1% agarose gel electrophoresis and

visualised under UV light.

Cytotoxicity Assays

All steps apart from luminescence measurement were performed in sterile

conditions. HT22 cells were re-suspended in complete DMEM to a

concentration of 3 x 104 cells/ml and 100μl seeded in wells of a 96-well plate.

Cells were left to adhere at 37oC in 5% CO2 for 24 hrs. Cell media was then

aspirated and 50μl of varying concentrations of glutamate (0, 1, 3, 5, 7, 10, 15

and 30mM) in simple DMEM added. Cells were incubated at 37oC with 5%

CO2 for 24hrs and cell viability measured by ATP-dependent Cell Titer Glo

luminescence using the TopCount NXT Microplate Scintillation and

Luminescence Counter machine from Packard (Connecticut, USA). Here, 50μl

Cell Titer Glo was added to each well before shaking at 70 rpm for 10 mins.

Next, 70μl of each well was transferred to a white opaque 96-well plate

(Perkin Elmer, Buckinghamshire) for luminescence counting.

The half-maximal inhibitory concentration (IC50) of glutamate was 5.9mM. A

6mM final concentration of glutamate was used in subsequent experiments to

examine the effect of mGPR75 activation on glutamate-induced toxicity. After

cell seeding, media was aspirated and 40μl of varying concentrations of

mCCL5 was added 1hr prior to addition of 10μl 30mM glutamate. Cells were

then incubated at 37oC with 5% CO2 for 24 hrs before luminescence counting,

as described above. Cell viability is expressed as a percentage of untreated

control luminescence. For each independent experiment, mean luminescence

values were obtained for 3 repeat measurements under each condition.

Amplification and cloning of human GPR75

For the purpose of hGPR75 expression analysis in transfected L1.2 cells, a

sequence encoding the influenza hemagglutinin (HA) epitope tag was coupled

to the full-length coding sequence of hGPR75 by PCR. The HA tag was in

frame with the N-terminus of the receptor, allowing detection of hGPR75 cell

surface expression through secondary antibody staining [27]. hGPR75 primer

pairs were designed and obtained from Invitrogen (Table 1). The forward

primer was designed to encode the Kozak sequence ‘CACC’, necessary for

ligation of HA-GPR75 into the TOPO entry vector and subsequent translation

initiation in mammalian cells [44]. Primers were used to amplify GPR75 from

the IMAGE vector pT7T3D-Pacl using Pfu-polymerase-based PCR. Next, 1μl

of the HA-GPR75 PCR product was cloned into the KanamycinR-containing

TOPO entry vector pENTR/SD/D-TOPO, following the pENTR Directional

TOPO Cloning Kit (Invitrogen) protocol, allowing entry into the Invitrogen

TOPO Gateway Cloning System (http://www.invitrogen.com).

Supercompetent OneShot E.Coli (Invitrogen) were transformed with the

reaction mixture and grown in kanamycin to amplify HA-GPR75-

pENTR/SD/D-TOPO DNA. Plasmid DNA was obtained by following

procedures in the FastPlasmid Miniprep Digestion Kit (5Prime, UK) and was

verified to contain recombinant plasmid by PCR, using the above HA-GPR75

specific primers. Plasmid DNA (~150ng) from a successful colony was cloned

into the AmpicillinR-containing TOPO destination vector pcDNA3.2/V5-DEST,

following the LR Reaction Kit (Invitrogen) protocol. The LR reaction mixture (1

μl) was then used to transform Supercompetent OneShot E.coli, which were

grown in ampiciillin and used to amplify HA-GPR75-pcDNA3.2/V5-DEST

DNA. Plasmid DNA was isolated using the FastPlasmid Miniprep Digestion Kit

and was verified to contain HA-GPR75 DNA by PCR, using the above HA-

GPR75-specific primers. The most successful recombinant cell culture, as

judged by DNA band intensity on an agarose gel (1%), was expanded by

growing overnight in LB and ampicillin (50µg/ml). The HiSpeed Plasmid

Purification Maxi kit (Qiagen) was used to isolate several hundred μg’s of HA-

GPR75-pcDNA3.2/V5-DEST DNA for transfection into L1.2 cells. Authenticity

of the HA-GPR75-pcDNA3.2/V5-DEST plasmid was verified by sequencing

(MWG Eurofins).

Transient Transfection of L1.2 Cells

All steps were performed in sterile conditions. L1.2 cells were counted and 1 x

107 cells were pelleted by centrifugation (160g, 5 mins) in a sterile 50ml falcon

tube. Cells were re-suspended in 800μl simple RPMI and dispensed into the

bottom of a 1ml sterile electroporation cuvette (BTX Harvard Apparatus,

USA). 10μg of HA-GPR75-pcDNA3.2/V5-DEST DNA and 50μl tRNA (10.5

mg/ml) was added to the cuvette, which was then incubated at 25oC for 20

mins, before electroporation (330V, 975µF) for 20-40ms using the BIO-RAD

Gene Pulser and the BIO-RAD Capacitance Extender Plus (Bio-Rad

Laboratories Inc., UK). The cuvette was then incubated at 25oC for 20 mins.

Cuvette contents were transferred to a 25ml tissue culture flask containing

10ml complete RPMI and incubated at 37oC in a 5% CO2 incubator for 4 hrs,

before addition of sodium butyrate to a final concentration of 10mM, to

promote gene expression. Cells were then incubated at 37oC with 5% CO2

overnight. As negative and positive controls, the identical transformation steps

were performed with empty pcDNA3 and HA-CXCR3-pcDNA3 plasmids

respectively.

Measuring Cell Surface Protein Expression Using Flow Cytometry

Approximately 5 x 105 transfected cells were added to 1ml of flow cytometry

(FC) buffer (0.01% NaN3, 0.1% BSA in HEPES-modified PBS) in FC tubes

and cells pelleted by centrifugation at 210g for 5mins. Supernatant was

discarded and cells were re-suspended in 100µl anti-HA MAb antibody

(diluted 1:100 in FC buffer). To control for non-specific binding of HA antibody,

the identical procedure was concurrently performed with 100µl IgG1 MAb

primary antibody (diluted 1:100 in FC buffer). Tubes were briefly vortexed and

incubated at 4oC for 15 mins. Next, 1ml FC buffer was added to tubes before

centrifugation at 210g for 5 mins, to wash excess antibody staining.

Supernatant was discarded and cells were re-suspended in 100µl FITC-

conjugated goat anti-mouse F(ab')2 secondary antibody (10mg/ml) (Dako,

Denmark). Tubes were briefly vortexed and incubated at 4oC for 15 mins. 1ml

FC buffer was then added and tubes centrifuged at 210g for 5 mins.

Supernatant was discarded and cells re-suspended in 500µl FC buffer. Tubes

were vortexed briefly before analysis using CellQuestPro software on the

Becton Dickinson FACS Caliber flow cytometry machine (BD Biosciences,

USA). Ten thousand events were collected and data from dead cells were

excluded by forward scatter/side scatter gating [28]. Fluorescence of the

FITC-conjugated goat F(ab')2 anti-mouse secondary antibody was detected by

the flow cytometer and used to calculate HA-specific staining, by subtracting

the mean fluorescence (FLH-1) of HA stained cells from the mean

fluorescence of IgG1 stained cells.

Statistical Analysis

Results are presented as the mean of n independent experiments, as

indicated. One-way ANOVA with Bonferonni’s multiple comparisons test was

used when comparing three or more means. Statistics were generated using

Prism (Graph Pad Software, San Diego, CA, USA). P values were considered

significant if p<0.05.

Results

Expression of murine CCR1, CCR3, CCR5 and GPR75 in HT22 cells

PCR using primers for murine CCR1, CCR3, CCR5 and GPR75 amplify

regions of size 546bp, 287bp, 523bp and 620bp respectively. Figure 1.a.

shows that primers were able to amplify all known mCCL5 receptors from

mouse genomic DNA. RT-PCR of HT22 RNA using identical primers showed

that mGPR75 is the only known mCCL5 receptor expressed in these cells

(Figure 1.b.). Therefore, mGPR75 activation in HT22 cells through addition of

mCCL5 has no confounding effects through activation of other chemokine

receptors. Alternate lanes contained the PCR reaction mix either without

mouse genomic DNA or the negative control RT reaction. These controls

reduced the chance of identifying false positive expression.

Glutamate cytotoxicity

Glutamate-induced toxicity in HT22 cells has been used to model neuronal

oxidative stress in vitro [29]. HT22 cells were allowed to adhere to the well of

a 96-well plate for 24 hrs, before incubation with 0-30mM glutamate for 24

hrs. Treatment with 3-30mM glutamate resulted in a step-wise decrease in

cell viability from 81.7% to 1.7% (Figure 2). The logarithmic dose-response to

glutamate formed a downward sloping sigmoidal curve and the IC50 for

glutamate toxicity was calculated as 5.9mM (logIC50 = -2.27±0.07).

Neuroprotection of murine GPR75 from glutamate-induced toxicity

It has previously been shown that mGPR75 activation by prior treatment with

CCL5 can prevent HT22 cell death induced by the neurotoxic amyloid-β [1].

This study next asked whether prior activation of mGPR75 could prevent

glutamate-induced oxidative toxicity in HT22 cells. Cells were pre-treated with

varying concentrations of mCCL5 for 1hr, before incubation with 6mM

glutamate for 24 hrs. Glutamate treatment resulted in a 50% reduction in cell

viability compared to untreated controls (Figure 3). Prior treatment with

mCCL5 did not significantly protect HT22 cells from glutamate-induced toxicity

in a dose-dependent manner. The maximum mean cell viability afforded after

glutamate treatment was 60.8% with 10nM concentrations of mCCL5. Pre-

treatment with 0.3nM mCCL5 provided the least protection from glutamate,

where mean cell viability was 46.8%. Cell viability measurements had a wider

variation with 10nM (n=2) and 30nM (n=2) pre-treatment with mCCL5.

Transient transfection of L1.2 cells with human GPR75

hGPR75 was coupled to a sequence encoding the HA tag by PCR and

subsequently cloned into the TOPO destination vector pcDNA3.2/V5-DEST,

using the TOPO Gateway Cloning System (Figure 4). HA-GPR75-

pcDNA3.2/V5-DEST DNA was transiently transfected into L1.2 cells. Cells

were first stained with anti-HA MAb or the isotype control IgG1 MAb primary

antibodies followed by the FITC-conjugated goat anti-mouse F(ab')2 seconday

antibody. HA-CXCR3-pcDNA3 transfection was used as a positive control for

the transfection protocol and empty pcDNA3 plasmid, which does not express

a receptor protein or HA tag sequence, served as a negative control. Using

flow cytometry, dead cells were excluded and HA-GPR75 cell surface

expression was determined (Figure 5 and 6). Mean fluorescence (FLH-1) for

HA-stained pcDNA3 transfected cells was 22.60 (arbitrary units), whereas

mean fluorescence for IgG1 stained cells was 7.41. The difference between

these values indicates HA-specific staining and is proportional to receptor cell

surface expression. Mean HA-specific staining for pcDNA3 transfections was

15.2, indicating the background level of HA staining. Mean HA-specific

staining for HA-GPR75-pcDNA3.2/V5-DEST transfected cells was 14.8833,

and for HA-CXCR3-pcDNA3 transfected cells was 41.1433. Mean HA-specific

staining of HA-CXCR3-pcDNA3 transfected cells was significantly higher than

pcDNA3 transfected cells (p<0.001) (Figure 6), indicating that the transfection

protocol was optimal and the staining procedure detects receptor cell surface

expression. Mean HA-specific staining of HA-GPR75-pcDNA3/V5-DEST

transfected cells was not significantly different from HA-specific staining of

pcDNA3 transfected cells. Moreover, HA-GPR75-pcDNA3.2/V5-DEST

transfected cells had significantly lower mean HA-specific staining than HA-

CXCR3-pcDNA3 transfected cells (p<0.001). These data indicate that HA-

GPR75 was not significantly expressed on the cell surface of transfected L1.2

cells.

Relatively few cells were acquired from one pcDNA3 transfection (Figure 4,

Exp. 2). However, mean luminescence was comparable to other pcDNA3

experiments, indicating that sufficient cells were obtained for analysis.

Discussion

The chemokine system plays an important role in inflammatory diseases,

including neurodegenerative diseases with contributing inflammatory

pathology such as AD, MS and AIDS-dementia complex [2, 3]. Evidence

exists for both a detrimental and protective role for chemokines in neuronal

survival [10, 12, 20]. Recently, a novel receptor for the chemokine CCL5 has

been identified, named GPR75. GPR75 is expressed predominantly in the

human and mouse central nervous system [1, 23, 26]. Reportedly, activation

of mouse GPR75 by CCL5 prevents neuronal cell death caused by the

amyloid-β protein [1]. Amyloid-β is toxic to neuronal cells via oxidative stress

mechanisms [30] [45]. It is therefore hypothesised that GPR75 has an

endogenous role in protection from oxidative stress in the central nervous

system. Exploiting the protective mechanisms of GPR75 could counter the

otherwise detrimental effects of chemokine upregulation in chronic

inflammation aswell as provide a potential therapeutic target for the treatment

of AD and other neurological diseases involving oxidative stress. This study

used the in vitro glutamate-induced toxicity model of oxidative stress to

investigate the protective effect of mGPR75 in HT22 cells [29]. Also, hGPR75

was transiently transfected into leuckoyte cells for further functional analysis.

This study first demonstrated that while mouse genomic DNA contains genes

for all known mCCL5 receptors: murine CCR1, CC3, CCR5 and GPR75

(Figure 1.a.), only mGPR75 is expressed in HT22 cells (Figure 1.b). These

findings agree with previous studies regarding the expression of mGPR75 in

HT22 cells [1].

It was shown that glutamate was toxic to HT22 cells with an IC50 of 5.9mM

(Figure 2). Similar glutamate concentrations have been extensively used to

study oxidative stress toxicity in HT22 cells, incurring similar losses of cell

viability [29, 31, 32]. Mechanisms of cell death in this model mimic those

observed in vivo in neurological diseases such as Parkinson’s disease and

cerebral ischemia, where brain glutathione is depleted [46], as well as in AD

and MS where there are high levels of oxidative stress [47].

It was next asked whether activation of mGPR75 could prevent glutamate-

induced toxicity. Increasing concentrations of mCCL5 pre-treatment did not

significantly protect HT22 cells from glutamate-induced toxicity (Figure 3).

This is in stark contrast to Ignatov et al (2006) where a single dose of mCCL5

was neuroprotective. It would be expected that if mGPR75 activation were to

oppose the effect of oxidative stress, a significant increase in cell viability

would be observed with the mCCL5 concentrations used. A number of factors

could explain the lack of neuroprotection observed.

Firstly, it is worthwhile examining the capabilities of the experiment. Although

this study confirmed the expression of mGPR75 mRNA transcripts [1], cell

surface expression of mGPR75 in HT22 cells has not been undoubtedly

demonstrated, meaning mCCL5 may not have activated mGPR75. Cell

differentiation is another unknown factor that can alter gene regulation and

result in loss or down-regulation of cell surface expression. Given that HT22

cells were maintained at a sub-confluent density and that mGPR75

expression was demonstrated shortly prior to cell viability assays, it could be

considered unlikely that this factor explains these observations. Therefore, our

study could be considered robust with respect to mGPR75 transcript but not

cell surface expression.

Another explanation for the insignificant neuroprotection observed could be

that mGPR75 is expressed at low levels endogenously in HT22 cells and

consequently the pro-survival mechanisms activated by mCCL5 are

insufficient to prevent cell death. Differential mechanisms of amyloid-β and

glutamate toxicity may also explain the preferential protection against

amyloid-β toxicity. While both models involve increases in ROS, the

intracellular pathways leading to and from this outcome are different.

Consequently, amyloid-β toxicity results in apoptosis [30] whereas glutamate

toxicity results in features of both apoptosis and necrosis [31]. It is concluded

that mGPR75 does not provide significant protection from oxidative stress in

HT22 cells. However, demonstration of mGPR75 surface expression in HT22

cells is a necessary pre-requisite for confirming this conclusion.

However, perhaps the most important consideration is the physiological

relevance and reproducibility of previous reports regarding the

neuroprotective action of mGPR75 [1]. Here, no definition was made

regarding whether human or mouse CCL5 was used to induce

neuroprotection via mGPR75. CCL5 was obtained from Bachem (Weial am

Rein, Germany). Inspection of the chemokine ordering catalog displays

ordering information for only hCCL5 (http://www.bachem.co.uk). This means

that hCCL5 was the only form of CCL5 used in this paper. Demonstration of

mGPR75 activation through exogenous application of hCCL5 may have little

physiological relevance and further studies are required to determine if

mCCL5 can activate mGPR75.

The typical chemokine receptor features that may be present in hGPR75 were

then investigated. Transient transfection of L1.2 cells has been used

previously for functional chemokine receptor analyses such as chemotaxis,

chemokine radio-ligand binding affinity assays, receptor post-translational

modifications and receptor export to the plasma membrane [34-36]. Transient

transfection of hGPR75 into L1.2 cells was performed as a pre-requisite to

performing functional studies of the receptor (Figure 4). hGPR75 mean HA-

specific staining was significantly lower than CXCR3 and not significantly

different from empty pcNA3 transfections, leading to the conclusion that

hGPR75 was poorly expressed on the cell surface of L1.2 cells. Intracellular

trafficking events such as receptor export, endocytosis and degredation

regulate cell surface expression [37]. One explanation for poor cell surface

expression of hGPR75 could relate to the effect of the HA tag on these

factors. However, previous experiments have demonstrated cell surface

expression of HA-chemokine receptor recombinant proteins without

compromise of receptor export or integration into the cell membrane [34, 35].

It is therefore believed that these results are not likely a consequence of HA

tag interference with normal receptor trafficking.

hGPR75 contains a large C-terminus of 169 residues, compared with around

50 amino acids found in other chemokine receptors [24]. It was recently

shown that C-terminal di-leucine motifs (i.e. LLXXL) are important for

trafficking of several chemokine receptors such as CCR3 and CXCR2 to the

cell surface of L1.2 cells, aswell as the neuronal receptor 5-HT in renal

epithelial and African green monkey cells [35, 38]. Examination of the amino

acid sequence of hGPR75 reveals a C-terminus lacking di-leucine motifs,

providing a possible explanation for poor receptor membrane expression in

L1.2 cells and supporting the view that C-terminal di-leucine motifs are

important for chemokine receptor export to the cell surface. The full length

protein contains several N-glycoslyation sites. These sites are known to be

important for sorting and trafficking, stabilisation of protein conformations and

protection from degredation [39]. The extent of N-glycosylation and other

post-translational modifications of hGPR75 transcripts and its effect on cell

surface expression are unknown. It might be expected that hGPR75

expression is restricted to a subset of cells which also express the appropriate

intracellular machinery to export it to the cell surface.

These results provide supporting evidence that GPR75 is an atypical

chemokine receptor in terms of structure, function and expression [24].

Transient expression of hGPR75 into neuronal cell lines such as HT22 cells

[1] is more likely to result in membrane expression, and therefore a

mechanism with which to study potential chemokine binding kinetics and

chemotaxis. These investigations may benefit first from confocal microscopy

of permeabilised HA-GPR75 transfected L1.2 cells coupled to HA-antibody

staining, in order to determine the sub-cellular localisation of HA-GPR75

following transcription. Western blotting of HA-GPR75 leukocyte transfectants

may also provide insight into the extent of post-translational modifications of

the nascent protein and provide an explanation for the poor cell membrane

expression found in this study.

The view that mGPR75 may be endogenously neuroprotective from amyloid-β

toxicity [1] derives from potentially physiologically irrelevant data and in this

setting first needs to be re-examined using mCCL5 to activate mGPR75. This

study has shown that mGPR75 does not have a significant neuroprotective

role from oxidative stress in HT22 cells. However, the trend towards

significance seen with increasing concentrations of mCCL5 pre-treatment

(Figure 3) suggests that GPR75 may have some beneficial action in vivo.

This trend may only become significant with a higher number of independent

experiments.

There is strong evidence that mGPR75 activation can protect neuronal cells

from amyloid-β induced toxicity [1]. The neuroprotective role of GPR75 in vivo

may be best explored with GPR75 knock-out mice in an Alzheimer’s disease

mouse model. Additionally, identification of other endogenous ligands,

together with cell type expression analysis will provide an important basis with

which to derive further functional hypotheses.

Figures

A B

1kbp750bp

500bp

250bp

Figure 1. mGPR75 is the only mCCL5 receptor transcript expressed in HT22

cells. A. mCCL5 receptors CCR1, CCR3, CCR5 and GPR75 amplified from

mouse genomic DNA (+ lanes). PCR was performed without mouse genomic

DNA (- lanes) as a negative control. B. CCR1, CCR3, CCR5 and GPR75 in

HT22 cells by amplification of RT reactions. RT-PCR was performed without

the reverse transcriptase enzyme (- lanes) as a negative control.

O0

20

40

60

80

100

120

-3 -2 -1

log [glutamate] M

Cel

l vi

abil

ity

(% c

on

tro

l)

Figure 2. HT22 cell dose response curve to glutamate treatment. The IC50

concentration of glutamate was calculated as 5.9mM (logIC50= -2.27±0.07).

Cells were incubated with 0 (n=6), 1 (n=6), 3 (n=6), 5 (n=4), 7 (n=4), 10 (n=6),

15 (n=4) and 30mM (n=5) glutamate for 24 hrs. Cell viability was determined

by ATP-dependent luminescence. Results presented are the mean of n

independent experiments ± standard error.

Control 0 0.1 0.3 1 3 10 300

25

50

75

100

6mM Glutamate

*** ******

*** ***

[RANTES] nM

Cel

l vi

abil

ity

(% c

on

tro

l)

Figure 3. HT22 cell viability in response to incubation with increasing

concentrations of mCCL5 prior to glutamate treatment. Treatment with 6mM

glutamate for 24 hrs resulted in a significant reduction in cell viability

(p<0.001). Prior treatment with varying concentrations of mCCL5 (0 (n=7), 0.1

(n=5), 0.3 (n=5), 1 (n=7), 3 (n=7), 10 (n=2) and 30nM (n=2)) for 1hr had no

significant effect on cell viability after treatment with glutamate. Cell viability

was significantly lower than untreated controls after pre-treatment with 0.1-

3nM but not 10 and 30nM mCCL5. Cell viability is expressed as a mean

percentage of untreated controls. Significance was calculated by one-way

ANOVA with Bonferonni’s multiple comparisons test.

+

pT7T3D-Pacl

hGPR75

hGPR75

HA

pENTR/SD/D-TOPO

AttL1

KanR

AttR1ccdB

AmpR

pcDNA 3.2/V5-DEST

HA-GPR75pcDNA 3.2/V5-DEST

GPR75

HA

AttL1

GPR75

HA

HA-GPR75pENTR/SD/D-TOPO

KanR

AmpR

AttL2

Figure 4

AttL2

AttR2

PCR

pENTR/SD/D-TOPO

ccdB

1. Coupling hGPR75 to HA sequence

3. Cloning HA-GPR75 into the TOPO Destination Plasmid

2. Cloning HA-GPR75 into TOPO Entry Plasmid

Figure 4. Cloning human GPR75 into a TOPO expression vector using the

TOPO Gateway Cloning System. hGPR75 was first coupled to a sequence

encoding the HA tag by PCR. HA-GPR75 was then cloned into the

kanamycinR TOPO entry plasmid pENTR/SD/D-TOPO, leaving HA-GPR75

flanked by the AttL1 and AttL2 sites. HA-GPR75-pENTR was transformed into

Supercompetent E.coli, grown in kanamycin, and positive transformants

selected for culture in LB and kanamycin. After isolation of pHA-GPR75-

ENTR/SD/D-TOPO DNA, the LR Reaction was used to clone HA-GPR75 into

the ampicillinR TOPO destination vector pcDNA3.2/V5-DEST, which uses the

enzyme LR Clonase. LR Clonase cuts HA-GPR75 from the entry plasmid at

the AttL1 and AttL1 sites and recombines into the AttR1 and AttR2 sites of the

destination plasmid, replacing the toxic counter selection gene ccdB. This also

creates a pENTR/SD/D-TOPO plasmid containing the ccdB gene. The

recombinant reaction mixture was transformed into Supercompetent E.coli

and transformants selected from an ampicillin agar plate for growth in LB and

ampicillin. E.coli harbouring the pENTR/SD/D-TOPO with ccdB gene die. HA-

GPR75-pcDNA3.2/V5-DEST DNA was isolated and used in subsequent

transfections.

pcDNA3 control

HA-GPR75

HA-CXCR3

21.1 15.75 8.75

14.51 18.98 11.16

42.47 41.45 39.51

IgG1HACounts

Experiment 1 Experiment 2 Experiment 3

FLH-1

Figure 5. Flow cytometry analysis of protein cell surface expression in L1.2

cells following transfection with pcDNA3, HA-GPR75-pcDNA3.2/V5-DEST or

HA-CXCR3-pcDNA3 DNA (rows labelled right-hand side). Fluorescence

(FLH-1, x-axis) is plotted against cell count (y-axis). Comparison of HA-

specific staining (inset top right) in HA-GPR75 transfections with empty

pcDNA3 (negative control) and HA-CXCR3 (positive control) tranfections

suggests that HA-GPR75 was poorly expressed on the cell surface of L1.2

cells. Cells were stained with FITC-conjugated mouse anti-goat F(AbI)2

secondary antibody following either HA or IgG1 isotype control primary MAbs

staining. HA-specific staining was calculated by subtracting the mean

fluorescence of IgG1 MAb stained cells (purple area) from the mean

fluorescence of HA MAb stained cells (green line).

Figure 6. Relative surface expression of HA-GPR75, compared with negative

empty pcDNA3 and positive HA-CXCR3 controls, in transfected L1.2 cells.

HA-GPR75 cell surface expression was not significantly higher than pcDNA3-

transfected cells, as measured by mean HA-specific staining. Both pcDNA3

and HA-GPR75 cell surface expression was significantly lower (p<0.001) than

HA-CXCR3 transfected cells. Cells were stained with anti-HA or IgG1 isotype

control MAb primary antibodies. The fluorescent FITC-conjugated goat F(ab')2

anti-mouse secondary antibody was used to calculate HA-specific staining, by

subtracting the mean FLH-1 fluorescence of HA stained cells from the mean

FLH-1 fluorescence of IgG1 stained cells. Data are expressed as mean

fluorescence ± standard error of 3 independent experiments. Statistical

analysis was carried out using one-way ANOVA with Bonferroni’s multiple

comparisons test.

pcDNA3 HA-GPR75 HA-CXCR30

5

10

15

20

25

30

35

40

45

*** ***

HA

-sp

ec

ific

flu

ore

sc

ence

Table 1. Oligonucleotide forward (F) and reverse primer (R) pairs used for

amplification of murine CCR1, CCR3, CCR5, GPR75 (upper) and

hGPR75 (lower). The size of the DNA fragment amplified is

indicated.

Gene (mouse) Sequence 5' to 3' Size bpCCR1 F AGCCTACCCCACAACTACAGAA 546CCR1 R CTTGTAGGGGAAATGAGGGCTACCR3 F ATGGCATTCAACACAGATG 287CCR3 R AATCCAGAATGGGACAGTGCCR5 F GGATTTTCAAGGGTCAGTTC 523CCR5 R AACCTTCTTTCTGAGATCTGGGPR75 F ACCTTGGTGACCTGCACTTT 620GPR75 R CTGTGGTCTGGAAGCATCAA

Gene (human)GPR75 F CACCATGTATCCATATGATGTCCCAGA- 1620

TTATGCCAACTCAACAGGCCACCTTCAGPR75 R TTAAACGGAGGGGACTGGAATC

References

1 Ignatov, A., Robert, J., Gregory-Evans, C. and Schaller, H. C. (2006)

CCL5 stimulates Ca2+ mobilization and inositol trisphosphate (IP3)

formation in cells transfected with G protein-coupled receptor 75. Br J

Pharmacol 149: 490-7

2 Charo, I. F. and Ransohoff, R. M. (2006) The many roles of

chemokines and chemokine receptors in inflammation. N Engl J Med

354: 610-21

3 Cartier, L., Hartley, O., Dubois-Dauphin, M. and Krause, K. H. (2005)

Chemokine receptors in the central nervous system: role in brain

inflammation and neurodegenerative diseases. Brain Res Brain Res

Rev 48: 16-42

4 He, J., Chen, Y., Farzan, M., Choe, H., Ohagen, A., Gartner, S.,

Busciglio, J., Yang, X., Hofmann, W., Newman, W., Mackay, C. R.,

Sodroski, J. and Gabuzda, D. (1997) CCR3 and CCR5 are co-

receptors for HIV-1 infection of microglia. Nature 385: 645-9

5 Lu, M., Grove, E. A. and Miller, R. J. (2002) Abnormal development of

the hippocampal dentate gyrus in mice lacking the CXCR4 chemokine

receptor. Proc Natl Acad Sci U S A 99: 7090-5

6 Bakhiet, M., Tjernlund, A., Mousa, A., Gad, A., Stromblad, S., Kuziel,

W. A., Seiger, A. and Andersson, J. (2001) CCL5 promotes growth and

survival of human first-trimester forebrain astrocytes. Nat Cell Biol 3:

150-7

7 Giovannelli, A., Limatola, C., Ragozzino, D., Mileo, A. M., Ruggieri, A.,

Ciotti, M. T., Mercanti, D., Santoni, A. and Eusebi, F. (1998) CXC

chemokines interleukin-8 (IL-8) and growth-related gene product alpha

(GROalpha) modulate Purkinje neuron activity in mouse cerebellum. J

Neuroimmunol 92: 122-32

8 Hamann, I., Zipp, F. and Infante-Duarte, C. (2008) Therapeutic

targeting of chemokine signaling in Multiple Sclerosis. J Neurol Sci

274: 31-8

9 Tani, M. and Ransohoff, R. M. (1994) Do chemokines mediate

inflammatory cell invasion of the central nervous system parenchyma?

Brain Pathol 4: 135-43

10 Tripathy, D., Thirumangalakudi, L., Grammas, P. (2010) RANTES

upregulation in the Alzheimer's disease brain: a possible

neuroprotective role. Neurobiol Aging 31: 8-16

11 Simpson, J., Rezaie, P., Newcombe, J., Cuzner, M. L., Male, D. and

Woodroofe, M. N. (2000) Expression of the beta-chemokine receptors

CCR2, CCR3 and CCR5 in multiple sclerosis central nervous system

tissue. J Neuroimmunol 108: 192-200

12 Rottman, J. B., Slavin, A. J., Silva, R., Weiner, H. L., Gerard, C. G. and

Hancock, W. W. (2000) Leukocyte recruitment during onset of

experimental allergic encephalomyelitis is CCR1 dependent. Eur J

Immunol 30: 2372-7

13 Karpus, W. J. and Kennedy, K. J. (1997) MIP-1alpha and MCP-1

differentially regulate acute and relapsing autoimmune

encephalomyelitis as well as Th1/Th2 lymphocyte differentiation. J

Leukoc Biol 62: 681-7

14 Selkoe, D. J. (1996) Amyloid beta-protein and the genetics of

Alzheimer's disease. J Biol Chem 271: 18295-8

15 McGeer, P. L., Itagaki, S., Tago, H. and McGeer, E. G. (1987) Reactive

microglia in patients with senile dementia of the Alzheimer type are

positive for the histocompatibility glycoprotein HLA-DR. Neurosci Lett

79: 195-200

16 Frisoni, G. B., Fox, N. C., Jack, C. R., Jr., Scheltens, P. and

Thompson, P. M. (2010) The clinical use of structural MRI in Alzheimer

disease. Nat Rev Neurol 6: 67-77

17 Xia, M. Q., Qin, S. X., Wu, L. J., Mackay, C. R. and Hyman, B. T.

(1998) Immunohistochemical study of the beta-chemokine receptors

CCR3 and CCR5 and their ligands in normal and Alzheimer's disease

brains. Am J Pathol 153: 31-7

18 Smits, H. A., Rijsmus, A., van Loon, J. H., Wat, J. W., Verhoef, J.,

Boven, L. A. and Nottet, H. S. (2002) Amyloid-beta-induced chemokine

production in primary human macrophages and astrocytes. J

Neuroimmunol 127: 160-8

19 Johnstone, M., Gearing, A. J. and Miller, K. M. (1999) A central role for

astrocytes in the inflammatory response to beta-amyloid; chemokines,

cytokines and reactive oxygen species are produced. J Neuroimmunol

93: 182-93

20 Tripathy, D., Thirumangalakudi, L. and Grammas, P. (2010) RANTES

upregulation in the Alzheimer's disease brain: a possible

neuroprotective role. Neurobiol Aging 31: 8-16

21 Kerschensteiner, M., Stadelmann, C., Dechant, G., Wekerle, H. and

Hohlfeld, R. (2003) Neurotrophic cross-talk between the nervous and

immune systems: implications for neurological diseases. Ann Neurol

53: 292-304

22 Orellana, D. I., Quintanilla, R. A. and Maccioni, R. B. (2007)

Neuroprotective effect of TNFalpha against the beta-amyloid

neurotoxicity mediated by CDK5 kinase. Biochim Biophys Acta 1773:

254-63

23 Tarttelin, E. E., Kirschner, L. S., Bellingham, J., Baffi, J., Taymans, S.

E., Gregory-Evans, K., Csaky, K., Stratakis, C. A. and Gregory-Evans,

C. Y. (1999) Cloning and characterization of a novel orphan G-protein-

coupled receptor localized to human chromosome 2p16. Biochem

Biophys Res Commun 260: 174-80

24 Pease, J. E. (2006) Tails of the unexpected - an atypical receptor for

the chemokine CCL5/CCL5 expressed in brain. Br J Pharmacol 149:

460-2

25 Viola, A. and Luster, A. D. (2008) Chemokines and their receptors:

drug targets in immunity and inflammation. Annu Rev Pharmacol

Toxicol 48: 171-97

26 Sauer, C. G., White, K., Stohr, H., Grimm, T., Hutchinson, A.,

Bernstein, P. S., Lewis, R. A., Simonelli, F., Pauleikhoff, D., Allikmets,

R. and Weber, B. H. (2001) Evaluation of the G protein coupled

receptor-75 (GPR75) in age related macular degeneration. Br J

Ophthalmol 85: 969-75

27 Field, J., Nikawa, J., Broek, D., MacDonald, B., Rodgers, L., Wilson, I.

A., Lerner, R. A. and Wigler, M. (1988) Purification of a RAS-

responsive adenylyl cyclase complex from Saccharomyces cerevisiae

by use of an epitope addition method. Mol Cell Biol 8: 2159-65

28 Vaidehi, N., Pease, J. E. and Horuk, R. (2009) Modeling small

molecule-compound binding to G-protein-coupled receptors. Methods

Enzymol 460: 263-88

29 Maher, P. (2001) How protein kinase C activation protects nerve cells

from oxidative stress-induced cell death. J Neurosci 21: 2929-38

30 Varadarajan, S., Kanski, J., Aksenova, M., Lauderback, C. and

Butterfield, D. A. (2001) Different mechanisms of oxidative stress and

neurotoxicity for Alzheimer's A beta(1--42) and A beta(25--35). J Am

Chem Soc 123: 5625-31

31 Tan, S., Wood, M. and Maher, P. (1998) Oxidative stress induces a

form of programmed cell death with characteristics of both apoptosis

and necrosis in neuronal cells. J Neurochem 71: 95-105

32 Maher, P. and Davis, J. B. (1996) The role of monoamine metabolism

in oxidative glutamate toxicity. J Neurosci 16: 6394-401

33 Greene, J. G. and Greenamyre, J. T. (1995) Exacerbation of NMDA,

AMPA, and L-glutamate excitotoxicity by the succinate dehydrogenase

inhibitor malonate. J Neurochem 64: 2332-8

34 Wise, E. L., Duchesnes, C., da Fonseca, P. C., Allen, R. A., Williams,

T. J. and Pease, J. E. (2007) Small molecule receptor agonists and

antagonists of CCR3 provide insight into mechanisms of chemokine

receptor activation. J Biol Chem 282: 27935-43

35 Wise, E. L., Bonner, K. T., Williams, T. J. and Pease, J. E. (2010) A

single nucleotide polymorphism in the CCR3 gene ablates receptor

export to the plasma membrane. J Allergy Clin Immunol 126: 150-7 e2

36 Mueller, A., Meiser, A., McDonagh, E. M., Fox, J. M., Petit, S. J.,

Xanthou, G., Williams, T. J. and Pease, J. E. (2008) CXCL4-induced

migration of activated T lymphocytes is mediated by the chemokine

receptor CXCR3. J Leukoc Biol 83: 875-82

37 Dong, C., Filipeanu, C. M., Duvernay, M. T. and Wu, G. (2007)

Regulation of G protein-coupled receptor export trafficking. Biochim

Biophys Acta 1768: 853-70

38 Carrel, D., Hamon, M. and Darmon, M. (2006) Role of the C-terminal

di-leucine motif of 5-HT1A and 5-HT1B serotonin receptors in plasma

membrane targeting. J Cell Sci 119: 4276-84

39 Hanisch, F. G. and Breloy, I. (2009) Protein-specific glycosylation:

signal patches and cis-controlling peptidic elements. Biol Chem 390:

619-26

40 Grammas, P. and Ovase, R. (2001) Inflammatory factors are elevated

in brain microvessels in Alzheimer's disease. Neurobiol Aging 22: 837-

42

41 Yates, S. L., Burgess, L. H., Kocsis-Angle, J., Antal, J. M., Dority, M.

D., Embury, P. B., Piotrkowski, A. M. and Brunden, K. R. (2000)

Amyloid beta and amylin fibrils induce increases in proinflammatory

cytokine and chemokine production by THP-1 cells and murine

microglia. J Neurochem 74: 1017-25

42 Tripathy, D., Thirumangalakudi, L. and Grammas, P. (2007) Expression

of macrophage inflammatory protein 1-alpha is elevated in Alzheimer's

vessels and is regulated by oxidative stress. J Alzheimers Dis 11: 447-

55

43 Wyss-Coray, T. (2006) Inflammation in Alzheimer disease: driving

force, bystander or beneficial response? Nat Med 12: 1005-15

44 Kozak, M. (1991) An analysis of vertebrate mRNA sequences:

intimations of translational control J Cell Biol 115:887-903

45 Behl, C., Davis, J. B., Lesley, R., Schubert, D. (1994) Hydrogen

peroxide mediates amyloid beta protein toxicity. Cell 77:817-27

46 Maher, P. (2005) The effects of stress and aging on glutathione

metabolism. Ageing Research Reviews 4:288-314

47 Lin, M.T., Beal, M.F. (2006) Mitochondrial dysfunction and oxidative

stress in neurodegenerative diseases. Nature 443:787-95