The process of Lewy body formation, rather than simply alpha-synuclein fibrillization, is the major driver of neurodegeneration in synuclein… · The intracellular accumulation of

1

The process of Lewy body formation, rather than simply alpha-synuclein

fibrillization, is the major driver of neurodegeneration in synucleinopathies

Anne-Laure Mahul-Mellier1, Johannes Burtscher1, Niran Maharjan1, Laura Weerens1,

Marie Croisier2, Fabien Kuttler3, Marion Leleu4, Graham Knott2, and Hilal A. Lashuel1*

1Laboratory of Molecular and Chemical Biology of Neurodegeneration, Brain Mind Institute, Ecole Polytechnique Fédérale de Lausanne (EPFL), 1015 Lausanne, Switzerland. 2BioEM Core Facility and Technology Platform, EPFL, Lausanne 1015, Switzerland. 3BiomolecularScreening Core Facility and Technology Platform, EPFL, Lausanne 1015, Switzerland. 3 Gene expression Core Facility and Technology Platform, EPFL, Lausanne 1015, Switzerland.

*To whom correspondence should be addressed at: Laboratory of Molecular and Chemical

Biology of Neurodegeneration, Brain Mind Institute, Ecole Polytechnique Fédérale de

Lausanne, 1015 Lausanne. Tel: +41216939691, Fax: +41216939665, Email:

[email protected]

Running title:

The grammar of Lewy body formation.

Keywords: alpha‐synuclein (α‐synuclein), Parkinson’s disease, aggregation, post‐

translational modification (PTM), mitochondria, synapse

was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprint (whichthis version posted September 2, 2019. . https://doi.org/10.1101/751891doi: bioRxiv preprint

https://doi.org/10.1101/751891

2

Abstract

Parkinson’s disease (PD) is characterized by the accumulation of misfolded alpha-synuclein

(α-syn) into intraneuronal inclusions named Lewy bodies (LB). Although it is widely believed

that α-syn plays a central role in the pathogenesis of PD and synucleinopathies, the processes

that govern α-syn fibrillization and LB formation in the brain remain poorly understood. In this

work, we sought to reverse engineer LBs and dissect the spatiotemporal events involved in

their biogenesis at the genetic, molecular, biochemical, structural, and cellular levels. Toward

this goal, we took advantage of a seeding-based model of α-syn fibril formation in primary

neurons and further developed this model to generate the first neuronal model that reproduces

the key events leading to LB formation; including seeding, fibrillization, and the formation of

LB-like inclusions that recapitulate many of the biochemical, structural, and organizational

features of LBs found in post-mortem human PD brain tissues. Next, we applied an integrative

approach combining confocal and correlative light-electron microscopy (CLEM) imaging

methods with biochemical profiling of α-syn species and temporal proteomic and

transcriptomic analyses to dissect the molecular events associated with LB formation and

maturation and to elucidate their contributions to neuronal dysfunctions and

neurodegeneration in PD and synucleinopathies. The results from these studies demonstrate

that LB formation involves a complex interplay between α-syn fibrillization, post-translational

modifications, and interactions between α-syn aggregates and membranous organelles,

including mitochondria and the autophagosome and endolysosome. Furthermore, we

demonstrate that the process of LB formation and maturation, rather than simply fibril

formation, is the major driver of neurodegeneration through disruption of cellular functions and

inducing mitochondria damage and deficits, as well as synaptic dysfunctions. Having a

neuronal model that allows for unlinking of the key processes involved in LB formation is

crucial for elucidating the molecular and cellular determinants of each process and their

contributions to neuronal dysfunction and degeneration in PD and synucleinopathies. Such a

model is essential to efforts to identify and investigate the mode of action and toxicity of drug

candidates targeting α-syn aggregation and LB formation.


https://doi.org/10.1101/751891

3

Introduction

The intracellular accumulation of aggregated forms of alpha-synuclein (α-syn) in neurons and

glial cells represents one of the main pathological hallmarks of Parkinson’s disease (PD) and

related synucleinopathies, including dementia with Lewy bodies (DLB) and multiple system

atrophy (MSA)1. PD and DLB are characterized by the presence of Lewy bodies (LB) and

Lewy neurites (LN) in subcortical and cortical neurons, while in MSA, α-syn inclusions are

mainly detected in glial cells and are referred to as glial cytoplasmic inclusions (GCIs)2,3.

Although it is widely believed that α-syn plays a central role in the pathogenesis of

synucleinopathies, the molecular and cellular processes that trigger and govern the

misfolding, fibrillization, LB formation, and spread of α-syn in the brain remain poorly

understood. Furthermore, whether the processes of α-syn fibrillization and inclusion formation

are protective or neurotoxic remains a subject of active investigation and debate. Addressing

this knowledge gap is crucial to 1) advancing our understanding of the molecular mechanisms

underpinning the pathogenesis of PD and other synucleinopathies; 2) guiding the

development of preclinical models that reproduce the full-spectrum or well-defined features of

the human pathology; and 3) developing more effective diagnostic and therapeutic strategies

for the management and treatment of these devastating diseases.

In-depth post-mortem neuropathological examinations of human brains from patients

with LB disorders and other synucleinopathies have revealed the existence of different sub-

types of pathological inclusions that are enriched in aggregated forms of α-syn, including

fibrils3-8. This has led to the hypothesis that aggregation of α-syn has a primary role in the

formation of LBs and other α-syn pathological aggregates. However, the absence of

experimental models that reproduce all the stages of LB formation and maturation has limited

our ability to decipher the different processes involved in LB formation and the contribution of

these processes to the pathogenesis of PD and synucleinopathies. To address this knowledge

gap, it is crucial to develop cellular and/or animal models that not only produce α-syn

aggregates but also recapitulate the process of LB formation at the biochemical, structural,

and organizational levels. One advantage of cellular models is that they offer unique


https://doi.org/10.1101/751891

4

opportunities to apply advanced imaging and omics approaches to elucidate in great detail the

key events associated with α-syn aggregation and LB formation and maturation and to

correlate these events with alteration in cellular pathways and functions/dysfunctions.

Until recently, the great majority of cellular models of synucleinopathies were based on

overexpression of WT or mutant α-syn alone, with other proteins, or coupled to treatment with

other stress inducers (e.g., toxins, proteasome inhibitors)9-19. In many cases, these conditions

were sufficient to induce α-syn accumulation and aggregation. However, very few studies

investigated the extent to which these aggregates reproduce the cardinal biochemical,

structural, and organizational features of LBs and other pathological states of α-syn in PD

brains. The formation of LB-like structures is usually assessed using a limited number of

methods to indirectly assess the aggregation properties of α-syn (e.g., proteinase K

resistant9,16 and binding to the amyloid-specific dye, thioflavin S13) and immunoreactivity for

selected LB markers10,12-15,17,19, such as p62, ubiquitin (Ub), and phosphorylated α-syn

(pS129), to define their LB-like properties. When electron microscopy (EM) was used, it clearly

demonstrated that the α-syn inclusions do not share the compositional complexity and

morphological features of the LBs, despite their immunoreactivity to the standard LB

markers13,20,21. These findings suggest that the great majority of α-syn cellular models

reproduce some aspects of α-syn aggregation or fibril formation, but do not recapitulate all of

the key events leading to LB formation and maturation.

Recently, it was shown that exogenously adding pre-formed fibrils of α-syn at

nanomolar concentration can act as a seed to initiate the misfolding and aggregation of

endogenous α-synuclein in both cellular22,23 and animal models24. This neuronal seeding

model is the first model that shows the formation and accumulation over time of long

filamentous aggregates. Although this seeding model enables the induction of α-syn

fibrillization in neurons, in the absence of α-syn overexpression, the transition from fibrils to

LB-like structures has not been reported, even though these aggregates are immunoreactive

for the standard LB makers (e.g., pS129 α-synuclein, p62, and ubiquitin). These observations


https://doi.org/10.1101/751891

5

suggest that the neuronal seeding model, as initially developed, is a suitable model for

investigating the processes involved in fibrils formations but not LB formation.

Given that LBs have been consistently shown to have complex composition and

organization and usually contain other non-proteinaceous material (lipids)25,26 and

membranous organelles8,27-32, we hypothesized that the transition from fibrils to LB might

require time and could be driven by post-translational modifications and structural

rearrangements of the fibrils. By extending the characterization of this neuronal seeding model

from 11–14 days to 21 days, we were eventually able to observe the transition from fibrils to

α-syn rich inclusions that recapitulate the biochemical, morphological, and structural features

of the bona fide human LBs, including the recruitment of membranous organelles and

accumulation of phosphorylated and C-terminally truncated α-syn aggregates33-38.

By employing an integrated approach using confocal and CLEM imaging, as well as

quantitative proteomic and transcriptomic analyses, we were able to investigate with

spatiotemporal resolution the biochemical and structural changes associated with each step

involved in LB biogenesis, from seeding to fibrillization to LB formation and maturation. Our

ability to uncouple the different stages of LB formation in this model provided unique

opportunities to investigate the cellular and functional changes that occur at each stage, thus

paving the way for elucidating how the different events associated with LB formation and

maturation contribute to α-syn-induced toxicity and neurodegeneration. Our work shows that

the process of LB formation and maturation, rather than simply α-syn fibril formation, is a major

contributor to α-syn-induced toxicity and neurodegeneration in PD and synucleinopathies. We

believe that this new model of LB formation can be further developed and used as a powerful

platform to further investigate the molecular determinants and cellular pathways that regulate

the stages of LB formation and maturation and to screen for therapeutic agents based on the

modulation of these pathways.


https://doi.org/10.1101/751891

6

Results

At early stage, α-syn seeded aggregates resemble bona fide human LBs

histochemically but not at the structural and organizational levels

To investigate the mechanisms of LB formation and maturation, we initially took advantage of

a cellular seeding-based model of synucleinopathies developed by Virginia Lee and

coworkers22,23. As a first step, we sought to determine to what extent this model reproduces

LB formation. Extracellular sonicated α-syn pre-formed fibrils (PFFs, length ~50–100 nm)

(Figure S1A-E) were added at a nanomolar concentration (70 nM) to primary neuronal cultures

(Figures 1A). Once internalized into the neurons, the PFFs serve as seeds and induced

endogenous α-syn to misfold and form intracellular aggregates in a time-dependent manner

(Figures 1B and S1F). To establish the spatio-temporal features of α-syn seeded aggregates

formed in neurons, we used ICC (Figures 1C-J and S3A-E) combined with high content

imaging analysis (HCA), which allows quantitative assessment of the level of α-syn-pS129 in

MAP2 positive neurons (Figure S3F-I). The epitopes of the antibodies used in our study are

summarized in Supplemental Figure 2.

Consistent with previous studies, we observed that PFF-treated neurons only started

to exhibit α-syn-pS129 positive inclusions 4 days after the addition of α-syn seeds (Figure

S3A). These rare aggregates were exclusively detected in neurites (Figure S3A). After 7 days

of treatment (D7), we observed an accumulation of filamentous-like α-syn aggregates in

neurites with a limited number of cell-body inclusions (Figures 1C and S3B, G-I). At 14 days

(D14), the number of filamentous aggregates continued to significantly increase in neurites

but also in the neuronal cell bodies where they were distributed in the vicinity of the nucleus

(Figures 1D and S3C, G-I).

The newly formed aggregates observed at D7 and D14 were all positive for the two

well-established LB markers, p62 (Figure 1E-F) and ubiquitin (Ub) (Figure 1G-H)39 and were

also stained by the Amytracker tracer, a fluorescent dye that binds specifically the β-sheet

structure of amyloid-like protein aggregates (Figure 1I-J). Although previous studies have


https://doi.org/10.1101/751891

7

suggested the formation of specific morphologies (strains) of α-syn aggregates in seeding

models, our ICC data revealed the formation of aggregates that are heterogeneous in size,

shape, and subcellular distribution in the same population of PFF-treated neurons (Figures

1C-J and S3B-C). Biochemical analysis of the insoluble fraction of the PFF-treated neurons

confirmed the accumulation of both truncated and high molecular weight (HMWs) α-syn

species that were positively stained with a pan-synuclein antibody (SYN-1) and with an

antibody against pS129 (Figures 1K and S7). Interestingly, these insoluble fractions displayed

a potent seeding activity in neuronal primary culture (Figure S4). Compared to recombinant

PFFs, we did not observe differences in the morphology and the subcellular distribution of the

seeded-aggregates formed after addition of “native aggregates” (Figures S3C and S4B).

These findings demonstrate that the newly formed pS129 positive α-syn filamentous

aggregates contain α-syn seeding competent species, most likely in a fibrillar species.

To determine if the newly formed aggregates share the structural and morphological

properties of the bona fide LBs observed in PD brains, we performed Electron Microscopy

(EM) and immunogold labeling studies against α-syn pS129 at D14. As shown in Figure 1L,

the newly formed aggregates in neurons appear as loosely organized uniform filaments

(Figure 1L, bottom panel). Interestingly, at this point, we did not observe significant lateral

association or clustering of the fibrils in the form of inclusions. Although previous studies have

referred to the α-syn aggregates formed at 11–14 days post-treatment with PFFs as LB-like

inclusions, our ICC and EM studies, which are consistent with previous studies using the same

model23,40,41 and tools (e.g., antibodies and LB markers), clearly demonstrate the formation of

predominantly α-syn fibrils, rather than LB-like inclusions. LBs are highly organized round

structures that are composed of not only α-syn fibrils but also other proteins42, lipids25,26, and

membranous organelles, including lysosomal structures and mitochondria8,28,29,31,43. The

absence of such structures at D14, even though the fibrillar aggregates are immunoreactive

for the classical markers used to define LBs, pS129, ubiquitin, and p62, suggests that these

markers cannot be used to accurately distinguish between α-syn fibrillar aggregates and

mature LBs.


https://doi.org/10.1101/751891

8

At late stage, α-syn seeded fibrillar aggregates rearrange into inclusions that

morphologically resemble to the bona fide human LBs

We hypothesized that the rearrangement and transition of the newly formed α-syn

fibrils into LB-like inclusions might require more time. Therefore, we sought to investigate the

structural and morphological properties of the newly formed aggregates over an extended

period, up to 21 days (D21) post-treatment with PFFs (DIV 28). Interestingly, at D21, ICC

combined with a HCA approach showed a significant increase in the number of aggregates

detected in the neuronal cell bodies between D14 and D21 (Figure S3F-H). Furthermore, we

observed major changes in the morphology of the newly formed aggregates. The seeded

aggregates, up to 14 days of formation, were exclusively detected as long filamentous-like

structures located either in the neurites and/or the neuronal cell bodies (Figure S3B-C).

However, at D21, we identified three different morphologies; filamentous (~30%), ribbon-like

(~45%), and round LB-like inclusions (~ 22%) (Figure S3D-E). The formation of these types

of aggregates in seeded neurons has not been reported, as previous studies limited their

analysis up to D14. The α-syn rounded inclusions observed at D21 were all positive for p62,

Ub, and the amyloid-specific dye (Amytracker) (Figure 1M-P). Furthermore, we also showed

the presence of several classes of lipids in the pS129-positive inclusions using fluorescent

probes (Figure S3 J-O). This finding is in line with several studies which have previously

documented the presence of lipids within LBs and α-syn pathological inclusions observed in

post-mortem PD human brain tissues25,26,44-47.

Finally, the LB-like inclusions were exclusively detected in the vicinity of the nucleus

(Figures 1M-P and S3D-E). After D14, no further significant accumulation of α-syn aggregates

was observed in the neurites (Figure S3G). Altogether, our data suggest that α-syn fibrillar

aggregates initially formed in the neuronal extensions (D4) are transported over time (D7–

D21) to the perinuclear region, where they eventually accumulate as LB-like inclusions (D21).


https://doi.org/10.1101/751891

9

The process of inclusion formation is accompanied by the sequestration of lipids,

organelles and endomembranes structures

The transition from filamentous aggregates into ribbon and round-like aggregates suggests

that the newly formed fibrils undergo major structural changes over time. To determine if these

changes are associated with the evolution and maturation of α-syn fibrils into LBs, we next

turned to correlative light and electron microscopy (CLEM) to characterize the ultrastructural

properties of the seeded α-syn aggregates formed in neurons after 7, 14, or 21 days post-

treatment with WT PFFs (Figures 1Q, 2 and S5A). As shown in Figure 2, the CLEM data

revealed a marked reorganization of the newly formed α-syn fibrils over time. Indeed, at D7,

EM images of neurites positive for pS129-positive α-syn seeded aggregates showed

predominantly single fibril filaments distant from each other (Figures 2Aa). Aligned and

randomly ordered fibrils were observed in the same neurite (Figures 2Aa). In comparison, in

neurite negative for α-syn seeded aggregates, we observed the classical organization of the

microtubules that appear as aligned bundle of long filaments parallel to the axis of the neurites

(Figures 2Ab). In-depth measurements of the diameters of the filament-like structures

observed in neurites confirmed that the newly formed α-syn fibrils exhibited an average

diameter of 11.94 ± 3.97 nm (standard deviation, SD) which was significantly smaller than the

average diameter of the microtubules (18.67 ± 2.94 nm) (Figure 2Ab, inset). Moreover, the

range of fibril lengths (from 500 nm to 2 μM per slide section) (Figure 2A) confirmed that the

fibrils detected in the cytosol were not simply internalized α-syn PFFs (size ~40-120 nm,

Figure S5B) but rather newly formed fibrils resulting from the seeding and fibrillization of

endogenous α-syn. At D7, although most of the newly formed α-syn fibrils were observed in

the neuritic extensions, pS129-positive α-syn aggregates were also detected in the cell bodies

of few neurons (Figure 1C-I).

CLEM showed, in the same neuronal cell body, α-syn fibrils randomly organized (Figure 2B-

C, blue arrows) or ordered as long tracks of parallel bundles of filaments (Figure 2B-C, red

arrows). At D14, most α-syn filaments were reorganized into laterally associated and tightly

packed bundles of fibrils (Figure 2D-E, red arrows).


https://doi.org/10.1101/751891

10

In some inclusions, these laterally associated bundles were seen to start to associate with or

encircle organelles, including mitochondria, autophagosomes, and others endolysosomal-like

vesicles (Figure 2D-E). Single fibrils, loosely distributed in the neuronal cell body, were also

detected close to these organelles (Figure 2D-E).

The sequestration of organelles and membranous structures by α-syn fibrillar

aggregates seems to gradually increase over time between D14 and D21 (Figures 2D-F and

S5F). At D21, both the ribbon-like aggregates (Figures 3A-B, highlighted in red and S6A) and

the LB-like inclusions (Figures 2F, 3C-D, highlighted in red and S6B) were composed of α-syn

filaments (highlighted in black) but also of a high number of mitochondria (highlighted in green)

and several types of vesicles, such as autophagosomes, endosome and lysosome-like

vesicles (highlighted respectively in yellow, pink and purple) (Figures 2F, 3A-D and S6A-D).

Interestingly, the mitochondria were either sequestered inside the inclusions or organized at

the periphery of the inclusions. The presence of these organelles inside the LB-like inclusions

was confirmed by ICC using specific markers for the late endosomes/lysosomes (Figure 3E,

LAMP1), the mitochondria (Figure 3G, Tom20) and the autophagosome vesicles (Figure 1M,

p62, and 3F, LAMP2A). BiP protein localized to the endoplasmic reticulum was also partially

colocalizing to the LB-like inclusions (Figure 3H). Our data strongly suggest that the process

of inclusion formation is not only driven by the mechanical assembly of newly formed α-syn

fibrils but seems to be accompanied by the sequestration or active recruitment of other

proteins, membranous structures, and organelles over time. This is in line with previous

studies showing that LBs from PD brains are not only composed of α-syn filaments and

proteinaceous material42,48,49 but also contain a mixture of vesicles, mitochondria, and others

organelles 8,27-31,43 as well as lipids25,26.

Formation and maturation of LB-like inclusions require the lateral association and the

fragmentation of the newly formed α-syn fibrils over time

The lateral association of the newly formed fibrils at D14 might represent an early stage in the

process of packaging fibrillar aggregates into LB-like inclusions. Also, the length of the newly

formed fibrils significantly decreased over time during the evolution of the inclusions (Figure


https://doi.org/10.1101/751891

11

S5G-J). At D7, the neurites contained long filaments of α-syn reaching up to 2 μm in length

(Figures 2Aa, 2B-C and S5G, J). Strikingly, at D14, the size of α-syn fibrils was significantly

reduced to an average length of 400 nm (Figures 2D-E and S5H, J). This was even more

obvious in the compact inclusions observed in neurons treated for 21 days, in which only very

short filaments were detected with an average size of 300 nm (Figures 2F-G and S5F, I-J).

This suggests that the lateral association of the newly formed fibrils and their packing into

higher-organized aggregates might require fragmentation of α-syn into shorter filaments. The

presence of C-terminally truncated species of α-syn was confirmed by Western blotting (WB),

as evidenced by the detection of the 12 kDa band by the pan α-syn antibody (SYN-1, epitope

91-99) but not by the antibody against pS129 (Figure S7). This is in line with our recent findings

showing that specific post-fibrillization C-terminal cleavages serve as key regulators in the

processing of α-syn seeds and the growth of newly formed α-syn fibrils in the neuronal seeding

model33.

Altogether, our findings suggest that the formation of α-syn inclusions, in the context

of this neuronal seeding model, requires a sequence of events starting with 1) the

internalization of PFF seeds, followed by 2) the initiation of the seeding, 3) fibril elongation and

post-fibrillization modification (phosphorylation at S129 and ubiquitination), 4) the

fragmentation of the newly formed fibrils, which facilitates 5) the structural reorganization of

the fibrils, their lateral assembly, and their packing into higher-order aggregates along with 6)

the recruitment and sequestration of organelles and endomembranes (Figure 9). It is likely

that many of these events are regulated by post-fibrillization post-translational dependent

interactions between α-syn fibrils and other proteins and organelles. To the best of our

knowledge, this is the first report of the formation of inclusions that recapitulate many of the

cardinal features of LBs, including the presence of fibrillar α-syn, lipids, and membranous

organelles.


https://doi.org/10.1101/751891

12

Quantitative proteomics reveals the temporal sequestration of membranous organelle,

synaptic, and mitochondrial proteins into LB-like inclusions

Having demonstrated by CLEM imaging that the maturation of the newly formed fibrils (D14)

into LB-like inclusions (D21) is accompanied by the active and gradual recruitment and

sequestration of organelles and endomembranes over time (D14 to D21), we next sought to

gain further insight into the molecular interactions and mechanisms that govern LB formation

and maturation by mapping the proteome of α-syn inclusions over time. Toward this goal, we

performed quantitative proteomic analysis on the insoluble fractions of PBS or PFF-treated

neurons after 7, 14, or 21 days of treatment (Figure 4). The proteomic data generated from

three independent experiments are presented as a volcano plot to depict the differentially

expressed proteins based on the mean intensity differences versus t-test probability.

At D7, after multi comparisons correction using the Bonferroni method (FDR threshold

<0.05, magnitude of proteins changes above 2 and a –log10 p-value >0.05), only α-syn and

the Phospholipase C Beta 1 (Plcb1) were shown to be significantly enriched in the insoluble

fraction with a nine- and two-fold increase in the insoluble fraction of the PFF-treated neurons,

respectively (Figure S8A). No proteins from the endomembrane compartments were

significantly enriched in the insoluble fraction of the PFF-treated neurons at D7. This finding

is in line with our CLEM observations showing that at an early stage, α-syn seeded aggregates

were mainly detected in the neurites as long filaments that did not appear to interact with

intracellular organelles.

Next, we examined the protein contents of the α-syn inclusions at the intermediate

stage, prior to (D14) and after (D21) the formation of LB-like inclusions (Figure 4). As shown

in Figure 4A, the volcano plots show that 633 proteins and 568 proteins were significantly

upregulated in the insoluble fraction of the PFF-treated neurons at D14 and D21, respectively.

These proteins were then classified by cellular component (Figure 4B) and biological

processes (Figure 4C) using the gene ontology (GO) term analysis and the database for

annotation, visualization, and integrated discovery (DAVID) analysis and pathways (Figure

S8B) using the Ingenuity Pathway Analysis (IPA). Classifications of the proteins by cellular


https://doi.org/10.1101/751891

13

compartment (Figure 4B) showed that the insoluble fractions of the PFFs-treated neurons at

D14 and D21 were highly enriched by proteins that belong to the endomembrane

compartments mainly from the mitochondria, the endoplasmic reticulum (ER), the Golgi and

to a lesser extent the endolysosomal apparatus or synapses. These data are in line with the

CLEM imaging showing that from D14 the newly formed fibrils start to interact with and

encircled several organelles, including mitochondria, autophagosome, endosomes,

lysosomes-like vesicles, and others endomembranous structures (Figures 2D) that are found

later to be sequestered in the LB-like inclusions at D21 (Figures 2F and 3). Finally, several

cytoskeletal proteins, including microtubule and myosin complexes, were also significantly

enriched at D14 and D21 in the insoluble fraction of the PFF-treated neurons (Figure 4B). It is

noteworthy that the close resemblance between the protein contents of the insoluble fraction

of PFF-treated neurons at D14 and D21 is expected given that at D21 only ~22% of the

positive α-syn aggregates have completely transitioned to inclusions with an LB-like

morphology (Figure S3E).

Formation and maturation of LB-like inclusions are dynamic processes which involve

proteins sequestration and alterations of key signaling pathways rather than simply α-

syn fibrillization

Several studies have shown that protein aggregation and inclusion formation could contribute

to neurodegeneration and disease progression through both gain of toxic function and loss of

normal protein function, possibly through aberrant interactions involving protein aggregation

or the sequestration of functional proteins within pathological inclusions50-54. Therefore, to gain

insight into the mechanisms and pathways that are involved and affected by α-syn fibrillization

and LB formation and maturation, the list of proteins found enriched in the PFF-treated

neurons (Figure 4A) was further classified by biological processes (Figure 4C) and signaling

pathways (Figure S8B). At the early stage of fibrils formation (D7), only α-syn and Plcb1

proteins were significantly enriched in the insoluble fraction of the PFF-treated neurons. At


https://doi.org/10.1101/751891

14

this stage, no biological processes were found to be altered (Figure S8A). Cellular

compartment analysis showed that the insoluble fractions of PFF-treated neurons at D14 and

D21 contained a large number of cytoskeletal proteins including several tubulin sub-units,

microtubule-associated proteins, and motor proteins (kinesin, dynein, and myosin) (Figure

4B). This cluster of proteins was associated with the enrichment of several biological

processes, including actin cytoskeleton organization, axonogenesis, and dendritic spine

development (Figure 4C). The top canonical signaling pathways were also related to axonal

guidance and microtubule regulation by the stathmin proteins (Figure S8B). The accumulation

of the cytoskeletal proteins in the neuronal insoluble fraction is concomitant with the

redistribution of newly formed α-syn aggregates from the neurites to the perinuclear region

(Figures 1C-P, S3B-H). This suggests that the retrograde trafficking of newly formed α-syn

fibrils is accompanied by the sequestration of the proteins involved in axonal transport.

Impaired axonal transport has been shown to have dramatic effects on the intracellular

trafficking of proteins, vesicles, and organelles55,56. In line with this hypothesis, our temporal

proteomic analysis revealed that, at D14 and D21, the most highly enriched terms for the

biological processes were related to intracellular protein transport, including ER to Golgi

mediated transport and the vesicle-mediated transport but also the nucleocytoplasmic protein

transport (Figure 4C). Overall, the sequestration of proteins related to the intracellular

transport inside α-syn inclusions seems to result in an impairment in the trafficking of

organelles and vesicles, such as mitochondria, endosomes, lysosomes, and the synaptic

vesicles55,56, that eventually accumulate inside α-syn inclusions as evidenced by CLEM

imaging (Figures 2 and 3). In line with this hypothesis, our proteomic data showed perturbation

of the biological processes and signaling pathways related to mitochondria and synaptic

compartments (Figures 4C and S8B). Interestingly, not only proteins involved in mitochondrial

transport were enriched in the insoluble fraction of the PFF-treated neurons but also proteins

related to mitochondrial dynamics, the mitochondrial apoptotic pathway, and the energy

metabolism pathways (Tricarboxylic acid cycle, ATP and NADH metabolisms). This indicates

that the process of inclusion formation that occurs throughout D14 to D21 might dramatically


https://doi.org/10.1101/751891

15

alter mitochondrial physiology, suggesting that mitochondrial dysfunction could be a major

contributor to neurodegeneration in PD and synucleinopathies.

The upregulation of biological processes related to synaptic homeostasis (Figure 4C)

was due to the accumulation of both pre and post-synaptic proteins (Figure 4E) mostly at D21

(Figure 4D). The processes involved in synaptic transmission, synapse assembly and synapse

maturation (Figure 4C) were associated with an upregulation of the long-term synaptic

depression and potentiation pathways but also of the endocannabinoid and CXCR4 signaling

that regulate synapse function57 (Figure S8B). Several signaling pathways related to

neurotoxicity were detected as upregulated in our analyses at D14, such as the Huntington’s

disease signaling, mitochondrial dysfunction, Apoptosis signaling, the ER stress pathway,

autophagy, and the neuroinflammation signaling pathway (Figure S8B).

Our proteomic and CLEM data provide strong evidence that formation of LB does not

occur through simply the continued formation, growth, and assembly of α-syn fibrils but instead

arises as a result of complex α-syn aggregation-dependent events that involve the active

recruitment and sequestration of proteins and organelles over time. This process, which

occurs mainly between 14-21 days, rather than simply fibril formation, which occurs as early

as 7 days, seems to trigger a cascade of cellular processes, including changes in the

physiological properties of the mitochondria and the synapses, that could ultimately lead to

neuronal dysfunctions and toxicity.

Transcriptomic analysis reveals multiple changes in gene expression during the

formation of the newly formed fibrils and their maturation into LB-like inclusions

Next, to better understand the mechanisms of dysfunctions that ultimately lead to

neurodegeneration, we investigated the transcriptomic changes in response to PFFs

treatment over time. RNA sequencing (RNA-Seq) technology was used to explore the

genome-wide transcript profiling in PBS and PFF-treated neurons after 7, 14, or 21 days of

treatment. Data were generated from three independent experiments. RNA-Seq analysis

(FDR threshold <0.01) identified a large number of genes that were differentially expressed


https://doi.org/10.1101/751891

16

between the PBS- and the PFF-treated neurons (Figure S9A). Interestingly, global

transcriptome changes increased over time in the PFF-treated neurons. At D7, only 75

differentially expressed genes were identified, while at D14 the total number of genes

increased to 435. At D21, 1017 genes were differentially expressed (Figure S9A), of which

455 were upregulated and 562 were downregulated (Figure S9A).

We first investigated the potential enrichment of cellular component (GO term analysis)

for the differentially expressed genes in PFF-treated neurons in cellular compartment. At D7,

the differentially expressed genes encoded for proteins located at the synapses, in the axons,

or the secretory and exocytic vesicles (Figure 5A). These genes are thought to play regulatory

roles in the neurogenesis processes, including the organization, the growth, and the extension

of the axons and dendrites (Figure 5B). Thus, the presence of the newly formed fibrils that are

mainly detected in the neuritic extensions at this stage could perturb the development and the

differentiation of the neurites. At D14, among the differentially expressed genes, 329 genes

(106 upregulated, 223 downregulated) were linked to the synaptic, neuritic, and vesicular

cellular compartments (Figure 5A). Further analyses showed that these genes were

associated with multiple biological processes, including neurogenesis, calcium homeostasis,

synaptic homeostasis (organization, plasticity, and neurotransmission), cytoskeleton

organization, response to stress, and neuronal cell death process (Figure 5B).

At D21, in addition to the axon and vesicles, our transcriptomic data showed an

enrichment of genes that encode for proteins present in several cellular compartments,

including the ion channels complex, plasma membrane protein complex, and the cell-cell

junctions. More importantly, our data show that the expression level of 217 synaptic related

genes was dramatically changed over time with a marked difference between D14 and D21

(Figures 5B, D, and S10B).

Most of the differentially expressed synaptic genes were significantly downregulated

between D14 and D21 (Figures 5D and S9B). Strikingly, at D21, ~20% of the genes

differentially expressed in the PFF-treated neurons were related to synaptic functions,

including neurotransmission processes and synapse organization. Also, at D21, biological


https://doi.org/10.1101/751891

17

processes related to the response to oxidative stress and mitochondria, including

mitochondrion disassembly, mitophagy, and mitochondria depolarization, were significantly

enriched (Figure 5B-C).

Finally, both transcriptomic and proteomic analyses revealed that shared biological

processes (Figures 4C and 5B) are mostly involved in the cytoskeletal, synaptic,

mitochondrial, and neuronal cell death functions. Altogether, our results show that alterations

of the mitochondrial and synaptic functions, both at the proteomic and transcriptomic levels,

occur primarily throughout D14 to D21, thus coinciding with inclusion formation, LB maturation,

and cell death.

Dynamics of Lewy body formation and maturation induce mitochondrial alterations

To validate our findings that mitochondrial dysfunctions are associated with the formation and

the maturation of the LB-like inclusions, we assessed the mitochondrial activity over time in

PFF-treated neurons. ICC for mitochondrial markers (VDAC1, TOM20, and TIM23) revealed

strong co-localization of mitochondria with α-syn pS129-positive aggregates starting from D14

after PFF exposure. To assess whether this recruitment of mitochondrial components

decreased mitochondrial function, we applied a combined protocol of high-resolution

respirometry with Amplex Red based fluorometry to measure the production of mitochondrial

reactive oxygen species (ROS).

Routine respiration of intact cells was significantly reduced at D21 (Figure 6B), while it was

similar to PBS-treated control cells at the other assessed time points. Plasma membranes

were subsequently permeabilized using digitonin, and substrates feeding into NADH-linked

respiration were supplied. In the absence (NL) and presence (NP) of ADP, these respirational

states did not significantly differ across all tested time points of PFF- and PBS-treatment.

Addition of succinate, drove overall respiration of all other groups to significantly higher

levels than neurons at D21. This was the case for both maximum oxidative phosphorylation

capacity (NSP) and maximum electron transport system capacity (NSE) in the uncoupled state

(by CCCP). Blocking NADH-linked respiration by rotenone, yielding maximal succinate-driven


https://doi.org/10.1101/751891

18

respiration in the CCCP uncoupled state, maintained the significantly lower respiration of

neurons at D21. Strikingly, the generation of mitochondrial ROS was significantly decreased

at D7 but returned to baseline levels after longer periods of PFF treatment (Figure 6B, lower

panel). In line with respiration results, analysis of proteomic data revealed significant

recruitment of oxidative phosphorylation system components into aggregates starting from

D14 (Figure 6C). Complexes I, II, and V were strongly affected up to D21, with complex II

subunit SDHC being robustly detected in aggregates at D14 and D21 (Figure 6D). The strong

sequestration of complex II components into aggregates might explain the stronger effects of

α-syn pathology on succinate- than on NADH-linked substrate driven respiration.

The reduced mitochondrial ROS production at D7 (Figure 6B) correlated with the

apparent lack of mitochondrial proteins involved in oxidative stress responses in aggregates

(Figure 6D). Coinciding with the appearance of proteins and components of the JNK pathway

in the aggregates, mitochondrial ROS production increased to baseline levels. Mitochondrial

membrane potential was measured from attached cells by TMRE fluorometry (Figure 6E), and

in line with respiration data, deterioration of mitochondrial membrane potential was apparent

only at D21. At this time point, we also observed a slight reduction of (membrane-potential

independent) binding of Mitotracker green to mitochondrial proteins (Figure 6F), indicating

moderate loss of mitochondrial density.

To investigate the effects of the aggregation process on selected mitochondrial

proteins in more detail, WB analyses were performed and the expression levels were

assessed at distinct time points of this process (Figure 6G): outer mitochondrial membrane

proteins (mitofusin 2 and VDAC1), matrix protein (Citrate synthase), inner mitochondrial

membrane proteins, including OPA1 and subunits of oxidative phosphorylation complexes

(OXPHOS), known to be labile when the respective complexes are not assembled. At D7, no

altered mitochondrial protein levels were observed despite reduced mitochondrial ROS

production and increases in α-syn pS129 and HMW species (Figure 6G). At D14, the levels

of the investigated mitochondrial proteins were still essentially unaltered, while significant

reductions were observed at D21 for pro-fusion protein OPA1 (long and short isoforms) and


https://doi.org/10.1101/751891

19

mitofusin 2 (Figure 6G). Similar effects were observed for subunits of oxidative

phosphorylation complexes, in particular, complex I subunit NDUFB8 (Figure 6G). Importantly,

levels of VDAC1 and citrate synthase, common markers of mitochondrial density, remained

relatively unaffected, even in this period of massive respirational deficits and dropping

mitochondrial membrane potential.

Synaptic dysfunction is primarily linked to the formation and the maturation of the LB-

like inclusions

Our transcriptomic and proteomic data strongly suggest that the reorganization of the newly

formed fibrils into LB-like inclusions are concomitant not only with mitochondria defects but

also with synaptic dysfunctions including neurotransmission, synaptic organization, and

plasticity (Figures 4C and 5B). Therefore, we assessed the protein levels of pre- and post-

synaptic markers [(respectively Synapsin I and Post-synaptic Density 95 (PSD95)]. We

measured a dramatic reduction of these synaptic markers at D21 (Figure 7A).

ICC also revealed that the density of the synapses was reduced in neurons having an

aggregates burden (Figure 7B-C). The loss of synapses correlates with the marked increase

in neuronal cell death observed at D21.

Finally, both proteomic and transcriptomic data suggested dysregulation of the mitogen-

activated protein kinase (MAPK) signaling pathways and the recruitment of the MAP kinases

ERK1 (MAPK3) and ERK2 (MAPK1) within α-syn inclusions over time. These findings are

especially relevant as the ERK signaling pathway is involved in regulating mitochondria fission

and integrity58-60 and synaptic plasticity61-64, and is also an important player in PD

pathogenesis65-67. WB analysis showed a significant reduction of the total protein level of the

extracellular signal-regulated (ERK 1/2) proteins at D21. Interestingly most of the ERK proteins

that were still expressed in neurons at D21 were highly phosphorylated, suggesting that the

ERK pathway is still activated at the late stage of LB formation. Finally, ICC revealed that p-

ERK 1/2 decorated the newly formed fibrils at D14 before being sequestered in the LB-like

inclusions at D21 (Figure 7D). Also, our data showed that p-ERK 1/2 was only associated with


https://doi.org/10.1101/751891

20

the newly formed aggregates localized in the neuronal cell bodies, as evidenced by the

absence of p-ERK 1/2 signal near the neuritic aggregates at D7 and D14. At D21, the granular

p-ERK 1/2 immunoreactivity was mostly detected at the periphery of the inclusions as

observed in the bona fide LBs found in human PD brain tissue68,69.

The formation and maturation of the LB-like inclusions are associated with neuronal

cell death

We next assessed how the processes involved in the formation, remodeling, and interactome

of α-syn aggregates could impact on the health of the cells at the distinct phases of α-syn

fibrillization from the early stage of fibrils formation (D7), through the packing of the newly

formed fibrils into aggregates (D7 to D14) and their maturation into LB-like inclusions (D14 to

D21).

First, it is important to note that treatment of α-syn KO neurons with the PFFs (70 nM)

did not induce neuronal death, even at D21, confirming that α-syn PFFs treatment and uptake

is not toxic to the neurons (Figure S10). Cell death was only detectable in WT neurons treated

with PFFs (Figure 8A-G). The first signs of toxicity in this neuronal population were only

observed from D14, as indicated by the significant activation of caspase 3, a key marker of

apoptosis.

From D14 to D21, the level of activated caspase 3 was further increased (Figure 8A-

B). The loss of plasma membrane integrity was observed starting at D19, as reflected by the

release of Lactate dehydrogenase (LDH) that significantly increased at D21 (Figure 8B-C).

ICC combined with HCA confirmed the neuronal loss at D21, as evident by the significant

decrease in the number of neuronal cell bodies and neurites (Figure 8D-E). In all the cell death

assays, the presence of α-syn positive aggregates was confirmed by the measurement of

pS129 level in MAP2-positive neurons (Figure 8F).

Strikingly, our transcriptomic analysis revealed that 156 genes involved in signaling

pathways related to the regulation of neuronal cell death were also significantly changed over

time in PFF-treated neurons (Figure 8G). These genes started to be significantly dysregulated


https://doi.org/10.1101/751891

21

at D14. At D21, 70 genes involved in cell death signaling pathways were upregulated in PFF-

treated neurons compared to PBS-treated neurons (Figure 8G). Among these genes, 24 were

directly related to apoptotic pathways, which is in line with our cell death assays showing

significant activation of caspase 3 at D21. Between D14 and D21, 26 genes were differentially

expressed in PFF-treated neurons (Figure 8H).

Our data also revealed a significant reduction of α-syn mRNA levels at D21 (Figure 8I),

concomitant with the downregulation of the transcript level of the Polo-like kinase 2 (Plk2)

(Figure 8J), the major kinase involved in the phosphorylation of α-syn at S129 residue. This

suggests that several cellular responses are deployed by the neurons to prevent further

aggregation and inclusion formation, either by downregulation of the protein level of α-syn or

its phosphorylation state.

Overall, our data suggest a progressive neurodegeneration that coincides with the first signs

of organelle accumulation and assembly of the LB-like inclusions.

Altogether our data demonstrate that the formation of fibrillar α-syn positive aggregates

and their maturation into highly organized LB-like inclusions are accompanied by

mitochondrial defects, synaptic dysfunctions, and the dysregulation of associated signaling

pathways that ultimately lead to toxicity and neurodegeneration.

Discussion

The majority of existing cellular models are models of α-syn fibril formation rather than

LBs

Several in vitro assays70-73 and cellular and animal models12,17,22,24,71,74 of α-syn aggregation

and pathology formation have been developed and are commonly used to study these

processes. While many of these models reproduce specific aspects or stages of LB pathology

formation, none has been shown to form pathological aggregates exhibiting the biochemical

and organizational complexity of α-syn pathologies, including LBs, found in post-mortem

brains of patients with synucleinopathies8,25,26,29-31,39,43,74,75. For the most part, classification of


https://doi.org/10.1101/751891

22

α-syn aggregates as having LB-like features has been limited to very few biomarkers12,13,17,

namely pS129, ubiquitin, and p62 immunoreactivity and the detection of high molecular weight

aggregates in WB13,22,40,41. In very few cases, detailed studies were performed to characterize

the nature of the aggregates and their morphological properties. Failure of these models to

reproduce the transition of α-syn from the aggregated/fibrillar stage to LB-like inclusions has

hampered efforts to elucidate the molecular determinants and cellular pathways that regulate

the different stages of LB pathology formation and to determine the role of this process in the

pathogenesis of PD.

The use of PFFs to seed the aggregation of endogenous α-syn has enabled the reliable

induction of α-syn fibril formation in neurons and other cell types74,76. Based on the use of the

LB markers discussed above, these seeding models are often presented as models of LB

pathology. However, EM studies22,40,41 of the seeded aggregates, including our own (Figure

2A-F), clearly show the presence of mainly fibrillar aggregates at the time points usually used

to assess seeding in this model (10–14 days) (Figures 1-2). These observations demonstrate

that the α-syn modifications and interacting proteins commonly used to define LB pathology

represent markers of α-syn fibril formation and, not necessarily, LB pathology, although these

markers persist with α-syn fibrils during their transition to LBs and other types of α-syn

pathologies.

Extending the seeding process enabled the reconstitution of LB-like inclusions in

neurons.

While investigating the mechanism of seeding and pathology spreading in mice inoculated

with PFFs, we observed a time-dependent shift in the morphology and localization of α-syn

pathology from a filamentous neuritic fibrillar pathology to predominantly compact α-syn in cell

body inclusions. Similarly, we observed that by simply extending the seeding process in

primary neurons from 14 to 21 days, we began to see major changes in the localization and

biochemical properties of the fibrils that eventually led to the formation rounded LB-like

inclusions (Figures 2F, S5F and 3) that exhibit similar biochemical, structural, and architectural


https://doi.org/10.1101/751891

23

features as patient-derived LBs, as previously described by EM7,8,30,31,46,75,77,78, IHC- or

ICC39,42,79-based imaging, WB34-38, and proteomic48,49 analyses. This includes the cleavage33

and accumulation of truncated fibrillar α-syn species34-38, the presence of many of the proteins

found in LBs42,48,49 and the active recruitment of membranous organelles (e.g., mitochondria,

the endolysosomal apparatus, and autophagolysosome-like vesicles)8,25,26,29-31,39,43,74,75,78,80,81.

Although previous reports have established the presence of lipids in LBs from post-mortem

PD tissues using different techniques, including Coherent Anti-Stokes Raman Scattering

(CARS) microscopy45,46 or synchrotron Fourier transform infrared micro-

spectroscopy (FTIRM)47, very few studies have explored the different types of lipids and their

distribution in LBs. Using different probes that target different types of lipids, we identified

several classes of lipids that colocalize within the LB-like structures. Consistent with our

confocal and CLEM imaging data, we observed enrichment of lipids (methyl ester staining)

that are specific for mitochondria, ER and Golgi apparatus membranes within the LB-like

inclusions. In addition, the phospholipids (cell membranes)26, sphingolipids (ER and Golgi

complex)26, neutral lipids25,26 (lipid droplets) and the cholesteryl esters26 (cholesterol transport)

which have been previously reported as components of the bona fide LB inclusions were also

detected reinforcing the similarities between the patient-derived LB pathologies and the LB-

like inclusions formed in the seeding model. These findings underscore the critical importance

of reassessing the role of lipids in the different stages of α-syn aggregation and LB formation

and maturation.

Altogether our findings are in agreement with ultrastructure-based studies showing that LBs

imaged in the substantia nigra27,29,31,46,75,78, the hippocampal CA2 region82, or the Stellate

ganglion8 from PD patients or non-PD patients30 exhibit organized structures that are enriched

in deformed and damaged mitochondria, cytoskeletal components, and lipidic structures,

including vesicles, fragmented membranes of organelles, and presynaptic structures.

Recently, in substantia nigra, CLEM approach showed some LBs rich in lipids and

membranous structures but devoid of α-syn fibrils46. However, a STED microscopy study of

similar LBs conducted by the same group revealed the presence of a highly dense and


https://doi.org/10.1101/751891

24

organized shell of phosphorylated α-syn at the periphery of these LBs45. These observations

raise the possibility that the CLEM procedure could have led to the disruption and removal of

this peripheral aggregated pS129-α-syn. One alternative explanation that is consistent with

our findings in the neuronal model is that the fibrils become increasingly fragmented over time

(Figure 2, ~50–350 nm in length at D21 in PFF-treated neurons). Such small fibrils, which are

also C-terminally truncated33, might not be recognized and/or could be missed, especially

when C-terminal antibodies were used to identify LBs (pS129 antibody or total α-syn antibody

against amino acids 115–122)46. We cannot rule out the possibility that LB structures devoid

of fibrillar α-syn aggregates exist and could represent a rare type of α-syn pathologies in PD

and synucleinopathies. Indeed, several reports have confirmed the existence of a large

morphological spectrum of LBs3,30,39,75,77,83-85.

Altogether our results suggest that the neuronal seeding model recapitulates many of

the key events and processes that govern α-syn seeding, aggregation, and LB formation

(Figures S13 and 9). This model also allows disentangling of the two processes of fibril

formation and Lewy body formation, thus paving the way for systematic investigation of the

molecular and cellular determinants of each process and their contributions to neuronal

dysfunction and degeneration.

The proteome of the neuronal LB-like inclusions overlaps with that of PD and points to

failure of the protein degradation machinery to clear α-syn inclusions

To further characterize the pathological relevance of the inclusions formed in the neuronal

seeding model, we compared our proteomic data with results from previous studies on the

proteome of brainstem or cortical LBs from PD human brain tissues. Approximately one-fourth

of the proteins identified in our inclusion proteomic data at D14 and D21 were previously

described as components of the LBs based on immunohistochemical-based studies 1,42,86

(Figure S11). When comparing our proteomic data of the LB-like inclusions with the proteome

of human LBs, we found that ~15–20% of the proteome overlaps with that of LBs from human

PD brain tissues48,49 (Figure S6). This is not surprising given the differences in the time of LB


https://doi.org/10.1101/751891

25

inclusion formation and maturation between primary neurons and in the human brain. It is also

evident from our CLEM studies that the neuronal LB-like inclusions have not reached the same

mature stage as the PD LBs. Interestingly, even previous studies that investigated the protein

content of human cortical LBs showed ~20% of similarities in the proteome of the inclusions.

Overall, most of the proteins found in common between LBs from PD human brain tissues and

the LB-like inclusions from the neuronal seeding model could be classified into three main

categories: 1) proteins from the mitochondria and synaptic compartments or belonging to the

endomembrane system; 2) cytoskeleton constituents and proteins associated with the

intracellular trafficking of proteins and vesicles and the nucleocytoplasmic transport; and 3)

proteins involved in the protein quality control (PQC) and the degradation/clearance

machineries (Figures S11–S12). These results suggest that the sequestration of proteins

related to the intracellular transport inside α-syn inclusions might result in the trafficking

impairment of organelles and vesicles, such as mitochondria, endosomes, lysosomes, and

the synaptic vesicles. Interestingly, dysfunction of the intracellular trafficking system and, in

particular, defects in the ER-Golgi caused by α-syn have been shown to underlie the

pathogenesis of PD at the early stage56. Previously published proteomic analyses using the

same neuronal seeding model also indicated a potential role of the microtubule-dependent

transport of vesicles and organelles87 during the process of aggregate formation (Figure S8C).

Finally, the accumulation of large components of the proteins involved in the PQC and

degradation/clearance machinery inside LB-like inclusions and the human bona fide LBs point

toward a potential failure of the protein degradation machinery to clear off α-syn inclusions,

leading to the intracellular accumulation of the aggregates as failed aggresomes-like

inclusions. In line with this hypothesis, it has been shown that a conditional KO of 26S

proteasome in mice led to the formation of LB-like inclusions consisting of filamentous α-syn,

mitochondria and membrane-bound vesicles in neurons88. This is also consistent with our

proteomic study showing a marked enrichment of the proteasomal system between D14 and

D21 in the insoluble fractions PFFs-treated neurons (Figures 4 and S12). Altogether these


https://doi.org/10.1101/751891

26

findings highlight the potential role of the proteasomal system in driving the formation of the

LB.

The processes associated with LB formation and maturation, rather than simply α-syn

fibril formation, are the major drivers of α-syn toxicity in neurons

Several studies have suggested that the formation of LBs represents a protective mechanism

whereby aggregated and potentially toxic α-syn species are actively recruited into aggresome-

like structures to prevent their aberrant interactions with other cytosolic proteins and their

deleterious effects on cellular organelles89. A protective role for LBs is plausible if one

assumes that this process is efficient. However, if this process stalls for any reason, then this

will likely expose neurons to deleterious effects mediated by the presence of toxic proteins

and damaged organelles and vesicles. To test this hypothesis, it is crucial to develop a

neuronal and animal model system that enables uncoupling of the different stages of α-syn

aggregation, fibrillization, and LB formation. One key advantage of neuronal models, as shown

in this study, is that they permit detailed investigation of the molecular and cellular changes

that occur during LB formation with high temporal resolution.

Our results show that formation of α-syn fibrils occurs as early as days 4–7, primarily

in neurites, where they accumulate as long filamentous fibrils (Figures 1C–J and 2Aa). At the

early stage of the seeding and fibrillization process (D7), the presence of these newly formed

fibrils did not result in significant alteration of the proteome (Figures 4 and S8A), and induced

only limited genetic and molecular perturbations (Figures 4 and 5) that did not impact neuronal

viability up to D14 (Figures 8A-F and S13). These findings are in line with previous studies

where no cell death was reported before D1422,40,41,90,91 and suggest that α-syn fibrillization is

not sufficient to trigger neuron death, despite the large accumulation of α-syn fibrils throughout

the cytosol of neurons.

However, the progressive accumulation of the filamentous fibrils in the neuronal cell

bodies from D7 to D14 was accompanied by the shortening of the fibrils, their lateral

association, and their interaction with surrounding organelles (Figure 2). These structural


https://doi.org/10.1101/751891

27

changes were concomitant with significant perturbations at the proteomic (Figure 4) and

transcriptomic levels (Figure 5). Despite the interaction of the newly formed fibrils with a large

number of proteins associated with cytoskeleton organization, mitochondrial functions,

intracellular trafficking of proteins, vesicles, and nucleocytoplasmic transport, only the early

stages of cell death were activated at D14 as evidenced by the significant activation of

caspase 3 without yet the loss of plasma membrane integrity (Figures 5A-F and S13). The

enrichment of proteins related to the chaperones machineries, the autophagy-lysosomal

pathway, and the ubiquitin-proteasome system in the insoluble fraction of the PFF-treated

neurons at D14 (Figures S12-S13) could suggest that the engagement of the protein quality

control machinery and other related processes represent early cellular responses to prevent

the formation and/or the accumulation of the fibrils in the cytosol. Similarly, transcriptomic

analyses revealed that the formation of α-syn seeded aggregates induced (between D7 and

D14) major dysregulations in the expression of genes involved in neurogenesis, calcium and

synaptic homeostasis, cytoskeleton organization, response to stress, and neuronal cell death

process (Figure 5). Therefore, the lack of noticeable toxic effects during the fibrillization

process (D7–D14) might reflect the ability of neurons to activate multiple pathways to counter

any negative effects induced by the fibrils.

In our extended neuronal seeding model, we observed that the major changes in the

structural properties of the newly formed fibrils occur between days 14 and 21. This suggests

that alternative cellular mechanisms take over to allow the structural reorganization of the

fibrils and their sequestration within LB-like inclusions. This could represent an ideal

detoxification mechanism by reducing aberrant interactions of the fibrils with cytosolic proteins

or organelles. However, our CLEM (Figure 3) and proteomic analyses (Figure 4) showed that

these structural changes were accompanied by significant recruitment and aberrant

sequestration of intracellular proteins related to the intracellular transport inside α-syn

inclusions. This seems to result in the trafficking impairment of organelles and vesicles such

as mitochondria, endosomes, lysosomes, and the synaptic vesicles56 that eventually

accumulate within LBs-like inclusions (Figures 2-4). This process was coupled with altered


https://doi.org/10.1101/751891

28

expression of genes associated with the cytoskeleton, mitochondria, and synaptic pathways

together with an increase of the neuronal cell death pathways and neurodegeneration (Figures

5-8 and S13). Our data suggest that post-fibrillization post-translational modifications could

play important roles in these processes by regulating the interactome of the fibrils and their

interactions with cellular organelles. The sequestration of proteins and organelles eventually

leads to a widespread loss of the biological functions, ultimately resulting in

neurodegeneration. Finally, the reorganization of the newly formed fibrils into LB-like

inclusions led to a significant decrease of α-syn both at the protein (Figure S7) and mRNA

(Figure 8I) levels. While depletion of endogenous α-syn could prevent further aggregation and

inclusion formation, it could also lead to loss of important physiological function(s) of α-syn

with cellular dysfunctions as consequences.

The dynamics of LB formation and maturation induce mitochondrial alterations

The prominent accumulation of mitochondria and mitochondrial components within the LB-like

inclusions prompted us to further investigate how the various stages of α-syn fibrillization and

LB formation influence mitochondrial functions (Figure S14). Although mitochondrial

dysfunctions have been strongly implicated in PD, and other neurodegenerative diseases92,93,

the mechanisms by which mitochondrial dysfunction is induced and how it promotes pathology

formation and/or neurodegeneration are still unclear.

Based on our CLEM results and literature evidence, we propose that interactions between the

newly formed α-syn aggregates and mitochondria (D7 to D14) result in the increasing

sequestration of mitochondrial organelles and proteins during the formation and the

maturation of the LB-like inclusions leading to severe mitochondria defects observed at D21

(Figures 3-4, 6 and S14). This is in line with proteomic48,49, IHC42 and EM29,31,46,75,77

characterizations of patient LBs, for which the presence of mitochondrial proteins and entire

mitochondrial organelles have also been demonstrated.


https://doi.org/10.1101/751891

29

Based on our results we suggest a working model on how subtle mitochondria-related events

across the formation and maturation of LB-like inclusions might induce neurodegeneration

(Figure S14).

A reduction in mitochondrial complex I, and of the pro-fusion proteins mitofusin 2 and OPA1

protein levels by WB (Figure 7) was only observed on D21, indicating an eventual failure of

compensatory mechanisms during the formation of LB-like inclusions. These observations

correlate with reduced mitochondrial membrane potential and a breakdown of mitochondrial

respiration at this time point. Decreased respiration has already been shown in previous

studies in the neuronal seeding model. However, respiration was assessed only between 8/9

and 14 days after PFFs treatment using mouse cortical neurons94 or rat midbrain neurons95,

respectively. Importantly, in these previous studies high PFF concentrations (140nM or

350nM) were used, which in our hands induce cell death events faster. The concentration

applied here (70nM) allowed investigation at a state, where LB-like inclusions occur. While

mitochondrial respiration in these reports was assessed only in intact cells, here we measured

maximum respiratory capacities at states requiring plasma membrane permeabilization. This

allowed the additional determination of mitochondrial complexes I and complexes II to

respiration capacity. Our data are in line with post-mortem studies96-98 reporting the deficiency

of the respiratory chain in SN neurons from PD patients.

Given that we were able to detect different types of changes in mitochondrial functions and

biochemical properties during the different stages associated with α-syn aggregation,

fibrillization and formation of LB-like inclusions, we believe that the seeding model provides a

powerful platform for dissecting the role of mitochondrial dysfunctions in synucleinopathies.

Synaptic functions are impaired during the formation and the maturation of the LB

Several studies on post-mortem PD brain tissues and animal models have recently suggested

that neuritic and synaptic degeneration correlate with early disease progression99. High

presynaptic accumulation of insoluble α-syn has been proposed as a greater contributor to the

development of clinical symptoms than LBs. Our proteomic (Figure 4) and transcriptomic


https://doi.org/10.1101/751891

30

analyses (Figure 6) suggest that mitochondrial defects are accompanied by an alteration of

synapse-related RNA and protein levels. However, it remains unclear which pathways in the

mitochondria-synapse signaling loop is dysregulated first by the formation and the maturation

of α-syn pathological inclusions100. Consistent with postmortem studies of PD patients101,102,

during the transition from fibrils to LB-like inclusion, we showed a reduction of synaptic density,

alterations of the protein level of both pre- and post-synaptic markers (Figure 8), and

dysregulation of the synaptic transcriptome (Figure 6). Unlike mitochondrial dysfunction, which

are manifested mainly once newly formed α-syn fibrils are reorganized into LB-like inclusions

(D14-D21), early synaptic changes at the transcriptomic level were observed concomitant with

the beginning of the α-syn fibrilization process and the appearance of α-syn-seeded

aggregates inside the neuritic extensions at the early stage of the seeding model (D4–D7)

(Figures 5E and S14). This suggests that synaptic dysfunction or different pathways linked to

synaptic dysfunction are affected at the different stages of α-syn aggregation and LB formation

and occur before the early onset of neurodegeneration, supporting the hypothesis that

synaptopathy is an initial event in the pathogenesis of PD and related synucleinopathies102,103.

Synaptotoxicity reflected by the downregulation of the synaptic activity and the loss of

synapses was also recently reported in seeding neuronal models22,91.

Finally, the ERK 1/2 signaling was also shown to be upregulated during both the

formation and the maturation of the LB-like inclusions (Figure 4). The ERK 1/2 pathway

regulates neuronal cell death, oxidative stress, mitochondria fission, and integrity, as well as

synaptic plasticity65, which are the major biological processes dysregulated in PD. Similar to

what has been previously reported in bona fide LB from PD patients68,69, we found that p-ERK

1/2 was recruited inside the LB-like inclusions (Figure 7D). Therefore, dysregulation of this

central signaling pathway during the formation and the maturation of the LB-like inclusions

could affect mitochondrial and synaptic functions, potentially explaining our observation in the

neuronal seeding model and PD brains.


https://doi.org/10.1101/751891

31

In conclusion, our work provides a comprehensive characterization of a highly

reproducible neuronal model that recapitulates many of the key biochemical, structural, and

organizational features of LB pathologies in PD brains. Using integrative imaging approaches,

we were able to dissect the key processes involved the formation of LB-like pathologies and

provide novel insight into their contribution to neuronal dysfunction and neurodegeneration.

To our knowledge, this is the first report that shows the formation of such LB-like inclusions

and presents a comprehensive characterization of the different stages of LB formation, from

seeding to fibrillization to the formation of LB-like inclusions at the molecular, biochemical,

proteomic, transcriptomic, and structural levels. These advances, combined with the

possibility to uncouple the three key processes (seeding, fibrillization, and LB formation) and

investigate them separately, provide unique opportunities to 1) investigate the molecular

mechanisms underpinning these processes; 2) elucidate their role in α-syn-induced toxicity

and potential contributions to the pathogenesis of PD; and 3) to screen for therapeutic agents

based on the modulation of these pathways. The use of a model system that allows the

investigation of these processes over a longer period of time (e.g., iPSC derived neurons)

could enable further insights into the molecular mechanisms that regulate LB pathology

formation, maturation, and pathological diversity in PD and synucleinopathies3, especially if

the development of such model systems is driven by insight from human pathology.


https://doi.org/10.1101/751891

32

Material and Methods

Antibodies and compounds

Information and RRID of the primary antibodies used in this study are listed in Figure S2.

Tables include their clone name, catalog numbers, vendors, and respective epitopes.

Expression and Purification of Mouse α-syn

pT7-7 plasmids were used for the expression of recombinant mouse α-syn in E. coli. Mouse

wild type (WT) α-syn was expressed and purified using anion exchange chromatography

(AEC) followed by reverse-phase High-Performance Liquid Chromatography (HPLC) and fully

characterized as previously described104,105.

Primary culture of hippocampal neurons and treatment with mouse α-syn fibrils

Primary hippocampal neurons were prepared from P0 pups of WT mice (C57BL/6JRccHsd,

Harlan) or α-syn KO mice (C57BL/6J OlaHsd, Harlan) and cultured as previously described106.

The neurons were seeded in black, clear-bottomed, 96-well plates (Falcon, Switzerland), 6-

wells plates, or onto coverslips (CS) (VWR, Switzerland) previously coated with poly-L-lysine

0.1% w/v in water (Brunschwig, Switzerland) at a density of 300,000 cells/mL. After 5 days in

culture, the WT or α-syn KO neurons were treated with extracellular mouse α-syn fibrils to a

final concentration of 70 nM and cultured for up to 21 days as previously described22,23. All

procedures were approved by the Swiss Federal Veterinary Office (authorization number VD

3392).

Immunocytochemistry (ICC)

After α-syn PFFs treatment, HeLa cells or primary hippocampal neurons were washed twice

with PBS, fixed in 4% PFA for 20 min at RT, and then immunostained as previously

described105. The antibodies used are indicated in the corresponding legend section of each

figure. The source and dilution of each antibody can be found in Figure S2. The cells plated

on CS were then examined with a confocal laser-scanning microscope (LSM 700, Carl Zeiss


https://doi.org/10.1101/751891

33

Microscopy, Germany) with a 40× objective and analyzed using Zen software

(RRID:SCR_013672). The cells plated in black, clear-bottom, 96-well plates were imaged

using the IN Cell Analyzer 2200 (with a ×10 objective). For each independent experiment, two

wells were acquired per tested condition, and in each well, nine fields of view were imaged.

Each experiment was reproduced at least three times independently.

Quantitative high-content wide-field cell imaging analyses (HCA)

After α-syn PFFs treatment, primary hippocampal neurons plated in black, clear-bottom, 96-

well plates (BD, Switzerland) were washed twice with PBS, fixed in 4% PFA for 20 min at RT

and then immunostained as described above. Images were acquired using the Nikon 10×/

0.45, Plan Apo, CFI/60 of the IN Cell Analyzer 2200 (GE Healthcare, Switzerland), a high-

throughput imaging system equipped with a high-resolution 16-bits sCMOS camera

(2048×2048 pixels), using a binning of 2×2. For each independent experiment, duplicated

wells were acquired per condition, and nine fields of view were imaged for each well. Each

experiment was reproduced at least three times independently. Images were then analyzed

using Cell profiler 3.0.0 software (RRID:SCR_007358) for identifying and quantifying the level

of LB-like inclusions (stained with pS129 antibody) formed in neurons MAP2-positive cells, the

number of neuronal cell bodies (co-stained with MAP2 staining and DAPI), or the number of

neurites (stained with MAP2 staining).

Correlative Light and Electron Microscopy (CLEM)

Primary hippocampal neurons were grown on 35 mm dishes with alphanumeric searching

grids etched to the bottom glass (MatTek Corporation, Ashland, MA, USA) and treated with

WT PFFs. At the indicated time point, cells were fixed for 2 h with 1% glutaraldehyde and 2.0%

PFA in 0.1 M phosphate buffer (PB) at pH 7.4. After washing with PBS, ICC was performed

(for more details, see the corresponding section in the Materials and Methods). Neurons with

LB-like inclusions (positively stained for pS129) were selected by fluorescence confocal

microscopy (LSM700, Carl Zeiss Microscopy) for ultrastructural analysis. The precise position


https://doi.org/10.1101/751891

34

of the selected neuron was recorded using the alpha-numeric grid etched on the dish bottom.

The cells were then fixed further with 2.5% glutaraldehyde and 2.0% paraformaldehyde in 0.1

M PB at pH 7.4 for another 2 h. After washing (5 times for 5 min) with 0.1 M cacodylate buffer

at pH 7.4, cells were post-fixed with 1% osmium tetroxide in the same buffer for 1 h and

washed with double-distilled water before contrasting with 1% uranyl acetate water for 1 h.

The cells were then dehydrated in increasing concentrations of alcohol (twice at 50%, once at

70%, once at 90%, once at 95%, and twice at 100%) for 3 min each wash. Dehydrated cells

were infiltrated with Durcupan resin diluted with absolute ethanol at 1:2 for 30 min, at 1:1 for

30 min, and 2:1 for 30 min, and twice with pure Durcupan (Electron Microscopy Sciences,

Hatfield, PA, USA) for 30 min each. After 2 h of incubation in fresh Durcupan resin, the dishes

were transferred into a 65°C oven for the resin to polymerize overnight. Once the resin had

hardened, the glass CS on the bottom of the dish was removed by repeated immersion in hot

(60°C) water, followed by liquid nitrogen. The cell of interest was then located using the

alphanumeric coordinates previously recorded and a razor blade used to cut this region away

from the rest of the resin. This piece was then glued to a resin block with acrylic glue, trimmed

with a glass knife using an ultramicrotome (Leica Ultracut UCT, Leica Microsystems), and then

ultrathin sections (50–60 nm) were cut serially from the face with a diamond knife (Diatome,

Biel, Switzerland) and collected onto 2 mm single-slot copper grids coated with formvar plastic

support film. Sections were contrasted with uranyl acetate and lead citrate and imaged with a

transmission electron microscope (Tecnai Spirit EM, FEI, The Netherlands) operating at 80

kV acceleration voltage and equipped with a digital camera (FEI Eagle, FEI).

Immunogold Staining

Primary hippocampal neurons were grown on 35 mm dishes with alphanumeric searching

grids etched to the bottom glass (MatTek Corporation, Ashland, MA, USA) and treated with

WT PFFs. At the indicated time point, cultured cells were fixed for 2 h with a buffered mix of

paraformaldehyde (2%) and glutaraldehyde (0.2%) in PB (0.1M), then washed in PBS (0.01M).

After washing with PBS, ICC was performed as described105. Briefly, cells were incubated with


https://doi.org/10.1101/751891

35

pS129 antibody (81a, Figure S4B) for 2 h at RT diluted in the blocking solution [(3% BSA and

0.1% Triton X-100 in PBS), (PBS-BSA-T)]. After five washes with PBS-BSA-T, neurons were

incubated with the Alexa Fluor647 Fluoronanogold secondary antibody (Nanoprobes, USA) for

1 h at RT. Neurons were washed five times with PBS-BSA-T and mounted in polyvinyl alcohol

mounting medium supplemented with anti-fading DABCO reagent. Neurons with LB-like

inclusions (positively stained for pS129) were selected by fluorescence confocal microscopy

(LSM700, Carl Zeiss Microscopy) for ultrastructural analysis. The precise position of the

selected neuron was recorded using the alpha-numeric grid etched on the dish bottom. The

cells were next washed in phosphate buffer (0.1M) and fixed again in 2.5% glutaraldehyde

before being rinsed in distilled water. A few drops of a silver enhancement solution (Aurion,

Netherlands) were then added to each CS to cover all of the cells and left in the dark for 1 h

at RT. The solution was then removed, and the CS washed in distilled water followed by 0.5%

osmium tetroxide for 30 min and 1% uranyl acetate for 40 min. Following this, the CS were

dehydrated through increasing concentrations of ethanol and then transferred to 100% epoxy

resin (Durcupan, Sigma Aldrich) for 4 h and then placed upside down on a glass CS in a 60°C

oven overnight. Once the resin had cured, the CS was removed, and regions of interest were

cut away with a razor blade and mounted onto a blank resin block for thin sectioning. Serial

thin sections were cut at 50 nm thickness with a diamond knife (Diatome, Switzerland) in an

ultramicrotome (UC7, Leica Microsystems) and collected onto a pioloform support firm on

copper slot grids. These were further stained with lead citrate and uranyl acetate. Sections

were imaged with a digital camera (Eagle, FEI Company) inside a transmission electron

microscope (Tecnai Spirit, FEI Company) operating at 80 kV.

Cell lysis and WB analyses of primary hippocampal neurons

Preparation of soluble and insoluble fractions

After α-syn PFFs treatment, primary hippocampal neurons were lysed as described in

Volpicelli-Daley et al.22,23. Briefly, treated neurons were lysed in 1% Triton X-100/ Tris-buffered

saline (TBS) (50 mM Tris, 150 mM NaCl, pH 7.5) supplemented with protease inhibitor


https://doi.org/10.1101/751891

36

cocktail, 1 mM phenylmethane sulfonyl fluoride (PMSF), and phosphatase inhibitor cocktail 2

and 3 (Sigma-Aldrich, Switzerland). After sonication using a fine probe [(0.5-s pulse at an

amplitude of 20%, ten times (Sonic Vibra Cell, Blanc Labo, Switzerland], cell lysates were

incubated on ice for 30 min and centrifuged at 100,000 g for 30 min at 4°C. The supernatant

(soluble fraction) was collected while the pellet was washed in 1% Triton X-100/TBS,

sonicated as described above, and centrifuged for another 30 min at 100,000 g. The

supernatant was discarded whereas the pellet (insoluble fraction) was resuspended in 2%

sodium dodecyl sulfate (SDS)/TBS supplemented with protease inhibitor cocktail, 1 mM

PMSF, and phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland), and sonicated

using a fine probe (0.5-s pulse at amplitude of 20%, 15 times).

Total cell lysates

After α-syn PFFs treatment, primary hippocampal neurons were lysed in 2% sodium dodecyl

sulfate (SDS)/TBS supplemented with protease inhibitor cocktail, 1 mM PMSF, and

phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich, Switzerland) and boiled for 10 min. The

bicinchoninic acid (BCA) protein assay was performed to quantify the protein concentration in

the total, soluble, and insoluble fractions before addition of Laemmli buffer 4× (4% SDS, 40%

glycerol, 0.05% bromophenol blue, 0.252 M Tris-HCl pH 6.8, and 5% β-mercaptoethanol).

Proteins from the total, soluble, and the insoluble fractions were then separated on a 16%

tricine gel, transferred onto a nitrocellulose membrane (Fisher Scientific, Switzerland) with a

semi-dry system (Bio-Rad, Switzerland), and immunostained as previously described105.

Proteomic identification of the proteins enriched in the insoluble fraction of the PFF-

treated neurons

Primary hippocampal neurons were treated with PBS or PFFs for 7, 14, or 21 days. Cells were

lysed at the indicated time-points into the soluble and insoluble fractions as described above.

Proteins from the insoluble fraction were then separated by SDS-PAGE on a 16%

polyacrylamide gel, which was then stained with Coomassie Safestain (Life Technologies,

Switzerland). Each gel lane was entirely sliced, and proteins were in-gel digested as previously


https://doi.org/10.1101/751891

37

described107. Peptides were desalted on stageTips108 and dried under a vacuum concentrator.

For LC-MS/MS analysis, resuspended peptides were separated by reversed phase

chromatography on a Dionex Ultimate 3000 RSLC nano UPLC system connected in-line with

an Orbitrap Lumos (Thermo Fisher Scientific, Waltham, USA). Label-free quantification (LFQ)

was performed using MaxQuant 1.6.0.1109 against the UniProt mouse database (UniProt

release 2017_05). Perseus was used to highlight differentially quantified proteins110. Reverse

proteins, contaminants, and proteins only identified by sites were filtered out. Biological

replicates were grouped together. Protein groups containing a minimum of two LFQ values in

at least one group were conserved. Empty values were imputed with random numbers from a

normal distribution (Width: 0.5 and Downshift: 1.7). Significant hits were determined by a

volcano plot-based strategy, combining t-test p-values with ratio information111. Significance

curves in the volcano plot corresponding to a SO value of 0.4 (D7 and D21) or 0.5 (D14) and

0.05 FDR were determined by a permutation-based method. Further graphical displays were

generated using a homemade program written in R (https://www.R-project.org/). Table 1

contains the final results.

Quantification of cell death in primary hippocampal neurons

Primary hippocampal neurons were plated in a 96-well plate and treated with α-syn PFFs (70

nM or up to 500 nM). After 7, 14, and 21 days of treatment, cell death was quantified using

complementary cell death assays.

Quantification of active caspase 3

The CaspaTag fluorescein caspase 3 activity kit (ImmunoChemistry Technologies, MN, USA)

allows the detection of active effector caspase (caspase 3) in living cells. These kits use the

specific fluorochrome peptide inhibitor (FAM-DEVD-fmk) of the caspase 3 (FLICA). This probe

passively enters the cells and binds irreversibly to the active caspases. Neurons were washed

twice with PBS and incubated for 30 min at 37°C with FAM-DEVD-FMK in accordance with

the supplier's instructions. Fluorescein emission was quantified using a Tecan infinite M200


https://www.r-project.org/

https://doi.org/10.1101/751891

38

Pro plate reader (Tecan, Maennedorf, Switzerland) with excitation and emission wavelengths

of 487 nm and 519 nm respectively.

Quantification of LDH release

Using a CytoTox 96® Non-Radioactive Cytotoxicity Assay (Promega, Switzerland), the lactic

acid dehydrogenase (LDH) released into culture supernatants was measured following the

manufacturer’s instructions. After a 30 min coupled enzymatic reaction, which results in the

conversion of a tetrazolium salt (INT) into a red formazan product, the amount of color formed,

that is proportional to the number of damaged cells, was measured using a Tecan infinite

M200 Pro plate reader (Tecan, Maennedorf, Switzerland) at a wavelength of 490 nm.

Quantitative real-time RT-PCR and transcriptomic analysis

Primary hippocampal neurons were treated with WT PFFs or PBS buffer for 7, 14, and 21

days. Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Switzerland) according to

the manufacturer's protocol. The concentration of each sample was measured using a

NanoDrop (NanoDrop Technologies, Wilmington, DE, USA), and the purity was confirmed

using the ratios at (260/280) nm and (260/230) nm.

Quantitative real-time RT-PCR

RNA (2 µg) was used to synthesize cDNA using the High-Capacity RNA-to-cDNA Kit (Life

Technologies) following the manufacturer's instructions. To quantify α-syn mRNAs levels, we

used the SYBR Green PCR master mix (Pack Power SYBR Green PCR mix, Life


https://doi.org/10.1101/751891

39

Technologies). Q-PCR was performed using the following primers synthesized by Microsynth

(Balgach, Switzerland):

Gene Forward sequence (5’-3’) Reverse sequence (5’-3’)

SNCA AATGTTGGAGGAGCAGTGGT GGCATGTCTTCCAGGATTCC

β-actin TTGTGATGGACTCCGGAGAC TGATGTCACGCACGATTTCC

GAPDH AACGACCCCTTCATTGACCT TGGAAGATGGTGATGGGCTT

Forty cycles of amplification were then performed in an ABI Prism 7900 (Applied Biosystem,

Foster City, USA) using a 384-well plate, which allowed the simultaneous analysis of the

genes of interest and the housekeeping genes (β-actin and GAPDH) that serve as references

for the normalization step. For each independent experiment, triplicated wells were acquired

per condition, and each experiment was reproduced at least three times independently. To

quantify the expression level of the genes of interest in the different conditions tested, the

comparative 2-ΔΔCT method was used where ΔΔCT = ΔCT(target gene)−ΔCT(reference gene)

and ΔCT = CT(target gene)−CT(reference gene). Results were expressed as the fold change

relative to control neurons (2-ΔΔCT). The geNorm method (RRID: SCR_006763,

https://genorm.cmgg.be/) was performed to assess the most stable reference gene that should

be used for the normalization of the gene expression112.

Temporal transcriptomic analysis

Libraries for mRNA-seq were prepared according to manufacturer’s instructions with the

TruSeq stranded mRNA kit (Illumina) starting from 300 ng of good-quality total RNAs (RNA

quality scores >8.9 on the TapeStation 4200). Libraries were subsequently loaded at 1.44 pM

on two High Output flow cells (Illumina) and sequenced in a NextSeq 500 instrument (Illumina)

according to manufacturer instructions, yielding 75 nt paired-end reads.

RNA-seq reads were aligned to the mm10 mouse reference genome

(GRCm38.p5) with STAR (version 2.5)113. An average of 52 million of uniquely mapped reads


https://genorm.cmgg.be/

https://www.ncbi.nlm.nih.gov/pubmed/23104886

https://doi.org/10.1101/751891

40

per sample was then assigned to genes (gencode primary assembly v16) using HTSeq-

count (version 0.9)114. The analysis was focused on protein-coding and antisense RNA genes

only, representing a total of 23,057 studied genes. Lowly expressed genes (CPM < 5) and

genes present in less than three samples were excluded prior to further processing.

Normalization and differential expression analysis of the remaining 11,767 genes were done

with the R package DEseq2 (version 1.2)115, using the internal DEseq and the

results methods. Genes with an absolute log2 fold-change greater than 1 and an FDR less

than 0.01 were considered as significantly differentially expressed. Table 2

[combined_DEseq2_FC1_FDR_0_01_PFatLeastOnce.xls] contains the final results. Tables

3-4 contains respectively analyses of mitochondrial and synaptic genes significantly enriched.

Respirometry on detached primary neurons

Primary hippocampal neurons were plated 4 weeks before respiration experiments. At 21, 14,

or 7 days before respiration, neurons were exposed to 70 nM PFFs. Immediately before

respiration experiments, cells were carefully washed with PBS, and exposed to 0.05% trypsin

for 35–40 min, until detachment of cells was clearly visible, after which DMEM F12 medium

was used to neutralize the trypsin. Cells were gently spun down (300 g for 3 min), and the

cells of 1.5 wells of 6 well plates were resuspended in DMEM F12 and used for high-resolution

respirometry. The cell suspension was transferred to MiR05 (0.5 mM EGTA, 3 mM MgCl2, 60

mM potassium lactobionate, 20 mM taurine, 10 mM KH2PO4, 20 mM HEPES, 110 mM sucrose

and 0.1% (w/v) BSA, pH 7.1) at a concentration of 2.5% cell suspension in MiR05 directly in

a 2 ml oxygraphy chamber. Respiration was measured in parallel to mitochondrial ROS

production (O2− and H2O2) at 37°C in the Oroboros O2k (calibrated for each experiment)

equipped with the O2K Fluo-LED2 Module (Oroboros Instruments, Austria). Mitochondrial

ROS measurements were performed as described previously116 using LEDs for green

excitation in the presence of 10 μM Amplex Red, 1 U/ml horseradish peroxidase, and 5 U/ml

superoxide dismutase in 2 ml MiR05 per O2K chamber. Calibration was performed by titrations

of 5 μL of 40 μM H2O2.


https://www.gencodegenes.org/mouse/release_M16.html

https://htseq.readthedocs.io/en/release_0.10.0/count.html

https://htseq.readthedocs.io/en/release_0.10.0/count.html

https://doi.org/10.1101/751891

41

Routine respiration and associated mitochondrial ROS production were assessed from

unpermeabilized cells, after which plasma membranes were permeabilized by application of

an optimized (optimal accessibility of substrates to mitochondria while maintaining

mitochondrial outer membranes intact) concentration of digitonin (5 μg/mL).

A substrate-uncoupler-inhibitor-titration (SUIT) protocol was applied to measure

oxygen flux at different respirational states on permeabilized cells, as described

previously117,118. Briefly, NADH-pathway (N) respiration in the LEAK and oxidative

phosphorylation (OXPHOS) state was analyzed in the presence of malate (2 mM), pyruvate

(10 mM) and glutamate (20 mM) before and after the addition of ADP (5 mM), respectively

(NL, NP). Addition of succinate (10 mM) allowed assessment of NADH- and Succinate-linked

respiration in OXPHOS (NSP) and the uncoupled state (NSE) after incremental (Δ0.5 μM)

addition of carbonyl cyanide m-chlorophenyl hydrazine (CCCP). Inhibition of Complex I by

rotenone (0.5 μM) yielded succinate-linked respiration in the uncoupled state (SE). Tissue-

mass specific oxygen fluxes were corrected for residual oxygen consumption, Rox, measured

after additional inhibition of the mitochondrial electron transfer system, ETS, Complex III with

antimycin A. For further normalization, fluxes of all respiratory states were divided by ETS-

capacity to obtain flux control ratios, FCR.

Terminology was applied according to

http://www.mitoglobal.org/index.php/Gnaiger_2019_MitoFit_Preprint_Arch

Mitochondrial ROS values were corrected for background fluorescence, and respirational

states before the addition of uncoupler were used for analysis.

Measurement of the mitochondrial membrane potential and the mitochondrial mass in

PFF-treated neurons

Primary hippocampal neurons were plated in a 96-well plate and treated with α-syn PFFs (70

nM). After 7, 14, and 21 days of treatment, mitochondrial membrane potential and

mitochondrial mass were quantified using the TMRE (tetramethylrhodamine, ethyl ester)


http://www.mitoglobal.org/index.php/Gnaiger_2019_MitoFit_Preprint_Arch

https://doi.org/10.1101/751891

42

assay kit (Abcam, UK) and Mitotracker Green tracer (Life Technologies, Switzerland) assays

respectively.

TMRE assay

TMRE is a permeant dye that accumulates in the active mitochondria. TMRE was added to

cells at a final concentration of 200 nM and incubated for 20 min 37°C. After a wash with PBS,

TMRE staining was quantified using a Tecan infinite M200 Pro plate reader (Tecan,

Maennedorf, Switzerland) with excitation and emission wavelengths of 549 nm and 575 nm

respectively.

Mitotracker Green assay

Mitotracker Green was added to cells at a final concentration of 20 nM and incubated for 30

min at 37°C. After a wash with PBS, TMRE staining was quantified using a Tecan infinite M200

Pro plate reader (Tecan, Maennedorf, Switzerland) with excitation and emission wavelengths

of 487 nm and 519 nm respectively.

Measurement of the synaptic area

Images were acquired on an LSM 700 microscope (Carl Zeiss Microscopy, Germany), with a

40× objective (N.A. = 1.30). The pixel size was set to 78 nm and a z-step of 400 nm; the

pinhole was set at 1 µm (equivalent 1A.U, channel 2).

To automatically analyze the z-stack images, the image analysis was performed in

Fiji119, using a custom script (in ImageJ macro language). Briefly, the script binarizes the

different channels of the image using thresholds and measures the area and perimeter.

The script binaries user selected channels of the image using a threshold, either a fixed value

or a value defined by an automatic threshold method (https://imagej.net/Auto_Threshold)

(user defined the appropriate threshold by visual inspection, c1 = DAPI, c2 = Synapsin I, c3 =

MAP2, c4 = pS129). From these resulting images, the script applies median filtering to remove

noisy pixels and outputs the final masks (user defined the radius of the median filter for each

channel, c1 = DAPI, c2 = Synapsin I, c3 = MAP2, c4 = pS129). Finally, the script measures

the area, the perimeter, and multiplies the perimeter value by the z-step (to get an estimate of


https://imagej.net/Auto_Threshold

https://doi.org/10.1101/751891

43

the surface). The generated masks are merged and saved as an output for visual validation

of the thresholding.

Relative Quantification of WBs and Statistical Analysis

The level of total α-syn (15 kDa, 12 kDa, or HMW) or pS129-α-syn were estimated by

measuring the WB band intensity using Image J software (U.S. National Institutes of Health,

Maryland, USA; RRID:SCR_001935) and normalized to the relative protein levels of actin. All

the experiments were independently repeated three times. The statistical analyses were

performed using Student’s t-test or ANOVA test followed by a Tukey-Kramer post-hoc test

using KaleidaGraph (RRID:SCR_014980). The data were regarded as statistically significant

at p<0.05.

Acknowledgments

This work was supported by funding from EPFL and UCB (H.A.L, A.L.M, J.B, N.M, and L.W).

We thank F.A for the production and the characterization of α-syn monomers and fibrils

depicted in Figure S1. We are grateful to Dr. Arne Seitz and his staff at the Bio-imaging Core

Facility (BioP, EPFL) for their technical support and helpful discussions. We thank Dr Romain

Guiet (BioP, EPFL) for the development of a custom script (in ImageJ macro language) used

for post-processing imaging analysis. We thank the Proteomics Core Facility (EPFL): Dr Marc

Moniatte for the discussions, and Romain Hamelin and Dr. Florence Armand for handling the

samples and for their valuable discussions. We thank Dr Gerardo Turcatti and his staff at the

Biomolecular Screening Core Facility (EPFL) for the discussions and their technical support.

We thank Dr. Bastien Mangeat and his staff at Gene expression Core Facility (EPFL) for their

technical support in handling the samples. We also thank Stéphanie Rosset and Anaëlle

Dubois at the Bio-EM Core facility (EPFL) for their technical support. Figures 9 and S14 have

been prepared partially created using with BioRender.


http://personnes.epfl.ch/gerardo.turcatti

https://doi.org/10.1101/751891

44

Author contributions

H.A.L conceived and supervised the study. H.A.L and A.L.M.M designed all the experiments

and wrote the paper. A.L.M.M performed and analyzed the experiments shown in Figures 1-

5, 6A, 6E-G, 7-9, and Figures S1B-S13. J.B designed, performed, and analyzed the

experiments shown in Figures 6B-D and S14. N.M analyzed the experiments shown in Figures

4 and S8, S12-S13. L.W performed and analyzed the experiments shown in Figures 6G and

7A. M.L. analyzed the transcriptomic data and participated to the Figures 4D, 5, 8G-H, I and

S9. F.K developed the pipeline for High Content Image Analysis (HCA) using Cell Profiler

software shown in Figures S3 G-I and Figure 8D-F. M.C prepared the samples for CLEM

analysis and acquired EM images in Figures 2, 3, and S5. G.K supervised the experiments

shown in Figures 1L, 2-3, and S5 and contributed to the interpretation of the data. All authors

reviewed and contributed to the writing.

Competing interests statement

Authors declare no competing financial interests in association with this manuscript.


https://doi.org/10.1101/751891

45

References

1 Goedert, M., Jakes, R. & Spillantini, M. G. The Synucleinopathies: Twenty Years On. Journal of Parkinson's disease 7, S53-S71, doi:10.3233/jpd-179005 (2017).

2 Spillantini, M. G., Crowther, R. A., Jakes, R., Hasegawa, M. & Goedert, M. alpha-Synuclein in filamentous inclusions of Lewy bodies from Parkinson's disease and dementia with lewy bodies. Proceedings of the National Academy of Sciences of the United States of America 95, 6469-6473 (1998).

3 Halliday, G. M., Holton, J. L., Revesz, T. & Dickson, D. W. Neuropathology underlying clinical variability in patients with synucleinopathies. Acta neuropathologica 122, 187-204, doi:10.1007/s00401-011-0852-9 (2011).

4 Peng, C., Gathagan, R. J. & Lee, V. M. Distinct alpha-Synuclein strains and implications for heterogeneity among alpha-Synucleinopathies. Neurobiology of disease 109, 209-218, doi:10.1016/j.nbd.2017.07.018 (2018).

5 Peelaerts, W., Bousset, L., Baekelandt, V. & Melki, R. a-Synuclein strains and seeding in Parkinson's disease, incidental Lewy body disease, dementia with Lewy bodies and multiple system atrophy: similarities and differences. Cell and tissue research, doi:10.1007/s00441-018-2839-5 (2018).

6 Forno, L. S. Concentric hyalin intraneuronal inclusions of Lewy type in the brains of elderly persons (50 incidental cases): relationship to parkinsonism. Journal of the American Geriatrics Society 17, 557-575 (1969).

7 Forno, L. S., DeLanney, L. E., Irwin, I. & Langston, J. W. Electron microscopy of Lewy bodies in the amygdala-parahippocampal region. Comparison with inclusion bodies in the MPTP-treated squirrel monkey. Advances in neurology 69, 217-228 (1996).

8 Forno, L. S. & Norville, R. L. Ultrastructure of Lewy bodies in the stellate ganglion. Acta neuropathologica 34, 183-197 (1976).

9 Azeredo da Silveira, S. et al. Phosphorylation does not prompt, nor prevent, the formation of alpha-synuclein toxic species in a rat model of Parkinson's disease. Human molecular genetics 18, 872-887, doi:10.1093/hmg/ddn417 (2009).

10 Bourdenx, M. et al. Lack of additive role of ageing in nigrostriatal neurodegeneration triggered by alpha-synuclein overexpression. Acta neuropathologica communications 3, 46, doi:10.1186/s40478-015-0222-2 (2015).

11 Daniel, G. et al. alpha-Synuclein-induced dopaminergic neurodegeneration in a rat model of Parkinson's disease occurs independent of ATP13A2 (PARK9). Neurobiology of disease 73, 229-243, doi:10.1016/j.nbd.2014.10.007 (2015).

12 Decressac, M., Mattsson, B. & Bjorklund, A. Comparison of the behavioural and histological characteristics of the 6-OHDA and alpha-synuclein rat models of Parkinson's disease. Experimental neurology 235, 306-315, doi:10.1016/j.expneurol.2012.02.012 (2012).

13 Fares, M. B. et al. Induction of de novo alpha-synuclein fibrillization in a neuronal model for Parkinson's disease. Proceedings of the National Academy of Sciences of the United States of America 113, E912-921, doi:10.1073/pnas.1512876113 (2016).

14 Koprich, J. B., Johnston, T. H., Reyes, M. G., Sun, X. & Brotchie, J. M. Expression of human A53T alpha-synuclein in the rat substantia nigra using a novel AAV1/2 vector produces a rapidly evolving pathology with protein aggregation, dystrophic neurite architecture and nigrostriatal degeneration with potential to model the pathology of Parkinson's disease. Molecular neurodegeneration 5, 43, doi:10.1186/1750-1326-5-43 (2010).

15 Oliveras-Salva, M. et al. rAAV2/7 vector-mediated overexpression of alpha-synuclein in mouse substantia nigra induces protein aggregation and progressive dose-dependent neurodegeneration. Molecular neurodegeneration 8, 44, doi:10.1186/1750-1326-8-44 (2013).

16 Taschenberger, G. et al. Aggregation of alphaSynuclein promotes progressive in vivo neurotoxicity in adult rat dopaminergic neurons. Acta neuropathologica 123, 671-683, doi:10.1007/s00401-011-0926-8 (2012).


https://doi.org/10.1101/751891

46

17 Ulusoy, A., Decressac, M., Kirik, D. & Bjorklund, A. Viral vector-mediated overexpression of alpha-synuclein as a progressive model of Parkinson's disease. Progress in brain research 184, 89-111, doi:10.1016/s0079-6123(10)84005-1 (2010).

18 Van der Perren, A. et al. Development of an Alpha-synuclein Based Rat Model for Parkinson's Disease via Stereotactic Injection of a Recombinant Adeno-associated Viral Vector. Journal of visualized experiments : JoVE, 53670, doi:10.3791/53670 (2016).

19 Yamada, M., Iwatsubo, T., Mizuno, Y. & Mochizuki, H. Overexpression of alpha-synuclein in rat substantia nigra results in loss of dopaminergic neurons, phosphorylation of alpha-synuclein and activation of caspase-9: resemblance to pathogenetic changes in Parkinson's disease. Journal of neurochemistry 91, 451-461, doi:10.1111/j.1471-4159.2004.02728.x (2004).

20 Ko, L. W., Ko, H. H., Lin, W. L., Kulathingal, J. G. & Yen, S. H. Aggregates assembled from overexpression of wild-type alpha-synuclein are not toxic to human neuronal cells. Journal of neuropathology and experimental neurology 67, 1084-1096, doi:10.1097/NEN.0b013e31818c3618 (2008).

21 Ostrerova-Golts, N. et al. The A53T alpha-synuclein mutation increases iron-dependent aggregation and toxicity. The Journal of neuroscience : the official journal of the Society for Neuroscience 20, 6048-6054 (2000).

22 Volpicelli-Daley, L. A., Luk, K. C. & Lee, V. M. Addition of exogenous alpha-synuclein preformed fibrils to primary neuronal cultures to seed recruitment of endogenous alpha-synuclein to Lewy body and Lewy neurite-like aggregates. Nature protocols 9, 2135-2146, doi:10.1038/nprot.2014.143 (2014).

23 Volpicelli-Daley, L. A. et al. Exogenous alpha-synuclein fibrils induce Lewy body pathology leading to synaptic dysfunction and neuron death. Neuron 72, 57-71, doi:10.1016/j.neuron.2011.08.033 (2011).

24 Luk, K. C. & Lee, V. M. Modeling Lewy pathology propagation in Parkinson's disease. Parkinsonism & related disorders 20 Suppl 1, S85-87, doi:10.1016/s1353-8020(13)70022-1 (2014).

25 Gai, W. P. et al. In situ and in vitro study of colocalization and segregation of alpha-synuclein, ubiquitin, and lipids in Lewy bodies. Experimental neurology 166, 324-333, doi:10.1006/exnr.2000.7527 (2000).

26 den Jager, W. A. Sphingomyelin in Lewy inclusion bodies in Parkinson's disease. Archives of neurology 21, 615-619, doi:10.1001/archneur.1969.00480180071006 (1969).

27 Duffy, P. E. & Tennyson, V. M. Phase and Electron Microscopic Observations of Lewy Bodies and Melanin Granules in the Substantia Nigra and Locus Caeruleus in Parkinson's Disease*†. Journal of Neuropathology & Experimental Neurology 24, 398-414, doi:10.1097/00005072-196507000-00003 (1965).

28 Forno, L. S. Neuropathology of Parkinson's disease. Journal of neuropathology and experimental neurology 55, 259-272, doi:10.1097/00005072-199603000-00001 (1996).

29 Hayashida, K., Oyanagi, S., Mizutani, Y. & Yokochi, M. An early cytoplasmic change before Lewy body maturation: an ultrastructural study of the substantia nigra from an autopsy case of juvenile parkinsonism. Acta neuropathologica 85, 445-448 (1993).

30 Takahashi, H., Iwanaga, K., Egawa, S. & Ikuta, F. Ultrastructural Relationship between Lewy Bodies and Pale Bodies Studied in Locus Ceruleus Neurons of a Non-Parkinsonian Patient. Neuropathology : official journal of the Japanese Society of Neuropathology 14, 73-80, doi:10.1111/j.1440-1789.1994.tb00242.x (1994).

31 Wakabayashi, K. et al. Accumulation of alpha-synuclein/NACP is a cytopathological feature common to Lewy body disease and multiple system atrophy. Acta neuropathologica 96, 445-452 (1998).

32 Shahmoradian, S. H. et al. Lewy pathology in Parkinson's disease consists of a crowded organellar, membranous medley. bioRxiv, 137976, doi:10.1101/137976 (2019).


https://doi.org/10.1101/751891

47

33 Mahul-Mellier, A.-L. et al. The making of a Lewy body: the role of α-synuclein post-fibrillization modifications in regulating the formation and the maturation of pathological inclusions. bioRxiv, 500058, doi:10.1101/500058 (2018).

34 Anderson, J. P. et al. Phosphorylation of Ser-129 is the dominant pathological modification of alpha-synuclein in familial and sporadic Lewy body disease. The Journal of biological chemistry 281, 29739-29752, doi:10.1074/jbc.M600933200 (2006).

35 Baba, M. et al. Aggregation of alpha-synuclein in Lewy bodies of sporadic Parkinson's disease and dementia with Lewy bodies. The American journal of pathology 152, 879-884 (1998).

36 Li, W. et al. Aggregation promoting C-terminal truncation of alpha-synuclein is a normal cellular process and is enhanced by the familial Parkinson's disease-linked mutations. Proceedings of the National Academy of Sciences of the United States of America 102, 2162-2167, doi:10.1073/pnas.0406976102 (2005).

37 Prasad, K., Beach, T. G., Hedreen, J. & Richfield, E. K. Critical role of truncated alpha-synuclein and aggregates in Parkinson's disease and incidental Lewy body disease. Brain pathology (Zurich, Switzerland) 22, 811-825, doi:10.1111/j.1750-3639.2012.00597.x (2012).

38 Tong, J. et al. Brain alpha-synuclein accumulation in multiple system atrophy, Parkinson's disease and progressive supranuclear palsy: a comparative investigation. Brain : a journal of neurology 133, 172-188, doi:10.1093/brain/awp282 (2010).

39 Kuusisto, E., Parkkinen, L. & Alafuzoff, I. Morphogenesis of Lewy bodies: dissimilar incorporation of alpha-synuclein, ubiquitin, and p62. Journal of neuropathology and experimental neurology 62, 1241-1253 (2003).

40 Grassi, D. et al. Identification of a highly neurotoxic alpha-synuclein species inducing mitochondrial damage and mitophagy in Parkinson's disease. Proceedings of the National Academy of Sciences of the United States of America 115, E2634-E2643, doi:10.1073/pnas.1713849115 (2018).

41 Tanik, S. A., Schultheiss, C. E., Volpicelli-Daley, L. A., Brunden, K. R. & Lee, V. M. Lewy body-like alpha-synuclein aggregates resist degradation and impair macroautophagy. The Journal of biological chemistry 288, 15194-15210, doi:10.1074/jbc.M113.457408 (2013).

42 Wakabayashi, K. et al. The Lewy body in Parkinson's disease and related neurodegenerative disorders. Molecular neurobiology 47, 495-508, doi:10.1007/s12035-012-8280-y (2013).

43 Soper, J. H. et al. Alpha-synuclein-induced aggregation of cytoplasmic vesicles in Saccharomyces cerevisiae. Molecular biology of the cell 19, 1093-1103, doi:10.1091/mbc.E07-08-0827 (2008).

44 Issidorides, M. R., Mytilineou, C., Panayotacopoulou, M. T. & Yahr, M. D. Lewy bodies in parkinsonism share components with intraneuronal protein bodies of normal brains. Journal of neural transmission. Parkinson's disease and dementia section 3, 49-61 (1991).

45 Moors, T. E. et al. The orchestration of subcellular alpha-synuclein pathology in the Parkinson’s disease brain revealed by STED microscopy. bioRxiv, 470476, doi:10.1101/470476 (2019).

46 Shahmoradian, S. H. et al. Lewy pathology in Parkinson's disease consists of crowded organelles and lipid membranes. Nature neuroscience 22, 1099-1109, doi:10.1038/s41593-019-0423-2 (2019).

47 Araki, K. et al. Synchrotron FTIR micro-spectroscopy for structural analysis of Lewy bodies in the brain of Parkinson's disease patients. Scientific reports 5, 17625, doi:10.1038/srep17625 (2015).

48 Leverenz, J. B. et al. Proteomic identification of novel proteins in cortical lewy bodies. Brain pathology (Zurich, Switzerland) 17, 139-145, doi:10.1111/j.1750-3639.2007.00048.x (2007).

49 Xia, Q. et al. Proteomic identification of novel proteins associated with Lewy bodies. Frontiers in bioscience : a journal and virtual library 13, 3850-3856 (2008).


https://doi.org/10.1101/751891

48

50 Winklhofer, K. F., Tatzelt, J. & Haass, C. The two faces of protein misfolding: gain- and loss-of-function in neurodegenerative diseases. The EMBO journal 27, 336-349, doi:10.1038/sj.emboj.7601930 (2008).

51 Villar-Pique, A., Lopes da Fonseca, T. & Outeiro, T. F. Structure, function and toxicity of alpha-synuclein: the Bermuda triangle in synucleinopathies. Journal of neurochemistry 139 Suppl 1, 240-255, doi:10.1111/jnc.13249 (2016).

52 Valastyan, J. S. & Lindquist, S. Mechanisms of protein-folding diseases at a glance. Disease models & mechanisms 7, 9-14, doi:10.1242/dmm.013474 (2014).

53 Paine, H. Does loss of the normal protein function contribute to the pathogenesis of Huntington's disease? Bioscience Horizons: The International Journal of Student Research 8, doi:10.1093/biohorizons/hzv005 (2015).

54 Oikawa, T. et al. alpha-Synuclein Fibrils Exhibit Gain of Toxic Function, Promoting Tau Aggregation and Inhibiting Microtubule Assembly. The Journal of biological chemistry 291, 15046-15056, doi:10.1074/jbc.M116.736355 (2016).

55 Hunn, B. H., Cragg, S. J., Bolam, J. P., Spillantini, M. G. & Wade-Martins, R. Impaired intracellular trafficking defines early Parkinson's disease. Trends in neurosciences 38, 178-188, doi:10.1016/j.tins.2014.12.009 (2015).

56 Lamberts, J. T. & Brundin, P. Axonal transport dysfunction in neurodegenerative diseases: the "holy grail" for developing disease modifying therapies? Neurobiology of disease 105, 271-272, doi:10.1016/j.nbd.2017.06.018 (2017).

57 Castillo, P. E., Younts, T. J., Chavez, A. E. & Hashimotodani, Y. Endocannabinoid signaling and synaptic function. Neuron 76, 70-81, doi:10.1016/j.neuron.2012.09.020 (2012).

58 Kim, H. Y. et al. Mitochondrial Ca(2+) uptake is essential for synaptic plasticity in pain. The Journal of neuroscience : the official journal of the Society for Neuroscience 31, 12982-12991, doi:10.1523/jneurosci.3093-11.2011 (2011).

59 Monick, M. M. et al. Constitutive ERK MAPK activity regulates macrophage ATP production and mitochondrial integrity. Journal of immunology (Baltimore, Md. : 1950) 180, 7485-7496, doi:10.4049/jimmunol.180.11.7485 (2008).

60 Yu, Q. et al. Mitochondrial Dysfunction Triggers Synaptic Deficits via Activation of p38 MAP Kinase Signaling in Differentiated Alzheimer's Disease Trans-Mitochondrial Cybrid Cells. Journal of Alzheimer's disease : JAD 59, 223-239, doi:10.3233/jad-170283 (2017).

61 Yamagata, Y. & Nairn, A. C. Contrasting features of ERK1/2 activity and synapsin I phosphorylation at the ERK1/2-dependent site in the rat brain in status epilepticus induced by kainic acid in vivo. Brain research 1625, 314-323, doi:10.1016/j.brainres.2015.08.023 (2015).

62 Vara, H., Onofri, F., Benfenati, F., Sassoe-Pognetto, M. & Giustetto, M. ERK activation in axonal varicosities modulates presynaptic plasticity in the CA3 region of the hippocampus through synapsin I. Proceedings of the National Academy of Sciences of the United States of America 106, 9872-9877, doi:10.1073/pnas.0900077106 (2009).

63 Zamora-Martinez, E. R. & Edwards, S. Neuronal extracellular signal-regulated kinase (ERK) activity as marker and mediator of alcohol and opioid dependence. Frontiers in integrative neuroscience 8, 24, doi:10.3389/fnint.2014.00024 (2014).

64 Giachello, C. N. et al. MAPK/Erk-dependent phosphorylation of synapsin mediates formation of functional synapses and short-term homosynaptic plasticity. Journal of cell science 123, 881-893, doi:10.1242/jcs.056846 (2010).

65 Bohush, A., Niewiadomska, G. & Filipek, A. Role of Mitogen Activated Protein Kinase Signaling in Parkinson's Disease. International journal of molecular sciences 19, doi:10.3390/ijms19102973 (2018).

66 Dzamko, N., Zhou, J., Huang, Y. & Halliday, G. M. Parkinson's disease-implicated kinases in the brain; insights into disease pathogenesis. Frontiers in molecular neuroscience 7, 57, doi:10.3389/fnmol.2014.00057 (2014).


https://doi.org/10.1101/751891

49

67 Kim, E. K. & Choi, E. J. Pathological roles of MAPK signaling pathways in human diseases. Biochimica et biophysica acta 1802, 396-405, doi:10.1016/j.bbadis.2009.12.009 (2010).

68 Zhu, J. H., Guo, F., Shelburne, J., Watkins, S. & Chu, C. T. Localization of phosphorylated ERK/MAP kinases to mitochondria and autophagosomes in Lewy body diseases. Brain pathology (Zurich, Switzerland) 13, 473-481 (2003).

69 Zhu, J. H., Kulich, S. M., Oury, T. D. & Chu, C. T. Cytoplasmic aggregates of phosphorylated extracellular signal-regulated protein kinases in Lewy body diseases. The American journal of pathology 161, 2087-2098, doi:10.1016/s0002-9440(10)64487-2 (2002).

70 Afitska, K., Fucikova, A., Shvadchak, V. V. & Yushchenko, D. A. alpha-Synuclein aggregation at low concentrations. Biochimica et biophysica acta. Proteins and proteomics, doi:10.1016/j.bbapap.2019.05.003 (2019).

71 Fares, M. B. et al. The novel Parkinson's disease linked mutation G51D attenuates in vitro aggregation and membrane binding of alpha-synuclein, and enhances its secretion and nuclear localization in cells. Human molecular genetics 23, 4491-4509, doi:10.1093/hmg/ddu165 (2014).

72 Narkiewicz, J., Giachin, G. & Legname, G. In vitro aggregation assays for the characterization of alpha-synuclein prion-like properties. Prion 8, 19-32, doi:10.4161/pri.28125 (2014).

73 Wordehoff, M. M. & Hoyer, W. alpha-Synuclein Aggregation Monitored by Thioflavin T Fluorescence Assay. Bio-protocol 8, doi:10.21769/BioProtoc.2941 (2018).

74 Duffy, M. F. et al. Quality Over Quantity: Advantages of Using Alpha-Synuclein Preformed Fibril Triggered Synucleinopathy to Model Idiopathic Parkinson's Disease. Frontiers in neuroscience 12, 621, doi:10.3389/fnins.2018.00621 (2018).

75 Forno, L. S. The Lewy body in Parkinson's disease. Advances in neurology 45, 35-43 (1987). 76 Karpowicz, R. J., Jr., Trojanowski, J. Q. & Lee, V. M. Transmission of alpha-synuclein seeds in

neurodegenerative disease: recent developments. Laboratory investigation; a journal of technical methods and pathology, doi:10.1038/s41374-019-0195-z (2019).

77 Forno, L. S. Lewy bodies. The New England journal of medicine 314, 122, doi:10.1056/nejm198601093140219 (1986).

78 Uryu, K. et al. Convergence of heat shock protein 90 with ubiquitin in filamentous alpha-synuclein inclusions of alpha-synucleinopathies. The American journal of pathology 168, 947-961 (2006).

79 Kanazawa, T. et al. Three-layered structure shared between Lewy bodies and lewy neurites-three-dimensional reconstruction of triple-labeled sections. Brain pathology (Zurich, Switzerland) 18, 415-422, doi:10.1111/j.1750-3639.2008.00140.x (2008).

80 Wakabayashi, K., Takahashi, H., Takeda, S., Ohama, E. & Ikuta, F. Parkinson's disease: the presence of Lewy bodies in Auerbach's and Meissner's plexuses. Acta neuropathologica 76, 217-221 (1988).

81 Lampert, P. W. A comparative electron microscopic study of reactive, degenerating, regenerating, and dystrophic axons. Journal of neuropathology and experimental neurology 26, 345-368, doi:10.1097/00005072-196707000-00001 (1967).

82 Dickson, D. W. et al. Hippocampal degeneration differentiates diffuse Lewy body disease (DLBD) from Alzheimer's disease: light and electron microscopic immunocytochemistry of CA2-3 neurites specific to DLBD. Neurology 41, 1402-1409, doi:10.1212/wnl.41.9.1402 (1991).

83 Gomez-Tortosa, E., Newell, K., Irizarry, M. C., Sanders, J. L. & Hyman, B. T. alpha-Synuclein immunoreactivity in dementia with Lewy bodies: morphological staging and comparison with ubiquitin immunostaining. Acta neuropathologica 99, 352-357 (2000).

84 Sakamoto, M. et al. Heterogeneity of nigral and cortical Lewy bodies differentiated by amplified triple-labeling for alpha-synuclein, ubiquitin, and thiazin red. Experimental neurology 177, 88-94 (2002).


https://doi.org/10.1101/751891

50

85 Vaikath, N. N. et al. Heterogeneity in alpha-synuclein subtypes and their expression in cortical brain tissue lysates from Lewy body diseases and Alzheimer's disease. Neuropathology and applied neurobiology, doi:10.1111/nan.12531 (2018).

86 Shults, C. W. Lewy bodies. Proceedings of the National Academy of Sciences of the United States of America 103, 1661-1668, doi:10.1073/pnas.0509567103 (2006).

87 Henderson, M. X. et al. Unbiased Proteomics of Early Lewy Body Formation Model Implicates Active Microtubule Affinity-Regulating Kinases (MARKs) in Synucleinopathies. The Journal of neuroscience : the official journal of the Society for Neuroscience 37, 5870-5884, doi:10.1523/jneurosci.2705-16.2017 (2017).

88 Bedford, L. et al. Depletion of 26S Proteasomes in Mouse Brain Neurons Causes Neurodegeneration and Lewy-Like Inclusions Resembling Human Pale Bodies. The Journal of Neuroscience 28, 8189, doi:10.1523/JNEUROSCI.2218-08.2008 (2008).

89 Olanow, C. W., Perl, D. P., DeMartino, G. N. & McNaught, K. S. Lewy-body formation is an aggresome-related process: a hypothesis. The Lancet. Neurology 3, 496-503, doi:10.1016/s1474-4422(04)00827-0 (2004).

90 Froula, J. M. et al. alpha-Synuclein fibril-induced paradoxical structural and functional defects in hippocampal neurons. Acta neuropathologica communications 6, 35, doi:10.1186/s40478-018-0537-x (2018).

91 Wu, Q. et al. Alpha-synuclein (alphaSyn) preformed fibrils induce endogenous alphaSyn aggregation, compromise synaptic activity and enhance synapse loss in cultured excitatory hippocampal neurons. The Journal of neuroscience : the official journal of the Society for Neuroscience, doi:10.1523/jneurosci.0060-19.2019 (2019).

92 Beal, M. F. Mitochondria, oxidative damage, and inflammation in Parkinson's disease. Annals of the New York Academy of Sciences 991, 120-131 (2003).

93 Betarbet, R., Sherer, T. B., Di, D. A. & Greenamyre, J. T. Mechanistic approaches to Parkinson's disease pathogenesis. Brain pathology 12, 499-510 (2002).

94 Wang, X. et al. Pathogenic alpha-synuclein aggregates preferentially bind to mitochondria and affect cellular respiration. Acta neuropathologica communications 7, 41 (2019).

95 Tapias, V. et al. Synthetic alpha-synuclein fibrils cause mitochondrial impairment and selective dopamine neurodegeneration in part via iNOS-mediated nitric oxide production. Cellular and molecular life sciences : CMLS 74, 2851-2874, doi:10.1007/s00018-017-2541-x (2017).

96 Grunewald, A. et al. Mitochondrial DNA Depletion in Respiratory Chain-Deficient Parkinson Disease Neurons. Annals of neurology 79, 366-378, doi:10.1002/ana.24571 (2016).

97 Schapira, A. H. Mitochondrial complex I deficiency in Parkinson's disease. Advances in neurology 60, 288-291 (1993).

98 Schapira, A. H. et al. Anatomic and disease specificity of NADH CoQ1 reductase (complex I) deficiency in Parkinson's disease. Journal of neurochemistry 55, 2142-2145 (1990).

99 Bellucci, A. et al. Review: Parkinson's disease: from synaptic loss to connectome dysfunction. Neuropathology and applied neurobiology 42, 77-94, doi:10.1111/nan.12297 (2016).

100 Zaltieri, M. et al. Mitochondrial Dysfunction and alpha-Synuclein Synaptic Pathology in Parkinson's Disease: Who's on First? Parkinson's disease 2015, 108029, doi:10.1155/2015/108029 (2015).

101 Zaja-Milatovic, S. et al. Selective dendritic degeneration of medium spiny neurons in dementia with Lewy bodies. Neurology 66, 1591-1593, doi:10.1212/01.wnl.0000216137.09685.c1 (2006).

102 Kramer, M. L. & Schulz-Schaeffer, W. J. Presynaptic alpha-synuclein aggregates, not Lewy bodies, cause neurodegeneration in dementia with Lewy bodies. The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 1405-1410, doi:10.1523/jneurosci.4564-06.2007 (2007).

103 Bridi, J. C. & Hirth, F. Mechanisms of alpha-Synuclein Induced Synaptopathy in Parkinson's Disease. Frontiers in neuroscience 12, 80, doi:10.3389/fnins.2018.00080 (2018).


https://doi.org/10.1101/751891

51

104 Fauvet, B. et al. alpha-Synuclein in central nervous system and from erythrocytes, mammalian cells, and Escherichia coli exists predominantly as disordered monomer. The Journal of biological chemistry 287, 15345-15364, doi:10.1074/jbc.M111.318949 (2012).

105 Mahul-Mellier, A. L. et al. Fibril growth and seeding capacity play key roles in alpha-synuclein-mediated apoptotic cell death. Cell death and differentiation 22, 2107-2122, doi:10.1038/cdd.2015.79 (2015).

106 Steiner, P. et al. Modulation of receptor cycling by neuron-enriched endosomal protein of 21 kD. The Journal of cell biology 157, 1197-1209, doi:10.1083/jcb.200202022 (2002).

107 Dorin-Semblat, D. et al. Malaria Parasite-Infected Erythrocytes Secrete PfCK1, the Plasmodium Homologue of the Pleiotropic Protein Kinase Casein Kinase 1. PloS one 10, e0139591, doi:10.1371/journal.pone.0139591 (2015).

108 Rappsilber, J., Mann, M. & Ishihama, Y. Protocol for micro-purification, enrichment, pre-fractionation and storage of peptides for proteomics using StageTips. Nature protocols 2, 1896-1906, doi:10.1038/nprot.2007.261 (2007).

109 Cox, J. et al. Accurate proteome-wide label-free quantification by delayed normalization and maximal peptide ratio extraction, termed MaxLFQ. Molecular & cellular proteomics : MCP 13, 2513-2526, doi:10.1074/mcp.M113.031591 (2014).

110 Tyanova, S. et al. The Perseus computational platform for comprehensive analysis of (prote)omics data. Nature methods 13, 731-740, doi:10.1038/nmeth.3901 (2016).

111 Hubner, N. C. et al. Quantitative proteomics combined with BAC TransgeneOmics reveals in vivo protein interactions. The Journal of cell biology 189, 739-754, doi:10.1083/jcb.200911091 (2010).

112 Vandesompele, J. et al. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome biology 3, RESEARCH0034 (2002).

113 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics (Oxford, England) 29, 15-21, doi:10.1093/bioinformatics/bts635 (2013).

114 Anders, S., Pyl, P. T. & Huber, W. HTSeq--a Python framework to work with high-throughput sequencing data. Bioinformatics (Oxford, England) 31, 166-169, doi:10.1093/bioinformatics/btu638 (2015).

115 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome biology 15, 550, doi:10.1186/s13059-014-0550-8 (2014).

116 Makrecka-Kuka, M., Krumschnabel, G. & Gnaiger, E. High-resolution respirometry for simultaneous measurement of oxygen and hydrogen peroxide fluxes in permeabilized cells, tissue homogenate and isolated mitochondria. Biomolecules 5, 1319-1338 (2015).

117 Burtscher, J., Zangrandi, L., Schwarzer, C. & Gnaiger, E. Differences in mitochondrial function in homogenated samples from healthy and epileptic specific brain tissues revealed by high-resolution respirometry. Mitochondrion 25, 104-112, doi:10.1016/j.mito.2015.10.007 (2015).

118 Pesta, D. & Gnaiger, E. High-resolution respirometry: OXPHOS protocols for human cells and permeabilized fibers from small biopsies of human muscle. Methods in molecular biology (Clifton, N.J.) 810, 25-58, doi:10.1007/978-1-61779-382-0_3 (2012).

119 Schindelin, J. et al. Fiji: an open-source platform for biological-image analysis. Nature methods 9, 676-682, doi:10.1038/nmeth.2019 (2012).


https://doi.org/10.1101/751891

52

Figures titles and Legends

Figure 1. At early stage, α-syn-seeded fibrillar aggregates share the

immunohistochemical but not the structural and morphological features of the bona

fide human LBs.

A. Seeding model in primary hippocampal neurons. 70 nM of mouse sonicated PFFs were

added to neurons at DIV 5 (days in vitro). Control neurons were treated with PBS used to

prepare PFFs. Following a defined period of 4 days (D4) during which no seeded aggregates

are detected, α-syn aggregates first appear in the neuronal extension (between D4 to D7)

before being detected in the neuronal cell bodies (D7–D14) where they eventually accumulate

(D14 to D21).

B. The formation of α-syn aggregates in the context of the neuronal seeding requires a

sequence of events starting with 1) the internalization and cleavage of PFF seeds (D0–D1)

followed by 2) the initiation of the seeding by the recruitment of endogenous α-syn (D0–D4),

3) fibril elongation along with the incorporation of PTMs, such as phosphorylation at residue

S129 (D4–D14), and 4) formation of large filamentous aggregates (D7–D14).

C-J, M-P. Temporal analysis of α-syn aggregates formed at D7 (C, E, G, I), at D14 (D, F, H,

J), and at D21(M-P) in WT neurons after addition of α-syn PFFs. Aggregates were detected

by ICC using pS129 (MJFR13 or 81a) in combination with total α-syn (epitope: 1-20) (C-D, M),

p62 (E-F, N) or ubiquitin (G-H, O) antibodies. Aggregates were also stained with the

Amytracker dye (I-J, P). Neurons were counterstained with microtubule-associated protein

(MAP2) antibody, and the nucleus was counterstained with DAPI staining. Scale bars = 10

μm.

K. WB analysis of α-syn seeded-aggregates formed 14 days after adding mouse PFFs to WT

neurons. Control neurons were treated with PBS. After sequential extractions, the insoluble

fractions of neuronal cell lysates were analyzed by immunoblotting. Total α-syn, pS129, and

actin were detected by SYN-1, pS129 (MJFR13), and actin antibodies, respectively.

Monomeric α-syn (15 kDa) is indicated by a double asterisk; C-terminal truncated α-syn (12


https://doi.org/10.1101/751891

53

kDa) is indicated by a single asterisk; the higher molecular weights (HMWs) corresponding to

the newly formed fibrils are detected from 25 kDa to the top of the gel.

L. At D14, neurons were fixed, and ICC with a pS129 (81a) antibody was performed and

imaged by confocal microscopy (upper images). Scale bar = 5 μm. The selected neuron was

embedded and cut by an ultramicrotome. Serial sections were examined by EM (bottom

image). Immunogold labeling allowed the detection of long filaments in the neuronal cell body

that appeared as tightly packed bundles of fibrils that were positive for pS129-α-syn. Scale

bar = 500 nm.

Q. In this study, we employed an integrated approach using advanced techniques in confocal

imaging, EM, proteomics, transcriptomic, and biochemistry to investigate, at the spatio-

temporal resolution (from D7 to D21), how the seeded intracellular aggregates recapitulate

the Lewy body-like inclusion pathology at the morphological, biochemical, structural, and

biological levels.

Figure 2. Formation and maturation of LB-like inclusions require the lateral association

and the fragmentation of the newly formed α-syn fibrils over time.

PFFs were added for 7, 14, and 21 days to the extracellular media of primary hippocampal

neurons plated on dishes with alpha-numerical searching grids imprinted on the bottom,

which allowed easy localization of the cells. At the indicated time, neurons were fixed, ICC

against pS129-α-syn was performed and imaged by confocal microscopy (A, B, D, F top

images; scale bar = 10 μm), and the selected neurons were embedded and cut using a

ultramicrotome. Serial sections were examined by EM (A, B, D, F bottom images). Aa. Neurite

with pS129-positive newly formed α-syn fibrils. Ab. Neurite negative for pS129 staining. Ab,

inset. Graph representing the mean ± SD of the width of the microtubules compared to the

newly formed fibrils at D7 (a minimum of 120 microtubules or newly formed fibrils were

counted). Measurements confirmed that the width of newly formed α-syn fibrils of 11.94±3.97

nm (SD) is significantly smaller than the average width of the microtubules of 18.67±2.94 nm


https://doi.org/10.1101/751891

54

(SD). p<0.001=*** (student t-test for unpaired data with equal variance), indicating that this

parameter can be used to discriminate the newly formed fibrils from the cytoskeletal proteins.

Autophagolysosomal-like vesicles are indicated by a yellow asterisk (D) or colored in yellow

(F), and mitochondrial compartments are indicated by a green asterisk (D) or colored in

green (F). Accumulation of endomembranous compartment at a late stage (D21) are

colored in pink (endosomes-like vesicles) and purple (lysosomes-like vesicles),

respectively. Nuclei are highlighted in blue. C-G. Representative images at higher

magnifications corresponding to the area indicated by a yellow rectangle in EM images

shown in B, D, and F respectively.

A, B, D, F. Scale bar = 1 μm; Aa and Ab. Scale bar = 500 nm; C-G. Scale bars = 300 nm.

Figure 3. Maturation of α-syn-seeded aggregates into LB-like inclusions is

accompanied by the sequestration of organelles and the endomembrane system over

time.

A-D. At D21, PFF-treated neurons were fixed, ICC against pS129-α-syn was performed and

imaged by confocal microscopy (A-D, inset images; scale bar = 5 μm), and serial sections of

the selected neurons were examined by EM. Representative images of LB-like inclusions

which exhibited a ribbon-like morphology (A-B) or compact and rounded structures (C-D). A

high number of mitochondria (highlighted in green) and several types of vesicles, such as

autophagosomes, endosome, and lysosome-like vesicles (highlighted respectively in yellow,

pink and purple) were detected inside or at the edge of these inclusions. A, C-D. Scale bar =

1 μm; B. Scale bar = 2 μm.

E-H. LB-like inclusions were detected by ICC using pS129 (MJFR13 or 81a) in combination

with LAMP1 (late endosome/lysosome marker) (E), LAMP2A (autophagolysosome marker)

(F), Tom20 (mitochondria marker) (G), or BiP (ER marker) (H) antibodies. Neurons were

stained with microtubule-associated protein (MAP2) antibody, and the nucleus was

counterstained with DAPI. Scale bars = 10 μm.


https://doi.org/10.1101/751891

55

Figure 4. Temporal proteomic analyses of the protein contents found in the insoluble

fraction of the PFF-treated neurons reveals a high increase in proteins related to the

endomembrane system.

A. Insoluble proteins from neurons treated with PBS and PFFs for 7, 14, and 21 days were

extracted and analyzed using LC-MS/MS. Identified proteins were plotted using volcano plot.

Mean difference (Log2 (Fold-Change) on the X-axis) between the insoluble fractions of PFF-

treated neurons and PBS neurons treated for 14 (left panel) or 21 days (right panel) were

plotted against Log10 (p-Value) on the Y-axis (T-Test). Dotted lines represent the FDR <0.05

(False Discovery Rate) and threshold of significance SO=1 assigned for the subsequent

analysis. A detailed list of the hits shown in the volcano plot is available in Table 1.

B-C. Classification of the proteins significantly enriched in the insoluble fractions of the PFF-

treated neurons at D14 and D21 by cellular component (B) and biological processes (C) using

Gene Ontology (GO) enrichment analyses determined by DAVID analysis.

D. Heat map representing color-coded fold change levels of mitochondrial (right) and synaptic

(left) proteins present in the insoluble fraction in neurons treated with PFFs 7, 14, and 21 days.

E. Cytoscape visualization of the proteins shared between 14 and 21 days PFFs treated

insoluble fraction based on cellular compartment related to mitochondrial and synaptic

function. The nodes (round shape) represent gene ontology terms; node color represents the

group and node size represent the significance of each gene ontology term.

Figure 5. Gene expression level changes during the formation of the newly formed

fibrils and their maturation into LB-like inclusions.

Temporal transcriptomic analysis of the gene expression level in PBS-treated neurons vs.

PFF-treated neurons treated for 7, 14, or 21 days. Genes with an absolute log2 fold-change

greater than 1 and an FDR less than 0.01 were considered as significantly differentially

expressed. Significant GO terms enrichment associated with cellular components (A) and

biological processes (B) from differentially regulated genes were plotted against –log10 P value

(t-test, PBS-treated neurons vs. PFF-treated neurons, Table 2). Log2 fold changes of the


https://doi.org/10.1101/751891

56

mitochondrial genes (C and Table 3), and the synaptic genes (D and Table 4) expression

levels are represented over time. “+” and “-” indicate a significant upregulation or

downregulation in the gene expression level respectively.

Figure 6. Dynamics of Lewy body formation and maturation induce mitochondrial

alterations.

Primary hippocampal neurons were treated with 70 nM of PFFs for 7, 14, or 21 days before

assessment of mitochondrial parameters.

A. ICC co-stainings of α-syn pS129 with VDAC1, TOM20, and TIM23 show increasing

colocalization of mitochondrial components with pS129-positive aggregates over time. Scale

bars = 5 μm. B. High-resolution respirometry revealed significant differences between PBS-

and PFF- treated groups at D21 in several respirational states (B, upper panel). Concurrently

assessed mitochondrial ROS-production was exclusively reduced at D7 (B, lower panel).

Statistical results in B were obtained from 2-way repeated measurement ANOVAs based on

a minimum of four independent experiments. C-D. Proteomic data on proteins implicated in

mitochondrial dysfunction suggest proteins related to oxidative phosphorylation (C) and

oxidative stress pathways (D) to be sequestered into aggregates only after D7 days.

Mitochondrial membrane potential was assessed fluorometrically from cells loaded with TMRE

(E); reduction in TMRE fluorescence intensity was observed at D21. Mitotracker green,

labeling mitochondrial proteins independent of mitochondrial membrane potential,

fluorescence (F) was moderately decreased at D21. G. WB analyses of total fractions derived

from neuronal cultures. Components of the oxidative phosphorylation (OXPHOS) system

(most notably the NDUF B8 subunit of complex I) are reduced at D21. A primary antibody mix

for subunits of OXPHOS complexes I-V was used, the band indicated by an orange arrow

represents CI-NDUF B8. Higher bands (from bottom to top) represent CII-SDHB, CIII-

UQCRC2, and CV-ATP5A, respectively. Also, levels of the mitochondrial shape changing

proteins mitofusin 2 and OPA1 were significantly decreased at D21. No significant changes in

levels of citrate synthase or VDAC1 proteins were observed at any time. The graphs (E-G),


https://doi.org/10.1101/751891

57

represent the mean +/- SD of a minimum of three independent experiments. p<0.05 = *,

p<0.005=**, p<0.0005=*** (ANOVA followed by Tukey HSD post-hoc test, PBS vs. PFF-

treated neurons). p<0.05 = # p<0.05 = ### (ANOVA followed by Tukey HSD post-hoc test,

D14 vs. D21 PFF-treated neurons).

Figure 7. Synaptic dysfunctions were associated with the formation and maturation of

the LB-like inclusions.

Primary hippocampal neurons were treated with 70 nM of PFFs for 7, 14, or 21 days before

assessment of synaptic parameters.

A. After total cell extraction, cells lysates were analyzed by WB. The levels of Synapsin I (pre-

synaptic protein), PSD95 (post-synaptic protein), and ERK 1/2 (synaptic plasticity marker)

were significantly decreased at D21. The phosphorylation level of ERK 1/2 (p-ERK 1/2)

significantly increased over time. The graphs represent the mean ± SD of a minimum of three

independent experiments. p<0.05 = *, p<0.005=** (ANOVA followed by Tukey HSD post-hoc

test, PBS vs. PFF-treated neurons). p<0.05 = ### (ANOVA followed by Tukey HSD post-hoc

test, D14 vs. D21 PFF-treated neurons).

B-C. Synaptic area decreases in PFF-treated neurons from D14. B. Aggregates were detected

by ICC using pS129 (MJFR13) in combination with Synapsin I antibodies. Neurons were

counterstained with microtubule-associated protein (MAP2) antibody, and the nucleus was

counterstained with DAPI staining. Scale bars = 5 μm. C. Measurement of the synaptic area

was performed over time. For each time-point, 24 neurons were imaged (z-step of 400 nm).

The image analysis was performed in Fiji using a custom script to automatically analyze the

z-stack images and measures the area of the synapse that was normalized to the perimeter

of the neuron of interest. p<0.05 = *, p<0.005=** (ANOVA followed by Tukey HSD post-hoc

test, PBS vs. PFF-treated neurons).

D. Aggregates were detected by ICC using pS129 (MJFR13) in combination with p-ERK 1/2

antibodies. ICC revealed the presence of p-ERK 1/2 associated with the newly formed fibrils

at D14 before being sequestered in the LB-like inclusions at D21. Scale bars = 5 μm.


https://doi.org/10.1101/751891

58

Figure 8. At late stages, the processes of formation and maturation of the LB-like

inclusions are associated with neuronal toxicity.

A-F. Addition of α-syn PFFs to primary neurons induces cell death in a time-dependent

manner in WT neurons. A-B. Cell death levels were assessed in WT neurons treated with

PFFs (70 nm) for up to D21 using complementary assays. Caspase 3 activation (A) was

measured as an early event of apoptotic cell death, while late cell death events were assessed

based on lactate dehydrogenase (LDH) release (B-C). For each independent experiment,

triplicate wells were measured per condition. D-F. Neuronal loss was also assessed by high

content image analysis (HCA) that allows us to determine the total number of neuronal cell

bodies (D), neurites (E) and the total level of pS129 in MAP2 positive neurons (F) over time in

PFF-treated primary culture. For each independent experiment, duplicated wells were

acquired per condition, and nine fields of view were imaged for each well. Images were then

analyzed using Cell Profile software to identify and quantify the number of neuronal cell bodies

(DAPI and MAP2-positive areas) and the number of neurites (MAP2-positiveareas).

The graphs (A-F) represent the mean ± SD of three independent experiments. p<0.01=*,

p<0.0001=*** (ANOVA followed by Tukey HSD post-hoc test, PBS vs. PFF-treated neurons).

p<0.01= #, p<0.001= ## (ANOVA followed by Tukey HSD post-hoc test, PFF-treated neurons

D14 vs. D21).

G-H, J. Temporal transcriptomic analysis of the gene expression level in PBS-treated neurons

vs. PFF-treated neurons treated for 7, 14, or 21 days. Genes with an absolute log2 fold-change

greater than 1 and an FDR less than 0.01 were considered as significantly differentially

expressed. G. Log2 fold changes of the cell death genes at D7, D14, and D21 (G: PBS vs.

PFF-treated neurons; H. Expression level of cell death genes D14 vs. D21. J. Fold changes

of SNCA and PLK2 genes (PBS vs. PFF-treated neurons). “+” and “-” indicate respectively a

significant upregulation or downregulation in the gene expression level.

I. Quantitative RT-qPCR was performed with primers specific for α-syn at the indicated time-

points after adding PFFs to WT neurons. Results are presented as fold change in comparison


https://doi.org/10.1101/751891

59

to the respective level in control neurons treated with PBS buffer. mRNA levels were

normalized to the relative transcriptional levels of GAPDH and actin housekeeping genes. The

graphs represent the mean ± SD of three independent experiments. p<0.005=** (ANOVA

followed by Tukey HSD post-hoc test, PBS vs. PFF-treated neurons).

Figure 9. The dynamics of Lewy body formation, rather than simply α-syn fibrillization,

is the primary cause of mitochondrial alterations, synaptic dysfunction, and

neurodegeneration.

Formation of α-syn inclusions in the context of the neuronal seeding requires a sequence of

events starting with 1) the internalization and cleavage of PFF seeds (D0-D1); followed by 2)

the initiation of the seeding by the recruitment of endogenous α-syn (D0-D4); 3) fibril

elongation along with the incorporation of PTMs, such as phosphorylation at residue S129

(D4-D14); 4) formation of seeded filamentous aggregates (D7) that are fragmented and

laterally associated over time (D7-D21); 5–6) the packing of the fibrils into LB-like inclusions

(D14-D21) that have a morphology similar to the bona fide LB detected in human

synucleinopathies (D21) is accompanied by the sequestration of organelles, endomembranes,

proteins and lipids. Our integrated approach using advanced techniques in EM, proteomics,

transcriptomic, and biochemistry clearly demonstrate that LB formation and maturation

impaired the normal functions and biological processes in PFF-treated neurons causing

mitochondrial alterations and synaptic dysfunctions that result in a progressive

neurodegeneration.


https://doi.org/10.1101/751891

Figure 1

A

PFFs(seeds)

Day 14 Day 21Day 7

α-synuclein monomer

Newlyformed fibrils

+ pS129

+ Interactors

Lewy body-like inclusion

Seeding

PFFs(seeds)

B

Elongation

Spatio-Temporal resolution of the LB-like inclusions

LC-MS/MS-based quantitative proteomic

Cell deathQuantitative transcriptomic analysis

Ultrastructure (CLEM)

Biochemistry - Candidate validation

Confocal imagingMorphology

Inclusion Composition

Confocal imaging - Candidate validation

Neuronal dysfunctions

Cellular dysfunctions

K

D21

D21

D21

D7

D7

D7

Q

Merged Total α-syn (1-20)pS129 (81a)

PFFs–treated neurons (D7) PFFs–treated neurons (D14) PFFs–treated neurons (D21)

C

E

G

10 μm10 μm

Merged pS129 (MJFR13) p62 Merged pS129 (MJFR13) p62 Merged pS129 (MJFR13) p62

Merged pS129 (MJFR13) ub Merged pS129 (MJFR13) ub Merged pS129 (MJFR13) ub

Merged pS129 (81a) Amytracker Merged pS129 (81a) Amytracker Merged pS129 (81a) Amytracker

Merged Total α-syn (1-20)pS129 (81a) Merged Total α-syn (1-20)pS129 (81a)

H

D

F

I J

O

M

N

P

C

500 nm

pS129 pS129/MAP2/DAPIL

75-

PBS PFFs

IB: SYN-1

IB: actin

IB: pS129 (MJFR13)

Inso

lubl

e Fr

actio

n –

D14

15-

10-

50-40-

40-

15-

35-25-

100-

Accumulation Maturation

***


https://doi.org/10.1101/751891

Figure 2

pS129 (81a) pS129// MAP2

300 nm

C

PFFs–treated neurons (D7) PFFs–treated neurons (D14)

pS129 (81a)

D F

pS129 (81a) pS129/ // MAP2 // DAPI

*

*

*

*

*

*

*

*

**

*

**

**

*

*

**

*

*

*

300 nm

E G 1 μm 1 μm

Nucleus

300 nm

PFFs–treated neurons (D21)

pS129/ // MAP2 // DAPI

pS129// MAP2

PFFs–treated neurons (D7)

1 μm

*

*

***

*

*

**

*

Nucleus

A

a

b

b

a

pS129 (81a)

a

1 μm

baNewly formed fibrils in pS129-positive neurite pS129-negative neurite

500 nm 500 nm

B

pS129// MAP2

0

5

10

15

20

25

1 2

Wid

th (n

m)

***

Newly formed fibrilsMicrotubules

c

*

*

*

*

*

** *

**

*

*

*

* * *

* **

**

*

*

*

*

**

*

* *


https://doi.org/10.1101/751891

1 μm

Figure 3

LAMP1 LAMP2A

BiPTom20

pS129 (81a)

pS129 (MJFR13)

pS129 (81a)

pS129 (81a)

Merged

Merged

Merged

Merged G

E

A

F

H

B

C D

10 µM

Nucleus

NucleusNu

cleu

s

pS129 pS129

pS129 pS129

Nucleus

Nucleus

2 μm

1 μm 1 μm


https://doi.org/10.1101/751891

0

20

40

60

80

100

0

15

30

45

-log1

0(P

valu

e) %

GO-term: Cellular Component

Day 21Day 14

Nucleocytoplasmic transport

Protein transport

0 5 10 15 20 25

TransportIntracellular protein transport

ER to Golgi vesicle-mediated transportVesicle-mediated transport

Protein export from nucleusNucleocytoplasmic transport

Protein import into nucleus

Protein foldingChaperone-mediated protein folding

Protein folding in endoplasmic reticulum

Tricarboxylic acid cycleATP metabolic process

NADH metabolic processATP biosynthetic process

Protein targeting to mitochondrionApoptotic mitochondrial changes

Mitochondrial transportMitochondrial fission

Apoptotic processProtein localization to pre-autophagosome

Response to endoplasmic reticulum stressResponse to oxidative stress

Regulation of stress-activated MAPK cascade

Synapse assemblyNeuron-neuron synaptic transmission

Neurotransmitter secretionSynaptic vesicle endocytosis

Synapse maturation

Actin cytoskeleton organizationAxonogenesis

Regulation of protein ubiquitinationUbiquitin-dependent protein catabolic process

Negative regulation of protein ubiquitination

Small GTPase mediated signal transduction

Dendritic spine development

Apoptosis

Mitochondria

Energymetabolism

Protein folding

-log10 (Pvalue)

Response tostress

Cytoskeleton

Ubiquitination

GO-term: Biological Processes Day 14Day 21

Ubiquitination

Cytoskeleton

Synapse

Response to Stress

Apoptosis

Mitochondria

Energy metabolism

Protein folding

Figure 4 Temporal protein expression profileLB-like inclusion specific components

Proteins extraction (Insoluble fraction) and Sample preparation (Trypsin digestion)

LC-MS/MS analysis(MS and data processing)

Day 14 Day 21

A

D

B

C

E

PFFs–treated neurons

D7 D14 D21PFFs–treated neurons

D7 D14 D21

Mito

chon

dria

l pro

tein

s in

inso

lubl

e fr

actio

n (fo

ld c

hang

e)

(PB

S-tr

eate

d ne

uron

s vs

PFF

s–tr

eate

d ne

uron

s)

Syna

ptic

pro

tein

s in

inso

lubl

e fr

actio

n (fo

ld c

hang

e)

(PB

S-tr

eate

d ne

uron

s vs

PFF

s–tr

eate

d ne

uron

s)

Primary Neurons

Day 14Day 7 Day 21PFFs(seeds)


https://doi.org/10.1101/751891

0 10 20

cleavage furrow

transport vesicleexocytic vesicle

secretory vesicle

presynapsesynaptic vesicleterminal bouton

postsynapsesynaptic membraneexcitatory synapse

postsynaptic density

axon partaxon terminusdendritic shaft

actin cytoskeletondendritic spine

neuron spine

focal adhesionadherens junction

cell-cell junction

ion channel complexcation channel complex

potassium channel complex

extracellular matrixproteinaceous extracellular matrix

transmembrane transporter complexplasma membrane protein complex

-log10(PValue)

Primary Neurons


Mito

chon

dria

l gen

es (3

5 ge

nes)

exp

ress

ion

(fold

cha

nge)

(P

BS-

trea

ted

neur

ons

vs P

FFs–

trea

ted

neur

ons)

0 10 20dendrite extension

positive regulation of neuron projection developmentpositive regulation of neuron differentiation

axon developmentglial cell differentiation

positive regulation of neurogenesis

positive regulation of cell projection organizationpositive regulation of cell growthcellular component disassembly

response to calcium ionpositive regulation of ion transmembrane transport

calcium ion transportcellular calcium ion homeostasis

negative regulation of MAP kinase activitynegative regulation of protein serine/threonine kinase…

modulation of synaptic transmissionregulation of membrane potential

regulation of synapse structure or activityneuronal action potential

regulation of synaptic plasticitysynapse organization

neurotransmitter transportneurotransmitter secretion

learning or memorycognition

regulation of actin filament-based processregulation of cytoskeleton organization

neuron deathregulation of neuron deathneuron apoptotic process

mitophagy in response to mitochondrial depolarizationresponse to mitochondrial depolarisation

macromitophagymitophagy

mitochondrion disassembly

multicellular organismal response to stressresponse to oxidative stress

small GTPase mediated signal transductionRas protein signal transduction

gamma-aminobutyric acid signaling pathwayextracellular matrix organization

Stre

ssM

itoch

ondr

iaD

eath

Cyt

oske

leto

nSy

naps

eC

alci

umio

nN

euro

gene

sis

-log10(PValue)

D14D21

D7


Syna

ptic

gen

es (2

17) e

xpre

ssio

n (fo

ld c

hang

e)

(PB

S-tr

eate

d ne

uron

s vs

PFF

s–tr

eate

d ne

uron

s)


Temporal transcriptomic analysis(Sequencing nextseq Illumina)

Gene expression changes

GO-term: Cellular Component GO-term: Biological processes

D14D21

D7

Heatmap key

D7 D14 D21

Figure 5

A B

C D

D7 D14 D21

Heatmap keyGrhprPcxBaxAcadsPink1Isoc2aMpstGpx1Ifi27Cmpk2TspoIdh2Sept4DmpkNdufb7Akr7a5BckdhaEtfbBloc1s1Ndufa11Slc25a18TstAifm3Acsl4Ttc19Cyb5r1PnpoGlsPak7Ndufaf5Prss35MsraBnip3Oxr1Nt5dc3


https://doi.org/10.1101/751891

α-s

yn/a

ctin

a.u

0

0.5

1

1.5

*

Merged Merged

routine NL NP NSP

0.00

0.05

0.10

0.15

mito

H2O

2 &

O2- (p

mol

/(s*u

nit)) PBS

PFF 7 daysPFF 14 daysPFF 21 days

*

routine NL NP NSP NSE SE

0

20

40

60

Oxy

gen

flux

[pm

ol/(s

*uni

t prim

ary

cultu

res)

]

**

** *

* D7 D14 D14-D21 D21

Sequestration of mitochondrial proteinsinto aggregates

Figure 6

Primary Neurons

Day 14Day 7 Day 21

MitochondrialDysfunction

01000020000300004000050000

Tris WT

Mito

trac

ker

a.u

01000020000300004000050000

Tris WT

TMR

E a.

u

###

***

*

E

A

RespirometryMitochondrial membrane potential (TMRE)Total mitochondria mass (Mitotracker)Biochemistry

PFFs(seeds)

IB: OPA-1

PFFs–treated neurons (Day 7) PFFs–treated neurons (Day 14) PFFs–treated neurons (Day 21)

Tom20

pS129 (MJFR13) Merged pS129 (MJFR13) pS129 (MJFR13)Mitochondria

Tim23

Mitochondria Mitochondria

VDAC1

Confocal imaging

00.5

11.5

2

#

00.5

11.5

2**

*

#

pS12

9/ac

tin a

.u

Mito

fusi

n2/a

ctin

a.u

Citr

ate

synt

hase

/act

in a

.u

*

OPA

1/ac

tin a

.u

0

0.5

1

1.5 #

**

00.5

11.5

2

00.5

11.5

2

CI-N

DU

FB8/

actin

a.u

#

*0

0.5

1

1.5

VDAC

1/ac

tin a

.u

IB: SYN-1

+ PFFs

10-

15-

25-

40-35-

50-

IB: Actin

40-

IB: pS129

15-

25-

40-35-

50-

IB: Mitofusin 2

86-

IB: OXPHOS

50-

25-

15-

35-

Complex I

Q

Complex II

Complex IIIComplex IV

C

ADP ATP

F0

F1

Complex V

SDHASDHB

NDUF B11NDUF A4

SDHC

COX6B

COX1

ATP5O

ATP5JATP5J2ATP5L

Cat

PRX3

PRX5

GPX4GPD2

JNK

MKK4

mtSOD

DHOH

C D

F

G

IB: Citrate Synthase

40-

IB: VDAC-1

31-

+ PFFs

100-

Mito

H20

2 an

d 0- 2

[pm

ol/(s

*Uni

t)]

B

Oxy

gen

flux

[pm

ol/(s

*Uni

t prim

ary

cultu

res)

]

**

**

*D7D14D21

PBS

Tom20

Tim23

VDAC1

Tom20

Tim23

VDAC1

+ PFFs

PBS PFFs

PBS PFFs

PBS PFFs


https://doi.org/10.1101/751891

00.5

11.5

2

PBS D7 D14 D21

**

Total protein fractions

Figure 7

Primary Neurons

Synaptic dysfunctions

Biochemistry Confocal Imaging

A

IB: PSD95

IB: Synapsin I

IB: p-ERK 1/2

IB: ERK 1/2

IB: Actin

00.5

11.5

2

PBS D7 D14 D21

**

PSD

95/actin

a.u

##

00.5

11.5

2

PBS D7 D14 D21

*

##Synap

sinI/actin

a.u

pER

K/ERK

a.u

##

+ PFFs

75-

95-

40-

35-

35-


PFFs

–tr

eate

d ne

uron

s

pS129 (81a) Merged p-ERK 1/2

D7

D21

D14

D21

PBS

D

PFFs

–tr

eate

d ne

uron

s

pS129 (MJFR13) Merged Synapsin I

D7

D21

D14

D21

PBS

B

Area

of t

he s

ynpa

se/ p

erim

eter

of

the

neur

ons

(μm

2 )

C

PBS PFFs

**

*

D7 D14 D21PBS

40

30

20

10

0


https://doi.org/10.1101/751891

0

100

200

300

400

500

D7 D14 D21

Transcriptomic analysisExpression level of cell death Genes

00.05

0.10.15

0.20.25

0.30.35

D7 D14 D21

LDH

rele

ase

(Abs

490

nm

) ***

A

0

500

1000

1500

2000

2500

D7 D14 D21

D

Cou

ntof

cel

l bod

ies

Cou

ntof

cel

l Neu

rites

*

#

*

#E

B

PBS PFFs

Temporal Toxicity analysisand

0

0.1

0.2

0.3

0.4

0.5

0.6

PBS D14 D16 D19 D21

LDH

rele

ase

(Abs

490

nm

) ***

***

###

C

G

I

Figure 8

01000200030004000500060007000

D7 D14 D21

***

***

Cas

pase

3 a

ctiv

atio

n (a

.u)

##

Primary Neurons


00.0050.01

0.0150.02

0.0250.03

0.0350.04

D7 D14 D21

F

***

pS12

9 le

vel (

mea

n in

tens

ity)

in M

AP2

posi

tive

neur

ons

*

***

00.20.40.60.8

11.21.4

1 2 3 4

α-s

yn m

RN

A Fo

ld in

crea

se

**

D7 D14 D21D21

J

Plk2

Snca

--

-

D14D7 D21

Profile of SNCA and Plk2 genes differential expressedin PFFs-treated neurons overtime

Diff

eren

tially

exp

ress

ed G

enes

invo

lved

in

cell

deat

h B

P -D

14 v

s D

21

(26

gene

s)

Diff

eren

tially

exp

ress

ed g

enes

invo

lved

in

cell

deat

h bi

olog

ical

pro

cess

es (B

P)PF

Fs-tr

eate

d ne

uron

s vs

PB

S (1

58 g

enes

)

D14D7 D21

Upregulated

Downregulated

D14 D21

D14 D21

KdrLpar1Emp1Nuak2Traf1Cyp26b1Xaf1Cxcl10Osr1HhipIgfbp3Fn1Thbs1Bmp6

PrkcgNptx1Gabra5CckSncaPtk2bCamk2aNtsr1Itga4Gpr37Gdf10Cd36

Pink1

Tspo1

HDAC7ApoeBaxRtknRapgef3Traf4Aifm3Wnt7a

Traf1Xaf1

PawrRnf112Nos1Ntsr1

4.5

4

3.5

3

2.5

2

Norm

.Exp

r(lo

g10)

2

Fold

Cha

nge

(log2

)

1.510.50

-2-1.5-1-0.5

H


https://doi.org/10.1101/751891

α-syn PFFs

Escape

PFFsinternalisation

C-ter Truncated fibrils and full-length fibrils

TruncationTruncated

seeds

C-terpeptide

+

+ PTMsSeeding

α-synMonomer

Elongation

Newly formed fibrils(p62, ub, ThS, pS129)

ub

ub

P

P

p62

Truncation

ub

ub

P

P

ub

P

P

Lateral association

Nucleus

Maturation

Lewy body-like inclusion α-syn aggregate

Interaction with

endomembranes,organelles,

proteins and lipids

ub

P

PLysosome

Endosome

Figure 9 Dynamics of Lewy body formation and maturation results in mitochondria alterations, synaptic dysfunctions and neurodegeneration

1 2 3

4

56

α-syn PFFs

α-syn Monomer

Newly formed fibrils

Truncated newly formed fibrils

Mitochondria

Vesicles(endosomes, lysosomes, autophagosomes)

EndoplasmicReticulum

Golgi apparatus

MicrotubuleActinNeurofilament

Lipid droplets

Synaptic Dysfunctions:

Synapse densityPre and post Synaptic markersDysregulation synaptic-gene relatedp-ERK 1/2 signalling pathway

Mitochondria Dysfunctions:SequestrationRespiration (Complexes I and II)BiomassPro-fusion markers

Cell death:

Caspase 3 activationLoss of plasma membrane integrityNeuritic atrophy Expression cell death gene-related


https://doi.org/10.1101/751891

Documents

The process of Lewy body formation, rather than simply alpha-synuclein fibrillization, is the major driver of neurodegeneration in synuclein… · The intracellular accumulation of