THE REGULATION OF VITAMIN D METABOLISM IN THE KIDNEY … › dspace › bit... · 1.6 Evidence For Bone Vitamin D Metabolism 18 1.6.1 Bone 1α-Hydroxylation 18 1.6.2 Bone 24-hydroxylation

i

THE REGULATION OF VITAMIN D METABOLISM

IN THE KIDNEY AND BONE

Paul Hamill Anderson B.Sc. (Hons.)

Department of Physiology

The University of Adelaide

South Australia

A thesis submitted for the degree of

Doctor of Philosophy

to

The University of Adelaide

June 2002

ii

Table of Contents

ABSTRACT xiv

DECLARATION xvii

ACKNOWLEDGEMENTS xviii

PUBLICATIONS ARISING xix

PRESENTATIONS ARISING xix

AWARDS ARISING xx

LIST OF FIGURES xxi

LIST OF TABLES xxv

1 CHAPTER 1: VITAMIN D METABOLISM IN KIDNEY AND

BONE

1

1.1 Introduction 1

1.2 Vitamin D Metabolism 3

1.2.1 Hepatic 25-Hydroxylation 3

1.2.2 Renal 1α-Hydroxylation 4

1.2.3 24-hydroxylation 6

1.3 Molecular Mechanism For The Action Of Vitamin D 9

1.4 Biological Actions of 1,25D 9

iii

1.4.1 Intestine 10

1.4.2 Bone 11

1.4.3 Parathyroid glands 12

1.4.4 Kidney 13

1.5 Factors That Effect The Kidney Vitamin D Metabolism 13

1.5.1 PTH 14

1.5.2 Calcium 15

1.5.3 Calcitonin 16

1.5.4 1,25D 17

1.6 Evidence For Bone Vitamin D Metabolism 18

1.6.1 Bone 1α-Hydroxylation 18

1.6.2 Bone 24-hydroxylation 21

1.7 Aims And Hypotheses 22

1.7.1 Detection and quantification of CYP27B1, CYP24 and VDR mRNA by

Real-Time RT-PCR

23

1.7.2 The effect of age on the metabolism of vitamin D in kidney and bone 23

1.7.3 The effect of dietary calcium on vitamin D metabolism in kidney and

bone

24

1.7.4 The effect of vitamin D-depletion on vitamin D metabolism in kidney and

bone

25

1.7.5 The effect of dietary calcium during vitamin D-depletion on vitamin D

metabolism in kidney and bone

26

2 CHAPTER 2: MATERIALS AND METHODS 27

2.1 Introduction 27

iv

2.2 Materials 27

2.3 Animals 28

2.3.1 Housing 28

2.3.2 Diet 28

2.3.2.1 Semi-Synthetic diet 28

2.3.3 Blood sample collection 31

2.4 Blood Biochemistry 31

2.4.1 Serum calcium and phosphate 31

2.4.2 Serum 1,25 dihydroxyvitamin D3 32

2.4.3 Serum 25 hydroxyvitamin D3 32

2.4.4 Serum parathyroid hormone 33

2.4.5 Serum calcitonin 33

2.5 Statistical Analyses 33

2.5.1 One-way analysis of variance 33

2.5.2 Two-way analysis of variance 34

2.5.3 Tukey’s post-hoc test 34

2.5.4 Linear and multiple-linear regression analysis 34

2.6 Molecular Biology Techniques 35

2.6.1 Materials and preparation of reagents 35

2.6.1.1 Antibiotics 35

2.6.1.2 RNase inhibiting solution 35

2.6.1.3 Buffer solutions 35

2.6.1.4 Formamide 35

2.6.1.5 Loading buffers for electrophoresis 36

2.6.2 Preparation of cDNA 36

v

2.6.2.1 Transformation of plasmids into competent cells 36

2.6.2.2 Plasmid screening procedure 37

2.6.2.3 Growth of bacterial cultures 37

2.6.2.4 Isolation of plasmid DNA 37

2.6.2.5 Quantificantion of DNA 38

2.6.2.6 Digestion and isolation of cDNA fragments 39

2.6.3 Extraction of total RNA for kidney and bone tissue 40

2.6.3.1 Collection of rat kidneys and bones for RNA extraction 40

2.6.3.2 Extraction of RNA 40

2.6.3.3 Quantification of RNA 41

2.6.4 First-strand cDNA synthesis 42

2.7 Quantitative Real-Time Reverse Transcriptase - Polymerase Chain Reaction

43

2.7.1 Real-time RT-PCR primers and probes 43

2.7.2 Polymerase chain reaction conditions 44

2.8 Ribonuclease Protection Assay 46

2.8.1 Labelling reaction and removal of template DNA 46

2.8.2 Gel purification of radio-labelled riboprobe 46

2.8.3 Determination of the quantity of total RNA used in ribonuclease

protection assay

47

2.8.4 Riboprobe: target RNA hybridisation 48

2.8.5 RNase digestion of unbound RNA 48

2.8.6 Separation and detection of riboprobe bound target mRNA 48

2.9 In Situ Hybridisation 49

2.9.1 In vitro transcription with digoxigenin-11-UTP 49

2.9.2 Estimation of the riboprobe yield 49

vi

2.9.3 Tissue preparation 49

2.9.4 Section pre-treatment 50

2.9.5 Hybridisation 50

2.9.6 Post-hybridisation wash 51

2.9.7 Antibody hybridisation / colour reactions 51

3 CHAPTER 3: EVALUATION OF THE QUANTIFICATION OF

CYP27B1, CYP24, VDR AND GAPDH mRNA USING THE REAL-TIME

REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION.

52

3.1 Introduction 52

3.2 Protocol 54

3.2.1 Experimental procedure 54

3.2.2 Estimation of cDNA standard copy number 55

3.2.3 Calculation of the slope of the linear regression line for optimal PCR

amplification

55

3.2.4 Data expression and statistical analysis 56

3.3 Results 57

3.3.1 Optimisation of the fluorogenic probe concentration 57

3.3.2 Range and sensitivity of fluorogenic detection 57

3.3.3 Standard curves 58

3.3.4 Reproducibility of cDNA standard detection 58

3.3.5 Comparison of copy numbers of mRNA obtained from standard curves

generated in different assays

64

3.3.6 Accuracy of the estimation of mRNA levels by reverse-transcription and

real-time PCR amplification

65

vii

3.3.7 Reproducibility of mRNA detection 69

3.3.8 Assessment of GAPDH and total RNA as the referent for mRNA

quantitation

72

3.4 Discussion 75

4 CHAPTER 4: THE EFFECTS OF AGE ON THE

REGULATION OF CYP27B1, CYP24 AND VDR mRNA

EXPRESSION

81

4.1 Introduction 81

4.2 Protocol 83


4.2.2 Biochemical analysis 83

4.2.3 Messenger RNA analyses 83

4.2.4 Data expression and statistical analyses 84

4.3 Results 84

4.3.1 Body weight and serum biochemistry 84

4.3.1.1 Serum Calcium 84

4.3.1.2 Serum 25D 84

4.3.1.3 Serum 1,25D 85

4.3.1.4 Serum PTH 85

4.3.1.5 Serum Calcitonin 85

4.3.2 Gene Expression in the Kidney 88

4.3.2.1 CYP27B1 mRNA 88

4.3.2.2 Relationship between serum 1,25D and kidney CYP27B1 mRNA 88

viii

4.3.2.3 Relationship between serum calcitonin and kidney CYP27B1 mRNA 88

4.3.2.4 CYP24 mRNA 92

4.3.2.5 Relationship between serum 1,25D and kidney CYP24 mRNA 92

4.3.2.6 Relationship between kidney CYP27B1 mRNA and kidney CYP24

mRNA

92

4.3.2.7 Relationship between serum calcitonin and kidney CYP24 mRNA 96

4.3.2.8 VDR mRNA 96

4.3.2.9 Relationship between kidney CYP24 mRNA and kidney VDR mRNA 96

4.3.3 Gene Expression in the bone 100

4.3.3.1 CYP27B1 mRNA 100

4.3.3.2 Relationship between serum calcium and bone CYP27B1 mRNA 100

4.3.3.3 Relationship between serum PTH and bone CYP27B1 mRNA 100

4.3.3.4 CYP24 mRNA 104

4.3.3.5 Relationship between bone CYP27B1 mRNA and bone CYP24

mRNA

104

4.3.3.6 Relationship between serum PTH and bone CYP24 mRNA 104

4.3.3.7 VDR mRNA 108

4.3.3.8 Relationship between serum 1,25D and bone VDR mRNA 108

4.4 Discussion 108

4.4.1 Determinants of serum 1,25D 108

4.4.2 Determinants of serum 25D 111

4.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA 111

4.4.3.1 Determinants of kidney CYP27B1 mRNA 111

4.4.3.2 Determinants of kidney CYP24 mRNA 114

4.4.3.3 Determinants of kidney VDR mRNA 116

ix

4.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA 118

4.4.4.1 Determinants of bone CYP27B1 118

4.4.4.2 Determinants of bone CYP24 119

4.4.4.3 Determinants of bone VDR 120

4.4.5 Comparisons of kidney and bone vitamin D endocrine systems 122

4.4.6 Summary 125

5 CHAPTER 5: THE EFFECT OF DIETARY CALCIUM AND

VITAMIN D ON CYP27B1, CYP24 AND VDR mRNA

EXPRESSION

127

5.1 Introduction 127

5.2 Protocol 128


5.2.2 Biochemical analysis 129

5.2.3 Bone histomorphometry 130

5.2.3.1 Bone fixation, cutting and resin embedding 130

5.2.3.2 Section Production 130

5.2.3.3 Modified von Kossa method for identification of calcified tissue 131

5.2.3.4 Von Kossa method for sites of calcium deposition with haematoxylin

and eosin counterstain

131

5.2.4 Messenger RNA Analyses 132

5.2.5 Data expression and statistical analysis 132

5.3 Results 132

5.3.1 Serum biochemistry 132

x

5.3.1.1 Serum 25D 133

5.3.1.2 Serum 1,25D 133

5.3.1.3 Serum calcium 133

5.3.1.4 Serum phosphate 133

5.3.1.5 Serum PTH 134

5.3.1.6 Serum calcitonin 134

5.3.2 Bone histomorphometry 138

5.3.2.1 Relationship between serum calcium and BV/TV in the D(-) animals 138

5.3.3 Gene expression in the kidney 141

5.3.3.1 CYP27B1 mRNA 141

5.3.3.2 Relationship between serum PTH and kidney CYP27B1 mRNA levels 141

5.3.3.3 CYP24 mRNA 144

5.3.3.4 Relationship between serum 25D and kidney CYP24 mRNA levels 144

5.3.3.5 Relationship between serum 1,25D and kidney CYP24 mRNA levels 144

5.3.3.6 Relationship between serum calcium and kidney CYP24 mRNA levels 149

5.3.3.7 Relationship between serum PTH and kidney CYP24 mRNA levels 149

5.3.3.8 Relationship between serum calcitonin and kidney CYP24 mRNA 149

5.3.3.9 Kidney VDR mRNA 149

5.3.4 Gene expression in the bone 155

5.3.4.1 CYP27B1 mRNA 155

5.3.4.2 Relationship between serum calcitonin and bone CYP27B1 mRNA

levels in D(+) animals

155

5.3.4.3 Relationship between serum PTH and bone CYP27B1 mRNA levels

in D(-) animals

155

5.3.4.4 Relationship between serum calcium and bone CYP27B1 mRNA

levels in D(-) animals

159

xi

5.3.4.5 Relationship between BV/TV and bone CYP27B1 mRNA in D(-)

animals

159

5.3.4.6 Bone CYP24 mRNA 163

5.3.4.7 Relationship between bone CYP27B1 and bone CYP24 mRNA levels 163

5.3.4.8 Relationship between serum PTH and bone CYP24 mRNA 163

5.3.4.9 Bone VDR mRNA 163

5.3.4.10 Relationship between serum calcium and bone VDR mRNA levels 168

5.3.4.11 Relationship between serum PTH and bone VDR mRNA levels 168

5.3.5 Assessment of CYP27B1 mRNA levels in kidney and bone by

ribonuclease protection assay

168

5.4 Discussion 172

5.4.1 Determinants of serum calcium levels 172

5.4.2 Determinants of serum 1,25D levels 172

5.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA 174

5.4.3.1 Determinants of CYP27B1 mRNA levels 174

5.4.3.2 Determinants of CYP24 mRNA levels 176

5.4.3.3 Determinants of VDR mRNA levels 178

5.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA 179

5.4.4.1 Determinants of CYP27B1 mRNA levels 179

5.4.4.2 Determinants of CYP24 mRNA levels 184

5.4.4.3 Determinants of VDR mRNA levels 185

5.4.5 Comparisons of the kidney and bone vitamin D endocrine systems 185

5.4.6 Summary 188

xii

6 CHAPTER 6: IDENTIFICATION OF BONE CELL TYPES

WITH THE CAPACITY TO METABOLISE VITAMIN D

190

6.1 Introduction 190

6.2 Protocol 191

6.2.1 Experimental procedures 191

6.2.2 Cell culture 192

6.2.3 Messenger RNA analyses 192

6.2.4 Insitu hybridisation 193

6.2.5 Data expression and statistical analyses 193

6.3 Results 193

6.3.1 Expression of CYP27B1 mRNA in the separate bone fractions 193

6.3.2 Expression of CYP24 mRNA in the separate bone fractions 195

6.3.3 Relationship between the expression of CYP27B1 and CYP24 mRNA 195

6.3.4 Expression of VDR mRNA in the separate bone fractions 195

6.3.5 Expression of CYP27B1 mRNA in bone cells 199

6.3.6 Expression of CYP24 mRNA in bone cells 199

6.3.7 Expression of VDR mRNA in bone cells 199

6.3.8 Detection of CYP27B1 mRNA by in situ hybridisation 203

6.4 Discussion 203

6.4.1 Expression of CYP27B1, CYP24 and VDR mRNA in specific bone

regions

203

6.4.1.1 CYP27B1 mRNA 203

6.4.1.2 CYP24 mRNA 206

6.4.1.3 VDR mRNA 207

xiii

6.4.2 Expression of CYP27B1, CYP24 and VDR mRNA in bone cells 208

6.4.2.1 CYP27B1 mRNA 208

6.4.2.2 CYP24 mRNA 209

6.4.2.3 VDR mRNA 210

6.4.3 Insitu identification of CYP27B1 mRNA in rat femora 212

6.4.4 Summary 213

7 CHAPTER 7: SUMMARY AND CONCLUSIONS 215

7.1 Summary 215

7.2 Limitations 223

7.3 Future Directions 225

8 BIBLIOGRAPHY 226

xiv

Abstract

The activation of 1,25D-dihydroxyvitamin D3 (1,25D) is catalysed by the enzyme 25-

hydroxyvitamin D-1α-hydroxylase (CYP27B1) in the kidney, which is the primary

producer of 1,25D in the body. Although the synthesis of 1,25D by CYP27B1 and the

catabolism of 1,25D by 25-hydroxyvitamin D-24-hydroxylase (CYP24) also take

place in the bone, the significance of the bone cell-specific metabolism of vitamin D

remains largely unknown. This thesis investigates the regulation of the expression of

CYP27B1, CYP24 and vitamin D receptor (VDR) mRNA, both in the bone and in the

kidney, with the aim to determine whether the regulation of the vitamin D metabolism

in the bone is independent from that in the kidney. The effects of age, dietary calcium

and vitamin D status on the expression these genes in both the kidney and the bone, as

well as on a number of biochemical factors known to regulate the renal metabolism of

1,25D, such as PTH, calcium and 1,25D itself, were examined. CYP27B1 mRNA

expression was also studied in histological sections of rat femoral bone. Furthermore,

CYP27B1, CYP24 and VDR mRNA expression were also identified in specific

regions of the rat femur and in a number of bone cell lines, with the aim to identify the

bone cell types that have the capacity to metabolise and/or to respond to vitamin D.

The age-related decrease in the circulating levels of 1,25D detected in animals ranging

in age from 3 weeks to 2 years old, was a direct result of a reduction in the expression

of CYP27B1 mRNA and an increase in the expression of CYP24 and VDR mRNA in

the kidney. In contrast, the expression of CYP27B1 and CYP24 mRNA in the bone is

high from 3 to 15 weeks of age, which is the period of rapid growth and development.

The expression of CYP27B1 mRNA in the bone was positively correlated with the

circulating levels of calcium throughout aging, which suggests that the 1,25D

xv

produced in the bone may be involved in the mineralisation process. The positive

correlation found between the expression of CYP27B1 and CYP24 mRNA in the

bone was in contrast with the negative correlation found between the expression of

these two enzymes in the kidney. This suggests that the 1,25D produced locally in the

bone, rather than the 1,25D produced in the kidney, is the primary determinant of the

CYP24 activity in the bone.

In vitamin D-deplete animals, fed a 0.1% calcium diet (D(-)/LC), the expression of

CYP27B1 mRNA was induced and the expression of CYP24 mRNA was suppressed

in the kidney. In contrast, both the expression of CYP27B1 and CYP24 mRNA were

low in the bones of these D(-)/LC animals. When vitamin D-deplete animals were fed

a 1% calcium diet (D(-)/HC), the expression of both CYP27B1 and CYP24 mRNA

was high in the bone, which was in direct contrast with the low expression of these

genes detected in the kidney. Besides this, a positive correlation was found between

the expression of CYP27B1 mRNA in the bone, serum calcium levels and bone

mineral volume (BV/TV) in the epiphysis, which supports the findings for the age

study that the locally produced 1,25D may be involved in the promotion of bone

mineralisation. Although serum PTH levels was positively correlated with the

expression of CYP27B1 mRNA in the kidneys of hypocalcaemic animals, there was

no such relationship detected between the levels of serum PTH and the expression of

CYP27B1 mRNA in the bone. This finding suggests that the regulation of the

expression of CYP27B1 mRNA in the bone is different from the regulation found in

the kidney. The identification of CYP27B1 mRNA in osteoblasts-like cells, taken

together with the associations between serum calcium and CYP27B1 mRNA

expression in the previous studies, suggests that 1,25D produced in osteoblasts may

xvi

play a significant role in the bone mineralisation process. The detection of CYP27B1

mRNA expression in a number of bone marrow cells suggests that locally produced

1,25D may also play a role in the growth and differentiation of hematopoietic cells.

17

Declaration

This thesis contains no material which has been accepted for the award of any other

degree or diploma in any university or other tertiary institution and, to the best of my

knowledge and belief, contains no material previously published or written by another

person, except where due reference has been made in the text.

I give my consent to this copy of my thesis, when deposited in the University Library,

being available for loan and photocopying.

Signature ………………………….

Date ………./………./……….

18

Acknowledgements

I wish to thank Associate Professor Howard Morris for his guidance and support as

my supervisor. Without his encouragement and support throughout my studies, I

would not be writing this now. I would also like to thank Associate Professor Alan

Need for allowing me to undertake this study in The Division of Clinical

Biochemistry at The Institute of Medical and Veterinary Science.

Thanks must also go to Dr Brian May and The Biochemistry Department of The

University of Adelaide for their invaluable advice and assistance.

Special thanks must go to Dr. Malcolm Cochran for his support and contributions

during my studies.

I would like to acknowledge Dr. Peter O’loughlin and my colleagues Dr Shunji Iida,

Alison Moore, Sonia Shulz of the Endocrine Research unit as well as Dr Rachel

Davey of the Department of Medicine, University of Melbourne, for their invaluable

advice, practical assistance and encouragement. Thanks must also go to the Endocrine

diagnostic laboratory, the Division of Molecular Pathology, the Animal care staff of

the Institute of Medical and Veterinary Science for their time and assistance.

Finally, I would like to thank my Mum, Dad, Kathryn, Allan, Robert, Ingrid and

Rachel for their support and encouragement throughout my years of study. I would

especially like to thank Ivanka Hendrix for her support and encouragement for me

both in the laboratory as my colleague and out of the laboratory as my partner. Her

belief in me gave me motivation to endure my studies.

19

Publications Arising

Anderson PH, Iida S, Cochran M, May B and Morris H. 2000 Regulation of vitamin

D metabolism in the bone. Bone 27 (4): 8s

Anderson PH, Iida S, Moore A, Cochran M, O’Loughlin P, May B and Morris H.

2001 Bone CYP27B1 mRNA is regulated by dietary calcium and not vitamin D.

Journal of Bone and Mineral Research 16 (1): 313s

Anderson PH, Iida S, Moore A, Cochran M, May B and Morris H. 2001 Bone Cell

regulation of Vitamin D metabolism. Bone 28 (5): 245s

Presentations Arising

International

Anderson PH, Iida S, Cochran M, May BK and Morris HA. 2001 Bone cell regulation

of vitamin D metabolism. International Bone and Mineral Society Conference. Bone

28 (5): 245s

Anderson PH, Iida S, Cochran M, O’Loughlin PD, May BK and Morris HA. 2001

Bone 25-hydroxyvitmain D-1�-hydroxlase is regulated by dietary calcium but not

PTH. American Society of Bone and Mineral Research Conference. Journal of Bone

and Mineral Research 16 (1): 313s

National

Anderson PH, Iida S, Moore AJ, Cochran M, May BK, Morris HA. 2000 Regulation

of vitamin D metabolism in bone. Australian & New Zealand Bone and Mineral

Society. p11, Abstract O3.

20

Anderson PH, Iida S, Moore AJ, Cochran M, May BK, Morris HA. 2000 Regulation

of vitamin D metabolism in bone. National Australian Society for Medical Research

Conference.

Anderson PH, Iida S, Dunn S, Stilliano A, Cochran M, May BK and Morris HA. 2001

Bone 25-hydroxyvitmain D-1α-hydroxlase is regulated by age, dietary calcium but

not PTH. Australian & New Zealand Bone and Mineral Society. p25, Abstract O1.

Anderson PH, Iida S, Dunn S, Stilliano A, Cochran M, May BK and Morris HA. 2001

Bone 25-hydroxyvitmain D-1α-hydroxlase: regulation by age and dietary calcium but

not vitamin D or PTH. National Australian Society for Medical Research Conference.

Awards Arising

Young Investigator Award Finalist. 2000 National Australian & New Zealand Bone

and Mineral Society Conference. Hamilton Island, Queensland.

Young Investigator Award Finalist. 2001 National Australian & New Zealand Bone

and Mineral Society Conference. Auckland, New Zealand.

IBMS Travel Award. 2001 International Bone and Mineral Society Research

Conference. Madrid, Spain.

Medibank Private Young Investigator Award. 2001 National Australian Society of

Medical Research Conference. Melbourne, Australia.

21

List of Figures 1.1 The structure of vitamin D and the addition of hydroxyl groups to either

activate or deactivate vitamin D.

8

3.1 Optimisation of the CYP27B1 probe concentration. 60

3.2 Amplification plots of three CYP27B1 cDNA standards. 62

3.3 Standard curves of CYP27B1, CYP24, VDR, and GAPDH cDNA. 64

3.4 Reproducibility of CT values obtained from cDNA samples of CYP27B1,

CYP24, VDR and GAPDH.

67

3.5 Reproducibility of fluorogenic detection of CYP27B1, CYP24, VDR and

GAPDH mRNA in total RNA samples.

71

4.1 Relationship between rat age (weeks) and serum 1,25D levels (pmol/L). 88

4.2 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA)

with age (weeks).

90

4.3 Relationship between serum 1,25D (pmol/L) and kidney CYP27B1

mRNA levels (copy numbers/µg total RNA).

91

4.4 Relationship between serum calcitonin (pmol/L) and kidney CYP27B1


92

4.5 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) with

age (weeks).

94

4.6 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA

levels (copy numbers/µg total RNA).

95

4.7 Relationship between kidney CYP27B1 mRNA (copy numbers/µg total

RNA) and kidney CYP24 mRNA levels (copy numbers/µg total RNA).

96

4.8 Relationship between serum calcitonin (pmol/L) and kidney CYP24


98

4.9 Expression of kidney VDR mRNA (copy numbers/µg total RNA) with age

(weeks).

99

4.10 Relationship between kidney CYP24 and kidney VDR mRNA expression

(copy numbers/µg total RNA).

100

4.11 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) with

age (weeks)

102

22

age (weeks). 4.12 Relationship between serum calcium (mmol/L) and bone CYP27B1

mRNA (copy numbers/µg total RNA).

103

4.13 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA

(copy numbers/µg total RNA).

104

4.14 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) with

age (weeks).

106

4.15 Relationship between bone CYP27B1 and bone CYP24 mRNA

expression (copy numbers/µg total RNA).

107

4.16 Relationship between serum PTH (pmol/L) levels and bone CYP24


108

4.17 Expression of bone VDR mRNA (copy numbers/µg total RNA) with age

(weeks).

110

4.18 Relationship between serum 1,25D levels (pmol/L) and bone VDR


111

5.1 Relationship between serum calcium (mmol/L) and serum PTH levels

(pmol/L).

136

5.2 Relationship between serum calcium (mmol/L) and serum calcitonin

levels (pmol/L).

137

5.3 Representative bone histology from each rat treatment group. 139

5.4 Relationship between serum calcium levels (pmol/L) and BV/TV (%) in

the epiphysis of the D(-) animals.

140

5.5 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA) in

each dietary treatment group.

142

5.6 Relationship between serum PTH (pmol/L) and CYP27B1 mRNA levels

(copy numbers/µg total RNA) in the kidney.

143

5.7 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) in


145

5.8 Relationship between serum 25D (nmol/L) and kidney CYP24 mRNA

levels (copy numbers/µg total RNA) in the D(+) animals.

146


levels (copy numbers/µg total RNA) in the D(+) animals.

147

23


levels (copy numbers/µg total RNA) in the D(-) animals.

148

5.11 Relationship between serum calcium (mmol/L) and CYP24 mRNA levels


150

5.12 Relationship between serum PTH (pmol/L) and CYP24 mRNA levels


151

5.13 Relationship between serum calcitonin (pmol/L) and CYP24 mRNA

levels (copy numbers/µg total RNA) in the kidney.

152

5.14 Expression of kidney VDR mRNA (copy numbers/µg total RNA) in each

dietary treatment group.

154

5.15 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) in


156

5.16 Relationship between serum calcitonin (pmol/L) and bone CYP27B1

mRNA levels (copy numbers/µg total RNA) in the D(+) animals.

157

5.17 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA


158

5.18 Relationship between serum calcium (mmol/L) and bone CYP27B1

mRNA levels (copy numbers/µg total RNA) in the D(-) animals.

160

5.19 Relationship between bone CYP27B1 mRNA levels (copy numbers/µg

total RNA) and BV/TV (%) in the epiphysis of the D(-) animals.

161

5.20 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) in each


164

5.21 Relationship between bone CYP27B1 mRNA (copy numbers/µg total

RNA) and bone CYP24 mRNA (copy numbers/µg total RNA).

165

5.22 Relationship between serum PTH (pmol/L) and bone CYP24 mRNA


166

5.23 Expression of bone VDR mRNA (copy numbers/µg total RNA) in each


167

5.24 Relationship between serum calcium (mmol/L) and VDR mRNA levels

(copy numbers/µg total RNA) in the bone.

169

5.25 Relationship between serum PTH (pmol/L) and bone VDR mRNA levels

(copy numbers/µg total RNA) in the D(+) animals.

170

24

5.26 Ribonuclease protection assay for CYP27B1 mRNA detected in total

RNA isolated from kidney and bone tissue from each animals dietary

treatment group.

171

6.1 The expression of CYP27B1 mRNA levels (copy number/µg total RNA)

in rat bone marrow, femoral head and cortical bone.

194

6.2 The expression of CYP24 mRNA levels (copy number/µg total RNA) in

the rat bone marrow, femoral head and cortical bone.

196

6.3 The relationship between the expression of CYP27B1 and of CYP24

mRNA levels (copy numbers/µg total RNA) in the bone marrow, the

femoral head and in the cortical bone fractions.

197

6.4 The expression of VDR mRNA levels (copy number/µg total RNA in the

rat bone marrow, femoral head and cortical bone.

198

6.5 The expression of CYP27B1 mRNA levels (copy number/GAPDH copy

number) in primary bone cells, UMR 201, and UMR 106 cells.

200

6.6 The expression of CYP24 mRNA levels (copy number/GAPDH copy


201

6.7 The expression of VDR mRNA levels (copy number/ GAPDH copy


202

6.8 The expression of CYP27B1 mRNA in rat bone marrow. 204

6.9 The expression of CYP27B1 mRNA in the rat femur. 205

7.1 Diagram representing the proposed effects of the vitamin D-replete/low

calcium (D(+)/LC) diet on the expression of CYP27B1 and CYP24 in the

kidney and bone.

217

7.2 Diagram representing the proposed effects of the vitamin D-replete/high

calcium (D(+)/HC) diet on the expression of CYP27B1 and CYP24 in the

kidney and bone.

218

7.3 Diagram representing the proposed effects of the vitamin D-deplete/low

calcium (D(−)/LC) diet on the expression of CYP27B1 and CYP24 in the

kidney and bone.

221

7.4 Diagram representing the proposed effects of the vitamin D-deplete/high

calcium (D(−)/HC) diet on the expression of CYP27B1 and CYP24 in the

kidney and bone.

222

25

List of Tables

2.1 Components of the Semi-Synthetic Diet 29

2.2 Components of the Mineral Mix 30

2.3 Fluorogenic probe and primer sets 45

3.1 Threshold cycle (CT) values for the optimisation of fluorogenic probe

concentrations for mRNA quantification.

61

3.2 Sensitivity of fluorogenic probe for detection. 63

3.3 Equation of the line-of-best-fit for mRNA copy number estimations

determined from separate standard curves.

68

3.4 Efficiency of mRNA amplification of kidney and bone samples. 69

3.5 Reproducibility of amplification of reverse-transcribed mRNA samples

assessed by the comparison of the equations of line-of-best-fit and the

line-of unity.

72

3.6 GAPDH threshold cycle (CT) values from various rats treatment groups

from kidney and bone.

74

3.7 Comparison of expression levels when using total RNA or GAPDH as

the referent.

75

4.1 Body weight and serum biochemistry of 25D, 1,25D, PTH, calcitonin and

calcium with respect to age.

87

5.1 Allocation of animals into the dietary treatment groups at 6 months of

age.

129

5.2 Serum biochemistry of 25D, 1,25D, calcium, phosphate, PTH and

calcitonin in animals from each dietary treatment group.

135

5.3 Single and multiple linear regression equations for serum calcium,

serum PTH and serum calcitonin as determinants of kidney CYP24

mRNA levels.

153

5.4 Single and multiple linear regression equations for serum calcium,

serum PTH and bone CYP27B1 mRNA levels as determinants of

epiphyseal BV/TV in the D(-) animals.

162

1

Chapter 1: Vitamin D metabolism in kidney and bone

1.1 Introduction

The primary role of the vitamin D endocrine system is to maintain calcium

homeostasis. The tight regulation of serum calcium levels is essential to support

normal nerve and muscle function as well to provide sufficient calcium for the

maintenance of mineralised bone. The most critical role of vitamin D is to enhance the

absorption of dietary calcium in the small intestine. In response to hypocalcemia, 25-

hydroxyvitamin D3 (25D) is activated to 1,25-dihydroxyvitamin D3 (1,25D) in the

kidney, which in turn, enhances the absorption of calcium from the intestine. In

addition, 1,25D is also essential for the maintenance of a mineralised skeleton. A lack

of vitamin D, through poor nutrition or inadequate exposure to the sun, results in bone

mineralisation defects, such as rickets and osteomalacia.

Vitamin D-deficiency is associated with an increased risk of hip fracture, arguably the

most devastating complication of osteoporosis (Chapuy et al 1992). In hip fracture

patients, it has been shown that, although circulating levels of 25D are deficient, the

circulating 1,25D levels are normal or slightly raised (Nordin and Morris 1992;

Nordin et al 1998). It is unclear why the normal circulating 1,25D levels in these hip

fracture patients are unable to normalise bone turnover. Interestingly, while patients

with hip fractures had normal levels of circulating 1,25D, the levels of 1,25D in the

bone were decreased when compared to subjects that had not had a hip fracture (Lidor

et al 1993). This suggests that the circulating level of 1,25D does not predict the level

of 1,25D in the bone.

2

The local synthesis of 1,25D by bone cells has recently been proposed to explain the

paradox between normal circulating 1,25D levels, vitamin D deficiency in bone tissue

and the initiation of the clinical features of vitamin D-deficiency. This proposal is

possible since it was found more than two decades ago that bone cell synthesise 1,25D

from 25D in vitro (Howard et al 1981). Few studies, however, have investigated the

regulation of the synthesis of 1,25D in the bone and the physiological role of the

locally produced 1,25D in the maintenance of healthy bone remains unresolved.

The enzyme 25-hydroxyvitamin D3-1α-hydroxylase (CYP27B1) is responsible for the

synthesis of 1,25D. This enzyme, which was first found in the kidney, has also been

identified in the bone. While a number of biological factors have been shown to

control the expression of CYP27B1 mRNA in the kidney, the regulation of CYP27B1

mRNA expression in bone has not been examined. The enzyme 25-hydroxyvitamin

D3-24-hydroxylase (CYP24) is responsible for the breakdown of 1,25D. The wide

tissue distribution of CYP24, including a number of different bone cell types, is

consistent with the tissue distribution of the vitamin D receptor (VDR). The regulation

of CYP24 activity in the bone, as well as in the kidney, has been well described.

The comparison of the vitamin D endocrine systems in the kidney and bone, based on

the activity of CYP27B1 and CYP24 and on the levels of VDR found in these tissues,

may help elucidate the physiological role for the locally produced 1,25D in processes

involved in bone metabolism. The studies described in this thesis were based on the

hypothesis that vitamin D metabolism in the bone is regulated independently of the

vitamin D metabolism in the kidney.

3

1.2 Vitamin D metabolism

Vitamin D, in the form of vitamin D3, is made from 7-dehydrocholesterol in the skin

by exposure to ultraviolet light (270–300 nm) from the sun. Alternatively, vitamin D,

in the form of either vitamin D2 or vitamin D3, can be derived from dietary sources

(DeLuca 1988). Vitamin D3 undergoes an activation process, involving first a 25-

hydroxylation in the liver, followed by 1α-hydroxylation in the kidney, to make the

biologically active compound 1,25D. While the synthesis of 25-hydroxyvitamin D3

(25D) by the liver is constitutive, the synthesis of 1,25D by the renal CYP27B1 is

tightly regulated (Jones et al 1998). CYP24 catabolises 1,25D to produce 1,24,25-

trihydroxyvitamin D3 (1,24,25D), which is the first step of 1,25D degradation, known

as the C-24 oxidation pathway (Henry 1992). The synthesis of 1,25D by CYP27B1

and degradation of 1,25D by CYP24 are subject to a high degree of control, which

confers specificity to 1,25D-mediated activity.

1.2.1 Hepatic 25-Hydroxylation

The 25-hydroxylation of vitamin D is the first step in the activation of vitamin D. This

step is catalysed by the liver enzyme, 25-hydroxylase (Blunt et al 1968), which has a

high affinity for vitamin D (Andersson et al 1989; Cali and Russell 1991; Takeda et al

1994; Okuda et al 1995). 25-hydroxylase is commonly named CYP27 because of its

27-hydroxylase activity on cholesterol from the bile-acid pathway (Pikuleva et al

1997). Although the liver is the primary site of 25-hydroxylation in vivo, there are

reports of CYP27 activity in skin, intestinal and renal extracts (Tucker et al 1973).

The CYP27 enzyme exists in both the microsomal and mitochondrial fractions of the

liver (Bhattacharyya and DeLuca 1974). The product of the 25-hydroxylation of

vitamin D, 25D is the major circulating metabolite of vitamin D (Hollis et al 1986),

4

which due largely to the stability of 25D when bound to the vitamin D-binding protein

in blood (Cooke and Haddad 1989; Cooke et al 1991). The level of 25D in the

circulation increases in proportion to vitamin D intake, and for this reason, the level of

serum 25D is commonly used as a clinical indicator of vitamin D status. The

metabolic fate of 25D is dependent on the calcium requirements of the animal. An

urgent need for calcium results in renal 1α-hydroxylation of 25D, whereas an

abundance of calcium results in 24-hydroxylation of 25D.

1.2.2 Renal 1α-Hydroxylation

The second step of vitamin D activation is the conversion of 25D to 1,25D. The

enzyme, CYP27B1, catalyses the introduction of a hydroxyl group into the 1α

position of the A ring of 25D to form 1,25D. CYP27B1 was named due to its

structural similarity to the liver CYP27 enzyme. The kidney was shown to be the

major source for the synthesis of 1,25D. Fraser and Kocidek (1970) used

nephrectomised animals to demonstrate that CYP27B1 enzyme activity was

predominantly in the kidney. More recently, CYP27B1 has been shown to be

expressed in a number of other tissues such as skin, intestine, brain, testis,

macrophages and bone (Zhender et al 2001; I Hendrix, personal observations).

Experiments investigating the regulation of CYP27B1 enzyme activity and

transcriptional activity in vivo have proved difficult due to the negative feedback

mechanisms that tightly control the metabolism of vitamin D. It was shown, however,

that the ability to convert 25D to 1,25D in the kidney is more efficient in 2-month-old

rats than older animals and this activity reduced gradually with age until 2 years of

age (Ishida et al 1987). More recently, studies of the mechanisms involved in

CYP27B1 gene regulation have been made possible with the cloning of mouse, rat

5

and human cDNA and genomic clones for CYP27B1 (Fu et al 1997(a); Monkawa et

al 1997; Shinki et al 1997; St Arnaud at al 1997; Takeyama et al 1997). Takeyama

and co-workers (1997) were the first to isolate a CYP27B1 cDNA. Using a VDR

knockout mouse, they were able to isolate the over-expressing CYP27B1 protein and

candidate cDNA, which occurred as a result of the absence of functional VDR.

Subsequent cloning of a human CYP27B1 cDNA was achieved using mRNA from

cultured human keratinocytes (Fu et al 1997(a)), which have previously been shown

to synthesize 1,25D (Pillai et al 1988). A full-length cDNA of 2·4kb was shown to

encode a 508-amino-acid protein with a predicted size of 56kDa.

CYP27B1 mRNA expression and protein has been found to be located to the renal

proximal tubules (Zehnder et al 1999), and, to a lesser extent, in distal tubules and

collecting ducts. There are, however, a number of studies that have shown the presence

of the CYP27B1 enzymes in a number of non-renal tissues and cells. The original

description of extra-renal CYP27B1 enzyme activity was based on studies of the

granulomatous disease sarcoidosis, which frequently presents with hypercalcaemia

(Papapoulos et al 1979, Barbour et al 1981). Since then, a number of sites for

CYP27B1 expression have been found such as skin, bone and lymph nodes, and more

recently the cerebellum, placenta, and pancreas (Panda et al 1999; Zehnder et al 2001).

While the regulation of CYP27B1 activity in non-renal tissues is largely unknown,

CYP27B1 mRNA expression and protein synthesis in the kidney has been extensively

studied and has been shown to be tightly regulated by a number of factors. PTH is a

potent stimulator of CYP27B1 transcription and activity in the kidney, which is

mediated through a cAMP signal transduction mechanism (Henry & Luntao 1989).

6

More recent reports have highlighted potential cAMP response elements (CREs) in

downstream areas of the CYP27B1 promoter, which are PTH-responsive (Brenza et al

1998; Murayama et al 1998; Murayama et al 1999; Brenza and DeLuca 2000). On the

other hand, 1,25D has been shown to down-regulate the PTH-stimulation of

CYP27B1 gene transactivation (Brenza and DeLuca 2000). 1,25D appears to achieve

its effects indirectly given that 1,25D was unable to suppress CYP27B1 promoter

activity in AOK-B50 kidney cells, but was able to suppress kidney CYP27B1 mRNA

expression in vivo (Brenza and DeLuca 2000). Furthermore, no vitamin D response

elements (VDREs) have been identified in the 1·4kb promoter of the CYP27B1 gene

(Murayama et al 1998; Portale and Miller 2000), which suggests the regulation of

CYP27B1 mRNA by 1,25D is mediated through an indirect mechanism. Murayama

and co-workers (2001) have identified a region on the promoter of the CYP27B1

gene, which is negatively regulated by 1,25D and requires the VDR for the inhibition

to occur. The VDR does not, however, directly bind to this region in the promoter and

the mechanism, to date, has not been fully elucidated. The regulation of renal

CYP27B1 mRNA expression and enzyme activity is discussed further in Chapter 1.5.

1.2.3 24-hydroxylation

The high potency of 1,25D in elevating serum calcium and phosphate levels requires

its circulating levels to be tightly regulated. The activity of 1,25D is attenuated by the

addition of a hydroxyl group in the C-24 position, which is catalysed by the enzyme,

CYP24. CYP24 is a multicatalytic enzyme, which in addition to the 24-hydroxylation

of either 25D or 1,25D, is able to catalyse the side chain hydroxylations at the C23

and C26 positions (Miyamoto et al 1997). These hydroxylation steps of the C-24

oxidation pathway converts 25D and 1,25D, which ultimately results in the formation

of water-soluble calcitroic acid, which is excreted (Makin et al 1989; Reddy & Tserng

7

1989). The catabolism of 1,25D limits the action of 1,25D in target cells once the

initial wave of 1,25-mediated gene expression has been initiated.

The first report of CYP24 enzyme activity was first shown in chicken kidney tissue

(Knutson & DeLuca 1974). Since then, CYP24 has been found in the intestine, bone

(Kumar 1984) and number other vitamin D-responsive tissues (Reinhardt & Horst

1989; Tomon et al 1990(a); Masuda et al 1994). Under normal physiological

circumstances, renal CYP24 activity was shown to be lowest in 2-month-old female

rats and gradually increased with age until 2 months of age (Ishida et al 1987), which

is converse to the reduced CYP27B1 activity with age described earlier. 1,25D

potently stimulates CYP24 enzyme activity, which has been shown in a variety of

renal and non-renal systems (Tanaka & DeLuca 1974; Tanaka et al 1977; Kumar et al

1978; Armbrecht and Boltz 1991; Armbrecht and Hodam 1994; Lemay et al 1995;

Roy et al 1995; Armbrecht et al 1997(a); Armbrecht et al 1998; Zierold et al 2000).

The first demonstration of the 1,25D-mediated induction of CYP24 activity in mature

osteoblasts cell cultures (Makin et al 1989) has led to a number of studies

investigating the regulating mechanism of CYP24 gene expression in bone. CYP24

was cloned in the early 1990s (Ohyama et al 1991(a); Chen et al 1993; Itoh et al 1995)

and the gene has been described for mouse, rat and human. In each case, the CYP24

gene possesses two VDREs in its promoter (Ohyama et al 1994(b); Chen and DeLuca

1995; Zhou et al 1997; Zierold et al 1995). The two VDREs in the CYP24 promoter

allow for the direct 1,25D/VDR-mediated up-regulation of CYP24 mRNA expression

(Hahn et al 1994; Kerry et al 1996).

8

Figure 1.1 The structure of vitamin D and the addition of hydroxyl groups to either

activate (green) or deactivate (red) vitamin D. The enzymes responsible for the these

hydroxylations are associated with each of the hydroxyl groups.

25-hydroxylase(CYP27)

25-hydroxyvitamin D-24-hydroxylase(CYP24)

25-hydroxyvitamin D-1α-hydroxylase(CYP27b1)OH

OH

OH

(CYP27B1)

9

1.3 Molecular Mechanism for the action of vitamin D

The biological activity of 1,25D is mediated by a high-affinity receptor, VDR, which

acts as a ligand-activated transcription factor. The VDR was found originally in the

organs involved in calcium homeostasis including the intestine, bone, kidney, and the

parathyroid glands. The isolation of cDNAs coding for the avian, human, mouse, and

rat VDR (McDonnell et al 1987; Baker et al 1988; Burmester et al 1988(a); Kamei et

al 1995) has led to VDR being detected in many other non-classical tissues and cell

types. The action of 1,25D in these tissue have been associated with a diverse range of

biological systems such as modulation of immune function, inhibition of cell growth,

and induction of cell differentiation.

Upon ligand binding, the cytoplasmic VDR rapidly translocates to the nucleus

whereby it forms a heterodimer with retinoic X receptor (RXR). This induces a VDR

conformation that is essential for VDR transactivation. The VDR-RXR heterodimer is

directed to the VDRE in the promoter region of 1,25D-regulated genes, with the RXR

binding the 5' half site and the VDR occupying the 3' half site of the VDRE (Haussler

et al 1998). This association serves to recruit nuclear proteins as co-activitators or co-

repressors necessary for VDR-mediated transcriptional regulation. In short, the

interactions of the 1,25D-bound VDR-RXR complex with nuclear proteins forms a so

called “pre-initiation complex”, which regulates the rate of transcription of the target

gene (Chakravarti et al 1996; Glass et al 1997).

1.4 Biological actions of 1,25D

Maintaining calcium homeostasis involves a coordinated mechanism largely from the

intestine, kidney, bone and parathyroid glands. The complex interactions of these

10

tissues ensure that the availability of calcium is adequate for a number of biological

functions, such as nerve and muscle functions as well the maintenance of mineralised

bone. More recently, 1,25D has been shown to be associated with biological functions

in other tissues, including keratinocytes, T cells and macrophages of the immune

system, islet cells of the pancreas, ovarian cells of the female and certain neuronal

tissue. In most cases, the precise roles for 1,25D in these tissues are still to be

determined, however, it is clear the vitamin D endocrinology has a variety of

biological effects beyond calcium homeostasis.

1.4.1 Intestine

Arguably the most important role for 1,25D is its ability to stimulate dietary calcium

absorption in the small intestine. This was convincingly shown in VDR knockout

mice, which developed marked hypocalcemia as a result of calcium malabsorption (Li

et al 1998(a)). Hence, it was shown that 1,25D increases intestinal calcium absorption

through a VDR-mediated transcription of specific genes involved in active calcium

absorption. A number of proteins have been shown to be essential for the entry of

calcium through the basement membrane into the enterocyte, the movement of

calcium through the cytoplasm, and the transfer of calcium across the basolateral

membrane into the circulation. The cytosolic calcium-binding protein, calbindin-D9k,

is thought to be particularly important in the translocation of calcium across the

enterocyte. 1,25D is able to up-regulate the expression of calbindin-D9k through the

VDRE in the proximal promoter of the gene (Darwish and DeLuca 1996). The direct

action of 1,25D on calbindin-D9k was also shown when the levels of mRNA and

protein for calbindin-D9k were dramatically reduced in the intestines of VDR

knockout mice (Li et al 1998(b)). The role of 1,25D in the regulation of other proteins

involved in the absorption of calcium is less clear. For example, while the extrusion of

11

calcium from the cell into the extracellular fluid by plasma membrane calcium

ATPase pump (PMCA) has been shown to respond to 1,25D treatment in vitamin D

deficient rats (Matkovits and Christakos 1995), no classical VDRE’s have been

identified in the promoter of this gene (Wasserman and Fullmer 1995). Although a

recently cloned epithelial calcium channel, ECaC, which is located in the basement

membrane of the enterocyte, has been shown to be reduced in the duodenum of VDR

knockout mice (Van Cromphaut et al 2001), the role of 1,25D in the regulation of this

ECaC gene expression is not fully understood.

1.4.2 Bone

Vitamin D deficiency leads to defects in bone mineralisation such as is found in

rickets and osteomalacia (Gallagher and Riggs 1978). In VDR-knockout mice, severe

impairment in bone mineralisation characterised by an increase in osteoid levels and

impaired calcein deposition was also shown (Amling et al 1999). Interestingly, normal

bone mineralisation could occur in these animals when they were fed a high calcium

diet, which was similar to the findings shown in calcium-supplemented vitamin D-

deficient animals (Weinstein et al 1984). This suggests that 1,25D is not absolutely

essential for bone mineralisation and the decreased availability of calcium and

phosphorus through impaired intestinal absorption may be the basis of the

mineralisation defect seen in vitamin D deficiency.

Nonetheless, 1,25D has been shown to play an important role in vitro in regulating

osteoblast gene transcription, differentiation and mineralisation (Matsumoto et al

1991; Rickard et al 1995). 1,25D directly stimulates the transcription of two genes

encoding for the bone matrix proteins, osteopontin and osteocalcin, which both

possess vitamin D response elements (VDRE) in their promoter. 1,25D also stimulates

12

osteoclastogenesis by differentiating pro-myelocytes and monocytes to active

osteoclasts (Abe et al 1981; Tanaka et al 1982). The 1,25D stimulation of osteoclastic

differentiation occurs indirectly, however, through osteoblasts to generate an

osteoblast-derived factor, which in turn promotes osteoclastic differentiation (Suda et

al 1995). It was shown that osteoblasts from VDR knockout mice were unable to

stimulate the differentiation of osteoclasts, which clearly indicates the presence of the

VDR in osteoblast is essential for this 1,25D-mediated effect (Takeda et al 1999).

It is thought that in order to maintain normal serum calcium levels, 1,25D can induce

osteoclastic bone resorption in order to mobilise calcium stores from the bone.

However, evidence that suggests 1,25D can also mediate the mineralisation processes,

suggests that 1,25D may be central in the initiation of bone re-modelling processes for

the repair microfracture (Gallagher & Riggs 1990; Langdahl et al 1996). That is, the

1,25D induced osteoclastic activity may provide calcium for the coupled bone

mineralisation process, rather than to maintain serum calcium levels (Eriksen et al

1989).

1.4.3 Parathyroid glands

While PTH stimulates the renal production of 1,25D in response to hypocalcemia,

1,25D can exert a negative feedback signal on the parathyroid glands to suppress

further synthesis and secretion of PTH (Cantley et al 1985; Chan et al 1986).

Furthermore 1,25D has been shown to control parathyroid cell growth (Szabo et al

1989). The PTH gene promoter contains a VDRE, which allows for the direct

regulation of PTH gene transcription by the 1,25D-VDR/RXR complex (Liu et al

1996). The lack of 1,25D feedback of the PTH promoter during vitamin D deficiency

is pronounced causing parathyroid hyperplasia and secondary hyperparathyroidism.

13

The correction of parathyroid gland growth and serum PTH levels in the VDR-

knockout mice through dietary supplementation, suggests that the feedback of 1,25D

on PTH production is not essential. It is likely, therefore, that both 1,25D and calcium

are regulators of PTH synthesis and parathyroid cell proliferation (Li et al 1998(a);

Takeda et al 1999).

1.4.4 Kidney

While perhaps the most important effect of 1,25D in the kidney is the negative

feedback on its own production through the suppression of CYP27B1 activity and the

stimulation of CYP24 activity, there is evidence that 1,25D is involved in calcium

reabsorption. 1,25D increases the expression of the renal calcium-transport protein,

calbindin-D28k (Varghese et al 1988; Bar et al 1990). Armbrecht and coworkers

(1989) showed that serum 1,25D levels correlate strongly with the expression of

calbindin-28k in the kidney measured in wide range of rat age groups. Furthermore,

1,25D has been shown to facilitate renal calcium reabsorption and promotes the PTH-

dependent calcium transport in the distal tubule where active calcium reabsorption

occurs (Yamamoto et al 1984; Friedman and Gesek 1993).

1.5 Factors that effect the kidney vitamin D metabolism

In normal physiological circumstances, the factors that regulate vitamin D

metabolism, such as PTH, calcium, calcitonin and 1,25D itself, are inextricably linked

to ensure that extracellular fluid calcium is tightly controlled within a narrow

concentration range. The response to even slight hypocalcaemia, results in a cascade

of biological processes with the aim to return serum calcium to normal levels. The

effects of a number of factors on vitamin D metabolism may occur indirectly or in

concert with other factors. Hence, experiments investigating the in vivo regulation of

14

vitamin D metabolism have proved difficult. The cloning of the genes for CYP27B1,

CYP24 and VDR, however, has been useful to investigate the direct transcriptional

regulation of the genes involved in vitamin D metabolism and activity.

1.5.1 PTH

While low serum calcium concentrations increases serum 1,25D levels, the release of

PTH during hypocalcemia is the predominant stimulator of renal 1,25D production.

PTH up-regulates the CYP27B1 mRNA levels (St-Arnuad et al 1997) and enzyme

activity (Garabedian et al 1972) predominantly in proximal tubular cells of the kidney.

In parathyroidectomised animals, no stimulation of renal CYP27B1 activity was

detected in response to hypocalcemia (Booth et al 1977; Horiuchi et al 1977). PTH

administration to these animals, however, was able to restore the induction of

CYP27B1 enzyme activity (Weisinger et al 1989; Lobaugh et al 1993). Addition of

PTH to AOK-B50 cells resulted in a 17-fold increase in the full-length CYP27B1

promoter-directed synthesis of luciferase (Brenza et al 1998). Gao et al (2002) showed

a PTH-mediated induction 2.5-fold in the first 305bp of the CYP27B1 promoter in

AOK-B50 cells. While the molecular mechanism behind the PTH-mediated regulation

of CYP27B1 activity is not fully understood, it appears likely that PTH induces

CYP27B1 activity, in part, through a receptor-mediated cAMP/phosphatidylinositol

4,5-bisphosphate (PIP2) signal transduction mechanism (Henry 1997). Three potential

CRE sites have been identified in the promoter of the CYP27B1 gene (Shinki et al

1998), which is suggestive of a direct effect of cAMP on the regulation of the

transcriptional activity of the CYP27B1 gene. CYP27B1 gene expression can be up-

regulated by forskolin, which is a specific cAMP-inducer, but not to the same extent

as was found with PTH-induction of CYP27B1 promoter activity (Brenza et al 1998).

15

Besides stimulating the activity of the CYP27B1 enzyme, PTH also markedly

suppresses the activity of the renal CYP24 enzyme activity (Shinki et al 1992).

Forskolin has been found to mimic the PTH-mediated suppression of renal CYP24

transcriptional activity (Mandla and Tenenhouse 1992), suggesting that cAMP

signalling may be involved in the regulation of CYP24 activity. No conventional CRE

sites have, however, been identified in the proximal promoter of the CYP24 gene. The

suppressive effect of PTH on CYP24 in the kidney does not necessarily occur in other

tissues. PTH has, for example, no effect on the expression of CYP24 mRNA in the

intestine (Shinki et al 1992), which is likely to be due to the absence of PTH receptors

in the intestine (Abou-Samra et al 1994). PTH does, however, stimulate 1,25D

induction of CYP24 mRNA in osteoblast-like cell lines (Armbrecht and Hodam

1994). The PTH-mediated up-regulation of CYP24 in osteoblast-like cells has been

shown to coincide with a rise in VDR mRNA levels (van Leeuwen et al 1992).

Similarly, the PTH-mediated down-regulation of CYP24 in the kidney has been

shown to correspond with a reduction in renal VDR mRNA and protein levels

(Reinhardt and Horst 1990). This suggests that the mechanism for the effect of PTH

on CYP24 activity involves the regulation of VDR expression. Despite the fact that

the mechanism for the PTH-mediated regulation of vitamin D metabolism is

unresolved, it is clear that PTH-mediated stimulation of CYP27B1 activity and

inhibition of renal CYP24 activity results in a marked elevation of circulating plasma

levels of 1,25D (Thakker et al 1986).

1.5.2 Calcium

Calcium primarily affects the renal production of 1,25D by interacting with the

calcium-sensing receptors (CaR) located in the parathyroid gland. In response to a

decrease in circulating serum calcium levels, the parathyroid cells rapidly secrete

16

PTH, which in turn, stimulates the renal production of 1,25D in the kidney. It has,

however, been shown that calcium can also directly regulate the metabolism of

vitamin D in the kidney. Studies, using parathyroidectomised, PTH-replete rats have

shown that elevated levels of serum calcium are able to reduced the circulating levels

of 1,25D (Matsumoto et al 1987; Weisinger et al 1989). Bland et al (1999) found a 5-

fold increase in the 1,25D production in the human proximal tubule cell line, HKC-8,

when treated with a low serum calcium medium. When these cells were treated with a

medium containing high level of calcium, the 1,25D production was significantly

reduced. The direct effect of calcium was suggested to be mediated by the CaR, which

is present in all segments of the nephron. The exact mechanism, however, of the CaR-

mediated inhibition of CYP27B1 mRNA expression is not known.

1.5.3 Calcitonin

When the circulating levels of calcium are high, the parathyroid gland halts the

secretion of PTH and the parafollicular cells of the thyroid gland turn on the secretion

of the hormone, calcitonin. Calcitonin directly acts on osteoclasts and osteocytes,

which results in a reduction of bone resorption and calcium mobilisation from the

skeleton, which results in the lowering of the circulating levels of calcium (Martin

1999). Although the role of calcitonin in vitamin D metabolism is suggested by some

to be secondary to the role of PTH (Lorenc et al 1977; Jones et al 1998), there have

been a number of studies that demonstrate a direct role for calcitonin in the

metabolism of vitamin D (Galante et al 1972; Beckman et al 1994). Of particular

interest, is the report that calcitonin stimulates the expression of CYP27B1 mRNA in

the kidney when serum calcium levels are normal (Shinki et al 1999). This study

showed that while the PTH-mediated stimulation of the expression of CYP27B1

mRNA occurred during hypocalcemia, only calcitonin was able to stimulate the

17

expression of CYP27B1 mRNA during normocalcemia. This finding is supported by

the identification of a positive regulatory site for calcitonin in the promoter of the

CYP27B1 gene (Murayama et al 1998). Recently, in vitro studies have shown that

calcitonin can up-regulate CYP24 promoter activity in the human kidney cell line,

AOK-B50 (unpublished data, Gao and May). The mechanism by which this up-

regulation occurs is, however, yet to be determined. In contrast to the kidney,

calcitonin has been found to inhibit the intestinal transcriptional regulation and

enzyme activity of CYP24. In thyroparathyroidectomised rats, a single dose of

calcitonin was found to return intestinal CYP24 mRNA expression levels to normal

(Beckman et al 1994). Although it has been shown that calcitonin may effect the

regulation CYP27B1 and CYP24 gene expression, the precise role of calcitonin in

mediating vitamin D metabolism remains unclear.

1.5.4 1,25D

The most striking effect of 1,25D on the metabolism of vitamin D is the up-regulation

of CYP24 activity. In fact, in vivo studies show that 1,25D is the most potent

stimulator of CYP24 activity. The 1,25D-mediated up-regulation of CYP24 activity

was first shown in the kidney and intestine (Tanaka and DeLuca 1974; Tanaka et al

1975; Tanaka et al 1977; Kumar et al 1978), and has also been shown in other tissues,

such as in bone (Howard et al 1981; Puzas et al 1987). 1,25D, bound to the VDR, has

been shown to directly stimulate the expression of CYP24 mRNA expression, by

interacting with the two VDREs found on the promoter of the CYP24 gene (Hahn et

al 1994; Kerry et al 1996). The induction of CYP24 and catabolism of 1,25D by

1,25D itself is an important feedback loop, which modulates the 1,25D-mediated

signalling in target tissues.

18

When 1,25D was administered to vitamin D-deficient rats, CYP24 activity in the

kidney was markedly induced and a reciprocal disappearance of renal CYP27B1

activity was found (Tanaka et al 1977). During vitamin D-deficiency, CYP27B1

activity is increased, which is attributed, in part, to the lack of negative feedback by

1,25D on CYP27B1 activity (Brunette et al 1977; Kawashima et al 1981; Fox et al

1991). The apparent down-regulation of CYP27B1 activity by 1,25D takes 2–4 hours

and is blocked by inhibitors of protein synthesis and transcription (Rosenthal et al

1980). The mechanism behind the effect of 1,25D on the regulation of CYP27B1 gene

transcription is not well understood, particularly since no classical VDREs have been

identified in the proximal promoter of the CYP27B1 gene. Murayama and co-workers

(1998) were able to locate a response region within the murine CYP27B1 promoter

that responded negatively to 1,25D. The exact mechanism behind this process,

however, has not been fully elucidated. While it is likely that 1,25D achieves its

effects on CYP27B1 by an indirect mechanism, an atypical negative VDRE within the

CYP27B1 gene promoter cannot be ruled out. Recently, Brenza and DeLuca (2000),

who showed the kidney CYP27B1 mRNA suppression by 1,25D administration in

vivo, were unable to show 1,25D-mediated suppression of CYP27B1 promoter

activity in AOK-B50 kidney cells. They suggested, therefore, that the mechanism of

1,25D-mediated suppression of CYP27B1 activity in vivo is indirect and may involve

other factors such as calcium and PTH.

1.6 Evidence for bone vitamin D metabolism

1.6.1 Bone 1α-hydroxylation

Although bone cells have has been known for over two decades to synthesise 1,25D,

surprisingly little is known about the regulation of CYP27B1 activity in the bone and

19

about the importance of the locally produced 1,25D. The first report that bone cells

could synthesise their own 1,25D came from Turner and co-workers (1980). They

found that primary cultures of human bone cells, taken from iliac crest biopsies and

incubated with 25D for 4 hours, synthesised both 1,25D and 24,25D, with specific

activities similar in magnitude to those of the enzymes found in kidney cells. The

suppression of CYP27B1 activity and stimulation of CYP24 activity by 1,25D itself in

these bone cells supported the proposition of Turner and co-workers that the

production of 1,25D in bone cells could be regulated in order to mediate bone mineral

metabolism.

Bone marrow macrophages have also been found to convert 25D into either 1,25D or

24,25D. Reichel and co-workers (1987(d)) demonstrated that, upon exposure to

recombinant human interferon-gamma (IFN-γ), bone marrow-derived macrophages

initially synthesised 1,25D from 25D. A delay in the breakdown of 25D to 24,25D,

suggested that the production of 24,25D was stimulated by high intracellular levels of

1,25D rather than by the IFN- γ. The 1,25D synthesised in the bone marrow

macrophages was found to promote the differentiation of pro-myelomonocytic HL-60

cells into macrophage-like cells, which suggests that locally produced 1,25D may act

in a paracrine or autocrine manner to modulate cell differentiation. The

myelomonocytic cell line, HD-11, was also shown to synthesise 1,25D from 25D.

Since this cell line is known to express the VDR, it is suggested that locally produced

1,25D may be involved in autocrine signalling (Adams et al 1990).

More recently, CYP27B1 mRNA has been identified in bone tissue by our laboratory

(unpublished data) and by other investigators (Panda et al 2001(a)). Panda and co-

20

workers were able to show by qualitative RT-PCR that the expression of CYP27B1

mRNA in rats was significantly higher in foetal bone than in adult bone. Furthermore,

they identified CYP27B1 mRNA expression in growth plate chondrocytes and

osteoblasts by in situ hybridisation. They were unable, however, to detect CYP27B1

mRNA in osteoclast or in the bone marrow using this method.

Although it is clear that specific bone cells contain the CYP27B1 enzyme and are able

to convert 25D to 1,25D, the functional relevance of this locally produced 1,25D is

still unknown. Of considerable interest is the study of 1,25D levels in human bone

conducted by Sagiv and co-workers (1993). They found that, although serum 1,25D

levels were similar in all age groups studied, the levels of 1,25D in the bone were

higher in women of 45 years of age and less when compared to those found in older

age groups (46-60 years and 61+ years of age). The same research team also

discovered that women of approximately 80 years of age, who had had a subcapital

fracture of the femur, had 5-times lower levels of 1,25D in the bone when compared

to those detected in aged matched women who had not had a fracture (Lidor et al

1993). This was despite the fact that the serum 1,25D levels were only slightly lower

in these women than in normal individuals. The association between low 1,25D levels

in the bone, aging and subcapital fracture may be significant in the understanding of

why normal circulating levels of 1,25D in hip fracture patients are not able to

normalise bone turnover. Moreover, the findings from these clinical studies suggest

that the 1,25D production in the bone may in deed be important in the bone

mineralisation processes.

21

1.6.2 Bone 24-hydroxylation

The identification of CYP24 activity in the intestine (Kumar et al 1978), was soon

followed by the finding that bone cells also have the ability to catabolise 1,25D.

Isolated rat calvarial cells were found to produce 24,25D following incubation with

25D (Turner et al 1980). The regulation of the activity of CYP24 in osteoblasts and

other bone cells has, however, only been extensively studied since the structural

characterisation and cloning of the gene for CYP24 (Ohyama et al 1993; Chen and

DeLuca 1995). The role for bone CYP24 in modulation of the activity of 1,25D was

illustrated best using a CYP24-knockout mouse model (St-Arnaud et al 2000). The

CYP24-knockout mice exhibited abnormal bone histology, characterised by excessive

un-mineralised bone matrix. It was suggested that the inability of bone cells, such as

osteoblasts, to catabolise 1,25D resulted in an unabated continuation of 1,25D-

mediated processes in these cells. This concept was shown to be likely when a VDR-

knockout mouse was crossed with the CYP24-knockout mouse expressing an

abnormal bone phenotype (St-Arnaud et al 2000). The bones of the double-knockout

mouse were phenotypically normal, provided a sufficient amount of calcium was

given to these animals in their diet. In the absence of the VDR, the high levels of

1,25D, which occurred as a consequence of the cells inability to catabolise 1,25D,

were unable to instigate its toxic effects on the bone. The finding that these animals

had normal bones, despite the absence of CYP24 activity, disproved the theory that

24,25D, produced by 24-hydroxylating 25D, was an important in the process of bone

development (St-Arnaud et al 2000).

Nishimura and co-workers (1994) were amongst the first to show that the

administration of 1,25D to rats resulted in an increase in the expression of CYP24

22

mRNA in the bone. They also found that the 1,25D induction of CYP24 mRNA

expression in the rat immature osteoblastic cells line, C-26, was greater than the

induction in the mature osteoblast cell line, C-11. PTH did not down-regulate the

1,25D-mediated expression of CYP24 mRNA in either the C-26 or the C-11 cell line,

which is in contrast with the finding that PTH suppresses the expression of CYP24

mRNA in the kidney. These findings suggest that the control of the expression of

CYP24 mRNA is tissue-specific. While the stimulation of CYP24 activity by 1,25D

in the bone clearly shows that it is involved in the modulation of 1,25D-mediated

processes, it is less clear whether the induction of CYP24 activity occurs

predominantly in response to the circulating levels of 1,25D or to the locally produced

1,25D in the bone.

1.7 Aims and hypotheses

The studies, described in this thesis, were based on the hypothesis that the metabolism

of vitamin D in bone cells is regulated independently from the metabolism of vitamin

D in the kidney. The recent characterisation of the CYP27B1 gene allows for the

study of the expression of CYP27B1 in the bone at the molecular level. Investigation

into the effects of age, dietary calcium and vitamin D, on the expression of CYP27B1,

CYP24 mRNA and VDR mRNA in rat kidney and bone tissue, provides valuable

insight into the control of the metabolism of vitamin D in both the kidney and bone.

Furthermore, by investigating the association between the synthesis of 1,25D in the

bone and bone cell processes such as mineralisation, a role for the locally produced

1,25D can be proposed.

23

1.7.1 Detection and quantification of CYP27B1, CYP24 and VDR

mRNA by Real-Time RT-PCR

The accurate quantification of CYP27B1 and CYP24 mRNA, has been difficult due to

the limitations in the ability to detect these lowly expressed mRNA species. While the

detection of CYP27B1, CYP24 and VDR mRNA by reverse transcriptase-polymerase

chain reaction (RT-PCR) has been performed in a number of studies, the accurate

quantification of these mRNA species by the relatively new technique of Real-Time

RT-PCR, has not been attempted. Furthermore, there are no reports of the

quantification of mRNA that has been extracted from mineralised bone by Real-Time

RT-PCR. The thorough assessment of the procedure for detecting levels of lowly

expressed mRNA species, provides a reliable method of mRNA quantification, which

other analytical procedures have not been able to provide.

1.7.2 The effect of age on the metabolism of vitamin D in kidney and

bone

The renal production of 1,25D has been shown to decline with age. This decline is

caused by a reduction in the activity of the CYP27B1 enzyme and an increase in the

activity of the CYP24 enzyme. While a number of different bone cells have been

shown to express the CYP27B1 and CYP24 genes, there is no documentation on the

regulation of the CYP27B1 and CYP24 mRNA expression in the bone with age.

While the inverse relationship between the expression of CYP27B1 and CYP24

mRNA in the kidney with age has been established, the relationship between the

expression of CYP27B1 and CYP24 mRNA in the bone is not known. Furthermore,

while VDR is essential for the expression of CYP24 mRNA in the kidney, the

24

relationship between the expression of CYP24 and VDR mRNA in the bone is

unclear.

Hypothesis 1: The role of the kidney in the supply of vitamin D-responsive tissues

with 1,25D is well documented. Since it is likely that the 1,25D produced in the bone

is used for autocrine or paracrine signalling processes, rather than for the maintenance

of circulating 1,25D levels, we hypothesise that the regulation of the metabolism of

vitamin D in the bone with age will specifically reflect the requirements of the 1,25D-

mediated processes that occur in the bone during the process of aging. That is, the

production of 1,25D will be highest in younger rats during periods of rapid bone

growth, metabolism and mineralisation.

1.7.3 The effect of dietary calcium on vitamin D metabolism in kidney

and bone

The effects of dietary calcium on the metabolism of vitamin D in the kidney have

been well described. A low calcium diet increases the renal production of 1,25D by

increasing the expression of CYP27B1 mRNA and reducing the expression of CYP24

mRNA, largely through transcriptional regulation by PTH. The effects of dietary

calcium concentration, however, on the expression of CYP27B1, CYP24 and VDR

mRNA in the bone, have not been documented.

Hypothesis 2: 1,25D has been found to promote the maturation of osteoblasts. Bone

mineralisation is also enhanced in the presence of a high concentration of calcium.

However, the mechanism by which a high calcium diet increases bone formation

when the circulating levels of 1,25D are suppressed is unknown. We hypothesise that,

in animals fed a high calcium diet, the production of 1,25D in the bone will be

25

increased. When circulating levels of 1,25D are low due to the high calcium diet, the

expression of CYP27B1 mRNA will be increased and the expression of CYP24

mRNA will be decreased to maximise the local 1,25D production, with the aim to

maintain the 1,25D-mediated bone formation process.

1.7.4 The effect of vitamin D-depletion on vitamin D metabolism in

kidney and bone

Vitamin D-deficiency has been shown to increase the expression of CYP27B1 mRNA

and to abolish the expression of CYP24 mRNA in the kidney. As well, vitamin D-

deficiency reduces VDR mRNA levels in parallel with the reduction in CYP24

mRNA expression. The inverse relationship between the expression of CYP27B1 and

CYP24 mRNA during vitamin D-depletion is consistent with the fact that the kidney

is the main supplier of 1,25D for the circulation. While the activity of CYP24 in rat

osteoblasts-like cells is known to be reduced in the absence of 1,25D, the effect of

vitamin D-depletion on the activity of CYP27B1 in the bone is unknown. The in vivo

effect of vitamin D-depletion on the metabolism of vitamin D in the bone has not been

investigated.

Hypothesis 3: While production of 1,25D in the kidney will be maximised in

response to vitamin D-depletion in an effort to restore circulating levels of 1,25D, the

production of 1,25D in the bone will be increased to compensate for the shortfall in

circulating levels of 1,25D. We hypothesise that, in the bone, the expression of

CYP27B1 mRNA will increase and the expression of CYP24 mRNA will decrease in

response to vitamin D-depletion.

26

1.7.5 The effect of dietary calcium during vitamin D-depletion on

vitamin D metabolism in kidney and bone

During vitamin D-deficiency, calcium absorption in the intestine is impaired, which

can lead to reduced serum calcium levels and reduction in the mineralisation of bone.

It has been shown that normal mineralisation of bone can occur during vitamin D-

deficiency when a high level of calcium is added to the diet. It is not known, however,

what the mechanism is that allows a high calcium diet to increase bone formation

when circulating 1,25D levels are deficient. The up-regulation of the production of

1,25D in the bone when fed a high calcium diet may mediate the mineralisation of

bone in the absence of circulating 1,25D levels.

Hypothesis 4: We hypothesise that, during vitamin D-depletion, a high calcium diet

will stimulate the synthesis of 1,25D in the bone, to an extent that does not occur in

the kidney, by increasing bone CYP27B1 mRNA expression and reducing CYP24

mRNA expression. This local production of 1,25D would allow for normal 1,25D-

mediated bone mineralisation to occur.

27

CHAPTER 2: MATERIALS AND METHODS

2.1 Introduction

Although many studies have extracted RNA from a variety of soft tissues, few have

extracted RNA from hard bone tissue. RNA, extracted from hard bone tissue, can be

contaminated with proteoglycans, which can affect the normal electrophoretic

migration of RNA through an agarose gel. This chapter describes a modified

technique for RNA extraction, based on the method from Chomczynski and Sacchi

(1991), that yields pure, un-degraded, proteoglycan-free RNA that can be used in a

real-time reverse-transcriptase polymerase chain reaction (RT-PCR). Previous studies

have examined the levels of expression of CYP27B1, CYP24, and VDR, by using a

semi-quantitative PCR technique or by performing Northern blot analysis. The low

levels of expression of CYP27B1 and CYP24, however, make a quantitative analysis

of the levels of mRNA expression difficult by these methods. This chapter describes

the relatively new technique of real-time RT-PCR, that is used to quantify the

absolute levels of target mRNA and overcome the shortfalls of other methods. The

technique for ribonuclease protection assay is also described to verify the results that

are obtained by using the real-time RT-PCR method. Furthermore, the dietary

treatments, specimen collection procedures and the techniques used to measure the

biochemical factors that are associated with calcium homeostasis and vitamin D

metabolism are described.

2.2 Materials

All chemicals and consumables used in the experiments were purchased from Sigma

Chemical Company (Milwaukee, USA), unless otherwise stated.

28

2.3 Animals

All animals used in the experiments were female Sprague-Dawley rats, which were

obtained from the Gilles Plains Animal Resource Centre (Gilles Plains, South

Australia). Animals used to investigate the effects of age (Chapter 4) were virgin. The

animals raised to be vitamin D-deplete were bred from mothers fed a vitamin D-

deficient diet. All other animals were retired-breeders of 5 months of age.

2.3.1 Housing

All animals were housed at 24°C with a 12-hour light/dark cycle. Animals raised to be

vitamin D-deplete were exposed to incandescent lighting. All other animals were

exposed to standard lighting.

2.3.2 Diet

Rats were fed either a commercial rat chow ad libitum (Table 2.1), containing 1%

calcium, 0.6% phosphorus and 4000U/Kg vitamin D (Milling Industries Pty Ltd.,

South Australia) or 40g per day of the AIN-93-VX semi-synthetic diet (American

Institute of Nutrition 1977, American Institute of Nutrition 1980) with the levels of

dietary calcium and vitamin D modified for the different experimental procedures.

Tap water was supplied ad libitum to all animals.

2.3.2.1 Semi-Synthetic diet

The semi synthetic diets were prepared in the laboratory according to a standard

formula (Table 1). The components of the mineral mix were weighed, crushed and

thoroughly mixed in a plastic container. Casein, cornstarch and cellulose were mixed

for 30 minutes in a pizza dough mixer (OEM, VE201, Bozzolo (MN) Italy). DL-

methionine, choline bitartrate, mineral mix (Table 2.3), CaCO3

29

Table 2.1 Components of the Semi-Synthetic Diet

Ingredient (g/Kg mix)

Casein 200

Corn Starch 650

Cellulose 50

DL-Methionine 3

Choline Bitartrate 2

Mineral Mix* 35

AIN-93-VX Vitamin Mix# 10

Calcium Carbonate (0.1%-1%) 25-250

Corn oil 50

The Composition of the AIN-93-VX vitamin mix (ICN Biomedicals Australasia,

Seven Hills, Australia) was as follows (mg/kg diet): Thiamine hydrochloride, 6;

Riboflavin, 6; Pyridoxine hydrochloride, 7; Nicotinic acid, 30; D-calcium

pantothenate, 16; Folic acid, 2; D-biotin, 0.2; Cyanocobalamin, 0.01; Retinyl

palmitate, 16; DL-α-tocopherol acetate, 200; Cholecalciferol, 2.5; Menadione sodium

bisulphite complex, 0.5; Finely powdered sucrose, 9729. * see Table 2.2 for mineral

mix components. # The AIN-93-VX Vitamin Mix is replaced by the AIN Special

vitamin D fortification mixture-Vitamin D-deficient, when preparing the diet for the

vitamin D-deplete animals.

30

Table 2.2 Components of the Mineral Mix*

Ingredient (g/Kg mix)

Sodium di-hydrogen phosphate (2H20) 197

Potassium di-hydrogen phosphate 275

Potassium sulphate 52

Magnesium oxide 24

Manganous carbonate 3.5

Ferric citrate 6

Zinc carbonate 1.6

Cupric carbonate 0.3

Potassium iodate 0.01

Sodium selenite 0.01

Chromium potassium sulphate 0.55

Sucrose (finely powdered) 440.03

31

(BDH, Kilsyth, Australia) and vitamin mix, (ICN Biomedicals Australasia, Seven

Hills, Australia) were combined and mixed thoroughly before being blended into the

casein, cornstarch and cellulose mixture. The amount of CaCO3 added was varied to

obtain either a 0.1% calcium diet or a 1% calcium diet. The vitamin mix either

contained the recommended levels of vitamin D (AIN-93-VX, ICN Biomedicals

Australasia, Seven Hills, Australia) or did not contain any vitamin D (Special vitamin

D fortification mixture-Vitamin D-deficient, ICN Biomedicals Australasia, Seven

Hills, Australia). Mixing was allowed to continue for a further 30 minutes. While the

dough mixer was in motion, corn oil was added to the mixture and mixing continued

for a further 30 minutes or until the mixture was consistent. Sufficient water was

added to form a dough, which was pressed into trays to a 3cm thickness. The dough

was allowed to dry overnight before it was divided up and frozen at -20°C.

2.3.3 Blood sample collection

All blood samples were taken from the tail vein under halothane anaesthesia. 2.5mLs

of blood was collected by removing 2mm from the tip of the tail with a scalpel. The

blood was collected in tubes with a clotting activator and centrifuged at 3,500 rpm for

15 minutes to collect the serum. A 250µl aliquot of serum from each blood sample

collected was stored separately for parathyroid hormone analysis. All serum samples

were frozen at –20°C until required for analysis.

2.4 Blood biochemistry

2.4.1 Serum calcium and phosphate

Serum calcium was measured according to the method of Moorehead and Biggs

(1974). Calcium reacts with cresolphtalein complexone in alkaline solution to form a

32

purple coloured complex. The intensity of the purple colour formed is proportional to

the calcium concentration and can be measured photometrically at 575nm. Serum

calcium was measured on a Clinical chemistry analyser (Cobas Bio, IN, USA), using

reagents manufactured by Trace Scientific (Victoria, Australia).

2.4.2 Serum 1,25 dihydroxyvitamin D3

Serum 1,25 dihydroxyvitamin D3 (1,25D) was measured by a 125I radioimmunoassay

(RIA) (Immunodiagnostic Systems Ltd, Bolden, UK). The serum samples are

delipidated and 1,25D is extracted from potential cross-reactants by incubation with a

highly specific, solid phase, monoclonal anti-1,25D antibody. The purified 1,25D

eluate is incubated with a highly specific sheep anti-1,25D antibody. Separation of the

antibody-bound tracer from the free tracer is achieved by a short incubation with anti-

sheep IgG cellulose. The bound radioactivity is inversely proportional to the

concentration of 1,25D. The minimum detectable concentration of the assay was

5pmol/L and at 118pmol/L, the interassay coefficient of variation was 5%.

2.4.3 Serum 25 hydroxyvitamin D3

Serum 25 hydroxyvitamin D3 (25D) was measured by a 125I radioimmunoassay (RIA)

(Immunodiagnostic Systems Ltd, Bolden, UK). This method involves the extraction

of 25D, followed by an incubation with both 125I-25D and a highly specific sheep anti-

25D-antibody. Separation of the antibody-bound tracer from the free tracer is

achieved during a short incubation step with an anti-sheep IgG cellulose. The bound

radioactivity is inversely proportional to the concentration of 25D. The minimum

detectable concentration of the assay was 3.0ηmol/L and at 136nmol/L, the interassay

coefficient of variation was 7.3%.

33

2.4.4 Serum parathyroid hormone

Serum parathyroid hormone (PTH) was measured using a rat-specific, two-site

immunoradiometric assay (IRMA) (Immutopics, Inc., San Clemente, CA USA). Both

intact PTH (1-84 amino acids) and N-terminal PTH (1-34 amino acids) are

immunologically bound by an immobilised antibody and a radiolabelled antibody, to

form a sandwich complex. The levels of the radioactively bound complex are then

measured in a gamma counter (Crystal II, Multidetector RIA System, Packard

Instruments Inc, Illinios, USA). The minimum detectable concentration of the assay

was 1.0 pg/mL and at 50 pg/mL, the interassay coefficient of variation was 4%.

2.4.5 Serum calcitonin

Serum calcitonin was measured by a rat specific, two-site immunoradiometric assay

(IRMA) (Immutopics, Inc., San Clemente, CA USA). A monoclonal antibody is

immobilised on plastic beads and captures both calcitonin and an affinity purified,

radiolabelled, polyclonal antibody, thereby forming a sandwich complex, which can

be detected. The radioactively labelled complex is then measured in a gamma counter

(Crystal II, Multidetector RIA System, Packard Instruments Inc, Illinios, USA). The

minimum detectable concentration of the assay was 0.6 pg/mL and at 33 pg/mL, the

interassay coefficient of variation was 3%.

2.5 Statistical analyses

2.5.1 One-way analysis of variance

One-way analysis of variance was used to analyse the effects of age on the expression

of CYP27B1, CYP24 and VDR mRNA and on the levels of serum biochemical

markers. The changes in bone cell mRNA levels for CYP27B1, CYP24 and VDR in

34

different bone fractions were also determined using this statistical test. The data were

analysed in Microsoft Excel 2000 (version 9.0.2720), which was run on a personal

computer. A value of p<0.05 was considered to be statistically significant.

2.5.1 Two-way analysis of variance

Two-way analysis of variance was used to analyse the effects of dietary calcium and

vitamin D treatment on the levels of mRNA expression and to analyse the interaction

between the two dietary treatments. The data were analysed in Microsoft Excel 2000

(version 9.0.2720), which was run on a personal computer. A value of p<0.05 was

considered to be statistically significant.

2.5.2 Tukey’s post-hoc test

A Tukey’s post-hoc test was used to identify the mean values that were significantly

different from each other within a data set that had been found to be statistically

significant with either a one- or two-way analysis of variance. The data were analysed

in PostHoc MS-DOS program (version 1.1), which was run on a personal computer.

2.5.3 Linear and multiple-linear regression analysis

Linear regression analysis was used, based on the "least squares" method to fit a line-

of-best-fit through a set of observations and to obtain a coefficient of determination

(R2) for the correlation between the observations recorded. When two or more

independent variables were analysed, a multiple linear regression analysis was used to

identify the determinants of a particular dependent variable. The data were analysed in

Microsoft Excel 2000 (version 9.0.2720), which was run on a personal computer. A

value of p<0.05 was considered to be statistically significant.

35

2.6 Molecular biology techniques

2.6.1 Materials and preparation of reagents

2.6.1.1 Antibiotics

A 100mg/mL stock solution of ampicillin and a 100mg/mL stock solution of

tetracycline were prepared in deionised H2O and sterilised through a 0.2µm Minisart

(Sartorius AG, Göttingen, Germany).

2.6.1.2 RNase inhibiting solution

RNase inhibiting solution (solution D) was prepared by dissolving 4M guanidine

isothiocynate (Gibco BRL Life Technologies Inc., MD, USA), 25mM sodium citrate,

pH 7 (BDH Chemicals, Kilsyth, Australia) and 0.5% sarcosyl at 60ºC. 2-

mercaptoethanol was added to obtain a concentration of 0.1M prior to use.

2.6.1.3 Buffer solutions

The buffer used for storing RNA and DNA (TE) consisted of 10mM Tris and 1mM

EDTA, pH 7.5. The electrophoresis buffer used for RNA and DNA electrophoresis

(TAE) consisted of 2mM Tris-acetate and 0.1mM EDTA, pH 8.2. The electrophoresis

buffer for ribonuclease protection assay (TBE) consisted of 10mM Tris, 9mM boric

acid, and 0.1mM EDTA, pH 8.3. The buffer used in the in situ hybridisation process

(SSC) consisted of 0.15M sodium chloride (BDH Chemicals, Kilsyth, Australia) and

15mM sodium citrate (BDH Chemicals, Kilsyth, Australia).

2.6.1.4 Formamide

Formamide (BDH Chemicals, Kilsyth, Australia) was deionised by adding 5% of ion

exchange resin (AG-501-X8 resin, BioRad, CA, USA) and stirring at room

36

temperature for 30 minutes. The formamide was filtered twice through No.1 Whatman

paper (Whatman International Ltd., Maidstone, UK) and was stored at 4°C.

2.6.1.5 Loading buffers for electrophoresis

Urea loading buffer (3 x concentrated) used for DNA agarose gel electrophoresis, was

prepared by dissolving 4M urea (BDH Chemicals, Kilsyth, Australia), 50% sucrose

(BDH Chemicals, Kilsyth, Australia), 50mM EDTA and 0.1% bromophenol blue at

37°C and stirring for 30 minutes. Loading buffer used for RNA agarose gel

electrophoresis (5 x concentrated), consisted of 25% glycerol, 0.5% sodium dodecyl

sulphate (SDS), 0.025% bromophenol blue, 1% xylene cyanole and 25mM EDTA

pH7.4. Loading buffers were stored at -20°C.

2.6.2 Preparation of cDNA

The cDNA for 25-hydoxyvitamin D 1α-hydroxylase (CYP27B1) (St-Arnaud 1997),

25-Hydoxyvitamin D 24-hydroxylase (CYP24) (Ohyama et al 1991(a)), Vitamin D

receptor (VDR) (Burmester et al 1988(a); Kamei et al 1995) and glyceraldehyde 3-

phosphate dehydrogenase (GAPDH) (Tso et al 1985, Fort et al 1985) were kindly

donated by Dr Brian May (Department of Molecular Biosciences, The University of

Adelaide, Australia).

2.6.2.1 Transformation of plasmids into competent cells.

5ng of plasmid was added to 20 µL of chemically competent DHα-Rec A- cells

(Donated by Dr Brian May, Department of Biochemistry) and this mixture was

incubated on ice for 20 minutes. The cells were heated for 2.5 minutes at 42°C and

then incubated for a further 2 minutes. The cells were recovered with 1 mL of L-

Broth, containing 0.01% Bactotryptone (Difco Laboratories, Michigan, USA),

0.005% Bacto yeast extract (Difco Laboratories, Michigan, USA), 0.01% sodium

37

chloride (BDH Chemicals, Kilsyth, Australia) and 20mM glucose (BDH Chemicals,

Kilsyth, Australia) in a shaking water bath for 30 minutes at 37°C. The pelleted cells

were plated onto Bactoagar (Difco Laboratories, Michigan, USA) agar plates (15g/L

L-broth), containing either 50ug/mL of ampicllin or 12.5µg/mL of tetracycline

according to antibiotic resistance of the plasmid prepared. Agar plates are incubated

inverted at 37°C overnight.

2.6.2.2 Plasmid screening procedure

Th plasmids were isolated by inoculating 500uL of L-broth with a colony from the

agar plate (Chapter 2.5.2.1) and incubated for 30 minutes at 65°C. The lysed cells

were centrifuged and 1µl of the supernatant was mixed with urea loading buffer

(Chapter 2.5.1.5) and was analysed along side 1µg of DMW-500 molecular weight

marker (Geneworks, Thebarton, Australia), in a 1% agarose-TAE electrophoresis gel

(Promega Company, Annadale, Australia) in TAE buffer (Chapter 2.5.1.3) at 80 volts

for 30 minutes. The agarose gel was stained in a 1mg/L ethidium bromide solution

and imaged by FluorImager 595 (Molecular Dynamics Inc., CA, USA) and

ImageQuant version 3.3 software (Molecular Dynamics Inc., CA, USA), which was

rum on a personal computer.

2.6.2.3 Growth of bacterial cultures

A colony was selected from the agar plate and used to inoculate a starter culture of

20mL L-broth containing either 50µg/mL ampicillin (Chapter 2.5.1.1) for the

CYP27B1, CYP24 and VDR plasmids or 12.5µg/mL tetracycline (Chapter 2.5.1.1)

for the GAPDH plasmid, and was incubated for 6 hours at 37°C. The starter culture

was then added to another 500mL of antibiotic L-broth and incubated at 37°C on an

38

orbital shaker over-night. 300µL of 80% glycerol was added to 300µL of the cell

culture and was stored at -70°C for future preparations of plasimds.

2.6.2.4 Isolation of plasmid DNA

To collect the cells, the bacterial cultures were centrifuged at 5,000rpm at 4°C for 15

minutes. The cell pellets were resuspended in mixture of 5mL TES (25mM Tris,

10mM EDTA, 15% (w/v) sucrose) and 1mL lysozyme (12 mg/mL dissolved in TES)

and incubated at 4°C for 40 minutes. 1% SDS and 0.2M sodium hydroxide (BDH

Chemicals, Kilsyth, Australia) were added and the cells were incubated on ice for a

further 10 minutes. 7.5ml of 3M sodium acetate, pH 4.6, was added to neutralise the

sodium hydroxide. The cells were incubated on ice for a further 10 minutes before

being centrifuged at 14,000 rpm at 4°C for 15 minutes to remove cell debris. The

supernatant was treated with 100µL RNase A (10mg/mL in 10mM Tris-HCl, pH 8.0

and 15mM sodium acetate) for 2 hours. The plasmid DNA was extracted twice by

adding 1 volume of phenol, pH 8.0 (saturated with 10mM Tris-HCl and 1mM EDTA)

and 1 volume of 24:1 chloroform/isoamyl alcohol (BDH Chemicals, Kilsyth,

Australia) and centrifuged at 13,000rpm at 4ºC for 5 minutes. The aqueous phase was

then mixed with 2 volumes of ethanol and incubated room temperature for 5 minutes

before being centrifuged at 13,000rpm for 15 minutes to recover the DNA. The DNA

was washed in 70% ethanol, re-centrifuged, air dried at room temperature and re-

dissolved in 1mL of TE buffer (Chapter 2.5.1.3). The DNA, together with 1µg of

DMW-500 molecular weight marker (Geneworks, Thebarton, Australia) was analysed

by electrophoresis on a 1% agarose-TAE gel (Promega Company, Annadale,

Australia) in a 1 x TAE buffer (Chapter 2.5.1.3) at 80 volts for 30 minutes. The

agarose gel was stained in a 1mg/L ethidium bromide solution and imaged by

39

FluorImager 595 (Molecular Dynamics Inc., CA, USA) and ImageQuant version 3.3

software (Molecular Dynamics Inc., CA, USA).

2.6.2.5 Quantification of DNA

The concentration of plasmid DNA was quantified by measuring the absorbance at

260nm on a spectrophotometer (Beckman Instruments, CA, USA). DNA samples

were diluted by adding 1µL of the plasmid DNA to 99µL of deionised H2O and were

then measured at a wavelength of 260nm DNA concentration was calculated with the

following formula:

DNA concentration (µg/µL) = Absorbance at 260nm x 50 x 100 (dilution factor)

Where Absorbance at 260nm = 1 for a 50µg/mL DNA solution (Sambrook et al 1989)

2.6.2.6 Digestion and isolation of cDNA fragments

Specific restriction enzymes were used to excise the cDNA from the host plasmid

(pBS−CYP27B1, EcoR1 and Nar1; pBSSK-CYP24, EcoR1 and Kpn1; pRSV-VDR, Eco

R1 and BamH1; pBR322-GAPDH, Pst1). The amount of restriction enzyme and one-

phor-all reaction buffer (100mM tris-acetate, pH 7.5, 100mM Magnesium acetate,

500mM potassium acetate) used to digest the plasmid was according to manufacturer

recommendations (Pharmacia Biotech, Uppsala, Sweden). The reaction mixtures were

incubated for 2 hours at 37°C. The digested mixtures were separated in a 1% agarose

gel (Promega Company, Annadale, Australia) together with 1µg of the DMW-500

molecular weight marker (Geneworks, Thebarton, Australia) at 80 volts for 30

minutes. The gel was stained in a 1mg/L ethidium bromide solution and viewed under

UV light. The cDNA band was excised from the remaining gel and the cDNA was

extracted from the agarose gel using a gel extraction kit (Quiagen GmbH, Hilden,

Germany). Briefly, the gel slice that contained the DNA was solubilised by adding 3

1000 1

40

volumes of a highly concentrated chaotropic salt buffer in the presence of silica

particles. DNA absorbs to the silica particles in the presence of high salt

concentrations. The high salt buffer was then used to wash the DNA bound silica,

which was followed by two washes in a 60% ethanol buffer to remove residual

agarose and salt contaminants. The silica particles were air-dried and the DNA was

eluted in TE buffer (Chapter 2.5.1.3). 1µL of the purified cDNA was electrophoresed

with 2µL of 3x urea loading buffer (Chapter 2.6.1.5) and 3µL H2O on a 1% agarose-

TAE gel (Promega Company, Annadale, Australia) in a 1 x TAE buffer (Chapter

2.6.1.3) at 80 volts for 30 minutes. The agarose gel was stained in a 1mg/L ethidium

bromide solution and imaged by FluorImager 595 (Molecular Dynamics Inc., CA,

USA) and ImageQuant version 3.3 software (Molecular Dynamics Inc., CA, USA).

Estimation of the cDNA concentration was estimated by comparing the intensity of

the cDNA band with the intensity of the band of 1µg of SPP-1/Eco R1 molecular

weight marker (Geneworks, Thebarton, Australia).

2.6.3 Extraction of total RNA from kidney and bone tissue

2.6.3.1 Collection of rat kidneys and bones for RNA extraction

The rats were anaesthetised with halothane and sacrificed by cervical dislocation. The

kidneys and femora were excised and all soft tissues surrounding the organs were

removed. The bone and kidneys were placed in 5mL collection pots and snap frozen

in liquid nitrogen and stored at –70°C until required for analysis. The tissues were

homogenised in 10mL of solution D (Chapter 2.6.1.2) in a 30mL sterile container

(Techno-Plas, Adelaide, Australia) using an Ultra-Tarrax (Janke and Kunkel, Staufen,

Germany).

2.6.3.2 Extraction of RNA

41

The extraction of RNA from the tissue lysate was based on a modified method of

Chomczynski and Sacchi (1987) and Davey et al (2000). Aliquots of 700µL of lysate

from each homogenised tissue were transferred into 2mL eppendorf tubes. The lysate

in each tube was mixed by inversion, with 700µL of 0.1M citrate buffer saturated

phenol, pH 4.3, 100µL of 2M sodium acetate and 200 µL of 24:1 chloroform/isoamyl

alcohol and then incubated on ice for 10 minutes. The aqueous phase, containing the

RNA, was removed after centrifuging the mixture at 13,000 rpm at 4ºC for 15 minutes

and mixed in a new tube with at least 1 volume of isopropanol and kept overnight at –

70°C. The samples were thawed and centrifuged at 13,000 rpm for 15 minutes to

recover the RNA. The supernatant was removed and the RNA pellet was redissolved

in 200µL of TE buffer (Chapter 2.5.1.3), mixed with 600µL of 4M sodium acetate

(BDH Chemicals, Kilsyth, Australia), and kept overnight at –70°C. The samples were

thawed and centrifuged at 13,000rpm for 15 minutes to recover the pure RNA. The

RNA pellets were washed with 500µL of 70% ethanol, re-centrifuged at 13,000rpm

for 10 minutes, dried at room temperature, and finally dissolved in 50µL of TE buffer

(Chapter 2.5.1.3). The integrity of the extracted RNA was determined by firstly

combining 1µL of RNA with 2µL of 3x urea loading buffer (Chapter 2.6.1.5) and 3µL

of sterile deionised H2O, which was then heated at 65°C for 5 minutes to denature the

ribosomal RNA. The samples were then cooled immediately on ice and separated by

electrophoresis in a 1% agarose gel (Promega Company, Annadale, Australia) in TAE

buffer (Chapter 2.6.1.3) at 80 volts for 30 minutes. The gel was stained in a 1mg/L

ethidium bromide solution and imaged by FluorImager 595 (Molecular Dynamics

Inc., CA, USA) and ImageQuant version 3.3 software (Molecular Dynamics Inc., CA,

USA) to determine the integrity of the RNA. Pure, undegraded RNA is indicated by

the presence of the ribosomal RNA bands 26s, 18s and 4s.

42

2.6.3.3 Quantification of RNA

Purified RNA was quantified on a spectrophotometer (Beckman Instruments, CA,

USA). The RNA samples were diluted by adding 1µL of RNA extract to 99µL of

deionised H2O and then measured at wavelengths of 260 and 280nm. The RNA

concentration was calculated with the following formula:

RNA concentration (µg/µL) = Absorbance at 260nm x 40 x 100 (dilution factor)

Where absorbance at 260nm = 1 for a 40µg/mL RNA solution

(Sambrook et al 1989)

The purity of RNA is indicated by the ration between the absorbance at 260nm and

the absorbance at 280nm. The RNA was considered to be adequately pure when the

ratio between A260 and A280 was 1.8 or higher (Sambrook et al 1989).

2.6.4 First-strand cDNA synthesis

The RNA was reverse-transcribed to generate first strand cDNA. 5µg of RNA was

incubated with 200ng oligo-dT primer (Geneworks, Adelaide, Australia) and

deionised H2O in a total volume of 8µL at 70°C for 10 minutes and the mixture was

immediately cooled on ice. A reaction mixture of 1nM of dATP, dTTP, dGTP and

dCTP (Geneworks, Adelaide, Australia), 10nM DTT, reaction buffer (250mM Tris-

HCL, pH8.3, 375mM potassium chloride, 15mM MgCl2) and 200U of Moloney

Murine Leukaemia Virus-Reverse Transcriptase enzyme (MMLV-RT) (Gibco BRL,

Melbourne, Australia) was added to a total reaction volume of 20µL. The reaction

mixture was first incubated at 37°C for 1 hour and then at 90°C for 5 minutes to

denature the enzyme.

1000 1

43

2.7 Quantitative Real-time reverse transcriptase-polymerase

chain reaction

Quantification of the PCR reaction exploits the 5’ nuclease activity of DNA

Polymerase (AmpliTaq Gold™, Perkin-Elmer Applied Biosystems, CA, USA) to

cleave the fluorogenic probe (TaqMan® probe, Perkin-Elmer Applied Biosystems,

CA, USA) during the PCR reaction. The fluorogenic probe contains a reporter dye at

the 5’ end and a quencher dye at the 3’ end of the probe. When the probe is intact, the

proximity of the reporter dye to the quencher dye allows the quencher dye to suppress

the fluorescence of the reporter dye. If the target cDNA is present, the probe will

specifically anneal between the forward and reverse primer sites. During the reaction,

the DNA polymerase will cleave the probe, thereby separating the reporter dye from

the quencher dye, which results in an increase in the fluorescence of the reporter. The

accumulation of PCR products is directly detected by monitoring the increase in

fluorescence of the reporter dye. The point at which the Sequence Detection

Application software (Perkin-Elmer Applied Biosystems, CA, USA) detects an

increase in signal, which is associated with an exponential increase of PCR product, is

called the Threshold Cycle or CT.

2.7.1 Real-time RT-PCR primers and probes.

The sequence of the primers and fluorogenic probe were based on published

sequences for CYP27B1, CYP24, VDR and GAPDH (Genebank, PubMed) and the

primers and probed were designed using Primer Express 1.0 (Perkin-Elmer Applied

Biosystems, CA, USA) (Table 2.3). Briefly, the specifications for primer selection

include: the GC content within 20-80%, runs of four or more Gs to be avoided, Tm of

the primers to be between 58 and 60ºC and the five nucleotides at the 3’ end of the

44

primer should not have more than two Gs and/or Cs. The specifications for the

selection of the probe include: the GC content within 20-80%, runs of four or more Gs

to be avoided, Tm of the primers to be between 68 and 70°C and no G should be occur

on the 5’ end of the probe. The fluorogenic primers and probes were designed to

amplify products of 150 base pairs or less. To prevent amplification of contaminating

genomic DNA, all primers and probes were designed such that the amplicon crossed

an intronic sequence (Table 2.3). All probes, except for the GAPDH probe, were

labelled with FAM Reporter dye at its 5’-end and a TAMRA Quencher dye at its 3’-

end. The GAPDH probe was labelled with a VIC reporter dye. The labelling of the

GAPDH probe with a different reporter dye allows multiplexing of the PCR reaction.

Multiplex reactions were not, however, used in these experiments. All probes were

synthesised by PE Applied Biosystems (CA, USA). All primers were synthesised by

Geneworks (Adelaide, Australia).

2.7.2 Polymerase chain reaction conditions

All PCR reactions were carried out in a final volume of 25 µl and were performed in

duplicate for each cDNA standard in the ABI PRISM 7700 Sequence Detection

System (PE Applied Biosystems, CA, USA). The reaction mix consisted of Universal

Master Mix (1x TaqMan buffer, 5.5mM MgCl2, 200 µM dNTPs, 0.01 unit/µl

AmpErase UNG, 0.05 unit/µl AmliTaq Gold) (PE Applied Biosystems, CA, USA),

200nM probe and 300nM each of the forward and reverse primers. The PCR

condition was 50°C for 2 minutes and 95°C for 10 minutes, which was followed by 40

cycles of 95°C for 15 sec and 60°C for 1 minute. Each standard curve PCR reaction

was repeated one week later.

45

TABLE 2.3 Fluorogenic probe and primer sets

For. GAGATCACAGGCGCTGTGAAC 1030-1050 107

Rev. TCCAACATCAACACTTCTTTGATCA 1138-1114

CY

P27B

1

Probe 6FAM-TGTCCCAGCTACCCCTGCTAAAGGCT-TAMRA 1087-1112 For. TGGATGAGCTGTGCGATGA 1333-1351 75 Rev. TGCTTTCAAAGGACCACTTGTTC 1407-1385 C

YP2

4

Probe 6FAM-CGAGGCCGCATCCCAGACCTG-TAMRA 1353-1373 For. TGACCCCACCTACGCTGACT 523-542 79 Rev. CCTTGGAGAATAGCTCCCTGTACT 599-576 V

DR

Probe 6FAM-ACTTCCGGCCTCCAGTTCGTATGGAC-TAMRA 549-572 For. TGCACCACCAACTGCTTA 519-536 177 Rev. GGATGCAGGGATGATGTT 589-572

GA

PDH

Probe VIC-CAGAAGACTGTGGATGGCCCCTC-TAMRA 556-578

All primer/probe sets were designed to span an intronic sequence. Exon/Intron

boundaries are shown as underlined bases. For GAPDH, the boundary occurs between

the forward primer and the probe. Fluorogenic probes are FAM-labelled at the 5’ end

and TAMRA-labelled at the 3’ end. All cDNA sequences were obtained from the

Genebank® database. CYP27B1, 25-hydroxyvitamin 1α-hyroxylase; CYP24, 25-

hydroxyvitamin 24-hyroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-

3-phosphate dehydrogenase.

Gen

e

Sequence 5’→ 3’ Ampliconlength (bp)

Primer/ Probe

Sequence Number

46

2.8 Ribonuclease protection assay

2.8.1 Labelling reaction and removal of template DNA

A random primer extension kit (Maxiscript™, Ambion, TX, USA) and [α32P]-dUTP

(Geneworks, Adelaide, Australia) was used to radioactively label the RNA probe

(riboprobe) that was complementary to the cDNA template (Chapter 2.6.2.6). 150ng

of cDNA template and 2µl of 10xTranscription buffer (Maxiscript™, Ambion, TX,

USA) were added prior to the addition of 1µl each of 10mM dATP, dCTP, dGTP and

5µl of [α32P]-dUTP. 1 unit of T7 Polymerase enzyme was added and this mixture was

incubated for 30 minutes at 37°C to allow for the synthesis of the radiolabelled

riboprobe. Template cDNA was removed from the reaction mix by adding DNase 1

and incubating at 37°C for a further 15 minutes.

2.8.2 Gel purification of radio-labelled riboprobe

The radiolabelled riboprobe was purified using polyacrylamide gel electrophoresis.

The 5% polyacrylamide gel was prepared by dissolving 24.48g of urea (8M) in 5.1ml

of 10xTBE (Chapter 2.5.1.3), 6.38ml of 40% acylamide:bisacrylamide and 51ml of

deionised H20. 408µl of 10% ammonium persulphate and 54.4 µl of TEMED were

added to the mixture and mixed prior to pouring the liquid gel into the gel cast. The

gel was allowed to polymerise and was loaded into the vertical electrophoresis tank.

10µl of gel loading buffer was added to the radiolabelled riboprobe, heated to 95°C,

chilled on ice and loaded into the wells of the gel submerged in TBE. The

electrophoresis of the riboprobe was run at 200V (Chapter 2.5.1.3) until the loading

buffer band approached the bottom of the gel. The gel was wrapped in plastic wrap

before being exposed to autoradiography film for 10 seconds, making sure to mark the

47

position of the film on the gel for reference. Once the film was processed (X-Ray film

Developer), the gel bands associated with the full-length radiolabelled riboprobe were

located by using the film as the guide and excised with a clean scalpel blade. The

remaining gel was re-exposed to new film to determine whether the probe was fully

excised. The gel containing the probe was placed in an eppendorf tube and incubated

overnight in 350µl of Elution buffer (Maxiscript™, Ambion, TX, USA) at 37°C. This

was done to obtain a pure, full-length probe for both CYP27B1 and GAPDH.

2.8.3 Determination of the quantity of total RNA used in ribonuclease

protection assay

It is essential that the riboprobe is present in excess when compared to the amount of

the target mRNA present in a sample. A pilot experiment was conducted to determine

the amount of total RNA to be used in the assay. Increasing amounts of total RNA

from kidneys of vitamin D-deplete rats fed a 0.1% calcium diet (ranging from 2.5µg-

30µg) were assayed with 6 x 104 cpm of GAPDH riboprobe. After the hybridisation

and RNase digestion of unbound RNA, the samples were separated on a 5%

polyacrylamide/8M urea gel (Chapter 2.7.2) and exposed to autoradiography film.

The intensity of the major protected fragment on the autoradiograph increased when

the amount of total RNA that was assayed was increased from 2.5µg to 20µg,

indicating that the riboprobe was present in molar excess over the mRNA in these

reactions (data not shown). When the amount of total RNA was increased from 20 to

30µg, the intensity of the major protected fragment failed to increase, indicating that

at 30µg the riboprobe was no longer in molar excess. The amount of total RNA to be

used in the assay was, therefore, determined to be 20 µg.

48

2.8.4 Riboprobe: target RNA hybridisation

20 µg of total RNA, either from rat bone or kidney, was mixed with 6 x 104 cpm of

CYP27B1 riboprobe and GAPDH riboprobe. 5M ammonium acetate was added to the

mixture to the final concentration of 0.5M. 100% ethanol (2.5 x vol) was then added

before being incubated for 15 minutes at –20°C. The mixture was pelleted by

centrifugation at 13,000 rpm for 15 minutes and the supernatant was removed. The

pellet was resuspended in 10µl of Hybridisation buffer (RPA III™, Ambion, TX,

USA), denatured at 95°C for 3 minutes and incubated overnight at 42°C.

2.8.5 RNase digestion of unbound RNA

150µl of a 1:100 dilution of RNase A/RNase T1 in RNase buffer (RPA III™,

Ambion, TX, USA) was added to each RNA hybridisation tube and incubated at 37°C

for 30 minutes. 225µl of RNase inactivation/precipitation solution (RPA III™,

Ambion, TX, USA) was added to each sample and the tubes were placed in –20°C for

15 minutes.

2.8.6 Separation and detection of riboprobe bound target mRNA

To recover the protected target mRNA, the tubes were centrifuged at 13,000 rpm for

15 minutes at 4°C and the supernatant was removed. The RNA pellet in each tube

were resuspended in 8µl of Gel loading buffer (RPA III™, Ambion, TX, USA) and

denatured at 95°C for 3 minutes, before being loaded into a 5% polyacrylamide/8M

urea gel and separated at 200V until the band of the loading buffer approached the end

of the gel (Chapter 2.7.2). The gel was wrapped in plastic wrap before being exposed

to autoradiography film overnight. The film was processed (X-Ray film Developer)

the next days to reveal the bands of protected target mRNA.

49

2.9 In situ hybridisation

2.9.1 In vitro transcription with digoxigenin-11-UTP

To generate the antisense and sense CYP27B1 riboprobe for in situ hybridisation,

PCR amplification of a 335-bp fragment of the rat CYP27B1 gene was amplified

using the following forward and reverse primers (Forward: 5’-CCG

TGTCCCAGACAGAGAC-3’; Reverse: 5’-CAGGACAGTCCGGGTCATGG-3’).

The PCR product was ligated into the T7/SP6 site of a pGEM-T vector (Promega,

Sydney, NSW), transfected into competent cells (Chapter 2.5.2.1), grown up

according to the methods described in Chapter 2.5.2.3 and the vector was isolated

according to Chapter 2.5.2.4. Before generating digoxigenin-labelled probes, the

plasmid was linearised with either the Nco I or the Not I restriction enzyme to allow

for the generation of the antisense or sense probe respectively. Digoxigenin-labelled

probes were synthesised according to kit instructions (Boehringer Mannheim-GmBH,

Mannheim, Germany). The antisense probe was synthesised using SP6 RNA

polymerase and the sense probe was synthesised using T7 RNA polymerase.

2.9.2 Estimation of the riboprobe yield

The riboprobe was serially diluted by 10-fold to generate 5 dilutions of the probe. A

drop of each these dilutions of the riboprobe were placed on a nylon membrane,

together with serial dilutions of Digoxigenin-labelled control RNA (Boehringer

Mannheim-GmBH, Mannheim, Germany). The membrane was exposed to UV

radiation (UV Cross-linker, Ultra-Lum, Adelaide, Australia) at 1200 kilojoules for 30

seconds to cross-link the riboprobe to the membrane. The membrane was incubated

with diluted anti-digoxigenin antibody for 30 minutes and was then incubated in 5%

NBT/BCIP (Boehringer Mannheim-GmBH, Mannheim, Germany). When the colour

50

developed to a sufficient intensity, the reaction was stopped by rinsing the membrane

in TE buffer (Chapter 2.5.1.3) for 5 minutes. An estimation of the riboprobe

concentration was achieved by comparing the colour intensity of the dots of the

riboprobe dilutions with the colour intensity of the dots of the control RNA samples.

2.9.3 Tissue preparation

The distal 20 mm of the femora were bisected in the sagittal plane. Cutting was

performed using a low speed saw (Buehler, Ltd., Evanston, IL, U.S.A.), with a

diamond tipped cutting blade. The femora were then fixed overnight in a 4%

paraformaldehyde/0.1% phosphate buffer at 4°C and then decalcified in a 1% EGTA,

9.5% nitric acid solution to leach out the calcium mineral. Once the femora were free

of calcium mineral, they were processed for dehydration and infiltration (TissueTech

VIP, Sakura, Japan) and embedded in paraffin wax. Five-micrometer thick

longitudinal sections were then cut using a microtome (Reichert, Heidelberg,

Germany), mounted on to salianised slides and stored until needed.

2.9.4 Section pre-treatment

The sections were placed in xylene for 15 minutes, before being placed in ethanol at

100, 95 and 80% for 5 minutes each. The sections were washed twice in PBS for 2.5

minutes, placed in 0.2 M HCl for 20 minutes and again washed in PBS. The dried

sections were then digested with 250µl of a freshly prepared 50µg/ml proteinase K

solution for 15 minutes at room temperature. The sections were washed with 2mg/ml

glycine/PBS for 5 minutes, 4% paraformal saline for 15 minutes, 0.25% acetic

anhydride/0.1M triethanolamine for 10 minutes and 0.5mM levamisole/0.1M Tris for

1 hour. Each section was washed with PBS between the incubations in the different

solutions. When the slides were dried, 250 µl of hybridisation buffer was added

51

containing, 50% deionised formamide (Chapter 2.5.1.4), 5 x SSC (Chapter 2.5.1.3),

2% Blocking reagent (Boehringer Mannheim-GmBH, Mannheim, Germany), 0.1% N-

lauryl sarcosine and 0.02% SDS. After the addition of the pre-hybridisation solution,

sections were first incubated for 30 minutes at room temperature and then for 2 hours

at 37°C.

2.9.5 Hybridisation

10ng of riboprobe, either antisense or sense, was added to the dried sections in 100µl

of hybridisation buffer and cover slips were carefully placed over the sections. The

slides were then incubated over-night at 42°C in a humidifying chamber.

2.9.6 Post-hybridisation wash

The sections were placed in 2x SSC (Chapter 2.5.1.3) for 5 minutes at 37°C and then

transferred into fresh 2x SSC (Chapter 2.5.1.3), leaving the cover slips behind. After

incubating for a further 25 minutes at 37°C, the sections were first placed in a 1x

SSC/30% deionised formamide (Chapters 2.5.1.3 and 2.5.1.4) solution for 30 minutes

at 37°C and followed by a 0.1x SSC (Chapter 2.5.1.3) solution for 30 minutes at

37°C.

2.9.7 Antibody hybridisation / colour reactions

The sections were prepared for the antibody hybridisation by placing then in a

washing buffer consisting of 0.003% Tween, 0.1M maleic acid, 0.15M sodium

chloride for 1 minute and then by incubating in a 1% blocking agent (Boehringer

Mannheim-GmBH, Mannheim, Germany) for 1 hour at room temperature. To each

dried section, 250µl of anti-DIG antibody, diluted 1:500 in blocking solution, was

added and the sections were incubated for 30 minutes at room temperature. The

excess solution was removed and sections were washed twice in washing buffer for 15

52

minutes and then washed once in a detection buffer containing 10% blocking reagent

(Boehringer Mannheim-GmBH, Mannheim, Germany), 0.1M maleic acid and 0.15M

sodium chloride for 2 minutes. Once the sections were dried, 250 µl of 1% NBT/BCIP

and 1mM levamisole in detection buffer was added to each section and the sections

were incubated until a colour developed (30 minutes to 16 hours). When the

developed colour was sufficiently intense, the sections were washed briefly in TE

(Chapter 2.5.1.3).

53

CHAPTER 3: Evaluation of the quantification of CYP27B1, CYP24, VDR and GAPDH mRNA using the Real-Time Reverse Transcriptase-Polymerase Chain Reaction.

3.1 INTRODUCTION

The Reverse Transcription-Polymerase Chain Reaction (RT-PCR) is the most sensitive

method currently used to detect low-abundance mRNA. There are, however,

substantial problems associated with its true sensitivity, reproducibility and specificity

and, as a quantitative method, it suffers from the problems inherent in PCR. A

fluorescence-based RT-PCR method, which overcomes limitations of other mRNA

analysis procedures, has recently been developed to quantify absolute mRNA levels.

Holland et al (1991) were the first to demonstrate that the cleavage of a labelled probe

by Taq DNA polymerase during a PCR reaction, could be used to detect the level of

amplification of a specific PCR product. In addition to the components of a typical

PCR reaction mixture, a 32P-labelled consensus probe, which binds to an internal

region of the target nucleotide template, was added. During amplification, the annealed

probe is cleaved by the 5’ exonuclease activity of Taq DNA polymerase extending

from an upstream primer into the region of the probe. After the PCR, Holland et al

measured the level of cleavage of the probe, by using thin layer chromatography to

separate the cleavage fragments from the intact probe. The development of fluorogenic

probes by Lee et al (1993) made it possible to eliminate the post-PCR processing to

analyse the levels of probe degradation. The cleavage of duel-labelled fluorogenic

54

probes with each cycle of PCR amplification, resulted in the release of a fluorescent

reporter. By measuring the emitted fluorescence, it was possible to measure product

accumulation in “real-time”. Since then, real-time PCR has been extensively used for

the detection of specific DNA including viral infections (Lockey et al 1998), parental

determination (Lo et al 1998) and for the determination of changes in the genetic code

through insertion or deletion of bases (Higuchi et al 1993; Orlando et al 1998).

More recently, real-time PCR has been applied to quantitate mRNA levels. Reverse-

transcription of mRNA to cDNA is followed by real-time PCR, using a specific

fluorogenic probe and a set of primers designed to specifically amplify the target

cDNA, without co-amplifying contaminating genomic DNA. During the reaction, the

cycle of amplification at which the fluorescence signal is higher than the background

emissions, termed the threshold cycle (CT), can be determined. The CT value is a

measure of the target sequence abundance. The higher the starting amounts of target

sequence, the sooner a significant increase in fluorescence is observed. The starting

copy number of mRNA can be determined absolutely from a standard curve made with

target DNA. This requires the quantification of the cDNA by measuring the cDNA

concentration and converting it to the number of cDNA copies using the molecular

weight of the DNA and Avogadro’s number (2.063 x 1023) as shown in the methods

below.

The real-time PCR method provides several advantages over other techniques of

mRNA analysis. It is a closed-tube PCR reaction, which avoids time-consuming post-

PCR manipulation and the risk of PCR contamination. Monitoring of the whole

reaction during real-time RT-PCR, permits the quantification to be based on the early,

55

linear part of the reaction curve, rather than the amount of end product. In this way the

problems with reagent-limiting amplification, associated with semi-quantitative PCR

procedures, are avoided. The sensitivity of real-time PCR for the detection of low

abundance mRNA species greatly exceeds the Northern blot analysis and therefore

significantly smaller amounts of starting material are required than in Northern blot

procedures.

The objective of the current study was to validate the sensitivity and accuracy of Real-

time RT-PCR assay when used to measure absolute abundance of mRNA for rodent

25-hydroxyvitamin D-1α−hydroxylase (CYP27B1), 25-hydroxyvitamin D-24-

hydroxylase (CYP24), vitamin D receptor (VDR) and glyceralderhyde-3-phosphate

dehydrogenase (GAPDH) in rat kidney and bone tissue.

3.2 PROTOCOL

3.2.1 Experimental procedure

The transformation of plasmid cDNA into competent cells, the growth of transformed

cells, and isolation of cDNA are described in Chapter 2.5.2. Messenger RNA

extraction, purification and quantification from rat kidney and bone tissue are

described in Chapter 2.5.3. First Strand cDNA synthesis from mRNA is described in

Chapter 2.5.4. The design of real-time RT-PCR probes and primers for CYP27B1,

CYP24, VDR and GAPDH mRNA is described in Chapter 2.6.1. The reaction

temperature, reagent mixture composition and conditions for real-time RT-PCR are

described in Chapter 2.6.2.

56

3.2.2 Estimation of cDNA standard copy number

The concentration of pure plasmid cDNA for each target mRNA species was

estimated by measuring the A260 in triplicate, using a spectrophotometer. The copy

number was calculated using the following formula:

copies/mL = 6.023x1023 x C x A260

where C = 50 µg/mL for dsDNA; MWt = cDNA molecular weight (base pairs x 6.5 x

102 Daltons)

Serial dilution for each cDNA species was done such that the diluted samples would

all provide CT values spanning the range of CT values expected from unknown

samples. The cDNA standards were stored at –20°C.

3.2.3 Calculation of the slope of the linear regression line for optimal

PCR amplification

When the efficiency of the PCR amplification is maximal, every amplicon transcript

is replicated in each cycle of PCR amplification. This duplication of transcripts with

each cycle of PCR amplification, results in an exponential increase in PCR product.

Generating a set of exponentially increasing numbers and plotting the logarithmic

values of these numbers against arbitrary cycle numbers, allows the slope of the line

to be calculated by linear regression analysis. A slope of -3.32 is the theoretical

maximal slope obtained by regression analysis of a PCR reaction of optimal

efficiency.

MW

57

3.2.4 Data expression and statistical analysis

For each assay, a standard curve was prepared by running a ranging of samples of a

known number of CYP27B1, CYP24, VDR or GAPDH cDNA molecules. All

samples for comparison were run in the same assay. After completion of the PCR

amplification, data were analysed with Sequence Detector 1.7 software (PE Applied

Biosystems, Foster City, CA). To maintain consistency, the baseline was set

automatically by this software using data collected from cycles 3 to 15, unless the CT

value obtained from samples was less than 15 cycles. In this circumstance, it was

necessary to manually set a narrower range of cycles to determine baseline. The

increase in intensity of the fluorescence emitted by the reporter dye (∆Rn) was

plotted against the cycle number. The CT was calculated by the sequence detection

software as the cycle number at which the amplification plot crossed the baseline. CT

values, obtained by running a set of samples ranging in cDNA concentration, were

plotted against copy numbers of cDNA to generate a standard curve. By obtaining the

CT values of unknown samples for a particular target cDNA sequence, the cDNA

copy number can be obtained from the relevant standard curve and the mRNA levels

in these samples for either CYP72b1, CYP24, VDR or GAPDH can therefore be

determined.

Efficiency of real-time RT-PCR was tested by the "least squares" method of linear

regression statistical analysis. Amplification efficiency in the cDNA standard curves

was tested by comparing the line-of-best-fit with a theoretical line representing the

maximum amplification efficiency. Linear regression analysis was used to determine

whether there was a difference between CT values from a theoretically maximal

amplification and CT values obtained in the cDNA amplification reactions performed.

58

The same statistical procedure was used to determine the mRNA amplification

efficiency. Linear regression analysis was used to test the reproducibility of real-time

RT-PCR by comparing the line-of-unity with the line-of-best-fit for the X-Y scatter

plot of CT values obtained from two separate real-time RT-PCR assays.

3.3 RESULTS

3.3.1 Optimisation of the fluorogenic probe concentration

To determine the optimal fluorogenic probe concentration, amplification plots were

obtained from cDNA samples with probe concentrations for each gene of interest

between 25nM and 300nM in the reaction mixture. Figure 3.1 shows the amplification

plot of CYP27B1 cDNA prepared from rat kidney mRNA with varying concentrations

of the CYP27B1 probe. The CT values obtained with varying probe concentration for

each gene is shown in Table 3.1. The lower the CT value obtained with a particular

concentration of probe, the greater the detection sensitivity. The optimal concentration

for each probe was considered to be 200nM. There was no significant improvement in

detection sensitivity with 300nM of each probe. 25nM and 100nM of each probe

reduced the detection sensitivity significantly in each case (p<0.05).

3.3.2 Range and sensitivity of fluorogenic detection

In preliminary experiments, reverse transcribed mRNA extracted from tissue was used

to obtain a range of CT values (data not shown). This was used to determine the range

of cDNA standard concentrations required to obtain CT values that spanned the range

of predicted CT values that would be obtained from experimental samples. The

amplification plots of three CYP27B1 cDNA samples measured in duplicates, shown

in Figure 3.2, ranged in concentration from 1.2 x104 copies/reaction to 1.2 x1010

59

copies/reaction, which demonstrated a 106-dilution range of detection. The range of

copies examined and the range of CT values obtained is shown in Table 3.2. The

greatest serial dilution performed was a 1.6 x 107-fold dilution of CYP27B1 cDNA.

CT values were detected up to 37.4 + 0.6, which was for an estimated 1.5 x102 copies

of VDR cDNA. No amplification was observed in the no-template controls (NTC)

reactions. The CT was allotted the arbitrary value of >45 when no amplification was

detected in the 45th cycle of the reaction. The most concentrated and most dilute

cDNA sample of each gene under investigation provided CT values, spanning the

range of CT values expected from unknown samples.

3.3.3 Standard curves

Standard curves for each cDNA species are shown in Figure 3.3. The standard curves

contain data from duplicate PCR reactions of each cDNA dilution and from a second

PCR reaction, which was performed approximately one week later. The correlation

coefficient for each cDNA standard curve was 0.99, indicating a high-level of

accuracy in detection throughout the cDNA concentration range. The efficiency of the

amplification was a high in all reactions. This was concluded from the slopes of the

standard curves, which were all within 10% of the theoretical optimum slope of -3.32

(Chapter 3.2.2). The reaction efficiency for CYP24 was 100%, while the efficiency

for CYP27B1, VDR and GAPDH was 96% (p<0.001), 93% (p<0.05), and 90%

(p<0.001), respectively.

3.3.4 Reproducibility of cDNA standard detection

The reproducibility of the fluorogenic probe detection was tested by performing two

separate PCR reactions on different days on serial dilutions of the same cDNA.

Comparisons of the CT values obtained from the two separate PCR reactions on

60

Figure 3.1 Optimisation of the CYP27B1 probe concentration. Amplification plots of

four concentrations of CYP27B1 cDNA, reversed transcribed from rat kidney mRNA.

A no-template control (NTC) was also included and was not amplified in the reaction.

The horizontal line shows the setting of the baseline. The point at which the

amplification plot crosses the base line is the CT value.

0

0.5

1

1.5

2

2.5

3

300nM 200nM 100nM

25nM

25 30 35 40 45

Cycle Number

Rn

NTC

Baseline

0

0.5

1

1.5

2

2.5

3

300nM 200nM 100nM

25nM

25 30 35 40 45

Cycle Number

Rn

NTC

Baseline

Fluo

resc

ence

Inte

nsity

(∆R

n)

61

Table 3.1 Threshold cycle (CT) values for the optimisation of fluorogenic probe

concentrations for mRNA quantification.

Fluorogenic Probe

300nM (CT)

200nM (CT)

100nM (CT)

25nM (CT)

NPC (CT)

CYP27B1 28.5 + 0.07 28.7 + 0.14 32.2 + 0.64* 41.7 + 1.4* >45

CYP24 19.9 + 0.05 19.9 + 0.32 20.9 + 0.18* 28.6 + 0.51* >45

VDR 18.5 + 0.20 18.8 + 0.22 20.3 + 0.27* 38.8 + 0.49* >45

GAPDH 17.2 + 0.12* 15.2 + 0.36 15.7 + 0.29* 36.2 + 0.70* >45

All primers were specific for rat cDNA sequence and the results show amplification

of rat cDNA standards. Values and mean + SD (n = 2). The no probe control (NPC)

was allotted a value of >45 when no amplification was detected before the 45th cycle

of the PCR reaction. ∗ p<0.05 vs. 200nM probe. CT, threshold cycle; CYP27B1, 25-

hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-hydroxylase; VDR,

vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

62

Figure 3.2 Amplification plots of three CYP27B1 cDNA standards. The three

standards represent the range of cDNA copies that can be detected. The amplification

plots of the standards ranged from 1.2 x 104 copies/reaction to 1.2 x 1010

copies/reaction. Duplicate reactions are shown and can appear superimposed. A no-

template control (NTC) was included, which was not amplified in the reaction. The

horizontal line shows the setting of the baseline. The point at which the amplification

plot crosses the base line is the CT value.

Baseline

1.2 x 1010 1 .2 x 10 7 1 .2 x 1 04

NTC

C ycle Thresho ld (C T) L ine

Cycle Number

2.5

2

1.5

1

0.5

04 8 12 16 20 24 28 32 36 40

1.2 x 1010 1 .2 x 10 7 1 .2 x 1 04

NTC

C ycle Thresho ld (C T) L ine

Cycle Number

2.5

2

1.5

1

0.5

04 8 12 16 20 24 28 32 36 40

Fluo

resc

ence

Inte

nsity

(R

n)

63

Table 3.2 Sensitivity of fluorogenic probe for detection

Fluorogenic Probe Range of copies detected Range of CT values detected NTC

(CT) CYP27B1 6.2 x 103 1.0 x 1011 34.2 + 0.01 9.7 + 0.05 >45

CYP24 1.3 x 103 2.7 x 1010 24.1 + 0.05 5.0 + 0.3 >45

VDR 1.5 x 102 1.2 x 106 37.4 + 0.6 23.8 + 0.06 >45

GAPDH 2.8 x 107 5.8 x 1010 20.0 + 0.2 8.0 + 0.06 >45

All primers were specific for rat cDNA sequence and the results show amplification

of rat cDNA standards. The no template control (NTC) was allotted a value of >45

when no amplification was detected in the 45th cycle of the PCR reaction. CT,

threshold cycle; CYP27B1, 25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-

hydroxyvitamin-24-hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-


64

Figure 3.3 Standard curves of CYP27B1 (A), CYP24 (B), VDR (C), and GAPDH (D)

cDNA. cDNA was serially diluted 1:2 before amplification with the appropriate

primers and probe. Each sample was assayed in duplicate and re-assayed one week

later. The standard curve is a product of both assays. The equation for the line-of-best-

fit, y = slope (±S.D.) x + y-intercept (±S.D.) The coefficient of determination (R2) is

shown for each standard curve. *p<0.001 vs. theoretical slope, #p<0.05 vs. theoretical

standard curve slope for maximum amplification efficiency.

R2 = 0.9976

103 104 105 106 107 108 109 10101011 10120

5

10

15

20

25

30

35

40

0

5

10

15

20

25

105 104 105 106 107 109108 1010 1011

20

25

30

35

40

102 103 104 105 106 10710

Cyc

le T

hres

hold

(CT)

y = -1.5823Ln(x) + 46.943R2 = 0.9975

5

10

15

20

25

105 106 107 108 109 1011

cDNA Copy Number

A B

C D

R2 = 0.9976

103 104 105 106 107 108 109 10101011 10120

5

10

15

20

25

30

35

40

0

5

10

15

20

25

105 104 105 106 107 109108 1010 1011

20

25

30

35

40

102 103 104 105 106 10710

Cyc

le T

hres

hold

(CT)

y = -1.5823Ln(x) + 46.943R2 = 0.9975

5

10

15

20

25

105 106 107 108 109 1011

cDNA Copy Number

A B

C D

y = *-3.45 (± 0.04)x + 47.66 (± 0.27)

R2 = 0.99

y = -3.28 (± 0.08)x + 37.97 (± 0.56)

R2 = 0.99

y = #-3.54 (± 0.09)x + 44.82 (± 0.36)

R2 = 0.99

y =* -3.64 (± 0.06)x + 46.94 (± 0.53)

R2 = 0.99

* p < 0.001 p = 0.67 (NS)

# p < 0.05 * p < 0.001

65

serially diluted cDNA for CYP27B1, CYP24, VDR and GAPDH cDNA showed a

high degree of reproducibility when analysed by the linear regression analysis (Figure

3.4). The inter-assay reproducibility was extremely high with a coefficient of variation

(CV) less than 5% for CYP27B1, VDR and GAPDH, whilst CYP24 had a CV of

5.5%. No statistical difference was found between the line-of-best-fit for each cDNA

species tested and the theoretical line-of-unity. The intercept of the line-of-best-fit

was not statistically different from 0 and the slope of the line-of-best-fit was not

statistically different from 1. This confirms that the CT values obtained on different

days of cDNA samples are reproducible between assay runs.

3.3.5 Comparison of copy numbers of mRNA obtained from standard

curves generated in different assays

The estimation of mRNA copy numbers from standard curves generated in separate

PCR amplification reactions was assessed. Kidney and bone total RNA were isolated

from rats that were fed either a 1% or 0.1% calcium combined with either a vitamin

D-replete or vitamin D-deficient semi-synthetic diet (Chapter 2.3.1.2). The total RNA

from each rat tissue was reverse-transcribed to cDNA (Chapter 2.5.4) and real-time

PCR (Chapter 2.6) was used to obtain CT values. Using these CT values, mRNA copy

numbers were estimated from two individual standard curves, which were generated

on different days. Regression analysis between the mRNA copy numbers determined

from each standard curve was performed. The line-of-best-fit determined for each

target species by linear regression analysis are shown in Table 3.3. The equations

shown are for the kidney and bone copy number data separately as well as combined.

If the copy numbers estimated from one standard curve, equalled the copy numbers

estimated from the other standard curve, the line-of-best-fit would be statistically the

same as the line-of-unity. The slope and intercept, however, for each gene of interest

66

examined were statistically different from the slope and intercept of the line-of-unity.

The deviation in the slope of the line-of-best-fit from the slope of the line-of-unity

was greatest for VDR, with a slope of 0.61 ± 0.001 (p<0.0001). When copy numbers

were separated into tissue groups, each linear regression analysis was equivalent to

the combined tissue analysis. A calculation of the average difference in mRNA copy

numbers determined by each standard curve was 20% for CYP27B1, while for

CYP24, VDR and GAPDH there was a 13%, 36% and 20% difference respectively.

3.3.6 Accuracy of the estimation of mRNA levels by reverse-

transcription and real-time PCR amplification

The accuracy of the estimation of mRNA levels by reverse transcription and PCR

amplification, was assessed using rat kidney and bone total RNA. Kidney and bone

total RNA was isolated (Chapter 2.5.3) from 6-month-old rats fed a standard chow

diet (Chapter 2.3.1.1). Purified total RNA was serially diluted, 1:2, starting with a

concentration of 5µg of total RNA for each sample. Each dilution was then reverse-

transcribed to cDNA (Chapter 2.5.4) and target cDNA sequences were amplified by

Real-Time PCR amplification using an appropriate primer and probe set (Chapter

2.6). The equations for the line-of-best-fit, determined by linear regression analysis,

for each mRNA species in kidney and bone are shown in Table 3.4. Linear

amplification was detected over the entire mRNA concentration. The coefficient of

determination for each line-of-best-fit was within 5% of linearity. The degree of

efficiency of the amplification was indicated by the comparison of the slope of the

line-of-best-fit for each reaction series and the theoretical slope of the line if the

reaction was to proceed with 100% efficiency. This theoretical slope for maximum

PCR amplification efficiency is –3.32 (Chapter 3.2.2). When the efficiency of PCR

67

Figure 3.4 Reproducibility of CT values obtained from cDNA samples of CYP27B1

(A), CYP24 (B), VDR (C) and GAPDH (D). The horizontal axis shows the results of

PCR Run 1 and the vertical axis of PCR Run 2. The equation for the line-of-best-fit, y

= slope(±S.D.)x + y-intercept (±S.D.), and the coefficient of determination (R2) are

shown for the regression analyses. All linear regression analyses were not statistically

different form the line-of-unity. CT, Threshold Cycle; CYP27B1, 25-hydroxyvitamin

D-1α-hydroxylase; CYP24, 25-hydroxyvitamin D-24-hydroxylase; VDR, vitamin D

receptor; GAPDH, glyceraldehyde phosphate dehydrogenase.

5

10

15

20

25

30

35

40

5 10 15 20 25 30 35 40

y = 1.01 (± 0.02) x – 0.58 (± 0.37)R2 = 0.99

0

5

10

15

20

25

30

0 5 10 15 20 25 30

y = 0.99 (± 0.02) – 0.07 (± 0.29)R2 = 0.99

20

25

30

35

40

20 25 30 35 40

y = 1.02 (± 0.04)x – 0.76 (± 1.20)R2 = 0.97

Cyc

le th

resh

old

CT

(Run

2)

5

10

15

20

5 10 15 20

y = 0.99 (± 0.02)x – 0.22 (± 0.34)R2 = 0.99

Cycle Threshold CT (Run 1)

A B

C D

5

10

15

20

25

30

35

40

5 10 15 20 25 30 35 40

y = 1.01 (± 0.02) x – 0.58 (± 0.37)R2 = 0.99

0

5

10

15

20

25

30

0 5 10 15 20 25 30

y = 0.99 (± 0.02) – 0.07 (± 0.29)R2 = 0.99

20

25

30

35

40

20 25 30 35 40

y = 1.02 (± 0.04)x – 0.76 (± 1.20)R2 = 0.97

Cyc

le th

resh

old

CT

(Run

2)

5

10

15

20

5 10 15 20

y = 0.99 (± 0.02)x – 0.22 (± 0.34)R2 = 0.99

Cycle Threshold CT (Run 1)

A B

C D

68

Table 3.3 Equation of the line-of-best-fit for mRNA copy number estimations

determined from separate standard curves.

Equations of line-of-best-fit are y = slope (±S.D.)x + y-intercept (±S.D.). All

regression analyses were statistically different from the line-of-unity (p<0.0001).

CYP27B1, 25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-

hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate

dehydrogenase.

Combined Y = 1.29 (± 0.002)x – 1.7 x104 (± 4.6 x104)

Kidney Y = 1.14 (± 0.001)x - 7.5 x104 (± 4.7 x104)

CYP

27B

1

Bone Y = 1.11 (± 0.001)x - 2.0 x104 (± 2.6 x103)

Combined y = 0.82 (± 0.002)x + 3.8 x103 (± 5.9 x102)

Kidney y = 0.82 (± 0.002)x + 4.7 x103 (± 1.2 x103)

CYP

24

Bone y = 0.84 (± 0.001)x + 1.4 x103 (± 1.4 x102)

Combined y = 0.61 (± 0.001)x + 2.4 x105 (± 6.2 x104)

Kidney y = 0.60 (± 0.001)x + 8.1 x105 (± 9.3 x104) VDR

Bone y = 0.64 (± 0.001)x + 2.0 x104 (± 2.2 x103)

Combined y = 0.81 (± 0.0002)x – 7.2 x106 (± 7.9 X105)

Kidney y = 0.81 (± 0.0001)x - 2.3 x107 (± 6.4 X105)

GA

PDH

Bone y = 0.80 (± 0.0003)x - 3.0 x106 (± 2.8 X105)

Equation Tissue Gene

69

Table 3.4. Efficiency of mRNA amplification of kidney and bone samples.

Kidney y = -3.21 (± 0.14)X + 32.7 (± 0.09) R2 = 0.99

CYP

27B1

Bone y = -3.72 (± 0.36)x + 32.6 (± 0.23) R2 = 0.96

Kidney y = -3.23 (± 0.17)x + 25.4 (± 0.07) R2 = 0.99

CYP

24

Bone y = -3.60 (± 0.20)x + 31.5 (± 0.18) R2 = 0.97

Kidney y = -3.56 (± 0.10)x + 21.4 (± 0.05) R2 = 0.95

VDR

Bone y = -3.35 (± 0.32)x + 30.4 (± 0.20) R2 = 0.96

Kidney y = -3.57 (± 0.29)x + 17.9 (± 0.15) R2 = 0.97

GAP

DH

Bone y = -3.34 (± 0.21)x + 21.6 (± 0.14) R2 = 0.98

Equations of line-of-best-fit are y = slope (±S.D.)x + y-intercept (±S.D.). CYP27B1,

25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-hydroxylase;

VDR, vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. All

slopes for the line-of-best-fit are not statistically different from the slope of the

theoretical line for maximum amplification efficiency.

Equation Coefficient of determination

Tissue Gene

70

amplification is reduced, the value for the slope of the line-of-best-fit becomes more

negative than the optimal slope of –3.32. The efficiency of PCR amplification of

reverse-transcribed mRNA was high in all cases. There was no statistical difference

between the slope of the line-of-best-fit and the theoretical slope for maximal

amplification efficiency for any of the mRNA species tested.

3.3.7 Reproducibility of mRNA detection

The reproducibility of the fluorogenic detection system was tested by comparing

results generated in PCR reactions run on different days. Total RNA was isolated

from kidney and bone tissue (Chapter 2.5.3), collected from 9-month-old rats fed a

semi-synthetic diet containing 0.5%, 0.2%, 0.4% or 1% calcium (Chapter 2.3.1.2) for

3 months. Messenger RNA was reverse transcribed for each PCR reaction (Chapter

2.5.4). Real-time PCR analysis was performed on the cDNA using specific probe and

primer sets for each target cDNA sequence (Chapter 2.6). CT values, obtained from

the two separate PCR amplification reactions of CYP27B1, CYP24, VDR and

GAPDH cDNA were compared by linear regression analysis, which is shown in

Figure 3.5. There was a high degree of reproducibility between the CT values obtained

from the two separate PCR reactions. For each cDNA sequence of interest analysed,

the coefficient of determination was within 5% of linearity when kidney and bone

data were combined. The coefficients of variation were less than 3% in the combined

data. The lines-of-best-fit describing CYP27B1, CYP24 and VDR mRNA detection

reproducibility were all statistically the same as the line-of-unity. The slope of the

line-of-best-fit for GAPDH, however, was greater than the slope of the line-of-unity

(p<0.001). The slope of the line-of-best-fit for bone GAPDH CT values remained

statistically different from the slope of the line-of-unity. In the case of kidney

GAPDH, however, no statistical difference was observed between slope of the line-of-

71

Figure 3.5 Reproducibility of fluorogenic detection of CYP27B1 (A), CYP24 (B),

VDR (C) and GAPDH (D) mRNA in total RNA samples. The horizontal axis shows

the results of PCR Run 1 and the vertical axis of PCR Run 2. The equation of the line-

of-best-fit and the coefficient of determination (R2) are shown for the analysis.

Equations of line-of-best-fit are y = slope (± SD)x + y-intercept (± SD). CT, Threshold

Cycle; CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; CYP24, 25-hydroxyvitamin

D-24-hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde phosphate

dehydrogenase.

17

15

13

19

11

171513 19119

9

17

15

13

19

11

171513 19119

9

21

19

17

23

15

25

27

29

211917 2315 25 27 29

21

19

17

23

15

25

27

29

211917 2315 25 27 29

30

28

26

32

24

34

36

302826 3224 34 36

30

28

26

32

24

34

36

302826 3224 34 36

21

19

17

23

15

25

27

29

31

33

35

211917 2315 25 27 29 31 33 35

21

19

17

23

15

25

27

29

31

33

35

211917 2315 25 27 29 31 33 35

A B

C D

y = 0.98 (± 0.02) x – 0.61 (± 0.55)R2 = 0.97

y = 1.05 (± 0.03) – 0.72 (± 0.53)R2 = 0.95

y = 1.00 (± 0.02)x – 0.01 (± 0.38)R2 = 0.98

y = 1.13 (± 0.02)x – 0.58 (± 0.32)R2 = 0.96

Threshold Cycle (Run 1)

Thre

chol

d C

ycle

(Run

2)

17

15

13

19

11

171513 19119

9

17

15

13

19

11

171513 19119

9

21

19

17

23

15

25

27

29

211917 2315 25 27 29

21

19

17

23

15

25

27

29

211917 2315 25 27 29

30

28

26

32

24

34

36

302826 3224 34 36

30

28

26

32

24

34

36

302826 3224 34 36

21

19

17

23

15

25

27

29

31

33

35

211917 2315 25 27 29 31 33 35

21

19

17

23

15

25

27

29

31

33

35

211917 2315 25 27 29 31 33 35

A B

C D

y = 0.98 (± 0.02) x – 0.61 (± 0.55)R2 = 0.97

y = 1.05 (± 0.03) – 0.72 (± 0.53)R2 = 0.95

y = 1.00 (± 0.02)x – 0.01 (± 0.38)R2 = 0.98

y = 1.13 (± 0.02)x – 0.58 (± 0.32)R2 = 0.96

Threshold Cycle (Run 1)

Thre

chol

d C

ycle

(Run

2)

72

Table 3.5. The reproducibility of amplification of reverse-transcribed mRNA samples

assessed by the comparison of the equations of line-of-best-fit and the line-of unity.

Combined y = 0.98 (± 0.02)x + 0.61 (± 0.55) R2 = 0.97

Kidney y = 0.99 (± 0.03) x + 0.35 (± 0.98) R2 = 0.95

CYP

27B1

Bone y = 0.93 (± 0.04)x + 1.85 (± 1.19) R2 = 0.91

Combined y = 1.05 (± 0.03)x – 0.72 (± 0.53) R2 = 0.95

Kidney y = 0.98 (± 0.06)x + 0.46 (± 1.04) R2 = 0.88

CYP

24

Bone y = 0.96 (± 0.06)x + 1.35 (± 1.27) R2 = 0.86

Combined y = 1.00 (± 0.02)x – 0.01 (± 0.38) R2 = 0.98

Kidney y = *0.83 (± 0.06)x + #3.05 (± 1.17) R2 = 0.80 VDR

Bone y = 0.98 (± 0.06)x + 0.57 (± 1.67) R2 = 0.85

Combined y = *1.13 (± 0.02)x– 0.58 (± 0.32) R2 = 0.96

Kidney y = 1.10 (± 0.08)x – 0.18 (± 0.93) R2 = 0.81

GAP

DH

Bone y = *1.13 (± 0.06)x – 0.60 (± 0.85) R2 = 0.89

Equations of line-of-best-fit are y = slope (±S.D.)x + y-intercept (±S.D.). ∗ p<0.05 vs

slope of line-of-unity; # p<0.05 vs intercept of line-of-unity. CYP27B1, 25-

hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-hydroxylase; VDR,

vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Equation Coefficient of Determination Tissue Gene

73

best-fit and that of the line-of-unity. The greatest variation in the coefficient of

determination and slope of line-of-best-fit occurred when only a narrow range of CT

values was detected in the analysis. The use of a limited range of CT values causes an

error in the estimation of the slope of the line-of-best-fit.

3.3.8 Assessment of GAPDH mRNA and total RNA as the referent for

mRNA quantitation

To assess the value of GAPDH as an internal control, CT values for GAPDH were

determined in rat kidney and bone tissue, removed from animals fed a combination of

a 1% or 0.1% calcium and a vitamin D-replete or vitamin D-deficient semi-synthetic

diet (Chapter 2.3.1.2), and are shown in Table 3.6. In the kidney, the levels of

GAPDH mRNA detected in different groups are relatively constant. The similar

expression of GAPDH could, therefore, be used in this tissue. In the bone, however,

the expression of GAPDH mRNA varies between the dietary treatment groups. The

rats fed a 1% calcium diet demonstrated reduction in CT by approximately 1 cycle,

which was independent of vitamin D status. Furthermore, the expression levels of

GAPDH were significantly lower in bone when compared to the levels in kidney. CT

values were 3 to 4 cycles higher in bone, which represents a 5- to 10-fold lower

GAPDH mRNA levels when compared to levels kidney. For these reason, the use of

GAPDH in bone as an referent is inappropriate. The expression levels of CYP27B1,

CYP24 and VDR mRNA when using either GAPDH or total RNA as the referents is

shown in Table 3.7. For the purpose of comparing expression levels of mRNA when

using either total RNA or GAPDH mRNA as the control, the expression levels of

mRNA is expressed as a percentage relative to animals fed a 1% calcium, vitamin D-

replete diet. In the kidney, expression levels of mRNA are comparable when corrected

with either total RNA or GAPDH mRNA. This was an expected outcome considering

74

Table 3.6 GAPDH threshold cycle (CT) values from various rats treatment groups

from kidney and bone.

Vit D (+) / 0.1% Calcium 11.74 + 0.25 15.58 + 0.21

Vit D (+) / 1% Calcium 11.57 + 0.16 14.66 + 0.51

Vit D (-) / 0.1% Calcium 11.74 + 0.09 15.50 + 0.26

Vit D (-) / 1% Calcium 11.78 + 0.15 14.40 + 0.27

Values and mean + SEM (n = 6). CT, threshold cycle; Vit D (+), vitamin D-replete;

Vit D (-), vitamin D-deficient; GAPDH, glyceraldehyde-3-phosphate dehydrogenase;

Rat treatment Kidney (CT) Bone (CT)

75

Table 3.7. Comparison of expression levels when using total RNA or GAPDH as the

referent.

Expression of each mRNA species is expressed as a percentage relative to rats fed 1%

calcium/Vit D (+) diet and s.e.m. Ca, calcium; Vit D (+), vitamin D-replete; Vit D (-),

vitamin D-deficient; CYP27B1, 25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-

hydroxyvitamin-24-hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-


/ µg total RNA 100% 172.3 53.1 14736 (s.e.m.) (26.5) (60.5) (16.7) (176.1)

/ GAPDH 100% 195.0 60.9 16322 CYP27B1

(s.e.m.) (23.8) (91.3) (20.7) (3751.2)

/ µg total RNA 100% 58.7 13.5 7.3 (s.e.m.) (6.4) (13.4) (5.1) (4.2)

/ GAPDH 100% 58.4 12.8 7.4 CYP24

(s.e.m.) (10.1) (4.3) (4.8) (3.9)

/ µg total RNA 100% 64.0 72.1 36.3 (s.e.m.) (23.2) (29.8) (17.8) (2.1)

/ GAPDH 100% 56.4 77.7 39.6

KID

NEY

VDR

(s.e.m.) (22.7) (22.8) (22.0) (1.7)

/ µg total RNA 100% 20.1 117.4 18.3 (s.e.m.) (23.3) (3.5) (23.8) (5.6)

/ GAPDH 100% 40.8 130.1 45.7 CYP27B1

(s.e.m.) (15.9) (4.2) (20.0) (9.4)

/ µg total RNA 100% 34.6 133.3 28.3 (s.e.m.) (33.9) (7.3) (34.2) (8.6)

/ GAPDH 100% 93.0 144.5 88.1 CYP24

(s.e.m.) (13.1) (40.0) (11.3) (31.0)

/ µg total RNA 100% 264.1 103.8 467.3 (s.e.m.) (16.8) (114.0) (18.4) (219.6)

/ GAPDH 100% 400.2 99.2 791.4

BO

NE

VDR

(s.e.m.) (37.5) (163.9) (33.5) (390.3)

Gene Internal Control

1% CaVit D (+) (control)

0.1% CaVit D (+)

(% of control)

1% Ca Vit D (-)

(% of control)

0.1% CaVit D (-)

(% of control)

76

that the GAPDH levels are consistent between all animal groups. In the bone,

however, while the trend of relative expression was the same whether using total

RNA or GAPDH mRNA as the referent, the magnitude of target mRNA expression

varied considerably, due to the variation in the GAPDH mRNA levels between

groups. Hence, to compare target mRNA levels between treatment groups as well as

between kidney and bone tissue, total RNA loaded per reaction was considered to be

more appropriate as the referent than GAPDH mRNA.

3.4 DISCUSSION

In this study, we have assessed the use of quantitative real-time RT-PCR in the

determination of CYP27B1, CYP24 and VDR mRNA levels in both rat kidney and

bone tissue, and we have optimised the experimental protocol of this method. This is

the first report to demonstrate a reliable, quantitative, detection of mRNA, extracted

from calcified tissue by real-time RT-PCR. Leutenegger et al (1999) extracted intact

total RNA from bone embedded in hydrophobic acrylic resin and used real-time PCR

to detect mRNA of several cytokines. They only used real-time RT-PCR, however, to

qualitatively analyse the mRNA species. Although a number of reports describe the

quantification of mRNA in various soft tissues (Wang et al 1989; Overbergh et al

1999; Yin et al 2001), there are no reports of the quantitative analysis of mRNA

obtained from calcified tissue, by real-time RT-PCR.

Relatively few studies have assessed the use of real-time RT-PCR in the quantitative

analysis of mRNA levels when compared with the number of studies that have

investigated the use of the technique in the detection of viral infections or allelic

discriminations. To our knowledge, no other studies have examined the regulation of

77

CYP27B1, CYP24 and VDR mRNA expression, using real-time RT-PCR. This

system accurately determines low levels of target mRNA expression and overcomes

the shortfalls of other less sensitive and non-quantitative techniques such as Northern

blot analysis or standard RT-PCR. The generation of standard curves with external

cDNA standards in order to derive copy numbers of target mRNA present in unknown

samples was demonstrated to be a robust, quantitative procedure. The cDNA

standards were also used to estimate the sensitivity of the method. The fluorogenic

probes were able to detect hundreds of copy numbers of target cDNA with high

reproducibility. It is likely that the fluorogenic probes may be sensitive enough to

even detect tens of copies since the highest CT value found at which hundreds of

copies were detected was considerably lower that the 45 cycles of the amplification

run. Additionally, no sign of amplification was detected in the NTC during the 45

cycles of the PCR reaction, which increases the reliability of low copy number

detection. The absence of amplified cDNA in the NTC demonstrated that the primer

and probe combinations did not amplify any potential contaminating genomic DNA

and confirmed that no contaminating material was present in the PCR reaction

mixture.

The sensitivity and efficiency of this system depends on the components present in the

reaction mixture being in excess. By using the linear part of the amplification curve,

rather than the amount of end product detected, to quantify cDNA levels present in a

particular sample, problems with amplification-limiting reagent concentrations is

avoided. Excessive amounts of probe, however, are known to interfere with cDNA

amplification by the forward and reverse primers. The optimised fluorogenic probe

concentration used for our PCR reactions was 200nM for each probe. The Universal

78

Master Mix (PE Applied Biosystems, Foster City, CA), which contains Amplitaq

Gold DNA polymerase (PE Applied Biosystems, Foster City, CA), is pre-optimised

for most fluorogenic probe PCR reactions. Although in some applications the level of

5’ exonuclease activity of Amplitaq Gold may vary, the use of Amplitaq Gold in the

current study does not appear to have compromised the progression of the PCR

reaction.

Linear amplification was detected over a large concentration range. In the case of

CYP27B1 cDNA, linear amplification was detected over a concentration range of 1.6

x 107-fold. The high degree of linearity, suggests that the dilutions performed and the

reaction conditions for each sample where appropriate. The concentrations of the

reaction components, such as the probe, the primers, the nucleotide and the

polymerase enzyme, are not limiting the reaction or the accuracy of CT detection.

The comparable amplification efficiencies found for the cDNA standards and for the

reverse-transcribed mRNA allows for the interpolation of mRNA copy numbers from

the cDNA standard curves. The high amplification efficiency of the reverse-

transcribed mRNA indicates the PCR efficiency is not affected by the use of the

phenol/chloroform method to purify total RNA from both soft kidney and mineralised

bone tissues, or by subsequent reverse-transcription of mRNA. While no direct

measurement can be made to determine the effectiveness of the first-strand synthesis

of cDNA from mRNA, the assumption can be made that the efficiency of the reverse-

transcription reaction is constant for all samples.

79

Duplicates of a PCR reaction of reverse-transcribed mRNA, exhibited a high degree

of reproducibility. No statistical difference could be determined between CT values

obtained from two separate PCR reactions, in any mRNA species except for GAPDH.

The reasons for the reduced reproducibility of the GAPDH amplification reaction are

unclear. They may be due to the small range of GAPDH levels detected, which may

prejudice the line-of-best-fit used to the determine the reproducibility of the GAPDH

mRNA analysis. A high degree of reproducibility was detected between CT values

obtained from two separate amplification reactions of cDNA standards, even at low

cDNA copy numbers. The CT values of the cDNA standards, generated on different

occasions showed a high reproducibility throughout the entire concentration range

tested. Despite this, when the mRNA copy number for a single unknown sample was

derived from each of the two standard curves, there was a significant difference in the

estimated amounts of copy numbers. This shows that even though the two standard

curves demonstrate a high degree of reproducibility in regards to the CT values, a

statistically insignificant shift of the standard curve can cause a substantial difference

in the amount of copy numbers estimated from this curve. Therefore, the

reproducibility of the reaction is limited when a separate standard curve is generated

for each PCR run. It was concluded, that the quantification of all unknown samples

during this project, should be derived from a single standard curve calculated from the

average of the two standard curves obtained through the amplification of a range of

cDNA standards.

The use of an endogenous standard as a means of controlling for experimental

variation is important. GAPDH mRNA could be used as an external referent for

unknown kidney mRNA samples, because consistent levels of GAPDH mRNA

80

expression were detected in all of the kidney samples tested. In the bone, however,

differences in GAPDH mRNA expression levels were detected. The rats fed the 1%

calcium diet, both vitamin D-replete and vitamin D-deplete, demonstrated a reduction

in CT value of approximately 1 cycle. This makes is impossible to compare relative

mRNA expression levels between the different dietary groups in bone tissue. There

have been a number of reports suggesting that GAPDH expression is regulated by a

number of physiological challenges and it is possible that the dietary treatment may

have altered the expression of GAPDH mRNA (Bustin et al 1999; Oliveira et al 1999;

Thellin et al 1999). As well, expression levels of GAPDH were significantly different

between the kidney and bone, with a reduction in CT values found in the kidney of 3

to 4 cycles. This represents a 5- to 10-fold increase of GAPDH mRNA copy number

in the kidney when compared to the bone, which does not allow for a direct

comparison of target message between these two tissues. Because the use of GAPDH

mRNA as a referent was considered inappropriate in the current study, total RNA was

used. Total RNA referent does not correct for the amount of cDNA loaded into each

PCR tube. There was, however, a high degree of reproducibility between the duplicate

reactions and between the two separate PCR runs, which suggested that a loading

control is not essential.

In conclusion, real-time RT-PCR is a rapid, highly reproducible and sensitive system,

which can accurately detect and quantify mRNA expression, even at very low levels.

Quantification based on the CT value, which is obtained from the early, linear stage of

amplification, rather than on the amount of end product detected, prevents the

problems associated with amplification limitation due to depletion of reagent

components, which is likely to occur in the later stages of amplification. The

81

generation of a standard curve, created by the amplification of cDNA standards of

known concentrations, allows for accurate estimation of mRNA copy numbers for a

specific gene. Furthermore, it enables us to compare mRNA expression levels

between different tissues and to compare results obtained from separate PCR runs.

The mRNA extraction and the reverse transcription procedure, prior to the real-time

RT-PCR analysis, do not appear to affect the accuracy and efficiency of the

fluorescence detection. Although the fluorogenic probes, specifically designed for

every target mRNA of interest, are difficult to design and expensive to synthesise,

they offer a high degree of specificity and sensitivity of detection, which gives rise to

a system that is superior over Northern blot analysis and semi-quantitative PCR

reactions.

82

CHAPTER 4: The Effects of Age on the Regulation of

CYP27B1, CYP24 and VDR mRNA Expression

4.1 Introduction Blood calcium levels are one of the most tightly regulated substances in the body. The

central role of the vitamin D endocrine system, along with PTH and calcitonin, is to

regulate blood calcium levels within a narrow range. Synthesis of 1,25D can increase

levels of serum calcium by increasing intestinal calcium absorption and renal calcium

reabsorption. The requirements for calcium, however, vary throughout life. During the

early stage of life when growth is vigorous, calcium requirements are high as the

skeleton accretes large amounts of calcium. During the latter stages of life, bone

growth ceases, and the skeleton in fact can serve as a source of calcium if dietary

calcium levels are inadequate. It is well established that intestinal calcium absorption

decreases with age (Gallagher et al 1979), which contributes to loss of calcium from

the skeleton (Morgan 1972; Nordin 1997). The role of the vitamin D endocrine

system in the adaptation of the body to the various requirements of calcium, however,

is less clear.

The biological activity of vitamin D is determined essentially from three genes, which

are CYP27B1, CYP24 and VDR. The synthesis of vitamin D by CYP27B1 occurs

primarily in the kidney. The catabolic activity of CYP24, however, occurs in the

kidney as well as in non-renal tissues that contain VDR. CYP27B1 and CYP24

enzyme activity are the most tightly regulated steps in vitamin D metabolism and

interact with several physiological factors such as calcium, PTH, calcitonin,

83

phosphate and 1,25D itself (Rost et al 1981; Nesbitt et al 1986; Nesbitt et al 1987;

Frolich et al 1990; Nesbitt and Drezner 1990; Walker et al 1990; Econs et al 1992;

Beckman et al 1995; Brenza et al 1998; Murayama et al 1998; Murayama et al 1999;

Shinki et al 1999; Yoshida et al 1999; Brenza and DeLuca 2000). In the kidney, these

factors usually have an effect on both CYP27B1 and CYP24 activity to modulate

1,25D production. For example, PTH strongly induces CYP27B1 activity and inhibits

CYP24 activity with the purpose of increasing 1,25D production (Matsumoto et al

1985; Shigematsu et al 1986; Shinki et al 1992; Armbrecht et al 1998; Zierold et al

2000). 1,25D, itself, has been shown to suppress CYP27B1 enzyme activity (Booth et

al 1985; Brenza and DeLuca 2000) and strongly induce CYP24 enzyme activity in a

feedback mechanism to limit the further synthesis of 1,25D (Akeno et al 1993;

Armbrecht and Hodam 1994; Itoh et al 1995; Lemay et al 1995; Armbrecht et al

1997(a); Armbrecht et al 1998; Furuichi et al 1998). There is emerging evidence that a

number of non-renal sites express CYP27B1 activity. Several recent studies have

shown that osteoblasts, as well as a variety of bone marrow precursor cells, express

CYP27B1 mRNA (Kreutz et al 1993; Nishimura et al 1994; Ichikawa et al 1995;

Panda et al 2001(a)). Although the precise role of CYP27B1 in these cells remains

unknown, the regulation of the 1α-hydroxylation of vitamin D in a number of non-

renal sites appears to be different from that of the renal 1α-hydroxylation step (Pryke

et al 1990; Reichel et al 1991; Gyetko et al 1993; Bell 1998; Zehnder et al 2001).

There is evidence for an age-related decline in the renal synthesis of 1,25D, which is

associated with reduced serum 1,25D levels and reduced VDR levels in target tissues

(Horst et al 1990; Takamoto et al 1990; Ebeling et al 1992; Johnson et al 1995). The

effect of age, however, on vitamin D activation and vitamin D catabolism, particularly

84

with respect to bone is unknown. To identify the effects of age on the biological

activity of vitamin D in kidney and bone tissue, levels of CYP27B1, CYP24 and VDR

mRNA were measured in these tissues removed from animals ranging in age from 3

weeks to 2 years of age. The animals were fed a standard rat chow for the duration of

the experiment, which contained adequate levels of calcium and vitamin D. The

measurement of several non-fasting serum markers of the vitamin D endocrine system

allows for further analysis of the regulation of kidney and bone CYP27B1, CYP24

and VDR mRNA expression.

4.2 Protocol


24 Sprague-Dawley female rats were allocated to 8 different age groups. Animals

were housed as described in Chapter 2.3 and were fed commercial rat chow (Chapter

2.3.1.1) and water ad libitum. Rats were sacrificed at the ages of 3, 6, 9, 12, 15, 26, 52

and 104 weeks of age as described in Chapter 2.5.3.1. Body weight was recorded at

time of death.

4.1.1 Biochemical analysis

Blood samples were collected from non-fasting animals at death as described in

Chapter 2.3.2. Blood serum was analysed for calcium (Chapter 2.4.1), 1,25D (Chapter

2.4.2), 25D (Chapter 2.4.3), PTH (Chapter 2.4.4) and calcitonin (Chapter 2.4.5).

4.1.2 Messenger RNA analyses

Messenger RNA extraction, purification and quantification from rat kidney and bone

tissue are described in Chapter 2.5.3. First strand cDNA synthesis from mRNA is

85

described in Chapter 2.5.4. The reaction temperature, reagent composition and

conditions for real-time RT-PCR are described in Chapter 2.6.2.

4.1.3 Data expression and statistical analyses

The effect of age on biochemical markers, CYP27B1, CYP24 and VDR mRNA were

statistically analysed with one-way analysis of variance (Chapter 2.4.6.2). A Tukey’s

post hoc test (Chapter 2.4.6.4) was used to identify the differences between age

groups. Multiple linear regression analysis was used to determine the relationship

between mRNA levels of a specific target gene and two or more biochemical markers

(Chapter 2.4.6.6) when each of the analyses demonstrated a significant linear

relationship.

4.3 Results

4.3.1 Body weight and serum biochemistry

Body weight and serum levels of 25D, 1,25D, PTH, calcitonin and calcium are shown

in Table 4.1.

4.3.1.1 Serum Calcium

The non-fasting serum calcium levels ranged from 2.6 ± 0.01 mmol/L at 26 weeks of

age to 3.0 ± 0.1 mmol/L at 15 weeks of age. Levels did not significantly vary between

the different age groups. Serum calcium did not correlate with serum PTH, calcitonin

or 1,25D levels.

4.3.1.2 Serum 25D

Serum 25D was higher at 12 and 15 weeks of age when compared to all other ages,

with levels of 276.6 ± 24.7 nmol/L and 316.9 ± 17.7 nmol/L respectively (p<0.0001)

86

despite constant dietary intake of vitamin D. In a multiple linear regression analysis,

CYP27B1 mRNA and CYP24 mRNA levels did not correlate with 25D over the

entire age range. Kidney CYP27B1 mRNA levels were, however, negatively

correlated with serum 25D levels between 3 and 12 weeks of age (R2 = 0.53)

(p<0.05). Furthermore, kidney CYP24 mRNA levels were negatively correlated with

serum 25D levels in animals between 15 and 104 weeks of age (R2 = 0.31) (p<0.05).

4.3.1.3 Serum 1,25D

Serum levels of 1,25D were highest in the 3-week-old rat at 805.1 ± 59.9 pmol/L.

Levels decreased significantly until 12 weeks of age (p<0.0001). 1,25D levels

plateaued at 26 weeks of age. The relationship for age and serum 1,25D had a

logathrithmic correlation with a coefficient of determination of 0.74 (Figure 4.1).

4.3.1.4 Serum PTH

Serum PTH fell from 19.5 ± 0.7 pmol/L at 6 weeks of age to 14.0 ± 1.3 pmol/L at 9

weeks of age and remained at this level at 12 and 15 weeks of age. Serum PTH levels

then rose again at 26, 52 and 104 weeks of age (p<0.05). Serum PTH levels were not

analysed at 3 weeks of age.

4.3.1.5 Serum Calcitonin

Serum calcitonin levels were low from 3 to 12 weeks of age before significantly

increasing at 15, 26 and 104 weeks of age (p<0.01). Calcitonin levels were highest at

104 weeks of age at 18.8 ± 1.5 pmol/L. Serum calcitonin levels were not analysed at

52 weeks of age.

87

Table 4.1 Body weight and serum biochemistry of 25D, 1,25D, PTH, calcitonin and

calcium with respect to age.

3 w 6 w 9 w 12 w 15 w 26 w 52 w 104 w

Body Weight (g)

69.0a ± 1.5

175.0a ± 12.5

238.7a

± 1.5 265.3b

± 6.3 294.7c ± 15.8

336.7 ± 8.8

380.0 ± 5.8

373.3 ± 12.0

25D (nmol/L)

157.9 ± 0.0

161.5 ± 5.5

178.9 ± 15.6

276.6d

± 24.7 316.9e

± 17.7 200.1 ± 8.7

193.7 ± 4.2

158.8 ± 33.0

1,25D (pmol/L)

805.1a ± 59.9

479.9f ± 87.8

421.4g

± 52.3 164.4 ± 21.3

151.9 ± 16.6

73.1 ± 14.4

130.2 ± 49.6

67.6 ± 24.2

PTH (pmol/L) NA 19.6h

± 0.7 14.0i ± 1.3

14.5i ± 2.8

15.7j ± 1.1

23.0k ± 2.2

22.0k ± 3.9

30.9 ± 6.0

Calcitonin (pmol/L)

5.7l (n=1)

5.6l ± 1.0

3.9l ± 0.3

6.5l ± 1.3

12.8m ± 2.1

15.4 ± 4.9

NA 18.8 ± 1.5

Calcium (mmol/L)

2.7 ± 0.1

2.8 ± 0.04

2.7 ± 0.06

2.8 ± 0.1

3.0 ± 0.1

2.6 ± 0.01

2.8 ± 0.1

2.7 ± 0.1

Values are mean ± s.e.m. n = 3. a p<0.0001 v all; b p<0.0001 v all but 15 w; c

p<0.0001 all but 12 & 26 w; d p<0.0001 v all but 15 & 26w; e p<0.0001 v all

but 12w; f p<0.0001 v all but 9w; g p<0.0001 v all but 6w; h p<0.05 v 9, 12 &

104w; i p<0.05 v all but 12 & 15w; j p<0.05 v 26, 52, 104w; k p<0.05 v 104w; l

p<0.01 v 15, 26, 104w; m p<0.01 v 104w. NA, not analysed; 25D, 25-

hydroxyvitamin D3; 1,25D, 1,25-dihydrixyvitamin D3; PTH, parathyroid

hormone; Calcitonin, Calcitonin; calcium, calcium.

88

Figure 4.1 Relationship between rat age (weeks) and serum 1,25D levels (pmol/L).

The coefficient of determination (R2) is shown for the regression analysis.

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

0

200

400

600

800

1000

Seru

m 1

,25D

(nm

ol/L

)

R2 = 0.74

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

0

200

400

600

800

1000

Seru

m 1

,25D

(nm

ol/L

)

R2 = 0.74

89

4.3.2 Gene expression in the kidney

4.3.2.1 CYP27B1 mRNA

Kidney CYP27B1 mRNA levels were highest in the 3-week-old rat at 2.5 x106 ± 2.6

x105 copies/µg of total RNA. This was significantly different from mRNA levels

found at 9 weeks of age and older. There was a reduction in the levels of kidney

CYP27B1 mRNA with age, such that mRNA levels fell to 3.1 x105 ± 1.6 x105

copies/µg of total RNA by 52 weeks of age and 3.1 x105 ± 5.2 x104 at 104 weeks.

These mRNA levels were both statistically different from the levels detected at 3 and

6 weeks of age (p<0.0001). The line-of-best-fit for the fall in mRNA expression with

age has a non-linear coefficient of determination of 0.92 (Figure 4.2). There was no

correlation of kidney CYP27B1 mRNA with serum PTH levels or serum calcium

levels.

4.3.2.2 Relationship between serum 1,25D and kidney CYP27B1 mRNA

Kidney CYP27B1 mRNA levels positively correlated with serum 1,25D levels such

that an increase in CYP27B1 mRNA expression is associated with an increase in

serum 1.25D levels (p<0.001) (Figure 4.3). The coefficient of determination for the

relationship was 0.72.

4.3.2.3 Relationship between serum calcitonin and kidney CYP27B1 mRNA

The negatively correlation between serum calcitonin and kidney CYP27B1 mRNA

levels is shown in Figure 4.4. The non-linear coefficient of determination for the

relationship was 0.49 (p<0.01).

90

Figure 4.2 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA)

with age. Values are mean ± s.e.m. (n = 3). The coefficient of determination (R2) is

shown for the regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase.

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

0

5

15

20

25

30

35

10

R2 = 0.92

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

0

5

15

20

25

30

35

10

R2 = 0.92

CYP

27B

1

91

Figure 4.3 Relationship between serum 1,25D (pmol/L) and kidney CYP27B1 mRNA

levels (copy numbers/µg total RNA). The coefficient of determination (R2) is shown

for the linear regression analysis. 1,25D, 1,25-dihydroxyvitamin D3; CYP27B1, 25-

hydroxyvitamin D-1α-hydroxylase.

CYP27b1 mRNA copy number (x105)/ µg total RNA

10 20 353000

100

200

300

400

500

600

700

800

900

1000

Seru

m 1

,25D

(nm

ol/L

)

R2 = 0.72

15 255


10 20 353000

100

200

300

400

500

600

700

800

900

1000

Seru

m 1

,25D

(nm

ol/L

)

R2 = 0.72

15 255

CYP27B1

92

Figure 4.4 Relationship between serum calcitonin (pmol/L) and kidney CYP27B1

mRNA levels (copy numbers/µg total RNA). The coefficient of determination (R2) is

shown for the linear regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-

hydroxylase.

Calcitonin (pmol/L)

CYP

27b1

mR

NA c

opy

num

ber (

x105 )

/ µg

tota

l RN

A

35R2 = 0.42

0

5

10

15

20

25

30

5 10 20150 25 30

CYP

27B

1

93

4.3.2.4 CYP24 mRNA

The relationship between kidney CYP24 mRNA copy numbers and age is shown in

Figure 4.5. Expression of kidney CYP24 mRNA was lowest at 9 weeks of age at 3.2

x104 ± 9.3 x103 copy numbers/µg total RNA and highest at 104 weeks of age with 1.1

x106 ± 1.1 x105 copy numbers/µg total RNA. The mRNA expression with age

resembles a J-curve. Expression of CYP24 mRNA is high at 3 weeks of age before

falling at 6 and 9 weeks of age. The mRNA levels then increased significantly from

12 to 26 weeks of age and plateaued at 52 weeks of age (p<0.0001). The coefficient of

determination of the logarithmic line-of-best-fit relationship for data between 6 and

104 weeks of age was 0.90 (data not shown).

4.3.2.5 Relationship between serum 1,25D and kidney CYP24 mRNA

Kidney CYP24 mRNA copy numbers were negatively correlated with serum 1,25D in

rats varying in age between 6 and 104 weeks (p<0.05) (Figure 4.6). The coefficient of

determination for the logathrithmic line-of-best-fit was 0.71.

4.3.2.6 Relationship between kidney CYP27B1 mRNA and kidney CYP24

mRNA

Kidney CYP24 mRNA levels were negatively correlated with kidney CYP27B1

mRNA levels in rats varying in age between 3 and 104 weeks of age (p<0.05) (Figure

4.7). The coefficient of determination for the line-of-best-fit was 0.38.

94

Figure 4.5 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) with

age (weeks). Values are mean ± s.e.m. (n = 3). CYP24, 25-hydroxyvitamin D-24-

hydroxylase.

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

24 m

RN

A co

py n

umbe

r (x1

04 )/ µ

g to

tal R

NA

0

2

6

8

10

12

14

4

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

24 m

RN

A co

py n

umbe

r (x1

04 )/ µ

g to

tal R

NA

0

2

6

8

10

12

14

4

95

Figure 4.6 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA

levels (copy numbers/µg total RNA). The coefficient of determination (R2) is shown

for the linear regression analysis. 1,25D, 1,25-dihydroxyvitamin D3; CYP24, 25-

hydroxyvitamin D-24-hydroxylase.

CYP24 mRNA copy number (x105)/ µg total RNA

2 4 860 10 12 140

100

200

300

400

500

600

700

Seru

m 1

,25D

(nm

ol/L

)

R2 = 0.71


2 4 860 10 12 140

100

200

300

400

500

600

700

Seru

m 1

,25D

(nm

ol/L

)


2 4 860 10 12 140

100

200

300

400

500

600

700

Seru

m 1

,25D

(nm

ol/L

)

R2 = 0.71

96

Figure 4.7 Relationship between kidney CYP27B1 mRNA (copy numbers/µg total

RNA) and kidney CYP24 mRNA levels (copy numbers/µg total RNA). The

coefficient of determination (R2) is shown for the linear regression analysis.

CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; CYP24, 25-hydroxyvitamin D-24-

hydroxylase.

5 10 20150


25 30 35

CYP

24 m

RN

A co

py n

umbe

r (x1

04 )/ µ

g to

tal R

NA

0

2

6

8

10

12

14

4

R2 = 0.38

5 10 20150


25 30 35

CYP

24 m

RN

A co

py n

umbe

r (x1

04 )/ µ

g to

tal R

NA

0

2

6

8

10

12

14

4

R2 = 0.38

CYP27B1

97

4.3.2.7 Relationship between serum calcitonin and kidney CYP24 mRNA

Kidney CYP24 mRNA copy numbers were positively correlated with serum

calcitonin levels in rats varying in age between 3 and 104 weeks of age (p<0.05)

(Figure 4.8). The coefficient of determination for the line-of-best-fit was 0.69. Due to

a lack of serum blood sample, serum calcitonin levels could not be measured in two 3-

week-old rats and all 26-week-old rats.

4.3.2.8 VDR mRNA

The expression of kidney VDR mRNA with age is shown in Figure 4.9, which

resembles a J-curve. Expression of VDR mRNA is high at 3 weeks of age before

falling at 6 and 9 weeks of age. The mRNA levels then significantly increase between

9 and 15 weeks of age and plateau at 26 weeks of age (p<0.0001). The coefficient of

determination of the logarithmic line-of-best-fit relationship for the data between 6

and 104 weeks of age was 0.66 (p<0.01) (data not shown).

4.3.2.9 Relationship between kidney CYP24 mRNA and kidney VDR mRNA

The relationship between kidney VDR and kidney CYP24 copy numbers is shown in

Figure 4.10. The positive correlation between kidney CYP24 and kidney VDR mRNA

expression has a coefficient of determination of 0.60 (p<0.01).

98

Figure 4.8 Relationship between serum calcitonin (pmol/L) and kidney CYP24

mRNA levels (copy numbers/µg total RNA). The coefficient of determination (R2) is

shown for the linear regression analysis. CYP24, 25-hydroxyvitamin D-24-

hydroxylase.

CYP

24 m

RN

A c

opy

num

ber (

x105 )

/ µg

tota

l RN

A

Calcitonin (pmol/L)

R2 = 0.69

5 10 20150 25 30

14

0

2

4

6

8

10

12

99

Figure 4.9 Expression of kidney VDR mRNA (copy numbers/µg total RNA) with age

(weeks). Values are mean ± s.e.m. (n = 3). VDR, vitamin D receptor.

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

VDR

mR

NA

copy

num

ber (

x104 )

/ µg

tota

l RN

A

0

5

15

20

25

10

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

VDR

mR

NA

copy

num

ber (

x104 )

/ µg

tota

l RN

A

0

5

15

20

25

10

100

Figure 4.10 Relationship between kidney CYP24 and kidney VDR mRNA expression

(copy numbers/µg total RNA). The coefficient of determination (R2) is shown for the

linear regression analysis. CYP24, 25-hydroxyvitamin D-24-hydroxylase; VDR,

vitamin D receptor.


2 4 8600

5

10

15

20

25

10 12 14

VDR

mR

NA

copy

num

ber (

x107 )

/ µg

tota

l RN

A

R2 = 0.60


2 4 8600

5

10

15

20

25

10 12 14

VDR

mR

NA

copy

num

ber (

x107 )

/ µg

tota

l RN

A

R2 = 0.60

101

4.3.3 Gene Expression in the bone


The expression of bone CYP27B1 mRNA with age is shown in Figure 4.11. Bone

CYP27B1 mRNA levels were highest and remained relatively constant in rats

between 3 and 15 weeks, with values ranging from 2.0 x106 ± 3.7 x105 copies/µg of

total RNA to 3.4 x106 ± 6.0 x105 copies/µg of total RNA. Their levels of CYP27B1

mRNA were approximately 3-fold higher than in rats at 26 weeks of age or older. The

mRNA levels in the 12-week-old rat were significantly higher when compared to the

26, 52 and 104 week old rats (p<0.01). The mRNA levels in the 6 and 15-week-old

rats where only higher than those found in the 26-week-old rats (p<0.01). There is no

correlation between bone CYP27B1 mRNA levels and serum 1,25D or kidney

CYP27B1 mRNA levels.

4.3.3.2 Relationship between serum calcium and bone CYP27B1 mRNA

The relationship between serum calcium and bone CYP27B1 mRNA level is shown in

Figure 4.12. There is a positive correlation between serum calcium and bone

CYP27B1 (p<0.05). The coefficient of determination for the relationship is 0.34.

4.3.3.3 Relationship between serum PTH and bone CYP27B1 mRNA

The relationship between serum PTH and bone CYP27B1 mRNA level is shown in

Figure 4.13. The negative correlation between serum PTH and bone CYP27B1

mRNA has a coefficient of determination of 0.49 (p<0.01). In a multiple linear

regression analysis, serum PTH levels and not serum Ca remained a significant

determinant of bone CYP27B1 mRNA expression.

102

Figure 4.11 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) with

age (weeks). Values are mean ± s.e.m. (n = 3). CYP27B1, 25-hydroxyvitamin D-1α-

hydroxylase.

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

0

5

15

20

25

30

35

10

40

45

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

0

5

15

20

25

30

35

10

40

45

CYP

27B

1

103

Figure 4.12 Relationship between serum calcium (mmol/L) and bone CYP27B1

mRNA (copy numbers/µg total RNA). The coefficient of determination (R2) is shown

for the linear regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase.

0

5

10

15

20

25

30

CYP

27b1

mR

NA

copy

num

ber (

x105 )

/ µg

tota

l RNA

35

40

45

50

2.5 2.6 2.82.72.4

Serum Calcium (mmol/L)

2.9 3 3.1 3.2

R2 = 0.34

0

5

10

15

20

25

30

CYP

27b1

mR

NA

copy

num

ber (

x105 )

/ µg

tota

l RNA

35

40

45

50

2.5 2.6 2.82.72.4


2.9 3 3.1 3.2

R2 = 0.34

CYP

27B

1

104

Figure 4.13 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA

(copy numbers/µg total RNA). The coefficient of determination (R2) is shown for the

linear regression analysis. PTH, parathyroid hormone; CYP27B1, 25-hydroxyvitamin

D-1α-hydroxylase.

PTH (pmol/L)

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

R2 = 0.49

0

5

10

15

20

25

30

35

40

45

5 10 20150 25 30 35 40 45

50

CYP

27B

1

105

4.3.3.4 CYP24 mRNA

The expression of bone CYP24 mRNA with age is shown in Figure 4.14. Bone

CYP24 mRNA levels were highest in rats ranging in age between 3 and 15 weeks

with values ranging from 4.7 x104 ± 6.1 x103 to 1.1 x105 ± 2.7 x104 copies/µg of total

RNA. The levels of CYP24 mRNA were over 4-fold higher in the 3- to 15-week-old

rats than in rats at 26 weeks of age or older. The mRNA levels were significantly

higher in the 12-week-old rats when compared to the 26, 52 and 104 week old rats

(p<0.05). There is no correlation between bone CYP24 mRNA levels and serum

1,25D or kidney CYP24 mRNA levels.

4.3.3.5 Relationship between bone CYP27B1 mRNA and bone CYP24 mRNA

The relationship between bone CYP24 mRNA and bone CYP27B1 mRNA copy

numbers is shown in Figure 4.15. Bone CYP27B1 mRNA and bone CYP24 mRNA

levels are positively correlated, with a coefficient of determination of 0.72

(p<0.0001).

4.3.3.6 Relationship between serum PTH and bone CYP24 mRNA

The relationship between bone CYP24 copy numbers and serum PTH levels is shown

in Figure 4.16. Bone CYP24 mRNA levels and serum PTH levels are negatively

correlated, with a coefficient of determination of 0.29 (p<0.05).

106

Figure 4.14 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) with

age (weeks). Values are mean ± s.e.m. (n = 3). CYP24, 25-hydroxyvitamin D-24-

hydroxylase.

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

0

2

6

8

12

14

16

4

18

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

0

2

6

8

12

14

16

4

18

107

Figure 4.15 Relationship between bone CYP27B1 mRNA (copy numbers/µg total

RNA) and bone CYP24 mRNA expression (copy numbers/µg total RNA). The

coefficient of determination (R2) is shown for the linear regression analysis.

CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase. CYP24, 25-hydroxyvitamin D-24-

hydroxylase.

5 10 20150


0

2

4

6

8

10

12

25 30 35

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

14

16

18

40 45 50

R2 = 0.74

5 10 20150


0

2

4

6

8

10

12

25 30 35

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

14

16

18

40 45 50

R2 = 0.74

CYP27B1

108

Figure 4.16 Relationship between serum PTH (pmol/L) levels and bone CYP24


for the linear regression analysis. PTH, parathyroid hormone; CYP24, 25-


R2 = 0.29

05 10 15 20 25

PTH (pmol/L)

30 35 40 45

2

4

8

6

0

10

12

14

16

18

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

109

4.3.3.7 VDR mRNA

The expression of bone VDR mRNA with age is shown in Figure 4.17. There was a

reduction in the levels of VDR mRNA with age such that VDR levels fell to 6.3 x105

± 2.2 x105 copies/µg of total RNA by 15 weeks of age and remained low until 104

weeks of age (p<0.001). This fall in expression had a coefficient of determination of

0.66.

4.3.3.8 Relationship between serum 1,25D and bone VDR mRNA

The relationship between serum 1,25D and bone VDR mRNA levels is shown in

Figure 4.18. Serum 1,25D levels correlate with bone VDR mRNA levels such that an

increase in expression of VDR mRNA is associated with an increase in serum 1.25D

levels (p<0.01). The coefficient of determination for the relationship was 0.69. In a

multiple linear regression analysis, serum 1,25D and not age determines bone VDR

mRNA levels (p<0.001).

4.4 Discussion

4.4.1 Determinants of serum 1,25D

1,25D is essential for the stimulation of intestinal calcium absorption, which provides

adequate calcium levels for normal bone mineralisation during growth and skeletal

development. As the skeletal growth slows down, less calcium is being deposited in

the bone and therefore the requirement for 1,25D-stimulated intestinal calcium

absorption is reduced. Consequently, the renal synthesis of 1,25D is reduced with age

and this has been reported in both rats (Ishida et al 1987) and humans (Gallagher et al

1979). In the current study, serum 1,25D levels correlate positively with kidney

CYP27B1 mRNA levels and negatively with kidney CYP24 mRNA levels. This

110

Figure 4.17 Expression of bone VDR mRNA (copy numbers/µg total RNA) with age

(weeks). Values are mean ± s.e.m. (n = 3). The coefficient of determination (R2) is

shown for the regression analysis. VDR, vitamin D receptor.

R2 = 0.6578

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

VDR

mR

NA

copy

num

ber (

x107 )

/ µg

tota

l RN

A

0

5

15

20

25

30

35

10

R2 = 0.65

R2 = 0.6578

0 10 20 30 40 50 60 70 80 90 100 110

Age (weeks)

VDR

mR

NA

copy

num

ber (

x107 )

/ µg

tota

l RN

A

0

5

15

20

25

30

35

10

R2 = 0.65

111

Figure 4.18 Relationship between serum 1,25D levels (pmol/L) and bone VDR


for the regression analysis. 1,25D, 1,25-dihydroxyvitamin D3; VDR, vitamin D

receptor.

5

10

20

15

0

25

30

35

40

45

0200100 300 400 500 600 700 800 900 1000

VDR

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

R2 = 0.60

Serum 1,25D (pmol/L)

112

suggests that the age related decline in serum 1,25D levels is due to a reduction in the

1,25D synthesis by kidney CYP27B1 and an increase in 1,25D catabolism by kidney

CYP24. The decreased availability of circulating 1,25D with age, due to changes in

CYP27B1 and CYP24 mRNA expression, may be important in the development of

intestinal calcium malabsorption, negative calcium balance and the subsequent bone

loss seen in humans (Armbrecht et al 1981; Nordin 1997).

4.4.2 Determinants of serum 25D

Data presented here indicate that serum 25D levels rise to a peak at 12 and 15 weeks

of age before falling again at 26 weeks of age and older. The exact reason for the peak

in serum 25D levels is not known, since the animals were provided with an adequate

and identical intake of dietary vitamin D at all times. It is possible that, since 25D

synthesis in the liver is not tightly regulated (Reinholz and DeLuca 1998), fluctuations

in 25D levels may be due to metabolism into 1,25D or 24,25D. This proposal is

supported by the negative correlation between CYP27B1 mRNA and 25D levels

between 3 and 12 weeks of age (p<0.01) and the positive correlation between CYP24

mRNA and 25D levels between 15 and 104 weeks of age (p<0.001). For this proposal

to be correct, the enzyme activities of CYP27B1 and CYP24 would have to be

modulated by large amounts to effect the large changes in total serum 25D levels of

some 100 to 150nmol/L. Measuring the clearance of 25D from the serum and

appearance of its metabolites at different ages could be done to test this hypothesis.

4.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA

4.4.3.1 Determinants of kidney CYP27B1 mRNA

An age related decline in CYP27B1 mRNA expression has been found in the current

study, which is shown to correlate with a decrease in serum 1,25D levels. This finding

113

is consistent with results from a study by Ishida and co-workers (1987) who showed a

decline in rat kidney CYP27B1 enzyme activity over a two-year period and a

corresponding reduction in serum 1,25D levels. The reduction in kidney CYP27B1

mRNA expression and serum 1,25D levels with age occurs concomitantly with the

decrease in skeletal calcium accretion (O’Loughlin and Morris, 1994) and a reduced

requirement for 1,25D-mediated calcium absorption in the latter stages of skeleton

maturation.

No relationship between serum PTH and kidney CYP27B1 mRNA levels was found

in this study, despite the fact that PTH has been shown to stimulate CYP27B1 gene

transcription (Tanaka et al 1972; Korkor et al 1987) through the cAMP-signalling

pathway (Horiuchi et al 1977; Henry 1985). Garabedian et al (1972) demonstrated,

that parathyroidectomised animals are unable to synthesise 1,25D in the kidney and

that PTH administration to these animals restored the renal production of 1,25D.

Furthermore, St-Arnaud et al (1997) reported a 2-fold increase in CYP27B1 mRNA

expression in the kidney of mice, following the infusion of a pharmacological dose of

PTH for 3 days. The lack of correlation between serum PTH and kidney CYP27B1

mRNA levels may be explained by the measurement of serum PTH levels in non-

fasting animals. The higher serum calcium levels, which occur during non-fasting

periods, may have suppressed the levels of serum PTH and concealed the relationship

between serum PTH and kidney CYP27B1 mRNA expression. Physiologically, PTH

stimulates CYP27B1 mRNA expression, in response to hypocalcemia (Suda et al

1994). The lack of correlation between serum PTH and kidney CYP27B1 mRNA

levels in the current study could therefore indicate PTH regulates CYP27B1 mRNA

expression only during periods of hypocalcaemia The lack of correlation between

serum PTH and kidney CYP27B1 mRNA levels in the current study could therefore

114

indicate PTH regulates CYP27B1 mRNA expression only during periods of

hypocalcaemia. The results from a study performed by Shinki et al (1999) support this

concept where PTH was found to induce CYP27B1 mRNA expression in vitamin D-

deficient hypocalcaemic rats but not in normocalcemic rats.

Another possible explanation for the lack of correlation between serum PTH levels

and kidney CYP27B1 mRNA levels, is provided by a study by Armbrecht and co-

workers (1999), when both young and adult rats were fed a low calcium diet. While a

similar increase in PTH levels was detected in both groups, CYP27B1 mRNA

expression was less responsive to PTH stimulation in the kidneys of adult rats when

compared to those in the young rats. The lack of responsiveness of the adult kidney to

PTH with regards to elevating CYP27B1 mRNA levels is consistent with studies in

humans (Neer et al 1975). Therefore, the increase in serum PTH levels with age could

be a response to the failing ability of PTH to stimulate CYP27B1 mRNA expression

in adulthood.

In the study by Shinki et al (1999) a single pharmacological dose of calcitonin was

given to normocalcemic rats, which unlike PTH, greatly enhanced both the in vivo

conversion of 25D into 1,25D and the CYP27B1 mRNA expression in the kidney.

This calcitonin-mediated stimulation of CYP27B1 has been previously shown by

enzyme activity in rat renal slices and by CYP27B1 promoter activity studies in

kidney cell-lines (Armbrecht et al 1987; Murayama et al 1998; Yoshida et al 1999).

The calcitonin-mediated increase in CYP27B1 mRNA expression, shown by Shinki et

al, was lost when animals were hypocalcaemic. This suggests that normal serum

calcium levels are required for calcitonin to stimulate renal CYP27B1 mRNA

115

expression. The negative correlation between serum calcitonin and CYP27B1 mRNA

levels in the current study, suggests that under vitamin D replete, normocalcemic

conditions, calcitonin may mediate a suppressive rather than stimulatory effect on

renal CYP27B1 mRNA expression. Although, the explanation for the differences in

results between the study of Shinki et al and the current study is unclear, it is possible

that the differences between the pharmacological doses of calcitonin that Shinki and

co-workers used and the physiological levels of calcitonin measured in the current

study is the basis for the discrepancy.

Although calcitonin has been suggested to play a role in the kidney, the most

important function of calcitonin is to lower serum calcium levels by inhibiting bone

resorption. Only in young rats, however, in which bone resorption is relatively high,

does calcitonin administration result in a significant reduction in bone resorption and

a subsequent fall in serum calcium levels (Armbrecht et al 1987; Tsai et al 1991). The

increase in calcitonin levels, starting from 15 weeks of age, may be an indication of

calcitonin insensitivity in adulthood, rather than of a direct involvement of calcitonin

in the regulation of renal CYP27B1 activity. The rise in calcitonin in adulthood might,

therefore, be a consequence of an inability to reduce serum calcium levels by

suppressing bone resorption. Further investigation of bone resorption activity with age

groups is required to substantiate this theory. Although calcitonin plays an important

role in calcium homeostasis, its effect on kidney CYP27B1 mRNA expression

remains unclear.

4.4.3.2 Determinants of kidney CYP24 mRNA

In the current study, CYP24 mRNA expression was positively correlated with age and

negatively correlated with serum 1,25D levels. This finding is consistent with CYP24

116

enzyme activity studies by Ishida and co-workers (1987). They showed a rise in

CYP24 enzyme activity, and a decline in rat kidney CYP27B1 enzyme activity over a

two-year period. The rise in the CYP24-mediated 1,25D breakdown, and the

reduction in the renal 1,25D synthesis reflect the reduced need for 1,25D when the

skeleton matures. The increase in CYP24 mRNA expression coupled to the decrease

in CYP27B1 mRNA expression confirms the reciprocal relationship between the two

enzymes (Boyle et al 1971; Gray et al 1971) and demonstrates the role of the kidney

in regulating levels of circulating 1,25D.

In this study, an age-related rise in serum calcitonin levels is shown, which rapidly

increases from 15 weeks of age. Although some studies in humans suggest that serum

calcitonin levels either remain constant or decrease with age, numerous studies in rats

report an age related increase in serum calcitonin levels (Kalu et al 1983; Lore et al

1984; Tiegs et al 1986; Kalu et al 1988; Lu et al 1998). The rise in serum calcitonin

was positively correlated with kidney CYP24 mRNA levels. This is the first report of

its kind to show a positive correlation between calcitonin and kidney CYP24. As

described earlier, the primary role for calcitonin is to lower serum calcium levels

during periods of hypercalcemia by inhibiting bone resorption. The positive

correlation between serum calcitonin and kidney CYP24 mRNA levels suggests that

calcitonin may also be able to regulate the catabolism of 1,25D, thereby reducing the

1,25D-mediated intestinal calcium absorption and consequently the serum calcium

levels. This is further supported by the fact that there is a negative correlation between

serum calcitonin and kidney CYP27B1 mRNA in this study. Further investigation into

the in vivo effects of calcitonin may reveal an important role for this hormone in

vitamin D metabolism.

117

In this study, kidney CYP24 mRNA levels positively correlated with kidney VDR

mRNA levels. Liganded VDR can directly regulate CYP24 gene expression by

binding to either of two distinct vitamin D response elements (VDRE), which are

located in the promoter region of the CYP24 gene (Ohyama et al 1994; Chen and

DeLuca 1995; Dwivedi et al 2000). A concomitant rise in VDR and CYP24 mRNA

levels has been previously described by Johnson et al (1995). They detected greater

levels of renal VDR and CYP24 mRNA and protein levels in 18-month-old female

Fischer 344 rats when compared to levels found in 6-month-old and younger rats.

Studies conducted under extreme physiological situations support the notion of a

dependency of CYP24 on VDR expression. In patients who suffer from vitamin D-

dependent rickets type II (VDDRII), which is characterised by a defective VDR, have

significantly reduced CYP24 enzyme activity levels (Tiosano et al 1998).

Furthermore, very high 1,25D levels were detected in VDR-knockout mice compared

to levels in wild-type animals, which was associated with undetectable levels of renal

CYP24 mRNA (Takeyama et al 1997).

4.4.3.3 Determinants of kidney VDR mRNA

While numerous in vitro and in vivo studies have shown a 1,25D-directed increase in

VDR mRNA in the kidney (Merke et al 1989; Strom et al 1989; Goff et al 1990;

Reinhardt and Horst 1990; Sandgren and DeLuca 1990; Santiso-Mere et al 1993;

Uhland-Smith and DeLuca 1993), there is no positive correlation detectable between

serum 1,25D and kidney VDR levels in the current study. In fact, there is a tendency

for a negative correlation between serum 1,25D and kidney VDR mRNA levels,

which is similar to the negative correlation found between serum 1,25D and CYP24

mRNA levels. This relationship becomes statistically significant when data from the

118

3-week-old animals are excluded (data not shown). Therefore, it appears that under

normal physiological circumstances, circulating 1,25D is not a direct determinant of

VDR mRNA expression in the kidney. Rather, the apparent dependence of CYP24

activity on VDR mRNA expression suggests that VDR is an indirect determinant of

the serum 1,25D levels via the regulation of CYP24 enzyme activity.

While changes in CYP27B1 and CYP24 mRNA expression result in a concomitant

change in enzyme activity, it is not clear whether the increase in VDR mRNA levels

with age actually results in an increased VDR protein levels. Strom et al (1989)

showed that 1,25D administration to vitamin D-deficient mice increased the VDR

mRNA levels by 10-fold but the total receptor protein levels only by 2-fold, and there

was no change in unoccupied VDR levels. It was suggested that the role of increased

in VDR mRNA levels was to maintain the constant levels of unoccupied receptor.

This concept was supported by Koszewski et al (1990) who could not detect any

difference in unoccupied VDR receptor levels between 1-month and 18-month-old

rats. Furthermore, Wiese et al (1992) found in rat fibroblast and intestinal epithelial

cells that 1,25D treatment did not increase VDR mRNA levels but did increase the

stability of the VDR protein. The study by Wiese et al was confirmed by several other

studies, which showed in intestinal, kidney and bone cells, that the mechanism of the

1,25D-mediated VDR up-regulation was due to an increase in the stability of the

occupied VDR, rather than to an increase in VDR mRNA expression (Costa and

Feldman 1987; Arbour et al 1993; Santiso-Mere et al 1993). It is therefore possible,

that the increase in VDR mRNA levels in adulthood found in the current study does

not reflect an increase in VDR protein levels, but rather reflects a greater turnover of

the less-stable unoccupied VDR, due to lower circulating 1,25D levels. An

119

investigation, however, of the total and unoccupied levels of VDR would be required

to substantiate this concept.

4.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA

4.4.4.1 Determinants of bone CYP27B1

The effects of age on vitamin D metabolism in bone tissue remain largely unknown.

In rats ranging in age from 3 to 15 weeks, the expression of CYP27B1 mRNA in the

bone is 4 to 5-fold higher when compared to the expression found in rats of 26 weeks

of age and older. This is the first report to demonstrate a relationship between bone

CYP27B1 mRNA expression levels and age. The detection of a higher expression of

bone CYP27B1 mRNA during the period of rapid growth, implicates a role for locally

produced 1,25D in bone growth and in the development of mineralised bone. The

possible involvement of local CYP27B1 activity in bone development is supported by

the positive correlation found between serum calcium and bone CYP27B1 mRNA

levels, which suggests that a rise in extracellular calcium may stimulate the expression

of bone CYP27B1 mRNA. Such a relationship between serum calcium and bone

CYP27B1 mRNA levels is possible considering the fact that 1,25D has been shown to

increase intracellular calcium levels and mineralisation of osteoblasts in vitro (Jenis et

al 1993; Shalhoub et al 1998). Bone CYP27B1 mRNA and serum 1,25D levels do not

correlate, which suggests that locally synthesised 1,25D serves an autocrine or

paracrine role and supports the hypothesis that locally produced 1,25D plays a role in

the growth and development of normal mineralised bone. Such a mechanism would

have particular physiological importance and would be worth further investigation.

Serum PTH levels were inversely correlated with bone CYP27B1 mRNA levels. This

suggests that the local production of 1,25D in the bone does not respond to PTH or

120

may even be suppressed by PTH. This is not the first report of a tissue-specific effect

of PTH on the regulation of CYP27B1 in a non-renal tissue, which is different from

that in the kidney. For example, PTH is unable to affect CYP27B1 enzyme activity in

pulmonary alveolar macrophages (Reichel et al 1987(a)). Interestingly, Reichel and

co-workers (1987(d)) also showed that both pulmonary alveolar macrophages and

bone marrow macrophages respond to interferon-γ by up-regulating the production of

1,25D. Hence, it is possible that PTH is also unable to stimulate CYP27B1 activity in

bone marrow macrophages. In the current study, the total RNA extracted from the

femora included the bone marrow. The lack of PTH-mediated stimulation of

CYP27B1 expression in the bone may, therefore, be partly explained by the presence

of bone marrow macrophage and macrophage-like cells in the tissue collected. The

investigation of the regulation of CYP27B1 activity in bone marrow macrophages and

other bone cells by PTH may provide evidence for a differential regulation of

CYP27B1 activity between the kidney and the bone. An examination of the bone cells

that express CYP27B1 mRNA is described in Chapter 6.

4.4.4.2 Determinants of bone CYP24

Of considerable interest is the strong positive correlation found between bone

CYP27B1 mRNA and bone CYP24 mRNA levels throughout the age range

examined. This is the first report of co-expression of the synthetic and catabolic

enzymes in an in vivo system. The co-expression of bone CYP27B1 and CYP24 is

supported by the study of Reichel et al (1987(d)), who showed that the addition of

25D to bone marrow macrophage cells caused an increase in CYP27B1 enzyme

activity and consequent rise in CYP24 enzyme activity. The increase in CYP24

activity was suggested to be due to the increase in intracellular production of 1,25D,

which suggests that CYP24 activity is responsive to locally produced 1,25D.

121

Furthermore, there was no correlation found between bone CYP24 mRNA and serum

1,25D levels, indicating that bone CYP24 mRNA expression is responsive to the

locally produced 1,25D rather than to the circulating 1,25D levels. The implication of

this observation is that the local synthesis of 1,25D in the bone plays a significant role

in autocrine or paracrine signalling and that CYP24 modulates the response to 1,25D

by catabolising 1,25D.

Bone CYP24 mRNA was negatively correlated with serum PTH levels. Although it is

well established that PTH suppresses the kidney CYP24 activity (Henry 1992; Henry

et al 1992; Shinki et al 1992), this is the first study to demonstrate this relationship

between serum PTH and bone CYP24 mRNA. Nishimura et al (1994), however,

showed that in osteoblast like cells, bone CYP24 mRNA expression was unaltered by

administration of PTH. The mechanism by which PTH down-regulates the bone

CYP24 mRNA is unclear. The divergence between results from Nishimura’s study

and the current study may be to be due to a tissue- and/or cell-specific effect of PTH

on CYP24 expression, which has been detected in previous studies. Yang et al, for

example, (1999) showed a cAMP-mediated suppression of CYP24 mRNA in renal

proximal tubule cells and a stimulation in renal distal tubule cells.

4.4.4.3 Determinants of bone VDR

Bone VDR mRNA levels fall with age. The levels are highest at 3 weeks of age and

plateau at 15 weeks of age. This is consistent with Horst et al (1990), who

demonstrated a reduction in unoccupied VDR levels in bones of 18-month-old rats

when compared to VDR levels in 1-month-old rats. When analysed by multiple linear

regression, however, bone VDR mRNA is positively correlated with serum 1,25D

levels and not with age. This is supported by other studies that have shown an

122

increase in VDR levels in osteoblast-like cell lines in response to 1,25D treatment

(Dokoh et al 1984; Pols et al 1988). The suggestion that circulating 1,25D levels

dictating the responsiveness of bone cells to 1,25D, is supported by previous studies

in osteoblast-like cell systems (Dokoh et al 1984; Chen et al 1986(a); Chen et al

1986(b); Staal et al 1997). Chen et al (1986(b)) showed, however, that sensitivity and

magnitude of the responses to 1,25D in cultured osteoblast-like cells, was specifically

dependent on the osteoblast numbers. Dokoh et al (1984) found a correlation between

serum 1,25D levels and the respective number of VDR molecules per cell in a

cultured osteosarcoma cell-line. Thus, the VDR mRNA reduction with age could be a

function either of decreased osteoblast numbers or decreased VDR levels in each bone

cell.

Supporting the suggestion of the relationship between 1,25D-mediated osteoblast

function and VDR levels, is the fact that the number of functional osteoblasts has been

shown to decrease with age (Bouillon et al 1995; Parfitt et al 1997). Therefore, the

reduction of VDR mRNA levels detected in the current study may reflect the reduced

functional capacity of osteoblasts. A relationship between serum 1,25D levels, bone

VDR levels and osteoblastic function may have some important physiological effects

during aging and on the vitamin D endocrine system, and therefore warrants further

investigation. While other bone cells have been shown to express VDR, including

bone marrow-derived monocytes, macrophages and T lymphocytes (Lemire et al

1984; Lemire et al 1985; Clemens et al 1988; Lemire and Archer 1991; Abu-Amer

and Bar-Shavit 1994; Gruber et al 1999), the effects of age on VDR mRNA

expression in these cells is unknown.

123

4.4.5 Comparisons of kidney and bone vitamin D endocrine systems

This study demonstrated that both kidney and bone tissue express mRNA for

CYP27B1, CYP24 and VDR. The regulation of the expression of these genes during

aging is, however, considerably different between the kidney and bone. In the kidney,

the inverse relationship between CYP27B1 and CYP24 mRNA suggests that the

primary role of the kidney is to control the circulating levels of 1,25D. In the bone,

however, the co-expression of CYP27B1 and CYP24 suggests that locally produced

1,25D is involved in autocrine or paracrine signalling. The positive correlation

between bone CYP24 and bone CYP27B1 suggests that, under normal physiological

conditions, it is the locally produced 1,25D that induces CYP24 in the bone, rather

than circulating 1,25D levels. This is, however, is in opposition to the current

paradigm of the vitamin D endocrine system, in which extra-renal CYP24 exclusively

deactivates circulating 1,25D to moderate the 1,25D-mediated action.

The regulation of bone CYP27B1 mRNA expression is considerably different from

that of kidney CYP27B1 mRNA expression. Kidney CYP27B1 mRNA levels were

not correlated with serum PTH levels. Interestingly, however, bone CYP27B1 mRNA

levels were negatively correlated with serum PTH levels. While the lack of correlation

between serum PTH and kidney CYP27B1 mRNA levels may be explained by the

possibility that PTH regulates kidney CYP27B1 mRNA expression only during

periods of hypocalcaemia, the potential for serum PTH-mediated inhibition of

CYP27B1 mRNA expression in the bone is worthy of further investigation.

Furthermore, defining the regulation of bone CYP27B1 mRNA by PTH may help to

124

resolve the different physiological role for 1,25D synthesis between the kidney and

bone.

Although this is the first report of the differential regulation of kidney and bone

vitamin D metabolism, it is not the first report of a difference in regulation of the

vitamin D metabolism between renal and non-renal tissues. For example, CYP27B1

activity in activated macrophages, unlike in kidney cells, is not inhibited by 1,25D or

extracellular calcium. This is suggested to be the basis for the uncontrolled CYP27B1

activity associated with sarcoidosis and other granulomatoses (Barbour et al 1981;

Adams and Hamilton 1984; Adams and Gacad 1985; Reichel et al 1987(a); Reichel et

al 1987(b); Reichel et al 1987(d); Papapoulos et al 1988; Dusso et al 1997). CYP24

mRNA expression has been shown to be regulated differently between the kidney and

intestine. When rats were challenged acutely with 1,25D, following a chronic

exposure to 1,25D, the kidney CYP24 mRNA levels were unaltered, while the

intestinal CYP24 mRNA levels were markedly induced (Demers et al 1997). This was

suggested to be due to the fact that CYP24 has different physiological roles in the

kidney and the intestine. In the intestine, CYP24 was induced to prevent the over-

stimulation of 1,25D-mediated calcium absorption, whereas CYP24 was not induced

in the kidney, possibly because 1,25D does not adversely stimulate 1,25D-mediated

processes in this tissue. Similarly, the differences between kidney and bone CYP24

mRNA expression can be attributed to the role of CYP24 in each tissue.

While during periods of normocalcemia PTH does not appear to regulate kidney

CYP27B1 mRNA expression, calcitonin, on the other hand, is negatively correlated

with kidney CYP27B1 mRNA and positively correlated with CYP24 mRNA levels.

125

This suggests that the role for calcitonin in reducing serum calcium levels may extend

to regulating serum 1,25D levels. While the precise role of calcitonin in regulation of

the renal vitamin D metabolism is unclear, the lack of correlation between calcitonin

and bone CYP27B1 or CYP24 mRNA levels suggests that calcitonin is more likely to

be involved in the regulation of circulating levels of 1,25D, than in the local

production of 1,25D in the bone.

A striking difference between vitamin D metabolism in kidney and bone was found

when studying the expression of VDR mRNA. The expression of VDR mRNA in the

kidney rises with age, whereas bone VDR mRNA levels fall with age. The difference

in VDR mRNA expression between bone and kidney may be due to a difference in the

need for vitamin D-responsiveness in these tissues with age. Assuming for the

moment that an increase in VDR mRNA expression results in an increase in VDR

protein levels, kidney VDR levels then increase in parallel with the age-related

increase in CYP24 levels, which is consistent with previous studies (Johnson et al

1995; Armbrecht et al 1998; Yang et al 2001). In the bone, however, there is no

correlation between CYP24 mRNA and VDR mRNA levels. The reason for this

difference in the association between CYP24 and VDR found between the kidney and

bone is unknown. Bone VDR levels, however, correlate with serum 1,25D levels,

suggesting that the vitamin D-responsiveness of bone tissue is dependent on the

circulating 1,25D levels. Bone CYP24 mRNA, on the other hand, responds to locally

synthesised 1,25D, rather than to circulating 1,25D. The uncoupling of the association

between CYP24 and VDR is therefore likely to be due to the different mechanisms

controlling bone CYP24 and VDR mRNA expression. Given that the VDR is required

for CYP24 expression mRNA in bone, the VDR levels present in the bone cell must

126

be sufficient to induce the CYP24-mediated catabolism of locally produced 1,25D,

and therefore further stimulation of VDR mRNA expression is not required.

4.4.6 Summary

In summary, this study demonstrated that both kidney and bone tissue express mRNA

for CYP27B1, CYP24 and VDR. In the kidney, CYP27B1 and CYP24 primarily

control the circulating levels of 1,25D, which in turn contribute to the stringent

regulation of serum calcium levels. While PTH was not correlated with kidney

CYP27B1, the association found between calcitonin and kidney CYP27B1 and

CYP24 mRNA during normocalcemia points to a new role for calcitonin in the

regulation of circulating 1,25D levels. The coupling of CYP27B1 and CYP24 mRNA

expression in the bone was in contrast with the inverse relationship found in the

kidney. Taken together with the lack of correlation between circulating 1,25D levels

and bone CYP24 mRNA, this suggests that, under normal physiological conditions,

the locally produced 1,25D plays a significant role in autocrine or paracrine signalling

of 1,25D-medaited bone cell events. In contrast, bone VDR mRNA expression is

associated with serum 1,25D and therefore the renal production of 1,25D, suggesting

that the vitamin D-responsiveness of bone is dependant on circulating 1,25D levels,

rather than locally produced 1,25D. However, an investigation into the unoccupied

VDR levels in these bones would be required to confirm the relationship of serum

1,25D levels and vitamin D-responsiveness of the bone. The decline in CYP27B1

expression in bone in adulthood has not been previously described and may be an

important factor in the reduction of bone formation found with age. The positive

correlation between bone CYP27B1 mRNA and serum calcium levels suggests locally

produced 1,25D may be involved in the mineralisation process. However, 1,25D

produced in the bone may also be associated with the differentiation and the

maturation of a number of vitamin D-responsive bone cells.

127

Chapter 5: The Effect of Dietary Calcium and Vitamin

D on CYP27B1, CYP24 and VDR mRNA Expression

5.1 Introduction

The investigation of the in vivo regulation of CYP27B1 and CYP24 activity has

proved difficult due to the tight control of vitamin D activity under normal

physiological conditions. Although a number of non-renal tissues have been shown to

synthesise 1,25D, so far most studies have focussed on the control of the CYP27B1

gene expression in the kidney. It has been known for more than two decades that bone

cells contain CYP27B1 (Howard et al 1981) and CYP24 activity, however, little is

known about the regulation of CYP27B1 mRNA expression and enzyme activity in

the bone and the relationship between CYP27B1 and CYP24 in this tissue.

By varying the content of calcium and vitamin D in the diet, a number of biochemical

and physiological changes are triggered in humans and animals. Intestinal calcium

absorption, renal calcium reabsorption and bone calcium metabolism are all regulated

by several hormones in an effort to maintain normocalcemia during these dietary

challenges. The vitamin D-endocrine system is central to the regulation of serum

calcium levels, which also involves a number of biochemical factors, such as PTH and

calcitonin. In response to hypocalcemia, PTH potently up-regulates kidney CYP27B1

mRNA expression (Booth et al 1985) and down-regulates both kidney CYP24 and

VDR mRNA expression (Matsumoto et al 1985; Shigematsu et al 1986; Reinhardt &

Horst 1990; Shinki et al 1992; Armbrecht et al 1998; Zierold et al 2000). In response

to hypercalcemia, the primary action of calcitonin is to reduce calcium resorption in

128

the bone (Ikegame et al 1996). While the role of calcitonin in regulating vitamin D

metabolism is controversial, there is some evidence, which suggests that this hormone

is involved in the regulation of CYP27B1 activity in the kidney (Shinki et al 1999)

and CYP24 in non-renal tissues (Beckman et al 1994).

Despite the advanced understanding of the regulation of the vitamin D synthesis in the

kidney, the regulation of the activity of the enzymes involved in vitamin D

metabolism in the bone is still unclear. Numerous studies have investigated the

regulation of CYP24 mRNA expression and enzyme activity in bone cell culture

experiments, but little work has been done on the regulation of CYP27B1 mRNA

expression in the bone. This study is the first to describe the regulation of CYP27B1,

CYP24 and VDR by dietary calcium and vitamin D in kidney and bone tissue and

compare the regulation of vitamin D metabolism between these two tissues. The

measurement of several non-fasting serum markers of the vitamin D endocrine system

is helpful in the identification of the regulation of CYP27B1, CYP24 and VDR

mRNA expression in kidney and bone tissue.

5.2 Protocol


20 Sprague-Dawley female rats were allocated to either vitamin D-replete or vitamin

D-deplete dietary treatment groups. Vitamin D-deplete animals were bred from

mothers fed a vitamin D-deficient diet and housed in a UV-free environment. The

vitamin D-replete animals were exposed to normal fluorescent tube lighting. All

animals were housed in a 12-hour light/dark cycle (Chapter 2.3). 10 vitamin D-replete

(D(+)) animals were maintained on a standard 1% calcium semisynthetic diet

129

(Chapter 2.3.1.1) and 10 vitamin D-deplete (D(-)) animals were maintained on a 1%

calcium semisynthetic diet deficient in vitamin D (Chapter 2.3.1.1). All animals were

maintained on their assigned diets until 6 months of age. At 6 months of age, 5 rats

from both the D(+) and D(-) groups were transferred to a 0.1% calcium semi-synthetic

diet, containing vitamin D for the D(+) animals and no vitamin D for the D(-) group.

All animals were fed the assigned diets for a further 3 months. A representation of the

4 dietary treatment groups with an abbreviation for each group name is shown in

Table 5.1. All rats were fed water ad libitum through the duration of the experiment.

All animals were sacrificed at 9 months of age as described in Chapter 2.5.3.1.

Table 5.1 Allocation of animals into the dietary treatment groups at 6 months of age.

5.2.2 Biochemical analysis

Blood samples were collected at time of death as described in Chapter 2.3.2. Blood

serum levels of calcium (Chapter 2.4.1), phosphate (Chapter 2.4.1), 1,25D (Chapter

2.4.2), 25D (Chapter 2.4.3), PTH (Chapter 2.4.4) and calcitonin (Chapter 2.4.5) were

determined.

Vitamin D-deficient

Vitamin D-replete

0. 1 % Calcium1 % Calcium

D(+) / LC(n = 5)

D(+) / HC(n = 5)

D(-) / LC(n = 5)

D(-) / HC(n = 5)

Vitamin D-deficient

Vitamin D-replete

0. 1 % Calcium1 % Calcium

D(+) / LC(n = 5)

D(+) / HC(n = 5)

D(-) / LC(n = 5)

D(-) / HC(n = 5)

130

5.2.3 Bone histomorphometry

5.2.3.1 Bone fixation, cutting and resin embedding

Rat femora were removed from animals and defleshed before being placed in neutral

buffered formalin at 4°C for 4 hours. Femora were then cut transversely, using a slow

speed saw (Beuhler, Ltd, Lake Bluff, USA) equipped with a diamond tipped blade

(van Moppes, Gloucester, UK), to expose the epiphyseal and metaphyseal regions.

All embedding protocols were derived from standard laboratory techniques (Moore,

1996). Samples were dehydrated in graded acetone (70%, 95%, 2 x 100%) for 1 hour

each, then transferred into two changes of methylmethacrylate (MMA) and 8% w/v

K-Plast plasticiser (Medim, Giessen, Germany) each for 24 hours. 4mL of the final

embedding mixture containing MMA, 8% w/v plascticiser and 0.9% (w/v) K-Plast

initiator (Medim, Giessen, Germany) was poured into 25mL polypropylene tubes and

the bone samples immersed, cut surface down. The tubes were tightly capped and

transferred to a 37°C water bath for overnight polymerisation. All work was

performed in a fume hood and contact with skin was avoided, with samples

maintained at 4°C prior to polymerisation. The embedded samples were cut from the

tubes using a band saw and fixed to aluminium block holders (Bio-Rad, Sydney,

Australia) with epoxy glue (Selleys, Sydney, Australia).

5.2.3.2 Section Production

Following embedding, the samples were trimmed to expose the sample area by

removing and discarding 10µm sections with a motorised microtome (Jüng K,

Reichert, and Heidelberg, Germany). To expose the maximal epiphyseal and

metaphyseal area, the samples were trimmed to the midline of the femur. The exposed

131

sample area was then moistened with 50% ethanol and three consecutive 5µm

sections were cut and placed onto glass slides. Sections were flattened onto the slides

following immersion in a 30:70 mixture of ethylene glycol mono-ethyl ether (Merck,

Kilsyth, Australia) and 70% ethanol heated to 65-70°C. The section was then covered

with polyethylene plastic and cartridge paper, clamped and annealed to the slide

overnight in a 37°C oven. Prior to staining, MMA was removed by 2 x 5 minute

immersions in 100% acetone. Sections were then dehydrated in ethanol (2 x 100%),

cleared in xylene (2 x 100%) and mounted in xylene-based moutant Eukill (Kinder

GmbH and co., Freiburg, Germany).

5.2.3.3 Modified von Kossa method for identification of calcified tissue

Procedure for modified von Kossa staining was derived from previously published

protocol (Page 1977). Sections previously stored in tap water were washed twice with

distilled water and transferred to an aqueous solution of 0.1% silver nitrate and

exposed to UV light for 45 minutes. Sections were then washed in distilled water and

transferred to an aqueous solution of 2.5% sodium thiosulphate for 5 minutes.

Sections were rinsed in distilled water before mounting.

5.2.3.4 Von Kossa method for sites of calcium deposition with haematoxylin and eosin counterstain

Procedure for haematoxylin and eosin counterstaining was derived from a previously

published protocol (Page 1977). Following the final distilled water wash of the von

Kossa staining protocol (Chapter 5.2.3.3), sections were stained in Lillie Mayer’s

alum haematoxylin (Page 1977) for 10 minutes and washed in tap water for 1 minute.

The next step involved a combination differentiation in acid alcohol solution and

blueing in a saturated aqueous solution of lithium carbonate. The appropriate end-

point for this component was blue nuclei and basophilic cytoplasm over a colourless

132

background. Sections were then rinsed in running tap water for 30 seconds and

stained with a 1% aqueous eosin solution for 3 minutes. The appropriate end-point of

this component was pink osteoid, and strong staining of acidophilic cytoplasm, while

retaining cytoplasmic texture.


Messenger RNA extraction, purification and quantification from rat kidney and bone

tissue are described in Chapter 2.5.3. First Strand cDNA synthesis from mRNA is

described in Chapter 2.5.4. The reaction temperature, reagent composition and

conditions for real-time RT-PCR are described in Chapter 2.6.2. Messenger RNA

analysis by ribonuclease protection assay is described in Chapter 2.7.

5.2.5 Data expression and statistical analysis

Two-way analysis of variance was performed on biochemical markers (Chapter

2.4.7.3). The effect of dietary treatment on CYP27B1, CYP24 and VDR mRNA

expression was determined using two-way analysis of variance (Chapter 2.4.7.3). The

data were further analysed using Tukey’s post hoc test (Chapter 2.4.7.4). Multi-linear

regression analysis was used to determine the relationship between mRNA levels of

target genes and between biochemical markers and mRNA levels (Chapter 2.4.7.5).

5.3 Results

5.3.1 Serum biochemistry

Serum levels of 25D, 1,25D, PTH, calcitonin, calcium and phosphate are shown in

Table 5.2. Data from only four animals from the D(+)/LC group can be presented

since one rat died of natural causes before the completion of the experiment.

133

5.3.1.1 Serum 25D

Serum 25D levels in the D(-) animals were approximately 14 nmol/L. These levels of

serum 25D are markedly reduced when compared to serum 25D levels in the D(+)

animals (p<0.001). A reduction in 25D levels was found in the D(+)/HC animals

when compared to levels in the D(+)/LC group (p<0.05).

5.3.1.2 Serum 1,25D

The serum 1,25D levels in the D(-)/LC animals were 33.8 ± 0.3 pmol/L, which was

higher than levels found in the D(-)/HC animals (p<0.05) but markedly reduced when

compared to levels in the D(+)/LC animals (p<0.05). The D(+)/LC animals showed

elevated 1,25D levels of 405 ± 50.2 pmol/L when compared to serum levels found in

the D(+)/HC group (p<0.05).

5.3.1.3 Serum calcium

The D(-)/LC animals were hypocalcaemic, and were significantly reduced when

compared to levels in the D(-)/HC animals and the D(+)/LC animals (p<0.05). The

serum calcium levels found in D(+)/LC animals, were significantly lower than those

found in D(+)/HC animals (p<0.05). Serum calcium levels were inversely correlated

with serum PTH levels (p<0.01). The coefficient of determination of this non-linear

relationship was 0.75. A positive correlation was found between serum calcium and

serum calcitonin levels (p<0.01). The coefficient of determination of this non-linear


5.3.1.4 Serum phosphate

Serum phosphate levels were significantly reduced in the D(-)/LC animals when

compared to the levels found in D(-)/HC animals and the D(+)/LC animals (p<0.05).

134

Both the D(-)/HC animals and the D(+)/LC animals showed elevated serum phosphate

levels when compared to the levels found in the D(+)/HC animals (p<0.05).

5.3.1.5 Serum PTH

The D(-)/LC animals showed markedly elevated PTH levels at 167.0 ± 28.8 pmol/L,

which were significantly higher than the levels found in the D(-)/HC animals and the

D(+)/LC animals (p<0.05). Both the D(-)/HC animals and the D(+)/LC animals

showed elevated serum PTH levels when compared to the levels found in the

D(+)/HC animals (p<0.05).

5.3.1.6 Serum calcitonin

The serum calcitonin levels were suppressed in the D(-) animals when compared to

the levels in the D(+) animal (p<0.01). The D(-)/LC animals had lower levels of

calcitonin when compared to the D(-)/HC animals (p<0.05). The D(+)/LC animals

also showed a significant reduction in the levels of serum calcitonin when compared

to the levels in the D(+)/HC animals (p<0.05).

135

Table 5.2 Serum biochemistry of 25D, 1,25D, calcium, phosphate, PTH and calcitonin

in animals from each dietary treatment group.

D(-) / LC D(-) / HC D(+) / LC D(+) / HC

25D (nmol/L) 14.0 ± 1.5* 14.3 ± 1.7† 134.3 ± 3.1 96.9 ± 7.2*

1,25D (pmol/L) 33.8 ± 0.3* 13.2 ± 2.9#† 405.8 ± 50.2 19.6 ± 3.9*

Calcium (mmol/L) 1.99 ± 0.12* 2.32 ± 0.03#† 2.48 ± 0.02 2.69 ± 0.05*

Phosphate (mmol/L) 1.14 ± 0.05* 1.62 ± 0.17#† 2.10 ± 0.2 0.97 ± 0.12*

PTH (pmol/L) 167.0 ± 28.8* 32.2 ± 3.1#† 23.5 ± 2.9 2.07 ± 0.7*

Calcitonin (pmol/L) 1.48 ± 0.23* 2.35 ± 0.71# 11.7 ± 4.7 87.9 ± 9.1*

Values are mean ± s.e.m. n = 5 except for vitamin D-replete/0.1% calcium where n

=4. *p<0.05 v D(+)/LC; # p<0.05 v D(-)/LC; † p<0.05 v 1% D(+)/HC. D(-)/LC,

vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium;

D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete fed 1%

calcium; 25D, 25-hydroxyvitamin D; 1,25D, 1,25-dihydrixyvitamin D3; PTH,

parathyroid hormone.

136

Figure 5.1 Relationship between serum calcium (mmol/L) and serum PTH levels

(pmol/L). The coefficient of determination (R2) is shown for the line-of-best-fit. PTH,

parathyroid hormone.

R2 = 0.75


2.11.91.71.5 2.3 2.5 2.7 2.9

Seru

m P

TH (p

mol

/L)

150

100

50

0

200

250

137

Figure 5.2 Relationship between serum calcium (mmol/L) and serum calcitonin levels

(pmol/L). The coefficient of determination (R2) is shown for the line-of-best-fit.

R2 = 0.59

Seru

m C

alci

toni

n (p

mol

/L) 120

100

80

60

40

20

140

0


2.11.91.71.5 2.3 2.5 2.7 2.9

R2 = 0.59

Seru

m C

alci

toni

n (p

mol

/L) 120

100

80

60

40

20

140

0


2.11.91.71.5 2.3 2.5 2.7 2.9

138

5.3.2 Bone histomorphometry

Rat femora bone sections, which are stained for mineral content, and representative of

each of the dietary treatment groups, is shown in Figure 5.3 (A). Of particular interest

were the femora removed from the D(-)/LC animals. These animals showed numerous

thin trabeculae in the metaphysis of the femur as well as a reduction of bone mineral

content in the epiphysis when compared to the D(-)/HC animals. These animals also

showed higher levels of osteoid adjacent to the thin trabeculae (Figure 5.3 (B)). When

animals were fed the 1% calcium diet, the D(-)/HC animals maintained a normal bone

mineral content and showed a reduction in osteoid content, despite the vitamin D-

depletion.

5.3.2.1 Relationship between serum calcium and BV/TV in the D(-) animals

The relationship between serum calcium levels and bone mineral volume in the

epiphyseal region (BV/TV) is shown in Figure 5.4. A strong positive correlation was

found between serum calcium levels and BV/TV in the epiphysis from the D(-)

animals (p<0.001). The coefficient of determination for the relationship was 0.82. No

such relationship was detected in the D(+) animals or when the data from all groups

were combined for analysis.

139

Figure 5.3 Representative bone histology from each rat treatment group. A: Sections

were stained for bone mineral by a modified von Kossa silver technique. B: Sections

were stained for bone cells by a Hemotoxin and Eosin technique.

D(+)/HC

D(+)/LC D(-)/LC

D(-)/HC

A B

D(+)/HCD(+)/HC

D(+)/LCD(+)/LC D(-)/LCD(-)/LC

D(-)/HCD(-)/HC

A B

140

Figure 5.4 Relationship between serum calcium levels (pmol/L) and BV/TV (%) in

the epiphysis of the D(-) animals. The coefficient of determination (R2) is shown for

the line-of-best-fit. BV/TV, bone volume/total volume; D(-), vitamin D-deplete.


2.12.01.91.7 2.3 2.51.8 2.2 2.4

50

45

35

30

25

20

BV

/ TV

(%) 40

R2 = 0.82


2.12.01.91.7 2.3 2.51.8 2.2 2.4

50

45

35

30

25

20

BV

/ TV

(%) 40

R2 = 0.82

141

5.3.3 Gene expression in the kidney


The effect of dietary calcium and vitamin D content on CYP27B1 mRNA copy

number in the kidney, are shown in Figure 5.5. In the kidney, CYP27B1 mRNA level

were markedly increased in the D(-)/LC animals and were 277-fold higher than those

found in the D(-)/HC animals (p<0.0001). The high expression of CYP27B1 mRNA

in the D(-)/LC animals, was confirmed by ribonuclease protection assay (Figure 5.26).

The CYP27B1 mRNA levels in the D(-)/HC animals, were not statistically different

from those found in the D(+)/HC animals. Although CYP27B1 mRNA levels were

lower in the D(+)/HC animals when compared to the levels in the D(+)/LC, this

difference did not achieve statistical significance. In the D(+) animals, there was a

positive trend between kidney CYP27B1 mRNA and serum 1,25D levels, which did

not reach statistical significance (p=0.07). CYP27B1 mRNA levels were not

associated with serum levels of calcium, phosphate, calcitonin or 1,25D in all animals.

5.3.3.2 Relationship between serum PTH and kidney CYP27B1 mRNA

levels

Serum PTH levels were positively correlated with kidney CYP27B1 mRNA copy

numbers (p<0.0001) (Figure 5.6). The coefficient of determination for this

relationship was 0.78. The marked elevated serum PTH levels in the D(-)/LC animals

corresponded to a markedly increased CYP27B1 mRNA. When the regression

analysis excluded these hypocalcaemic animals, no relationship was found between

serum PTH and CYP27B1 mRNA levels in the kidney.

142

Figure 5.5 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA) in

each dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where

n = 4). *p<0.05 v 1% D(-)/HC & D(+)/LC. D(+)/LC, vitamin D-replete fed 0.1%

calcium; D(+)/HC, vitamin D-replete fed 1% calcium; D(-)/LC, vitamin D-deplete fed

0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP27B1, 25-


D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

5

10

600

800

1000

Dietary Treatment Group

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

2.5

7.5

12.5

700

900*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

5

10

600

800

1000


CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

05 )/ µ

g to

tal R

NA

2.5

7.5

12.5

700

900*

CYP

27B

1

143

Figure 5.6 Relationship between serum PTH (pmol/L) and CYP27B1 mRNA levels

(copy numbers/µg total RNA) in the kidney. The coefficient of determination (R2) is

shown for the line-of-best-fit. PTH, parathyroid hormone; CYP27B1, 25-


R2 = 0.78

Serum PTH (pmol/L)

150100500 200 250

2

4

8

6

0

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

07 )/ µ

g to

tal R

NA

10

12

14

18

R2 = 0.78

Serum PTH (pmol/L)

150100500 200 250

2

4

8

6

0

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

07 )/ µ

g to

tal R

NA

10

12

14

18

CYP

27B

1

144

5.3.3.3 CYP24 mRNA

The effects of dietary calcium and vitamin D content on CYP24 mRNA copy number

are shown in Figure 5.7. CYP24 mRNA levels in the D(-) animals were markedly

reduced when compared to the D(+) animals (p<0.001). The CYP24 mRNA levels in

the D(-)/LC animals were comparable to the D(-)/HC animals and were 8-fold lower

than levels in the (D+)/LC animals. The highest levels of CYP24 mRNA were

recorded in the D(+)/HC animals at 5.9 x105 ± 3.7 x104 copy numbers/µg total RNA,

which were 1.5-fold higher than levels in the D(+)/LC animals (p<0.01).

5.3.3.4 Relationship between serum 25D and kidney CYP24 mRNA levels

A negative correlation was found between serum 25D and CYP24 mRNA levels in

the kidney of D(+) animals (p<0.05) (Figure 5.8). The coefficient of determination of

this relationship was 0.64.

5.3.3.5 Relationship between serum 1,25D and kidney CYP24 mRNA levels

A negative correlation was found between serum 1,25D and CYP24 mRNA levels in

the kidneys of D(+) animals (p<0.05) (Figure 5.9). The coefficient of determination

for this relationship was 0.56. A negative correlation was also found between serum

1,25D and CYP24 mRNA levels in the kidneys of D(-) animals (p<0.05) (Figure

5.10). The coefficient of determination for this relationship was 0.45. No such

relationship was detected, however, when the data from all groups were combined for

analysis.

145

Figure 5.7 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) in each

dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where n =

4). *p<0.05 v D(+)/LC; # p<0.001 v D(+)/HC. D(+)/LC, vitamin D-replete fed 0.1%


0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP24, 25-


0

1

2

3

4

5

6

7

CYP

24 m

RN

A co

py n

umbe

r (x1

05 )/ µ

g to

tal R

NA


#

*

*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

1

2

3

4

5

6

7

CYP

24 m

RN

A co

py n

umbe

r (x1

05 )/ µ

g to

tal R

NA


#

*

*

0

1

2

3

4

5

6

7

CYP

24 m

RN

A co

py n

umbe

r (x1

05 )/ µ

g to

tal R

NA


#

*

*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC

146

Figure 5.8 Relationship between serum 25D (nmol/L) and kidney CYP24 mRNA

levels (copy numbers/µg total RNA) in the D(+) animals. The coefficient of

determination (R2) is shown for the line-of-best-fit. 25D, 25-hydroxyvitamin D3;

CYP24, 25-hydroxyvitamin D-24-hydroxylase; D(+), vitamin-replete.

R2 = 0.64

Seru

m 2

5D (n

mol

/L) 120

100

80

60

40

20

01 2 430


5 6 7 8

140

160

147

Figure 5.9 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA

levels (copy numbers/µg total RNA) in the D(+) animals. The coefficient of

determination (R2) is shown for the line-of-best-fit. 1,25D, 1,25-dihydroxyvitamin D3;

CYP24, 25-hydroxyvitamin D-24-hydroxylase; D(+), vitamin-replete.

0

0

0

0

0

0

0

R2 = 0.56

Seru

m 1

,25D

(pm

ol/L

)

600

500

400

300

200

100

01 2 430


5 6 7 80

0

0

0

0

0

0

R2 = 0.56

Seru

m 1

,25D

(pm

ol/L

)

600

500

400

300

200

100

01 2 430


5 6 7 8

148

Figure 5.10 Relationship between serum 1,25D (pmol/L) and kidneys CYP24 mRNA

levels (copy numbers/µg total RNA) in the D(-) animals. The coefficient of

determination (R2) is shown for the line-of-best-fit. 1,25D, 1,25-dihydroxyvitamin D3;

CYP24, 25-hydroxyvitamin D-24-hydroxylase; D(-), vitamin D-deplete.

R2 = 0.47

Seru

m 1

,25D

(pm

ol/L

)

30

25

20

15

10

5

02 4 860


10 12 14 16 18

35

R2 = 0.47

Seru

m 1

,25D

(pm

ol/L

)

30

25

20

15

10

5

02 4 860


10 12 14 16 18

35

149

5.3.3.6 Relationship between serum calcium and kidney CYP24 mRNA levels

A positive correlation was found between serum calcium and CYP24 mRNA levels in

the kidney (p<0.0001) (Figure 5.11). The coefficient of determination for this


5.3.3.7 Relationship between serum PTH and kidney CYP24 mRNA levels

A negative correlation was found between serum PTH and CYP24 mRNA levels in

the kidney (p<0.01) (Figure 5.12). The coefficient of determination for this


5.3.3.8 Relationship between serum calcitonin and kidney CYP24 mRNA

A positive correlation was found between serum calcitonin and CYP24 mRNA levels

in the kidney (p<0.0001) (Figure 5.13). The strong logarithmic relationship had a

coefficient of determination of 0.81. In a multiple linear regression, which included

serum calcitonin, calcium and PTH levels, calcitonin was the only significant

determinant of CYP24 mRNA expression levels (p<0.01) (Table 5.3).

5.3.3.9 Kidney VDR mRNA

The effects of dietary calcium and vitamin D content on the expression of VDR

mRNA in the kidney are shown in Figure 5.14. While there was a an increase in VDR

mRNA expression in the 1% calcium fed D(+) and D(-) animals, this rise did not

achieve statistical significance.

150

Figure 5.11 Relationship between serum calcium (mmol/L) and CYP24 mRNA levels


shown for the line-of-best-fit. CYP24, 25-hydroxyvitamin D-24-hydroxylase.

R2 = 0.63


2.11.91.71.5 2.3 2.5 2.7 2.9

CYP

24 m

RN

A co

py n

umbe

r (x1

05 )/ µ

g to

tal R

NA

1

2

4

3

0

5

6

7

8R2 = 0.63


2.11.91.71.5 2.3 2.5 2.7 2.9

CYP

24 m

RN

A co

py n

umbe

r (x1

05 )/ µ

g to

tal R

NA

1

2

4

3

0

5

6

7

8

151

Figure 5.12 Relationship between serum PTH (pmol/L) and CYP24 mRNA levels


shown for the line-of-best-fit. PTH, parathyroid hormone; CYP24, 25-hydroxyvitamin

D-24-hydroxylase.

R2 = 0.55

Serum PTH (pmol/L)

150100500 200 250

12

10

8

6

4

2

0

CYP

24 m

RN

A c

opy

num

ber (

x105 )

/ µg

tota

l RN

A

R2 = 0.55

Serum PTH (pmol/L)

150100500 200 250

12

10

8

6

4

2

0

CYP

24 m

RN

A c

opy

num

ber (

x105 )

/ µg

tota

l RN

A

152

Figure 5.13 Relationship between serum calcitonin (pmol/L) and CYP24 mRNA

levels (copy numbers/µg total RNA) in the kidney. The coefficient of determination

(R2) is shown for the line-of-best-fit. CYP24, 25-hydroxyvitamin D-24-hydroxylase.

R2 = 0.81

Serum Calcitonin (pmol/L)

12010080604020 1400

1

2

4

3

0

CYP2

4 m

RN

A c

opy

num

ber (

x105 )

/ µg

tota

l RN

A

5

6

7

8

R2 = 0.81


12010080604020 1400

1

2

4

3

0

CYP2

4 m

RN

A c

opy

num

ber (

x105 )

/ µg

tota

l RN

A

5

6

7

8

153

Table 5.3 Single and multiple linear regression equations for serum calcium, serum

PTH and serum calcitonin as determinants of kidney CYP24 mRNA levels.

Independent Variable Equation R2 P value

Serum Calcium CYP24 = 6.55x105 Calcium - 1.29 x106 0.57 2.0x10-4

Serum PTH CYP24 = -241.45 PTH + 3.89x105 0.39 4.2x10-3

Serum Calcitonin CYP24 = 5.28x103 Calcitonin + 1.23 x105 0.68 1.2x10-5

Serum Calcium CYP24 = + 2.37x105 Calcium NS

+ Serum PTH - 47.5 PTH NS

+ Serum Calcitonin + 3.75x103 Calcitonin - 3.71x105 0.002

Multiple R2 = 0.88

CYP24, 25-hydroxyvitamin D-24-hydroxylase; PTH, parathyroid hormone. (n = 19)

154

Figure 5.14 Expression of kidney VDR mRNA (copy numbers/µg total RNA) in each


4). D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete fed 1%

calcium; D(-)/LC, vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-deplete

fed 1% calcium; VDR, vitamin D receptor.

0

1

2

3

4

5

6

VDR

mR

NA

copy

num

ber (

x107 )

/ µg

tota

l RN

A


D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

1

2

3

4

5

6

VDR

mR

NA

copy

num

ber (

x107 )

/ µg

tota

l RN

A


D(+) / LC D(+) / HC D(-) / LC D(-) / HC

155

5.3.4 Gene expression in the bone


The effects of dietary calcium and vitamin D content on the expression of CYP27B1

mRNA in bone are shown in Figure 5.15. The CYP27B1 mRNA levels in bone were

highest in the 1% calcium fed D(+) and D(-) animals. Levels in these groups were

approximately 4-fold higher than those found in the 0.1% calcium fed D(+) and D(-)

animals (p<0.05). The CYP27B1 mRNA levels in the bone for each of the dietary

treatment groups were confirmed qualitatively by ribonuclease protection assay

(Figure 5.26).

5.3.4.2 Relationship between serum calcitonin and bone CYP27B1 mRNA

levels in D(+) animals

A positive relationship was detected between serum calcitonin and bone CYP27B1

mRNA levels in the D(+) animals (p<0.05) (Figure 5.16). The coefficient of

determination for the relationship was 0.65. No such relationship was detected in the

D(-) animals or when the data from all groups were combined for analysis.

5.3.4.3 Relationship between serum PTH and bone CYP27B1 mRNA levels

in D(-) animals

A negative relationship was found between serum PTH and bone CYP27B1 mRNA

levels in the D(-) animals (p<0.05) (Figure 5.17). The coefficient of determination for

the relationship was 0.76. No such relationship was detected in the D(+) animals. A

negative correlation was, however, detected when data from all four dietary treatment

groups were included in the analysis. The coefficient of determination for this

relationship was 0.28 (p<0.05) (data not shown).

156

Figure 5.15 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) in

each dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where

n = 4). *p<0.05 v D(+)/LC; # p<0.01 v D(-)/LC. D(+)/LC, vitamin D-replete fed 0.1%


0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP27B1, 25-


0

1

2

3

4

5

6

7

CYP

27b1

mR

NA

copy

num

ber (

x106 )

/ µg

tota

l RN

A


#

*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

1

2

3

4

5

6

7

CYP

27b1

mR

NA

copy

num

ber (

x106 )

/ µg

tota

l RN

A


#

*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC

CYP

27B

1

157

Figure 5.16 Relationship between serum calcitonin (pmol/L) and bone CYP27B1

mRNA levels (copy numbers/µg total RNA) in the D(+) animals. The coefficient of

determination (R2) is shown for the line-of-best-fit. CYP27B1, 25-hydroxyvitamin D-

1α-hydroxylase; D(+), vitamin D-replete.


12010080604020 1400

R2 = 0.65

1

2

4

3

0

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

06 )/ µ

g to

tal R

NA

5

6

7

8


12010080604020 1400

R2 = 0.65

1

2

4

3

0

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

06 )/ µ

g to

tal R

NA

5

6

7

8

CYP

27B

1

158

Figure 5.17 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA


determination (R2) is shown for the line-of-best-fit. PTH, parathyroid hormone;

CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; D(-), vitamin D-deplete.

1

2

4

3

0

CYP

27b1

mR

NA

copy

num

ber (

x106 )

/ µg

tota

l RN

A

5

6

7

8

9

Serum PTH (pmol/L)

150100500 200 250

R2 = 0.76

1

2

4

3

0

CYP

27b1

mR

NA

copy

num

ber (

x106 )

/ µg

tota

l RN

A

5

6

7

8

9

Serum PTH (pmol/L)

150100500 200 250

R2 = 0.76

CYP

27B

1

159

5.3.4.4 Relationship between serum calcium and bone CYP27B1 mRNA levels in D(-) animals

A positive logarithmic relationship was detected between serum calcium and bone

CYP27B1 mRNA levels in D(-) animals (p<0.05) (Figure 5.17). The coefficient of

determination for the relationship was 0.69. No such relationship was detected in the

D(+) animals or when the data from all groups were combined for analysis.

5.3.4.5 Relationship between BV/TV and bone CYP27B1 mRNA in D(-) animals

A positive correlation was found between bone mineral volume (BV/TV) and bone

CYP27B1 mRNA levels in the epiphysis of the D(-) animals groups (p<0.01) (Figure

5.18). The coefficient of determination for the relationship was 0.63. No such

relationship was detected in the D(+) animals or when the data from all groups were

combined for analysis. In a multiple linear regression, which included serum calcium,

PTH, and bone CYP27B1 mRNA levels, only serum calcium was found to be a

significant determinant of epiphyseal BV/TV in the D(-) animals (p<0.01) (Table 5.4).

160

Figure 5.18 Relationship between serum calcium (mmol/L) and bone CYP27B1

mRNA levels (copy numbers/µg total RNA) in the D(-) animals. The coefficient of


1α-hydroxylase; D(-), vitamin D-deplete.


2.11.91.71.5 2.3 2.5

1

2

4

3

0

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

06 )/ µ

g to

tal R

NA

5

6

7

8

9

R2 = 0.69


2.11.91.71.5 2.3 2.5

1

2

4

3

0

CYP

27b1

mR

NA

cop

y nu

mbe

r (x1

06 )/ µ

g to

tal R

NA

5

6

7

8

9

R2 = 0.69

CYP

27B

1

161

Figure 5.19 Relationship between bone CYP27B1 mRNA levels (copy numbers/µg

total RNA) and BV/TV (%) in the epiphysis of the D(-) animals. The coefficient of

determination (R2) is shown for the line-of-best-fit. BV/TV, bone volume/total

volume; D(-), vitamin D-deplete.

50

45

35

30

25

20

BV

/ TV

(%) 40

1 2 430

CYP27b1 Copy Number (x106)/ µg Total RNA

5 6 7 8 9

R2 = 0.63

50

45

35

30

25

20

BV

/ TV

(%) 40

1 2 430

CYP27b1 Copy Number (x106)/ µg Total RNA

5 6 7 8 9

R2 = 0.63

CYP27B1

162

Table 5.4 Single and multiple linear regression equations for serum calcium, serum

PTH and bone CYP27B1 mRNA levels as determinants of epiphyseal BV/TV in the

D(-) animals.

Independent Variable Equation R2 P value

serum Calcium BV/TV = 31.2 Calcium - 33.5 x106 0.74 0.0013

serum PTH BV/TV = -0.08 PTH - 41.0 0.45 0.034

bone CYP27B1 BV/TV = 2.1x10-7 bone CYP27B1 + 28.2 0.46 0.032

serum Calcium BV/TV = + 28.3 Calcium 0.002

+ serum PTH - 0.03 PTH NS

+ bone CYP27B1 - 3.3x10-7 bone CYP27B1 - 23.4 NS

Multiple R2 = 0.78

CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; PTH, parathyroid hormone;

BV/TV, bone mineral volume. (n = 10)

163

5.3.4.6 Bone CYP24 mRNA

The effects of dietary calcium and vitamin D content on the expression of CYP24

mRNA in bone are shown in Figure 5.20. CYP24 mRNA copy number levels were

highest in the 1% calcium fed D(+) and D(-) animals. The CYP24 mRNA levels in the

D(-)/LC animals were 4-fold lower than levels in the D(-)/HC animals (p<0.05) and

were comparable to levels in the D(+)/LC animals. The CYP24 mRNA levels in

D(+)/LC animals were 3-fold higher than levels in the D(+)/HC animals (p<0.05). No

effect of vitamin D status on CYP24 mRNA levels was detected in the bone.

5.3.4.7 Relationship between bone CYP27B1 and bone CYP24 mRNA

levels

A positive linear relationship was detected between CYP27B1 and CYP24 mRNA

levels in the bone (p<0.0001) (Figure 5.21). The coefficient of determination for the


5.3.4.8 Relationship between serum PTH and bone CYP24 mRNA

A negative correlation was detected between serum PTH and bone CYP24 mRNA

levels in the D(-) animals (p<0.01) (Figure 5.22). The coefficient of determination for

the relationship was 0.78. No such relationship was detected in the D(+) animals or

when the data from all groups were combined for analysis.

5.3.4.9 Bone VDR mRNA

VDR mRNA levels were increased in the 0.1% calcium fed D(+) and D(-) animals,

however these differences did not achieve statistical significance between the VDR

mRNA levels found in the different dietary treatment groups (Figure 5.23).

164

Figure 5.20 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) in each


4). * p<0.05 v D(+)/LC; # p<0.05 v D(-)/LC. D(+)/LC, vitamin D-replete fed 0.1%


0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP24, 25-


0

2

4

6

8

10

12

14

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

16

18


#

*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

2

4

6

8

10

12

14

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

16

18


#

*

D(+) / LC D(+) / HC D(-) / LC D(-) / HC

165

Figure 5.21 Relationship between bone CYP27B1 mRNA (copy numbers/µg total

RNA) and bone CYP24 mRNA (copy numbers/µg total RNA). The coefficient of


1α-hydroxylase; CYP24, 25-hydroxyvitamin D-24-hydroxylase.

R2 = 0.8525

20

15

10

5

0

CYP

24 m

RN

A co

py n

umbe

r (x1

04 )/ µ

g to

tal R

NA

1 2 430


5 6 7 8 9

R2 = 0.8525

20

15

10

5

0

CYP

24 m

RN

A co

py n

umbe

r (x1

04 )/ µ

g to

tal R

NA

1 2 430


5 6 7 8 9

CYP27B1

166

Figure 5.22 Relationship between serum PTH (pmol/L) and bone CYP24 mRNA


determination (R2) is shown for the line-of-best-fit. PTH, parathyroid hormone;

CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; D(-), vitamin D-deplete.

Serum PTH (pmol/L)

150100500 200 250

25

20

15

10

5

0

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

R2 = 0.78

Serum PTH (pmol/L)

150100500 200 250

25

20

15

10

5

0

CYP

24 m

RN

A c

opy

num

ber (

x104 )

/ µg

tota

l RN

A

R2 = 0.78

167

Figure 5.23 Expression of bone VDR mRNA (copy numbers/µg total RNA) in each


4). D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete fed 1%

calcium; D(-)/LC, vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-deplete

fed 1% calcium; VDR, vitamin D receptor.

0

5

5

5

5

6

6

6

6

VDR

mR

NA

copy

num

ber (

x105 )

/ µg

tota

l RN

A

0

2

4

6

8

10

12

14

16


D(+) / LC D(+) / HC D(-) / LC D(-) / HC0

5

5

5

5

6

6

6

6

VDR

mR

NA

copy

num

ber (

x105 )

/ µg

tota

l RN

A

0

2

4

6

8

10

12

14

16


D(+) / LC D(+) / HC D(-) / LC D(-) / HC

168

5.3.4.10 Relationship between serum calcium and bone VDR mRNA levels

A negative relationship was found between serum calcium and bone VDR mRNA

levels when data from all treatment groups were combined (p<0.05) (Figure 5.24).

The coefficient of determination for the relationship is 0.28. This negative correlation

was also detected in the D(-) animals alone (p<0.05), which had a coefficient of

determination of 0.45 (data not shown). No such relationship was detected in the D(+)

animals alone. Thus the levels of VDR mRNA in the bone are increased in

hypocalcemic animals.

5.3.4.11 Relationship between serum PTH and bone VDR mRNA levels

A positive relationship was found between serum PTH levels and bone VDR mRNA

levels in the D(+) animals (Figure 5.25). The coefficient of determination for the

relationship was 0.56. No such relationship was detected in the D(-) animals or when

the data from all groups were combined for analysis.

5.3.5 Assessment of CYP27B1 mRNA levels in kidney and bone by

ribonuclease protection assay

The semi-quantitative analysis of CYP27B1 mRNA levels by ribonuclease protection

assay is shown in Figure 5.26. CYP27B1 and GAPDH mRNA were detected in both

kidney and bone total RNA, isolated from animals from each of the dietary treatment

groups (n = 3). In the kidney, CYP27B1 mRNA levels were highest in the D(-)/LC

animals. In the bone, CYP27B1 mRNA expression appeared higher in the D(+) and

D(-) animals fed the 1% calcium diets when compared to the D(+) and D(-) animals

fed the 0.1% calcium diets.

169

Figure 5.24 Relationship between serum calcium (mmol/L) and VDR mRNA levels

(copy numbers/µg total RNA) in the bone. The coefficient of determination (R2) is

shown for the line-of-best-fit. VDR, vitamin D receptor.

R2 = 0.37


2.11.91.71.5 2.3 2.5 2.7 2.9

VDR

mR

Na

copy

num

ber (

x106 )

/ µg

tota

l RN

A

1

2

4

3

0

5

6

R2 = 0.37


2.11.91.71.5 2.3 2.5 2.7 2.9

VDR

mR

Na

copy

num

ber (

x106 )

/ µg

tota

l RN

A

1

2

4

3

0

5

6

170

Figure 5.25 Relationship between serum PTH (pmol/L) and bone VDR mRNA levels

(copy numbers/µg total RNA) in the D(+) animals. The coefficient of determination

(R2) is shown for the line-of-best-fit. VDR, vitamin D receptor; D(+), vitamin D-

replete.

Serum PTH (pmol/L)

151050 20 25 30 35

5

10

20

15

0

VDR

mR

NA

copy

num

ber (

x106 )

/ µg

tota

l RN

A

25

30

35

R2 = 0.56

Serum PTH (pmol/L)

151050 20 25 30 35

5

10

20

15

0

VDR

mR

NA

copy

num

ber (

x106 )

/ µg

tota

l RN

A

25

30

35

R2 = 0.56

171

Figure 5.26 Ribonuclea se protection assay for CYP27B1 mRNA detected in total

RNA isolated from kidney (A) and bone (B) tissue from each dietary treatment group

(n = 3). D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete

fed 1% calcium; D(-)/LC, vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-

deplete fed 1% calcium; CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; GAPDH,

glyceraldehyde-3-phosphate dehydrogenase.

CYP27b1

GAPDH

D(+)/LC D(+)/HC D(-)/LC D(-)/HC

CYP27b1

GAPDH

D(+)/LC D(+)/HC D(-)/LC D(-)/HC

A

B

CYP27b1

GAPDH

D(+)/LC D(+)/HC D(-)/LC D(-)/HC

CYP27b1

GAPDH

D(+)/LC D(+)/HC D(-)/LC D(-)/HC

A

B

CYP27B1

CYP27B1

172

5.4 Discussion

5.4.1 Determinants of serum calcium levels

The negative correlation between serum calcium and serum PTH levels is consistent

with the physiological role of PTH to maintain of circulating serum calcium levels. In

response to hypocalcaemia, the parathyroid glands react rapidly to secrete PTH. PTH

then initiates a sequence of events, which involve 1,25D synthesis and 1,25D-

stimulated intestinal calcium absorption to normalise calcium concentrations in the

circulation.

Converse to the negative relationship between serum calcium and serum PTH levels,

serum calcium levels were positively correlated with serum calcitonin levels. In

response to hypercalcaemia, calcitonin is secreted from parafollicular cells of the

thyroid gland to lower serum calcium. The primary action of calcitonin is to inhibit

skeletal calcium resorption by suppressing osteoclastic activity, reducing of calcium

mobilisation into to the circulation and ultimately reduces the levels of serum calcium.

In a multiple linear regression analysis, both serum PTH and serum calcitonin

hormones contribute to the regulation of serum calcium levels, suggesting that there is

a complex regulatory mechanism of serum calcium levels, which involves PTH and

calcitonin during periods of hypocalcemia and hypercalcemia.

5.4.2 Determinants of serum 1,25D levels

The synthesis of 1,25D and catabolism of 25D and 1,25D in the kidney determines the

concentration of 1,25D in the circulation (Armbrecht & Boltz 1991; Armbrecht et al

1997(a); Eto et al 1998; Zehnder et al 1999). In the D(-) animals, the marked

reduction in 25D levels, from the vitamin D-deficient diet and housing in a UV-free

173

environment, was the primary reason for the reduced serum 1,25D levels. The

negative correlation between kidney CYP24 mRNA and serum 1,25D levels in the

D(-) animals, however, suggests that serum 1,25D levels are modulated by CYP24,

even when the vitamin D levels are depleted. Furthermore, a negative correlation

between serum 1,25D and kidney CYP24 mRNA was detected in D(+) animals. These

data are consistent with a model that when dietary calcium levels are high, obviating

the requirement for 1,25D-mediated intestinal calcium absorption, 1,25D levels are

reduced as a result of increased gene expression of kidney CYP24, which also has the

effect of reducing serum 25D levels.

While no statistically positive relationship was detected between kidney CYP27B1

mRNA and serum 1,25D levels, it is possible that modulation of the expression of

renal CYP27B1 mRNA in the D(+) animals plays a role in determining serum 1,25D

levels. In the D(+)/LC animals, CYP27B1 mRNA levels were slightly increased,

although not significantly (p= 0.07), when compared to the levels detected in the

D(+)/HC animals. This increase was associated with a marked increase in serum

1,25D levels. In a multiple linear regression analysis including both kidney CYP27B1

mRNA and kidney CYP24 mRNA levels, accounted for a greater proportion of the

variation in the serum 1,25D levels, than when the analysis was restricted to CYP24

mRNA levels alone. These data suggest that the regulation of both kidney CYP24 and

kidney CYP27B1 contribute to the regulation of serum 1,25D levels. CYP24

expression, however, appears to be a more important factor when dietary calcium

levels are varied between 0.1% and 1%, as studied in this experiment.

174

5.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA

5.4.3.1 Determinants of CYP27B1 mRNA levels

The biosynthesis of 1,25D by the renal CYP27B1 enzyme is required for the

stimulation of intestinal calcium absorption and renal calcium reabsorption.

Reflecting this role for 1,25D, the activity of CYP27B1 is tightly regulated by a

number of factors including calcium, phosphate, PTH, calcitonin and 1,25D itself. In a

multiple linear regression, however, which included all these factors, only PTH was

found to be a significant determinant of CYP27B1 mRNA levels in the kidney,

particularly as a result of the high PTH levels, which occurred in the hypocalcemic

D(−)/LC animals. These studies did not find that a significant relationship between

PTH and kidney CYP27B1 mRNA levels in animals that were normocalcemic.

Numerous studies have shown, both in in vitro and in vivo experiments, that PTH is a

most potent stimulator of renal CYP27B1 mRNA expression and enzyme activity

especially when pharmacological levels of PTH are used (Frolich et al 1990; Welsh et

al 1991; Brenza et al 1998; Murayama et al 1998; Murayama et al 1999; Yang et al

1999; Brenza and DeLuca 2000). It would appear, however, that the variation in

serum PTH levels between 2 and 30 pmol/L is not associated with significant

stimulation of kidney CYP27B1 mRNA in normocalcemic animals.

While it has been shown that exogenous administration of 1,25D to animals can

inhibit the in vivo expression of kidney CYP27B1 mRNA (Brenza and DeLuca 2000),

these data suggest that, under normal physiological circumstances, 1,25D is not a

major determinant of CYP27B1 mRNA expression in the kidney. Kidney CYP27B1

mRNA expression was not induced in D(-)/HC animals, despite a marked reduction in

serum 1,25D levels. This finding is in contrast with the study of Fox et al (1991) who

175

showed that renal cortical slices taken from vitamin D-deficient animals fed a 2%

calcium diet, showed a 17-fold increased CYP27B1 activity when compared with

activity detected in renal cortical slices taken from normal animals fed 0.8% calcium.

They concluded that absence of 1,25D-mediated enzyme inhibition is a strong

stimulus of CYP27B1 activity, which is independent of the effects of PTH, calcium

and phosphate. The discrepancy between the result reported here and those of Fox et

al are unclear. It is possible, however, that in the Fox et al study, an increase in 1,25D

levels detected in renal cortical slices of vitamin D-deficient animals fed 2% calcium,

may not be due to increased CYP27B1 activity, but instead to a reduced clearance of

1,25D as a result of decreased CYP24 activity.

The suppression of the CYP27B1 mRNA expression in the D(+)/HC animals by the

1% calcium diet, despite vitamin D-depletion, is consistent with previous studies,

using parathyroidectomised, PTH-replete rats. In these animals, it has been shown that

elevated calcium levels are able to directly inhibit circulating levels of 1,25D

(Matsumoto et al 1987; Weisinger et al 1989). Bland et al (1999) was also able to

show that in human proximal tubule cell line, HKC-8, a treatment with a medium

containing a high calcium level significantly inhibited 1,25D production. In this study,

calcium was suggested to directly affect CYP27B1 activity, through the calcium-

sensing receptor (CaR), which is present in all segments of the nephron. While no

correlation was found between serum calcium and kidney CYP27B1 mRNA levels in

the current study, it is possible that the normal serum calcium levels in the D(-)/HC

animals was able to directly inhibit CYP27B1 mRNA expression in the kidney.

176

5.4.3.2 Determinants of CYP24 mRNA levels

The catabolic enzyme CYP24 has been shown to be induced by 1,25D and suppressed

in the absence of 1,25D (Tanaka and DeLuca 1974; Tanaka et al 1975; Tanaka et al

1977; Kumar et al 1978). The negative correlations found between CYP24 mRNA

levels in the kidney and serum 1,25D levels indicate, however, that the expression of

CYP24 mRNA and therefore enzyme activity is a major determinant of serum 1,25D

levels. The expression of CYP24 mRNA is consistent with the biological role of

CYP24 in the deactivation of 1,25D and in the limitation of the biological effect of

1,25D. The positive correlation between serum calcium and the expression of CYP24

mRNA in the kidney suggest that a high calcium diet, which reduces the requirement

for 1,25D-mediated intestinal calcium, causes an increase in CYP24 activity to reduce

serum 1,25D levels.

The positive correlation between serum calcium and kidney CYP24 mRNA levels is

consistent with findings from Spanos et al (1981). They showed a significant

stimulation of CYP24 activity in isolated chick renal tubules, incubated in the

presence of a high calcium concentration. Previous studies have shown a direct

regulation of the renal vitamin D metabolism by calcium. This was, however,

suggested to be due to a calcium-mediated increase in CYP27B1 activity (Matsumoto

et al 1987; Weisinger et al 1989; Bland et al 1999). The positive correlation between

serum calcium and kidney CYP24 mRNA levels suggests that if calcium is directly

involved in the renal vitamin D metabolism, it acts through stimulation of vitamin D

breakdown, rather than of vitamin D synthesis.

177

The negative correlation between serum PTH and CYP24 mRNA levels is consistent

with findings from several researchers, which have shown that PTH suppresses

CYP24 activity (Tanaka et al 1975; Shigematsu et al 1986; Henry 1992; Henry et al

1992; Shinki et al 1992; Armbrecht et al 1998). The PTH-mediated suppression of the

CYP24 mRNA expression in the kidney occurs via the cAMP signal transduction

pathway (Shigematsu et al 1986; Shinki et al 1992; Zierold et al 2000). The precise

mechanism by which PTH down-regulates the CYP24 mRNA, however, remains

unclear. This is partly due to the tissue- and cell-specific effect of PTH on CYP24

mRNA expression. For example, while a PTH-mediated suppression of CYP24

transcription has been found in renal proximal tubule cells, the addition of 1,25D and

cAMP together in renal distal tubule cells acts synergistically to induced CYP24

mRNA expression (Yang et al 1999).

Of considerable interest is the strong positive relationship between serum calcitonin

and CYP24 mRNA levels. In a multiple linear regression including levels of serum

calcitonin, calcium and PTH, only calcitonin significantly contributed to the

regulation of CYP24 mRNA expression, which is consistent with the positive

relationship between CYP24 expression and serum calcitonin levels described in

Chapter 4. This, to our knowledge, is the first published report of the regulation of

kidney CYP24 mRNA by serum calcitonin. Recently, in vitro studies have shown that

calcitonin up-regulates CYP24 promoter activity in the human kidney cell line, AOK-

B50 (unpublished data, Gao and May). Thus, in addition to inhibiting bone resorption,

calcitonin may reduce the levels of serum calcium by reducing circulating 1,25D

levels, through the renal catabolism of 1,25D by CYP24. Further investigation of the

178

effects of calcitonin on kidney CYP24 mRNA expression would be required to

substantiate this theory.

5.4.3.3 Determinants of VDR mRNA levels

Although the expression of VDR mRNA appears to be regulated by dietary calcium

and vitamin D, no statistically significant relationship between these factors and the

expression levels of VDR mRNA could be detected in this study. Previous studies

have, however, shown regulation in VDR mRNA expression by 1,25D and calcium.

Zineb et al (1998) showed a reduction in rat kidney VDR mRNA during vitamin D-

deficiency. Goff et al (1990) showed a decrease in kidney VDR protein levels of 35%

in rats fed a 0.02% calcium diet when compared to protein levels from animals fed a

calcium-replete diet, even though serum 1,25D levels were increased in the calcium

restricted animals. These studies are consistent with the current study in that the

lowest expression level of VDR mRNA in the kidney was found in the D(-)/LC

animals. The reasons for the reduction in VDR mRNA levels, associated with low

levels of dietary calcium are unclear. Recently, however, Beckman and DeLuca

(2002) found that the down regulation of VDR protein levels in the kidney during

hypocalcemia blocks the 1,25D-mediated suppression of CYP27B1 gene expression,

and therefore allows for unabated renal production of 1,25D. Further investigation of

the regulation of VDR mRNA expression by dietary calcium and vitamin D, is needed

to understand the complex mechanisms that regulate of VDR mRNA expression in the

kidney.

179

5.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA

5.4.4.1 Determinants of CYP27B1 mRNA levels

This is the first report that describes the in vivo regulation of CYP27B1 mRNA

expression by dietary calcium in the bone. While, bone CYP27B1 mRNA levels were

4-fold higher in 1% calcium fed animals when compared to the levels in the 0.1%

calcium fed animals, the mechanisms that regulate CYP27B1 mRNA in the bone

appear to be more complex than simply the effect of dietary calcium load. The change

in dietary calcium and vitamin D levels between the animal treatment groups have

profound effects on the concentrations of serum calcium, 1,25D, PTH and calcitonin,

and it appears that these factors interact to regulate the expression of bone CYP27B1

mRNA.

In the D(-) animals, a negative correlation was detected between serum PTH and bone

CYP27B1 mRNA levels, which is suggestive of an inhibitory role of PTH in the

regulation of bone CYP27B1 mRNA expression. This is in direct contrast with the

well-described, potent stimulatory effect of PTH on kidney CYP27B1 transcriptional

activity (Henry et al 1974; Henry 1982; Brenza et al 1998; Murayama et al 1998).

Although the down-regulation of the CYP27B1 mRNA expression in bone by PTH

has not been described before, PTH has been shown not to have an effect on the

expression of CYP27B1 mRNA in non-renal tissues (Reichel et al 1987(a)) as is

discussed in detail in Chapter 4. CYP27B1 mRNA expression in bone cells could be,

in a similar way, unresponsive to PTH.

In addition to the association with PTH, bone CYP27B1 mRNA levels were positively

correlated with serum calcium levels in the D(-) animals. The suggestion that the

180

circulating serum calcium levels could directly stimulate CYP27B1 mRNA

expression in the bone is possible since the CaR has been shown to be expressed on a

number of bone cell types including, bone marrow precursor cells, progenitor cells,

osteoblasts and pre-osteoblast cells (House et al 1997; Yamaguchi et al 1998(a);

Yamaguchi et al 1998(b); Yamaguchi et al 1998(c); Yamaguchi et al 1998(d);

Yamaguchi et al 2001). While the direct effect of calcium on the expression of

CYP27B1 mRNA expression in the kidney has previously been shown (Matsumoto et

al 1987; Weisinger et al 1989; Bland et al 1999), an effect of calcium on the

expression of bone CYP27B1 mRNA has not yet been reported. Further investigation

in the effects of serum calcium, as well as PTH, on a number of bone cell types would

be valuable to delineate the relative importance of these two factors in the regulation

of the expression of CYP27B1 mRNA in the bone during vitamin D-depletion. While

there was no correlation between serum calcium and PTH in the D(+) animals, the

relative importance of these factors during vitamin D-repletion cannot be discounted.

It is likely that any association between serum calcium and CYP27B1 in the bone, for

example, would be masked by the tight regulation of serum calcium levels.

In the D(+) animals, a positive correlation was found between the serum calcitonin

and CYP27B1 mRNA in the bone. While a calcitonin-mediated stimulation of

CYP27B1 mRNA expression in the bone has not been previously reported, the

hormone has been shown to stimulate CYP27B1 mRNA expression in the kidney

(Murayama et al 1998; Murayama et al 1999; Shinki et al 1999; Yoshida et al 1999).

Interestingly, Shinki et al (1999) showed a calcitonin-mediated regulation of the

expression of CYP27B1 mRNA in the kidney, which occurred only during

normocalcemia. This is consistent with the finding that the positive correlation

181

between the serum calcitonin levels and bone CYP27B1 mRNA levels was only

detectable in normocalcemic animals. The well-established role for calcitonin in the

bone is to act via the calcitonin receptor (CTR) in osteoclasts to inhibit bone

resorption activity. For calcitonin to have an effect on CYP27B1 mRNA expression in

the bone, it may therefore occur through the osteoclasts (Sexton et al 1999; Pondel

2000), as no other bone cells have been found to express the CTR. Such a link

between calcitonin, osteoclasts and CYP27B1 mRNA expression requires further

investigation.

While no clear correlation was detected between serum 1,25D and bone CYP27B1

mRNA levels, the role of serum 1,25D in the regulation of CYP27B1 mRNA

expression in the bone cannot be discounted. When serum 1,25D levels were high in

D(+)/LC animals, bone CYP27B1 mRNA expression was low and, conversely, when

serum 1,25D levels were low in D(+)/HC animals, bone CYP27B1 mRNA expression

was high. A 1,25D-mediated inhibition of bone CYP27B1 mRNA expression is

feasible, since 1,25D has been shown to down-regulate the expression and activity of

kidney CYP27B1 mRNA in process that is not fully understood (Rosenthal et al 1980;

Tanaka & DeLuca 1984; Takeyama et al 1997; Brenza & DeLuca 2000). Brenza and

DeLuca (2000) believe that the down regulation of CYP27B1 mRNA expression is

indirect, since they could not demonstrate a 1,25D-mediated suppression of CYP27B1

promoter activity in AOK-B50 kidney cells, but did show a 1,25D-mediated

suppression of kidney CYP27B1 mRNA in vivo. A more direct effect of 1,25D on

CYP27B1 mRNA expression, however, has been proposed by Takeyama and

colleagues (1997) and Kato (2000), who have identified a putative negative vitamin D

response element (nVDRE) on the promoter of the human CYP27B1 gene. While the

182

down-regulation of CYP27B1 transcriptional activity by 1,25D requires the VDR, the

exact mechanism by which 1,25D interacts with the nVDRE is yet to determined.

The expression of CYP27B1 mRNA in the bone is likely to be controlled by more

than one physiological factor. The findings from the current study suggest that the

control of the expression of CYP27B1 mRNA in bone during vitamin D-repletion is

different from that during vitamin D-depletion. When the D(+) animals were fed the

1% calcium diet, the expression of CYP27B1 mRNA in the bone is increased. The

increase in the expression of CYP27B1 mRNA in the bone is either due to a

calcitonin-mediated stimulation of the CYP27B1 mRNA expression or an absence of

the 1,25D-mediated suppression of CYP27B1 mRNA expression. Whatever the direct

mechanism of control may involve, the suggestion is that when the serum levels of

1,25D are low, due to the reduced requirement for 1,25D-mediated calcium

absorption, the production of 1,25D in the bone is up-regulated to compensate for the

fall in circulating 1,25D levels. During vitamin D-depletion, however, the expression

of CYP27B1 mRNA is increased when serum calcium levels are increased as a result

of the 1% calcium diet. This increase in the expression of CYP27B1 mRNA in the

bone is either due to a calcium-mediated stimulation of the CYP27B1 mRNA

expression, or to a previously undescribed PTH-mediated inhibition of the CYP27B1

mRNA expression. When the findings from the D(+) and D(-) animals are taken

together, it appears that an increase in CYP27B1-mediated 1,25D synthesis in the

bone takes place when serum 1,25D levels are low, providing that serum calcium

levels are normal. The local production of 1,25D in the bone may occur so that

processes in the bone, which require calcium can function normally, such as during

bone cell mineralisation.

183

There is evidence that supports the suggestion that 1,25D synthesised in the bone is

involved in the mineralisation process. In the D(-) animals, a positive relationship was

detected between the expression of CYP27B1 mRNA in the bone and the bone

mineral volume (BV/TV) in the epiphyseal region of the femur. This association was

the result of the positive correlation of CYP27B1 mRNA expression with both

trabecular number and trabecular thickness in this region (data not shown). This

suggests that if locally produced 1,25D is involved in increasing the net bone

formation during systemic vitamin D-depletion, it does so by increasing the thickness

and the number of trabeculae. In addition, despite the absence of the renal supply of

1,25D, the high expression of CYP27B1 mRNA in the D(-)/HC was associated with a

reduction in osteoid levels when compared to levels in the D(-)/LC animals,

suggesting further that locally produced 1,25D may promote bone mineralisation.

This finding is consistent with the positive correlation between bone CYP27B1

mRNA and serum calcium levels found in Chapter 4. Although this hypothesis seems

possible, a degree of caution should be taken, since serum calcium was found in a

multiple linear regression to be a significant determinant of BV/TV in the epiphysis.

Serum calcium has been found to directly stimulate bone mineralisation in

chondrogenic cells and increase the expression of several markers of cell

differentiation (Chang et al 2002). Serum calcium also affects the levels of serum

PTH levels, which has its own biological effect on bone mineralisation (Rader et al

1979; McSheehy & Chambers 1986; Toromanoff et al 1997; Swarthout et al 2002).

Nonetheless, a physiological mechanism, involving locally produced 1,25D, is

plausible and has significant implications in our understanding of the regulation of

bone mineralisation, particularly during vitamin D-depletion.

184

5.4.4.2 Determinants of CYP24 mRNA levels

Dietary calcium levels regulate the expression of CYP24 mRNA in the bone. The

expression of CYP24 mRNA is highest in the animals fed the 1% calcium diet,

irrespective of the vitamin D-load in their diet. A strong positive relationship was

detected between CYP27B1 and CYP24 mRNA levels in the bone, suggesting that the

locally produced 1,25D is the major determinant of the expression of CYP24 mRNA

in the bone. Consistent with these findings, Reichel et al (1987(d)) showed an increase

in the enzyme activity of both CYP27B1 and CYP24 in response to the addition of

25D to bone marrow macrophage cells. The increase in CYP24 activity occurred after

the rise in CYP27B1 activity, suggesting that CYP24 serves to catabolise the locally

produced 1,25D. Furthermore, 1,25D administration to rats was shown to increase the

expression of CYP24 mRNA in osteoblasts and cause a 4-fold increase in the enzyme

activity of CYP24 in isolated rat calvaria (Nishimura et al 1994). The fact that no

correlation was found between bone CYP24 mRNA and serum 1,25D levels in the

current study, further suggests that the CYP24 present in the bone responds to levels

of locally produced 1,25D rather than to the circulating levels of 1,25D.

The CYP24 mRNA levels in the bone were found to be negatively correlated with the

serum PTH levels in the D(-) animals. This is in contrast to stimulatory effect of PTH

on the expression of CYP24 mRNA shown in rat osteoblasts. Armbrecht and co-

workers (1994, 1996, 1998) showed that the 1,25D-mediated stimulation of the

expression of CYP24 mRNA in the osteoblast-like cells was synergistically increased

by the administration of PTH. The synergistic effect of PTH on CYP24 in osteoblasts

was, however, shown only in the presence of 1,25D. This point may explain the

difference in the findings of Armbrecht et al and that of the current study, since the

185

negatively correlation between PTH and CYP24 was only detected in the D(-) animals

when circulating 1,25D levels are low. Further study is, however, required to

elucidate the exact role of PTH in the regulation of the expression of CYP24 mRNA

in the bone.

5.4.4.3 Determinants of VDR mRNA levels

No statistically significant effect between dietary calcium and vitamin D levels and

the levels of VDR mRNA in the bone could be detected in any of the four treatment

groups. Thus, the regulation of the expression of VDR mRNA in bone remains

unclear. In the vitamin D-replete animals, the serum PTH levels were positively

correlated with the levels of VDR mRNA in the bone. A PTH-mediated stimulation of

the expression of VDR mRNA has been shown in several cell culture studies. The

expression of VDR mRNA was shown to be up-regulated by PTH, via cAMP, in both

growth plate chondrocytes and UMR-106 cells (van Leeuwen et al 1992; Klaus et al

1994; Krishnan et al 1995). There is no clear explanation for the lack of correlation

between serum PTH and bone VDR mRNA in the D(-) animals. This may be due to

the hypocalcemia in the D(-) animals fed 0.1% calcium diet. A negative correlation

was detected between serum calcium levels and expression levels of VDR mRNA in

the bone. It may be possible that calcium, together with PTH, can regulate the

expression of VDR mRNA in the bone and ultimately the vitamin D-responsiveness

of bone cells to 1,25D.

5.4.5 Comparisons of the kidney and bone vitamin D endocrine

systems

This study clearly demonstrated that the expression pattern of CYP27B1, CYP24 and

VDR mRNA was different in the bone from the pattern detected in the kidney. The

186

difference in the expression pattern of CYP27B1 mRNA between the kidney and bone

has been previously shown. Panda et al (2001(a)) showed, by qualitative assessment

of PCR products, that the expression of CYP27B1 mRNA was higher in bone of

foetal rats than in bone of adult rats. In contrast, they also showed that the expression

of CYP27B1 mRNA was higher in the kidney from adult rats than in the kidney from

foetal rats. This study is the first to quantify the differences in the regulation of the

expression of CYP27B1 mRNA found between kidney and bone tissue.

A partial explanation for the differences in the regulation of CYP27B1 mRNA

expression detected between the kidney and bone may come from the difference in

signalling pathways that are involved in the regulation of CYP27B1 mRNA

expression by different physiological factors. PTH predominantly stimulates the

expression of kidney CYP27B1 and the synthesis of 1,25D through a cAMP/protein

kinase A (PKA)-dependent pathway (Murayama et al 1999). PTH can, however, also

activate the protein kinase C (PKC) pathway (Janulis et al 1992) and activation of this

pathway has been shown to result in inhibition of the renal synthesis of 1,25D (Henry

1986; Henry and Luntao 1989; Mandla et al 1990; Welsh et al 1991). The PTH-

mediated PKA-signalling pathway predominates over the PKC-signalling pathway in

the kidney, which results in CYP27B1 mRNA expression and 1,25D synthesis

(Janulis et al 1992; Swarthout et al 2002). It is possible that in bone tissue, the PTH-

mediated PKC pathway is dominant over the PKA pathway, PKA pathway non-

responsiveness of CYP27B1 to the PKA pathway.

In the kidney, CYP27B1 and CYP24 mRNA expression are reciprocally regulated to

modulate the circulating levels of 1,25D. In the bone, CYP27B1 and CYP24 mRNA

187

levels were increased when circulating levels of 1,25D were low, provided that levels

of serum calcium were normal. In the kidney, a slight increase in the expression of

CYP27B1 mRNA and more pronounced decrease in CYP24 mRNA expression that

was detected in the D(+)/LC animals resulted in a marked increase in the levels of

serum 1,25D. In the bone, however, a reduction in the expression of CYP27B1

mRNA was detected in the D(+)/LC animals. The negative correlation detected

between the serum levels of 1,25D and the expression of CYP27B1 mRNA in the

bone suggests that the activation of CYP27B1 mRNA expression in the bone is only

required when the circulating levels of 1,25D are low. The expression of CYP24

mRNA in the bone, however, appears to be unresponsive to changes in circulating

levels of 1,25D. The coupling of the expression of CYP27B1 and CYP24 mRNA in

the bone suggests that the primary role of CYP24 in the bone is to catabolise the

locally produced 1,25D. This also suggests that the 1,25D synthesised in the bone is

more important for the continuation of 1,25D-dependant processes in the bone, than

the 1,25D that is produced in the kidney.

In the D(-)/LC animals, the kidney is unable to synthesise sufficient 1,25D to restore

circulating levels of calcium, due to the low levels of the substrate, 25D. This need for

the kidney to up-regulate the synthesis of 1,25D was reflected in the drastic increase

in kidney CYP27B1 mRNA levels and in the marked reduction in CYP24 mRNA. In

the D(+)/HC animals, however, the expression levels of kidney CYP27B1 were

reduced to levels comparable with the D(+) animals, presumably because the dietary

calcium levels were sufficient to maintain eucalcemia without the need for 1,25D-

mediated calcium absorption. The pattern of expression of CYP27B1 mRNA in the

bone in the D(-) animals was opposite to that in the kidney. The low expression of

188

CYP27B1 mRNA detected in the bones of the D(-)/LC animals may be due directly to

the hypocalcemia that was found in these animals. Supporting this hypothesis is the

positive correlation found between serum calcium and the levels of CYP27B1 mRNA

in the bone of the D(-) animals, suggesting that calcium may be able to directly

stimulate the synthesis of 1,25D in the bone. Interestingly, the expression of CYP24

mRNA and the expression of CYP27B1 mRNA were also coupled in the bones of the

D(-) animals, suggesting that even under these conditions, locally produced 1,25D is

sufficient to maintain the 1,25D-mediated processes in the bone, despite the low

circulating levels of 25D and 1,25D found in these animals. The apparent

unresponsiveness of CYP27B1 in the bone to vitamin D-depletion, under the

condition that circulating calcium levels are normal, may explain why, during vitamin

D deficiency, the intake of a high calcium diet alone is able to maintain a normal

mineralised skeleton (Pettifor et al 1984; Clark et al 1987; Schaafsma et al 1987).

5.4.6 Summary

This study is the first to demonstrate the difference in regulation of CYP27B1, CYP24

and VDR mRNA expression by calcium and vitamin D, between kidney and the bone.

The difference in the regulation of the expression of these genes can be explained, in

part, by the difference in the associations between these genes and the biochemical

factors that regulate their expression between the two tissues. For example, PTH

potently stimulates the expression of CYP27B1 mRNA in the kidney, but it

apparently is not involved in the transcriptional activation of CYP27B1 in the bone.

The reasons for the tissue-specific effects of PTH and other factors on the expression

of CYP27B1, CYP24 and VDR mRNA are not clear. They may, however, be due to

the different signal transduction pathways that are activated in kidney and bone cells.

189

While the different mechanisms that control gene expression of CYP27B1, CYP24

and VDR are unknown in the kidney and bone, the differences in the regulation of the

these genes are likely to reflect the different physiological roles of vitamin D in these

tissues. In the kidney, the reciprocal regulation of CYP27B1 and CYP24 mRNA

expression ensures that appropriate 1,25D is supplied for 1,25D-mediated intestinal

calcium absorption and other calcium homeostatic mechanisms. In the bone, however,

the strong coupling of CYP27B1 and CYP24 mRNA expression suggest that locally

produced 1,25D acts in an autocrine or paracrine manner for the initiation of 1,25D-

dependant processes. While the role for the kidney supplying 1,25D to the bone for

these processes remains probable, it appears that the role for 1,25D synthesis in the

bone is to compensate for when the kidney production of 1,25D is reduced. Having

said this, the coupling of the expression of CYP27B1 and CYP24 mRNA in the bone

clearly shows the production of 1,25D in the bone is primary determinant of CYP24

activity. This suggests that the autocrine or paracrine function of 1,25D is significant

and must be regulated over the circulating levels of 1,25D by its catabolism. When the

renal production of 1,25D was low, the positive correlation between CYP27B1

mRNA and serum calcium levels, which was also associated with bone volume in the

epiphysis and reduction of osteoid in the metaphysis, suggests that an increase of

locally produced 1,25D may be involved in promoting bone mineralisation. This

possibility has important consequence for the role of 1,25D in the bone and our

understanding of process of mineralisation during vitamin D-depletion.

190

Chapter 6: Identification of the bone cell types with

the capacity to metabolise vitamin D

6.1 Introduction

CYP27B1 enzyme activity was first identified in bone cells over 20 years ago. Turner

and co-workers (1980) detected that cultured bone cells from rat calvariae were able

to synthesise 1,25D from 25D. They also showed that, when these cells were

incubated with 1,25D, the activity of CYP24 in these cells was markedly induced.

Reichel and co-workers (1987) identified CYP27B1 and CYP24 enzyme activity in

bone marrow macrophage cell cultures. They showed that the induction of the 1,25D

production in these cells was followed by a subsequent induction of the activity of

CYP24 in the same cells. No further research was reported on the expression of

CYP27B1 in bone cells until 1999 when the Panda and co-workers detected

CYP27B1 mRNA expression in femoral sections of foetal mice. In this study

CYP27B1 mRNA was identified in chondrocytes of the growth plate and in

osteoblasts associated with trabeculae. Little further research has been conducted,

however, on the identification of the specific bone cell types that express CYP27B1

and the relationship between the expression of CYP27B1, CYP24 and VDR mRNA in

bone cells.

The experiments in this study were based on the hypothesis that CYP27B1, CYP24

and VDR mRNA was expressed in osteoblasts and in a number of cells from the bone

marrow. The present study investigated the expression of CYP27B1, CYP24 and

VDR mRNA in specific regions of the rat femora, with the aim to identify the specific

191

zones of the femur that have the ability to metabolise vitamin D. In situ hybridisation

was used to identify the specific cell types in the rat femur that are able to synthesise

1,25D. To investigate the in vitro expression of CYP27B1, CYP24 and VDR mRNA,

two rat clonal osteosarcoma cell lines, UMR 106-06 and UMR 201-10B, as well as

primary rat bone cell cultures were used. The UMR cell lines, which are similar in

function to osteoblasts, have been "arrested" at a particular stage of differentiation and

have been characterised in terms of their expression of genes that are involved in the

regulation of osteoblastic function (Forrest et al 1985; Zhou et al 1991; Choong et al

1993). Although UMR 106 cells are not fully differentiated, they can be induced to

mineralise in vitro (Stanford et al 1995). The less mature UMR 201 cells are

preosteoblastic cells and cannot be induced to mineralise in vitro (Zhou et al 1991).

The investigation of the expression of CYP27B1, CYP24 and VDR mRNA in these

cells will be helpful in determining the role for these genes in the regulation of

osteoblastic function.

6.2 Protocol

6.2.1 Experimental Procedures

Sprague-Dawley female rats (n = 4) were housed as described in Chapter 2.3 and

were fed commercial rat chow (Chapter 2.3.1.1). Animals were sacrificed at 6 months

of age as described in Chapter 2.5.3.1. Rat femora were removed, snap frozen in

liquid nitrogen and stored at -70°C until ready for mRNA extraction. One femur from

each animal was divided into the bone marrow, cortical bone and femoral head. The

distal femoral head, containing the epiphysis, growth plate and metaphysis, was

collected from each femur. The bone marrow was collected by flushing out the

diaphysis with PBS using a 20-gauge needle and syringe. The cortical bone was taken

192

from the diaphysis and was coarsely crushed and washed in PBS to remove any

remaining bone marrow.

6.2.2 Cell culture

Primary osteoblast cells, UMR 201-10B and UMR 106-06 cell lines were obtained

from Dr D Findlay, Department of Orthopaedics, Royal Adelaide Hospital, Adelaide.

Primary osteoblast cells were grown from rat trabecular bone as described previously

(Gronthos et al 1997). Briefly, specimens of trabecular bone were dissected into small

pieces and washed extensively in PBS. The fragments were seeded as explants into

75cm2 culture dishes (Corning, Costar Corp., Cambridge, MA) and cultured in Eagle's

minimal essential medium (ICN Biomedicals, Aurora, OH), containing 10% heat-

inactivated foetal calf serum (Trace Biosciences, Ltd., Noble Park, Vic, Australia) and

L-ascorbic acid-2-phosphate (NovaChem, Victoria, Australia). The UMR-201-10B

and UMR 106-06 cell lines were grown in culture as described previously (Zhou et al

1991; Celic et al 1998). Briefly, these cell lines were maintained in Dulbeccos

minimal essential media (DMEM) supplemented with 10% foetal calf serum (FCS).

The growth media for UMR 201-10B also contained 200µg/ml of the antibiotic G418,

except when cells were prepared for experiments. All cell cultures were grown at

37°C in a humidified 5% CO2 atmosphere.


Messenger RNA extraction, purification and quantification from bone tissue are

described in Chapter 2.5.3. The method of mRNA extraction, purification and

quantification from harvested cell lines was the same as described for tissue samples.

First Strand cDNA synthesis from mRNA is described in Chapter 2.5.4. The reaction

temperature, reagent composition and conditions for real-time RT-PCR are described

193

in Chapter 2.6.2. The copy numbers of mRNA for CYP27B1, CYP24 and VDR in the

cell lines were expressed relative to the levels of GAPDH mRNA in each cell line.

6.2.4 Insitu hybridisation

One rat femur from each animal was prepared for in situ hybridisation. In situ

hybridisation analysis, performed for CYP27B1 mRNA on rat femoral bone sections,

is described in Chapter 2.8.

6.2.5 Data expression and statistical analyses

One-way analysis of variance (Chapter 2.4.6.1) was performed to compare the levels

of CYP27B1, CYP24 and VDR mRNA between the three bone fractions as well as

between the three individual cell lines. The data were further analysed using Tukey’s

post hoc test (Chapter 2.4.6.3). Linear regression analysis (Chapter 2.4.6.4) was used

to compare the levels of CYP27B1 and CYP24 mRNA detected in the three bone

factions.

6.3 Results

6.3.1 Expression of CYP27B1 mRNA in specific bone regions

The expression of CYP27B1 mRNA in the bone marrow, femoral head and cortical

bone fractions of the rat femur is shown in Figure 6.1. Expression of CYP27B1

mRNA was detected in all fractions of the rat femur. In the femoral head, however,

the levels of mRNA expression was more than 2-fold higher than the levels found in

the bone marrow and cortical bone (p<0.01).

194

Figure 6.1 The expression of CYP27B1 mRNA levels (copy number/µg total RNA) in

rat bone marrow, femoral head and cortical bone. Values are mean ± sem. n = 4. * p <

0.01 vs. bone marrow and cortical bone fractions. CYP27B1, 25-hydroxyvitamin D-

1α-hydroxylase.

BoneMarrow

FemoralHead

CorticalBone

2 x104

4 x105

6 x105

0

CYP

27b1

Cop

y N

umbe

r/ µ

g to

tal R

NA

1.2 x106

1.0 x106

8 x105

1.4 x106

*

BoneMarrow

FemoralHead

CorticalBone

2 x104

4 x105

6 x105

0

CYP

27b1

Cop

y N

umbe

r/ µ

g to

tal R

NA

1.2 x106

1.0 x106

8 x105

1.4 x106

*

2 x105

CYP

27B

1

195

6.3.2 Expression of CYP24 mRNA in specific bone regions

The expression of CYP24 mRNA in the bone marrow, femoral head and cortical bone

fractions of the rat femur is shown in Figure 6.2. CYP24 mRNA was detected in all

fractions of the rat femur. In the femoral head, however, the levels of mRNA

expression was 26-fold higher than the levels found in the bone marrow and more

than 260-fold higher than the levels of expression found in the cortical bone

(p<0.001). The levels of CYP24 mRNA expression in the bone marrow was

significantly higher than that in the cortical bone (p<0.001).

6.3.3 Relationship between CYP27B1 and CYP24 mRNA expression

A positive relationship was detected between CYP27B1 and CYP24 mRNA levels in

the bone (p<0.01) (Figure 6.3). The coefficient of determination for the relationship

was 0.81. This relationship between CY27b1 and CYP24 mRNA was, however,

found only to occur in the femoral head.

6.3.4 Expression of VDR mRNA in the separate bone fractions

The expression of VDR mRNA in the bone marrow, femoral head and cortical bone

fractions of the rat femur is shown in Figure 6.4. VDR mRNA was detected in all

fractions of the rat femur. In the cortical bone, however, the levels of mRNA

expression was approximately 20-fold lower than the levels of expression found in

both the bone marrow and the femoral head (p<0.01). The expression levels of VDR

mRNA levels in both the bone marrow and the femoral head were comparable at

approximately 1.2 x105 (± 2.5 x104) copies/µg of total RNA.

196

Figure 6.2 The expression of CYP24 mRNA levels (copy number/µg total RNA) in

the rat bone marrow, femoral head and cortical bone. Values are mean ± sem. n = 4. *

p <0.001 vs. bone marrow and cortical bone fractions. CYP24, 25-hydroxyvitamin D-

24-hydroxylase.

BoneMarrow

FemoralHead

CorticalBone

CYP

24 C

opy

Num

ber

/ µg

tota

l RN

A

1.25 x104

2.5 x104

3.75 x104

0

1.2 x106

1.0 x106

5 x104

1.4 x106 *

1.6 x106

BoneMarrow

FemoralHead

CorticalBone

CYP

24 C

opy

Num

ber

/ µg

tota

l RN

A

1.25 x104

2.5 x104

3.75 x104

0

1.2 x106

1.0 x106

5 x104

1.4 x106 *

1.6 x106

197

Figure 6.3 The relationship between the expression of CYP27B1 and of CYP24

mRNA levels (copy numbers/µg total RNA) in the bone marrow (○), the femoral head

(◊) and in the cortical bone (×) fractions. The coefficient of determination (R2) is

shown for the linear regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-

hydroxylase. CYP24, 25-hydroxyvitamin D-24-hydroxylase.

2

4

6

0

8

10

16

12

14

18C

YP24

Cop

y N

umbe

r (X

105 )

/ µg

tota

l RN

A

2 4 60 8 10 12 14

CYP27b1 Copy Number (x 105)/ µg total RNA

R2 = 0.81

2

4

6

0

8

10

16

12

14

18C

YP24

Cop

y N

umbe

r (X

105 )

/ µg

tota

l RN

A

2 4 60 8 10 12 14

CYP27b1 Copy Number (x 105)/ µg total RNA

R2 = 0.81

CYP27B1

198

Figure 6.4 The expression of VDR mRNA levels (copy number/µg total RNA in the

rat bone marrow, femoral head and cortical bone. Values are mean ± sem. n = 4. * p <

0.05 vs. bone marrow and femoral head fractions. VDR, vitamin D receptor.

BoneMarrow

FemoralHead

CorticalBone

VDR

Cop

y Nu

mbe

r/ µ

g to

tal R

NA

2 x104

4 x104

6 x104

0

8 x104

1.0 x105

1.6 x105

1.2 x105

1.4 x105

*

BoneMarrow

FemoralHead

CorticalBone

VDR

Cop

y Nu

mbe

r/ µ

g to

tal R

NA

2 x104

4 x104

6 x104

0

8 x104

1.0 x105

1.6 x105

1.2 x105

1.4 x105

*

199

6.3.5 Expression of CYP27B1 mRNA in bone cells

The expression of CYP27B1 mRNA in primary bone cell cultures, UMR 201 and

UMR 106 cells is shown in Figure 6.5. CYP27B1 mRNA was detected in all of the

cell lines tested. The highest level of CYP27B1 mRNA expression was detected in

UMR 106 cells, and was approximately 4-fold higher than the levels of expression

detected in the primary bone cells and in UMR 201 cells (p<0.05).

6.3.6 Expression of CYP24 mRNA in bone cells

The expression of CYP24 mRNA in primary bone cell cultures, UMR 201 and UMR

106 cells is shown in Figure 6.6. CYP24 mRNA was detected in all of the cell lines

tested. In the UMR 201 cells, the levels of mRNA expression was approximately 77-

fold higher than the level of expression detected in the primary bone cells and

approximately 130-fold higher than that found in the UMR 106 cells (p<0.001).

6.3.7 Expression of VDR mRNA in bone cells

The expression of VDR mRNA in primary bone cell cultures, UMR 201 and UMR

106 cells is shown in Figure 6.7. VDR mRNA was detected in all fractions of the rat

femur. In the UMR 201 cells, the levels of mRNA expression was approximately 10-

fold lower than the level detected in the primary bone cells (p<0.05). The level in the

UMR 106 cells was highest, and was approximately 7-fold higher than the level of

mRNA expression detected in the primary bone cells.

200

Figure 6.5 The expression of CYP27B1 mRNA levels (copy number/GAPDH copy

number) in primary bone cells, UMR 201, and UMR 106 cells. Values are mean ±

sem. n = 3. * p<0.01 vs Primary bone cells, # p<0.01 vs UMR 201 cells. CYP27B1,

25-hydroxyvitamin D-1α-hydroxylase.

Primarybone cells

UMR 201 UMR 106

CYP

27b1

mR

NA

cop

y nu

mbe

r / G

APD

H m

RN

A

1 x 10-3

0

2 x 10-3

3 x 10-3

4 x 10-3

5 x 10-3

6 x 10-3

7 x 10-3

* #

*

CYP

27B

1

201

Figure 6.6 The expression of CYP24 mRNA levels (copy number/GAPDH copy


sem. n = 3. * p<0.01 vs Primary bone cells, # p<0.01 vs UMR 201 cells. CYP24, 25-


Primarybone cells

UMR 201 UMR 106

CYP

24 m

RN

A c

opy

num

ber

/ GA

PDH

mR

NA

5 x10-5

1 x 10-4

0

2 x 10-4

1.5 x 10-4

2.5 x 10-4

3 x 10-4

3.5 x 10-4

4 x 10-4

4.5 x 10-4

#

*

202

Figure 6.7 The expression of VDR mRNA levels (copy number/GAPDH copy


sem. n = 3. * p<0.01 vs Primary bone cells, # p<0.01 vs UMR 201 cells. CYP27B1,

25-hydroxyvitamin D-1α-hydroxylase.

Primarybone cells

UMR 201 UMR 106

VDR

mR

NA

cop

y nu

mbe

r / G

APD

H m

RNA

1 x 10-2

0

2 x 10-2

3 x 10-2

4 x 10-2

5 x 10-2

* #

*

203

6.3.8 Detection of CYP27B1 mRNA by in situ hybridisation

The detection of CYP27B1 mRNA in femoral bone sections by in situ hybridisation

showed a wide spread expression of CYP27B1 mRNA expression in the

haematopoietic cells of the bone marrow (Figure 6.8). No CYP27B1 mRNA was

detected in other bone marrow cells such as megakaryocytes and adipose cells.

Although no CYP27B1 mRNA was detected in osteoblasts, very few osteoblasts were

found in these sections. CYP27B1-positive cells of a normoblast nature were

identified adjacent to the trabeculae (Figure 6.9). The osteocytes of the lacuna did not

express CYP27B1 mRNA.

6.4 Discussion

6.4.1 Expression of CYP27B1, CYP24 and VDR mRNA in specific bone

regions


CYP27B1 mRNA was detected in all specific fractions of bone collected from the

femur. The highest expression of CYP27B1 mRNA was detected in the femoral head

and was more than 2-fold higher than the expression levels detected in the cortical

bone and in the bone marrow. The high expression of CYP27B1 mRNA in this region

is consistent with the study of Panda and co-workers (2001(a)), who identified

CYP27B1 mRNA in the chondrocytes of the growth plate and in osteoblasts

associated with metaphyseal trabeculae. Since the femoral head region studied here

contains the epiphysis, the growth

204

Figure 6.8 The expression of CYP27B1 mRNA in rat bone marrow. Tissue sections

were hybridised with a digoxigenin-labelled rat CYP27B1 anti-sense riboprobe. (A)

The purple stain indicates the expression of CYP27B1 mRNA. (B) No reaction was

detected in the control section, which was hybridised with a digoxigenin-labelled rat

CYP27B1 sense riboprobe.

A BA B

205

Figure 6.9 The detection of CYP27B1 mRNA in the rat femur. Tissue sections were

hybridised with a digoxigenin-labelled rat CYP27B1 anti-sense riboprobe. (A) The

purple stain indicates the expression of CYP27B1 mRNA. Depicted in these slides are

haematopoietic cells (1), megakaryocytes (2), trabecula bone (3), osteocytes (4) and

adipose cells (5). (B) No reaction was detected in the control section, which was

hybridised with a digoxigenin-labelled rat CYP27B1 sense riboprobe.

A B

1

1

2

2

3 3

4

5

5

A B

1

1

2

2

3 3

4

5

5

206

plate, trabeculae and bone marrow from the metaphyseal region, CYP27B1 mRNA

expression could be expressed in a number of cells types in each of these sites. The

high expression of CYP27B1 in the femoral head suggests that 1,25D-mediated

autocrine or paracrine signalling pathways may be involved in the skeletal growth and

maturation.

Although the cortical bone is an area of low cellular activity, the level of CYP27B1

mRNA expression in this region was comparable with the level of expression that was

detected in the bone marrow. The significance of the expression of CYP27B1 mRNA

in the cortical bone is presently unclear. Bone marrow macrophages are known to

have CYP27B1 activity (Reichel et al 1987) and 1,25D has been shown to be involved

in a number of processes in the bone-marrow, such as macrophage differentiation and

activity (Clohisy et al 1987; Abu-Amer and Bar-Shavit 1993; Rickard et al 1995) and

in the immune response (Gray and Cohen 1985; Abu-Amer and Bar-Shavit 1994).

6.4.1.2 CYP24 mRNA

Although CYP24 mRNA was detected in all three regions examined, the highest level

of CYP24 mRNA expression was found in the femoral head. This is consistent with

reports of CYP24 mRNA and enzyme activity in osteoblasts (Turner et al 1980;

Makin et al 1989). Although bone marrow macrophages have been shown to have

CYP24 activity (Reichel et al 1987), in the current study the levels of expression of

CYP24 in the bone marrow is significantly lower than the levels of expression

detected in the femoral head. The level of expression of CYP24 mRNA in the bone

marrow, however, was significantly higher than the level of expression found in the

cortical bone. The low level of CYP24 mRNA expression in the cortical bone is likely

207

to be the result of the low cellular activity of the terminally differentiated, highly

compacted and mineralised cells.

Of considerable interest is the co-expression of CYP27B1 and CYP24 mRNA in the

femoral head, which is consistent with the findings presented in Chapters 4 and 5.

Although this relationship could not be detected in the bone marrow, the coupling of

bone CYP27B1 and CYP24 has been shown in bone marrow macrophage cells

(Reichel et al 1987). The activity of CYP24 was shown to be increased in bone

marrow macrophages in response to the intracellular production of 1,25D. The

coupling of CYP27B1 and CYP24 mRNA expression suggests that the activity of the

locally produced 1,25D, is modulated by the catabolic activity of CYP24 in the

femoral head.

6.4.1.3 VDR mRNA

Although VDR mRNA was detected in all three faction of the bone examined, the

expression levels of VDR mRNA were significantly higher in the bone marrow and

femoral head when compared to the levels detected in the cortical bone. The detection

of VDR mRNA in the bone marrow and in the femoral head, like the presence of

CYP24 mRNA, reflects the high cellular activity of cells in these regions. VDR has

been identified in a number of bone cell types. Immunohistochemistry analysis on

both rat and human bone, have shown that VDR protein is present in high amounts in

osteoblasts (Clemens et al 1988; Langub et al 2000). A number of studies have shown

that osteoblast-like cell lines also express the VDR (Mahonen and Maenpaa 1994;

Ohtera et al 2001). The presence of VDR in osteoblasts is necessary for a number of

1,25D-mediated processes, such as the regulation of osteoblastic-specific genes,

208

including osteocalcin and osteopontin (Kraichely and MacDonald 1998; Martinez et

al 2001).

The detection of VDR mRNA in the bone marrow is consistent with previous studies

that have identified VDR in a number of bone cell types. Clemens et al (1988) and

Gruber et al (1999) identified the VDR in a variety of different bone marrow cells,

including monocytes-macrophages and T and B-lymphocytes. Cells from the

osteoblastic cell lineage, primary stromal cells and more differentiated fibroblasts

were also shown to express the VDR. The interactions between these VDR-positive

cells and 1,25D are numerous and are only recently starting to be resolved. Abu-Amer

and Bar-Shavit (1994) showed, for example, that the interaction between 1,25D and

mature monocytes and macrophages enhances their immune function and improves

host defence by promoting macrophage survival and differentiation. In lymphocytes,

however, 1,25D acts in an immunoinhibitory agent by decreasing both the

proliferation rate and the activity of T- and B-lymphocytes (Lemire et al 1984; Lemire

et al 1985; Lemire and Archer 1991).

6.4.2 Expression of CYP27B1, CYP24 and VDR mRNA in bone cells


The highest expression of CYP27B1 mRNA was found in the UMR 106 cells when

compared to the UMR 201 cells and primary bone cells. This suggests that the UMR

106 cells, which can mature and mineralise in vitro, have an increased capacity to

synthesise 1,25D. UMR 106 cells have been shown to contain PTH, calcitonin, and

calcium receptors, which all respond to their respective ligands by stimulating the

cAMP-dependent protein kinase pathway (Yamaguchi et al 1998(b)). Since PTH,

calcitonin and calcium have all been shown to stimulate the transcriptional activity of

209

CYP27B1 in kidney cell lines (Brenza and DeLuca 2000), it is possible that one or

more of these factors may mediated the expression of CYP27B1 mRNA in the UMR

106 cells via a cAMP-mediated signalling process.

The UMR 201 cells, which are phenotypically an immature preosteoblast and are

unable to mineralise in vitro, expresses CYP27B1 mRNA at a level, which is

approximately 4-fold lower than the level of expression detected in the UMR 106

cells. It is possible that the levels of maturation of the osteoblast affect the level of

expression of CYP27B1 mRNA. This concept is supported by the finding that the

level of CYP27B1 mRNA expression in immature, primary osteoblasts, which is

comparable with the level of expression detected in UMR 201 cells. These findings,

taken together with the fact that 1,25D stimulates the influx of calcium into the

osteoblast (Meszaros and Farach-Carson 1997; Nakagawa et al 1999), suggests that

the level of CYP27B1 mRNA expression in the bone cell may be associated with the

ability of these cells to mineralise.

6.4.2.2 CYP24 mRNA

The level of expression of CYP24 mRNA in UMR 201 cells was markedly higher

than the level of expression found in UMR 106 and primary bone cells. This is

consistent with the report by Nishimura and co-workers (1994), that the 1,25D-

mediated induction of CYP24 mRNA expression was more rapid and much greater in

an immature osteoblast-like cell-line, C-26, compared with a more mature osteoblast-

like cell-line, C-11. This is in contrast with the level of expression of CYP27B1

mRNA detected in the UMR 201 and UMR 106 cells. Armbrecht and co-workers

(1994, 1998) have previously reported the low level of expression of CYP24 mRNA

210

in UMR 106 cells. They found that the low basal expression of CYP24 mRNA was

markedly increased when exogenous 1,25D and PTH was added to medium.

One of the functions of CYP24 in bone is the inactivation of 1,25D, thereby

preventing the elevation of intracellular 1,25D levels that could adversely affect

mineralisation. St-Arnaud and co-workers (2000) recently identified markedly

elevated 1,25D levels and impaired bone formation at specific sites in mice with the

CYP24 gene knocked out. The high CYP24 mRNA expression in immature UMR 201

cells may, therefore, prevent the 1,25D-mediated differentiation and mineralisation in

these cells. The lower level of expression of CYP24 mRNA in UMR 106 cells may

reflect the need for these cells to mature and to mineralise. The level of expression of

CYP24 mRNA in primary osteoblast cells, is comparable to the level of expression

detected in UMR 106 cells, therefore suggests that these cells, like UMR 106 cells,

are able to mature and to mineralise.

6.4.2.3 VDR mRNA

The level of VDR mRNA expression in UMR 106 cells was significantly higher

than the levels detected in UMR 201 or primary osteoblast cells. This clearly

shows that UMR 106 cells are responsive to 1,25D-mediated gene

transcription, which is consistent with previous studies that have shown the

presence of VDR in osteoblast-like cells is required for 1,25D-mediated

processes (Dokoh et al 1984; Chen et al 1986(a); Chen et al 1986(b); Stein et

al 1990; Staal et al 1997). Dokoh et al (1984) detected in a series of rat

osteogenic sarcoma (ROS) cell lines that the high level of VDR protein in a

particular cell was associated with the strong osteoblastic nature of this cell.

They also found a strong correlation between the concentration of 1,25D in

211

the medium and the number of VDR molecules per ROS cell. Since the UMR

106 and UMR 201 cells were maintained in the same medium, it may be

possible that the high levels of VDR mRNA in UMR 106 cells is due to the

increase in the synthesis of 1,25D by CYP27B1 in these cells. Further

examination, however, into the relationship between the VDR mRNA levels

and the amount of 1,25D produced in UMR 106 cells, is required to

substantiate this theory.

The level of VDR mRNA levels in the UMR 201 cells was low compared to the levels

detected in UMR 106 and primary bone cells, suggesting that this cell-line may be

unable to respond to 1,25D. This is, to our knowledge, the first report of the

expression of VDR mRNA in UMR 201 cells. The lack of ability for UMR 201 cells

to mineralise in vitro may be explained, in part, by the inability of these cells to

respond to 1,25D due to their low expression of VDR mRNA.

Although, the level of expression of VDR mRNA in UMR 201 cells is low, the level

of CYP24 mRNA expression detected in the same cells was markedly high. This

finding is in contrast with a number of studies that have demonstrated that the VDR is

required for the 1,25D mediated stimulation of CYP24 mRNA expression in the

kidney and in other cell types (Pols et al 1991; Staal et al 1997). This is not, however,

the first study to detect this disassociation between VDR and CYP24 mRNA in

immature osteoblasts. Nishimura and co-workers (1994) found by using three

different osteoblastic cell lines (C-26, C-20, and C-11), which varied in level of

maturity, that the expression of VDR mRNA was lowest and the expression of CYP24

mRNA was highest in the most immature osteoblastic cell line (C-26). This suggests

212

that, unlike in the kidney, in the bone the level of expression of CYP24 cannot be not

be explained simply by the level of the expression of VDR mRNA.

It is important to note that the level of VDR mRNA expression in UMR 201 cells is

not a direct measure of the level of VDR protein in these cell. Previous studies have

reported a lack of association between the levels of VDR mRNA and the VDR protein

levels (Strom et al 1989; Wiese et al 1992). Wiese et al (1992), for example, showed

that the treatment of rat fibroblasts with 1,25D did not increase the levels of VDR

mRNA, but did increase the stability of the VDR protein. It was suggested that an

increase in the level of VDR mRNA is only required to maintain a constant level of

unoccupied receptor. It is therefore possible, that the low level of VDR mRNA in

UMR 201 cells is not indicative of a low level of VDR protein. An investigation into

the regulation of the expression of VDR mRNA and the amount of total and

unoccupied VDR is required to determine the ability of UMR 201 cells to respond to

1,25D and to study the relationship between the levels of CYP24 activity and VDR

content in these cells.

6.4.3 Insitu identification of CYP27B1 mRNA in rat femora

A number of bone cells in the rat femur were shown to express CYP27B1 mRNA by

using in situ hybridisation. The majority of the CYP27B1-positive cells that were

identified were of haematopoietic lineage found throughout the bone marrow (Figure

6.8). This is the first report of CYP27B1 mRNA expression in these largely

undifferentiated, normoblast-like cells. The homogeneity of the haematopoietic cells

made it difficult to determine the exact cells that express CYP27B1 mRNA. Although

CYP27B1 mRNA has previously been identified in bone marrow macrophages

(Reichel et al 1987), in the current study no CYP27B1 mRNA could be detected in

213

macrophages. The absence of CYP27B1 mRNA expression was also found in other

differentiated cells, such as megakaryocytes. In the current study, the expression of

CYP27B1 mRNA was not detected on osteoblasts. Since osteoblasts can be found on

only 2 to 4% of the total trabecula bone surface (A Moore, unpublished data), it is

likely that we were unable to detect osteoblasts expressing CYP27B1 mRNA due to

the absence of these cells in the sections we examined. While we were not able to

positively identify osteoblasts in our sections, Panda and co-workers (1999), were

able to detect CYP27B1 mRNA in osteoblasts of foetal mice femora. The absence of

CYP27B1 mRNA detection in osteoblasts of the adult rat femur may, therefore, be

due to the inability to detect the lower expression of CYP27B1 mRNA in these cells

when compared to the high expression of CYP27B1 mRNA in osteoblasts of the

foetal mice bones.

6.4.4 Summary

The study of the expression of CYP27B1 and CYP24 mRNA in different regions of

the rat femur and in specific osteoblast-like cells, has shown that a number of cells in

the bone are able to synthesise and catabolise 1,25D. The high level of expression of

CYP27B1 in the femoral head is consistent with the high cellular activity in this area.

Although bone cells have been shown to produce 1,25D, the exact role of this locally

produced 1,25D remains unclear. Of particular interest are the results obtained from

mature UMR 106 cells. The levels of CYP27B1 mRNA were higher and the levels of

CYP24 mRNA were lower in UMR 106 cells than the mRNA levels found in UMR

201 cells. In addition, the level of expression of VDR mRNA was significantly higher

in these cells than in any other cell type examined. Taken together, these findings

suggest that more mature osteoblast have the ability to both produce 1,25D and to

respond to 1,25D. Since 1,25D has been shown to promote the mineralisation of

214

mature osteoblasts in vitro, it is possible that the 1,25D produced in these osteoblasts

is involved in the mineralisation process. The UMR 201 cells, which have been

arrested in a preosteoblatsic stage of development, express CYP24 mRNA at a high

level, even though the level of VDR mRNA expression is very low. The ability of

these cells to catabolise 1,25D suggests that, during the early development of the

osteoclast, it is necessary to limit the activity of 1,25D, so that the immature

osteoblast can proliferate without the 1,25D-mediated stimulation of the

mineralisation processes.

This study has demonstrated for the first time, the expression of CYP27B1 mRNA in

normoblastic, haematopoietic cell types. Although the role of CYP27B1 in these non-

differentiated cells of the bone marrow is presently unclear, this finding is consistent

with the detection CYP27B1 mRNA in the bone marrow of the femur. The possibility

that 1,25D-mediated processes such as macrophage differentiation and immune

responses are dependent on 1,25D produced in haematopoietic cells would require

further investigation.

215

CHAPTER 7: Summary and Conclusions

7.1 Summary

This thesis investigated the regulation of the expression of CYP27B1, CYP24 and

VDR mRNA, both in the bone and in the kidney. The broad aim was to determine

whether the regulation of the vitamin D metabolism in the bone is independent from

that in the kidney. The quantitative real-time RT-PCR was used to detect low levels of

mRNA, overcoming the limitations of other methods, such as Northern blot analysis.

This technique was able to accurately quantify the copy numbers mRNA in a highly

reproducible and sensitive manner. The measurement of the absolute quantities of

CYP27B1, CYP24 and VDR mRNA in both the kidney and in bone was used to

determine the effects of age, dietary calcium and vitamin D status on the metabolism

of vitamin D in these tissues. The data derived from the studies on age and dietary

manipulations have enable the development of an number of models for the regulation

of gene expression for CYP27B1 and CYP24.

The first hypothesis investigated the expression of CYP27B1, CYP24 and VDR

mRNA with age. This study clearly demonstrated that the expression levels of these

three genes in the bone were significantly different from the levels found in the

kidney. While in the kidney an age-related decrease in the expression of CYP27B1

mRNA and an increase in the expression of CYP24 mRNA was detected, in the bone

the expression of both CYP27B1 and CYP24 mRNA was high throughout the period

of rapid growth and development. The age-related decrease in the renal CYP27B1

mRNA and the increase in the renal CYP24 mRNA expression resulted in a decline in

serum 1,25D levels with age. The positive correlation found between the CYP27B1

216

mRNA expression in the bone and the circulating levels of calcium, suggests that the

1,25D that is produced in the bone, particularly during the period of bone growth, may

be involved in bone mineralisation. The coupling of CYP27B1 and CYP24 mRNA

expression in the bone implies that the breakdown of locally produced 1,25D in the

bone is necessary to modulate the biological activity of this 1,25D in the bone.

The second hypothesis related to the effect of the concentration of dietary calcium on

the expression of CYP27B1, CYP24 and VDR mRNA in the kidney and bone. This

study demonstrated that the expression of these genes is regulated in such ways that

appropriate blood levels of 1,25D are produced for calcium absorption in the intestine.

In animals fed a low calcium diet, intestinal calcium absorption was stimulated by the

rise in circulating levels of 1,25D, which occurred as a result of increase renal

CYP27B1 mRNA and decreased renal CYP24 mRNA expression (Figure 8.1). The

animals fed a high calcium diet abrogated the need for active intestinal calcium

absorption and consequently the synthesis of renal 1,25D by CYP27B1 was reduced

and the breakdown of 1,25D and 25D by kidney CYP24 was increased (Figure 8.2).

In the bone, the expression of CY27b1 and CYP24 mRNA were strikingly different to

that in the kidney. In animals fed a low calcium diet, the expression of CYP27B1 and

CYP24 mRNA in the bone were both reduced.

In contrast, the expression of CYP27B1 and CYP24 mRNA in the bone was increased

as a result of the consumption of a high calcium diet. The difference in the regulation

of CYP27B1 and CYP24 mRNA between the kidney and bone may be explained in

217

Figure 7.1 Diagram representing the proposed effects of the vitamin D-replete/low

calcium (D(+)/LC) diet on the expression of CYP27B1 and CYP24 in the kidney and

bone. In response to the low calcium diet, serum PTH increases the CYP27B1 mRNA

expression and suppresses CYP24 mRNA expression in the kidney. The rise in

CYP27B1 activity increases in the production of 1,25D, which in turn is able to

stimulate 1,25D-mediated intestinal calcium absorption. In the bone, CYP27B1

mRNA expression is not stimulated by PTH and may be suppressed by the increase in

serum 1,25D levels. Bone CYP24 mRNA levels correspond to the low expression

levels of CYP27B1 mRNA in the bone and do not respond to the rise in circulating

levels of 1,25D. 1,25D-mediated bone mineralisation is normal due to the production

of 1,25D in the kidney.

BONE

1,25D↓

Ca++b 25D↑

CYP27b1↑

CYP24↓

KIDNEY

CYP24↓

PTH↑

CIRCULATION

CYP27b1↓

1,25D↑

DIET: Vitamin D-Replete + Low Calcium

1,24,25D 1,24,25D

25D↑CYP24↓

24,25D

Calcitonin↓

VDR +1

Intestinal Caabsorption

1,25D↑

Normal BoneMineralisation

218

Figure 7.2 Diagram representing the proposed effects of the vitamin D-replete/high

calcium (D(+)/HC) diet on the expression of CYP27B1 and CYP24 in the kidney and

bone. In response to the high calcium diet, the low serum PTH levels result in low

expression of CYP27B1 mRNA in the kidney. The rise in serum calcium levels also

directly suppresses the expression of CYP27B1 in the kidney and, along with high

serum calcitonin levels, stimulates the expression of CYP24 in the kidney, ultimately

reducing the production of 1,25D in the kidney. Serum calcium and calcitonin also

stimulates the expression of CYP27B1 in the bone. The rise in bone CYP27B1

activity increases in the production of 1,25D in the bone and consequently the levels

of CYP24 activity. 1,25D-mediated bone mineralisation is normal due to the

production of 1,25D in the bone.

1,25D↑

Ca++↑ 25D↑

CYP27b1↓

CYP24↑ CYP24↑

PTH↓ CYP27b1↑

1,25D↓

DIET: Vitamin D-Replete + High Calcium

1,24,25D 1,24,25D

25D↑

VDR +1


CYP24↑

24,25D


Calcitonin↑↑

1,25D↓

BONEKIDNEY CIRCULATION

219

part, by the supply of 1,25D to the bone. In the animals fed the low calcium diet, the

high circulating levels of 1,25D may be sufficient for the supply of 1,25D to the bone

for 1,25D-mediated bone processes, which reduced the need for locally produced

1,25D (Figure 8.1). In the animals fed the high calcium diet, the low circulating 1,25D

levels may cause the increase in CYP27B1 mRNA expression in the bone and the

local production of 1,25D (Figure 8.2). The positive correlation between serum

calcitonin levels and the expression of CYP27B1 mRNA in the bone suggests that the

calcitonin may be involved in the production of 1,25D in the bone. It is possible,

therefore, that an increase in 1,25D production in the bone, either by the absence of

inhibition by circulating 1,25D levels or by calcitonin-mediated stimulation, may

ensure that the 1,25D-mediated bone mineralisation continues normally in the event

of a reduction in circulating 1,25D levels.

The third and fourth hypotheses are related to the effect of vitamin D-depletion and

the combined effect of dietary calcium concentration and vitamin D-status, on the

expression of CYP27B1, CYP24 and VDR mRNA in the kidney and in the bone. The

depletion of vitamin D abolished the expression of CYP24 mRNA in the kidney,

which was independent of the concentration of calcium in the diet. The CYP27B1

mRNA expression in the kidney of the vitamin D-depleted animals was, however,

dependent on the amount of calcium that was added to this diet.

When the vitamin D-deplete animals were fed a low calcium diet, the expression of

CYP27B1 mRNA in the kidney was markedly induced by the elevated serum PTH

levels, which occurred as a result of the pronounced hypocalcemia (Figure 8.3).

Despite the drive towards increased 1,25D production, the circulating levels of serum

220

1,25D were low due to the depletion of 25D levels. When the vitamin D-deplete

animals were fed a high calcium diet, the requirement for the 1,25D-mediated

intestinal calcium absorption was reduced and, therefore, the emphasis on the renal

synthesis of 1,25D was also reduced (Figure 8.4).

Unlike in the kidney, the expression of CYP27B1 mRNA in the bone was low in the

vitamin D-deplete animals fed the low calcium diet. While serum PTH potently up-

regulated the expression of renal CYP27B1 mRNA of these animals, it appears that

the expression of CYP27B1 mRNA in the bone is not stimulated by serum PTH

(Figure 8.3). In the vitamin D-deplete animals that were fed the high calcium diet, the

expression of CYP27B1 in the bone was high. The increased levels of serum calcium

in these animals were correlated with the increased expression of CYP27B1 mRNA in

the bone (Figure 8.4), suggesting that when serum calcium levels are normal, the

production of 1,25D in the bone is also increased. The positive association between

CYP27B1 mRNA expression in the bone and BV/TV in the epiphysis of the vitamin

D-deplete animals suggests that as serum calcium levels increase with the

consumption of a high calcium diet, the production of 1,25D in the bone may occur to

mediate the bone mineralisation. Along with finding that CYP27B1 mRNA

expression in the bone in the vitamin D-replete animals fed the high calcium diet,

1,25D production in the bone may ensure that bone mineralisation proceeds when the

supply of renal 1,25D is insufficient, provided that the supply of calcium is adequate.

The difference in the coordinated regulation of the expression of CYP27B1 and

CYP24 mRNA found between the kidney and the bone is likely to reflect the different

roles of the 1,25D produced in these tissues. In the kidney, the reciprocal regulation of

221

Figure 7.3 Diagram representing the proposed effects of the vitamin D-deplete/low

calcium (D(-)/LC) diet on the expression of CYP27B1 and CYP24 in the kidney and

bone. In response to the vitamin D-depletion and low calcium diet, serum PTH levels

are markedly induced, which results in high CYP27B1 mRNA expression in the

kidney. Despite the high CYP27B1 activity, the production of 1,25D is low due to the

depleted 25D levels and 1,25D-mediated intestinal calcium absorption is unable to

occur. In the bone, CYP27B1 mRNA expression appears to be inhibited by serum

PTH and may also be suppressed due to low serum levels of calcium and calcitonin.

Bone CYP24 mRNA levels correspond to the low production of 1,25D in the bone.

1,25D-mediated bone mineralisation is abnormal due to the lack of 1,25D production

in either the kidney or the bone.

1,25D↓

Ca++↓↓ 25D↓

CYP27b1↑↑

CYP24↓ CYP24↓

PTH↑↑ CYP27b1↓

1,25D↓

DIET: Vitamin D-Deplete + Low Calcium

1,24,25D 1,24,25D

25D↓

VDR +1

Abnormal BoneMineralisation

CYP24↓

24,25D


Calcitonin↓

1,25D↓


222

Figure 7.4 Diagram representing the proposed effects of the vitamin D-deplete/high

calcium (D(-)/HC) diet on the expression of CYP27B1 and CYP24 in the kidney and

bone. In response to the vitamin D-depletion and high calcium diet, the low serum

PTH levels result in low expression of CYP27B1 mRNA in the kidney. Serum

calcium levels also directly suppresses the expression of CYP27B1 in the kidney. The

expression of CYP2 4 in the kidney is, however, low due to the low serum levels of

25D and 1,25D. Serum calcium and calcitonin stimulates the expression of CYP27B1

in the bone. The rise in bone CYP27B1 activity increases in the production of 1,25D

in the bone and consequently the levels of CYP24 activity. 1,25D-mediated bone

mineralisation is normal due to the production of 1,25D in the bone.

1,25D↓

Ca++b 25D↓

CYP27b1↓

CYP24↓ CYP24↑

PTH↓ CYP27b1↑

1,25D↓↓

DIET: Vitamin D-Deplete + High Calcium

1,24,25D 1,24,25D

25D↓

VDR +1


CYP24↓

24,25D


Calcitonin↑

1,25D↓↓


223

the expression of CYP27B1 and CYP24 mRNA ensures that appropriate amounts of

1,25D are supplied to the circulation to mediate intestinal calcium absorption and

other processes involved in calcium homeostasis. In the kidney, the expression of

CYP27B1 mRNA is stimulated by PTH during hypocalcemia and the expression of

CYP24 mRNA may be stimulated by serum calcitonin during normocalcemia. In the

bone, however, the strong coupling of the expression of CYP27B1 and CYP24

mRNA found in studies investigating the effects of age, dietary calcium and vitamin

D status, suggests that the locally produced 1,25D acts in an autocrine or paracrine

manner to initiate 1,25D-mediated processes. It is possible that the production of

1,25D in the bone may be the primary source of 1,25D required for local processes.

This is supported by the finding that, in the bone, CYP24 mRNA expression is

primarily concerned with the catabolism of locally produced 1,25D, rather than with

the catabolism of the circulating 1,25D. Such a proposal would, however, require

further investigation. The mechanism that would allow CYP24 in the bone to

catabolise the locally produced 1,25D, rather than the circulating 1,25D, is likely to

involve other biological factors that regulate the expression of CYP24 in this tissue.

The absence of the PTH-mediated down-regulation of the expression of CYP24

mRNA, found in young, developing animals and in vitamin D-deplete animals fed a

high calcium diet, may stimulate the expression of CYP24 mRNA in the bone and

allow for the specific catabolism of locally produced 1,25D.

7.2 Limitations

The design of the experiments in this thesis was such that it is difficult to conclusively

demonstrate that the regulation of the transcriptional activity of CYP271b, CYP24 or

VDR was due solely to one or more factors. The associations between specific gene

expression and factors known to be involved in vitamin D metabolism and calcium

224

homeostasis generates hypotheses to the regulation of vitamin D metabolism. Further

studies, however, investigating the specific regulation of CYP27B1 in the bone would

be required to substantiate these hypotheses.

The hypotheses generated in this thesis are largely based on the assumption that the

measurement of absolute levels mRNA extracted from tissue are representative of the

protein levels and activity. The strong associations between both the expression of

CYP27B1, CYP24 mRNA in the kidney and serum 1,25D levels found in this thesis

suggests the measurement of these mRNA species are a reasonable estimate of the

activity of their respective enzymes. It is less clear, however, whether the levels of

CYP27B1 and CYP24 in the bone directly relate to the activity of these enzymes and

the production of 1,25D in the bone. Furthermore, previous studies have shown that

VDR mRNA levels do not necessarily directly relate to the protein levels of VDR.

Future experiments may incorporate the measurement of protein levels of CYP27B1,

CYP24 and VDR by western blot analysis to ascertain the relationship between

mRNA expression of the genes investigated in this thesis and the protein levels and

activity. Alternatively, it is possible to conduct enzyme activity assays, which would

be able to determine the activity of CYP27B1 and CYP24 enzymes under different

physiological conditions. Immunohistochemistry could also be used to identify VDR

protein in the kidney and bone.

The identification of the specific bone cell types that express CYP27B1 mRNA was

limited by the sensitivity of method. CYP27B1 mRNA is lowly expressed and it is

possible that the particular method of in situ hybridisation that we employed was

unable to detect all the cell types that expressed this gene. Besides this, the bone

225

marrow cells that were found to contain CYP27B1 mRNA could not be precisely

identified due to their undifferentiated nature. In the mouse and human, it is possible

to select and purify specific cell types from the bone marrow, which would have

allowed us to clearly identify the cell types that express CYP27B1 mRNA. The

available antibodies required to select the cell types were, however, too few in the rat

to warrant this course of action.

7.3 Future Directions

The distinct regulation of CYP27B1 and CYP24 mRNA in the bone, which appears to

be associated with process of bone mineralisation, is one of the most important

observations made in this thesis. To further investigate this possibility, the infusion of

25D directly into one femur of vitamin D-deplete animals would allow us to compare

the femur given adequate 25D levels and the other femur, which is in a 25D-deplete

environment within the same animal. The expression of CYP27B1 mRNA and the

histological examination of these bones would then be able to give a clear link

between the production of 1,25D in the bone and measurements of bone

mineralisation.

A transgenic mouse, which expresses the luciferase reporter gene under the control of

1.5kb promoter of the CYP27B1 gene, has recently been developed in our laboratory.

In future, specific truncations and deletions in the promoter of the CYP27B1 gene

could be used in a similar transgenic animal model to identify whether specific factors

such as serum calcium, calcitonin and PTH are directly involved in the expression of

the CYP27B1 gene in the bone.

226

Bibliography

Abe E, Miyaura C, Sakagami H, Takeda M, Konno K, Yamazaki T, Yoshiki S, Suda

T. 1981. Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-

dihydroxyvitamin D3. Proc Natl Acad Sci USA 78(8): 4990-4.

Abu-Amer Y and Bar-Shavit Z. 1993. Impaired bone marrow-derived macrophage

differentiation in vitamin D deficiency. Cell Immunol 151(2): 356-68.

Abu-Amer Y and Bar-Shavit Z. 1994. Regulation of TNF-alpha release from bone

marrow-derived macrophages by vitamin D. J Cell Biochem 55(4): 435-44.

Abou-Samra AB, Juppner H, Kong XF, Schipani E, Iida-Klein A, Karga H, Urena P,

Gardella TF, Potts JT Jr, Kronenberg HM 1994. Structure, function, and expression of

the receptor for parathyroid hormone and parathyroid hormone-related peptide. Adv

Nephrol Necker Hosp(23): 247-64.

Adams JS, Beeker TG, Hongo T, Clemens TL. 1990. Constitutive expression of a

vitamin D 1-hydroxylase in a myelomonocytic cell line: a model for studying 1,25-

dihydroxyvitamin D production in vitro. J Bone Miner Res 5(12): 1265-9.

Adams DO and Hamilton TA. 1984. The cell biology of macrophage activation. Annu

Rev Immunol 2: 283-318.

227

Adams JS and Gacad MA. 1985. Characterization of 1 alpha-hydroxylation of vitamin

D3 sterols by cultured alveolar macrophages from patients with sarcoidosis. J Exp

Med 161(4): 755-65.

Akeno N, Saikatsu S and Horiuchi N. 1993. Increase of renal 25-hydroxyvitamin D3-

24-hydroxylase activity and its messenger ribonucleic acid level in 1 alpha-

hydroxyvitamin D3-administered rats: possibility of the presence of two forms of 24-

hydroxylase. J Nutr Sci Vitaminol (Tokyo) 39(2): 89-100.

Amling M, Priemel M, Holzmann T, Chapin K, Rueger JM, Baron R and Demay MB.

1999. Rescue of the skeletal phenotype of vitamin D receptor-ablated mice in the

setting of normal mineral ion homeostasis: formal histomorphometric and

biomechanical analyses. Endocrinology 140(11): 4982-7.

Andersson S, Davis DL, Dahlback H, Jornvall H, Russell DW. 1989. Cloning,

structure, and expression of the mitochondrial cytochrome P-450 sterol 26-

hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264(14): 8222-9.

Arbour NC, Prahl JM and DeLuca HF. 1993. Stabilization of the vitamin D receptor

in rat osteosarcoma cells through the action of 1,25-dihydroxyvitamin D3. Mol

Endocrinol 7(10): 1307-12.

Armbrecht HJ and Boltz MA. 1991. Expression of 25-hydroxyvitamin D 24-

hydroxylase cytochrome P450 in kidney and intestine. Effect of 1,25-

dihydroxyvitamin D and age. FEBS Lett 292(1-2): 17-20.

228

Armbrecht HJ, Boltz M, Strong R, Richardson A, Bruns ME and Christakos S. 1989.

Expression of calbindin-D decreases with age in intestine and kidney. Endocrinology

125(6): 2950-6.

Armbrecht HJ, Chen ML, Hodam TL and Boltz MA. 1997(a). Induction of 24-

hydroxylase cytochrome P450 mRNA by 1,25-dihydroxyvitamin D and phorbol esters

in normal rat kidney (NRK-52E) cells. J Endocrinol 153(2): 199-205.

Armbrecht HJ and Hodam TL. 1994. Parathyroid hormone and 1,25-

dihydroxyvitamin D synergistically induce the 1,25-dihydroxyvitamin D-24-

hydroxylase in rat UMR-106 osteoblast- like cells. Biochem Biophys Res Commun

205(1): 674-9.

Armbrecht HJ, Hodam TL, Boltz MA and Kumar VB. 1999. Capacity of a low

calcium diet to induce the renal vitamin D 1a-hydroxylase is decreased in adult rats.

Biochem Biophys Res Commun 255(3): 731-4.

Armbrecht HJ, Hodam TL, Boltz MA, Partridge NC, Brown AJ and Kumar VB. 1998.

Induction of the vitamin D 24-hydroxylase (CYP24) by 1,25-dihydroxyvitamin D3 is

regulated by parathyroid hormone in UMR106 osteoblastic cells. Endocrinology

139(8): 3375-81.

Armbrecht HJ, Wongsurawat VJ, Hodam TL and Wongsurawat N. 1997(b). Insulin

markedly potentiates the capacity of parathyroid hormone to increase expression of

229

25-hydroxyvitamin D3-24-hydroxylase in rat osteoblastic cells in the presence of

1,25-dihydroxyvitamin D3. FEBS Lett 393(1): 77-80.

Armbrecht HJ, Wongsurawat N and Paschal RE. 1987. Effect of age on renal

responsiveness to parathyroid hormone and calcitonin in rats. J Endocrinol 114(2):

173-8.

Armbrecht HJ, Zenser TV and Davis BB. 1981. Conversion of 25-hydroxyvitamin D3

to 1,25-dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 in renal slices from the

rat. Endocrinology 109(1): 218-22.

Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR,

Pike JW, Shine J and O'Malley BW. 1988. Cloning and expression of full-length

cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85(10): 3294-8.

Bar A, Shani M, Fullmer CS, Brindak ME, Striem S. 1990. Modulation of chick

intestinal and renal calbindin gene expression by dietary vitamin D3, 1,25-

dihydroxyvitamin D3, calcium and phosphorus. Mol Cell Endocrinol 72(1): 23-31.

Barbour GL, Coburn JW, Slatopolsky E, Norman AW and Horst RL. 1981.

Hypercalcemia in an anephric patient with sarcoidosis: evidence for extrarenal

generation of 1,25-dihydroxyvitamin D. N Engl J Med 305(8): 440-3.

230

Beckman MJ, Goff JP, Reinhardt TA, Beitz DC and Horst RL. 1994. In vivo

regulation of rat intestinal 24-hydroxylase: potential new role of calcitonin.

Endocrinology 135(5): 1951-5.

Beckman MJ, Johnson JA, Goff JP, Reinhardt TA, Beitz DC and Horst RL. 1997. The

role of dietary calcium in the physiology of vitamin D toxicity: excess dietary vitamin

D3 blunts parathyroid hormone induction of kidney 1-hydroxylase. 574.1905 A67

319(2): 535-9.

Beckman MJ and DeLuca HF. 2002. Regulation of renal vitamin D receptor is an

important determinant of 1alpha,25-dihydroxyvitamin D(3) levels in vivo. Arch

Biochem Biophys 401(1): 44-52.

Bell NH. 1998. Renal and nonrenal 25-hydroxyvitamin D-1alpha-hydroxylases and

their clinical significance. J Bone Miner Res 13(3): 350-3.

Bhattacharyya MH and DeLuca HF. 1974. Subcellular location of rat liver calciferol-

25-hydroxylase. Arch Biochem Biophys 160(1): 58-62.

Bland R, Walker EA, Hughes SV, Stewart PM and Hewison M. 1999. Constitutive

expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in a transformed human

proximal tubule cell line: evidence for direct regulation of vitamin D metabolism by

calcium. Endocrinology 140(5): 2027-34.

231

Blunt JW, Tanaka Y, DeLuca HF. 1968. Biological activity of 25-

hydroxycholecalciferol, a metabolite of vitamin D3. Proc Natl Acad Sci USA 61(4):

1503-6.

Booth BE, Tsai HC, Morris RC Jr. 1977. Parathyroidectomy reduces 25-

hydroxyvitamin D3-1 alpha-hydroxylase activity in the hypocalcemic vitamin D-

deficient chick. J Clin Invest 60(6): 1314-20.

Booth BE, Tsai HC and Morris RC Jr. 1985. Vitamin D status regulates 25-

hydroxyvitamin D3-1 alpha-hydroxylase and its responsiveness to parathyroid

hormone in the chick. J Clin Invest 75(1): 155-61.

Bouillon R, Bex M, Van Herck E, Laureys J, Dooms L, Lesaffre E and Ravussin E.

1995. Influence of age, sex, and insulin on osteoblast function: osteoblast dysfunction

in diabetes mellitus. J Clin Endocrinol Metab 80(4): 1194-202.

Boyle IT, Gray RW and DeLuca HF. 1971. Regulation by calcium of in vivo

synthesis of 1,25-dihydroxycholecalciferol and 21,25-dihydroxycholecalciferol. Proc

Natl Acad Sci USA 68(9): 2131-4.

Brenza HL and DeLuca HF. 2000. Regulation of 25-hydroxyvitamin D3 1alpha-

hydroxylase gene expression by parathyroid hormone and 1,25-dihydroxyvitamin D3.

Arch Biochem Biophys 381(1): 143-52.

232

Brenza HL, Kimmel-Jehan C, Jehan F, Shinki T, Wakino S, Anazawa H, Suda T and

DeLuca HF. 1998. Parathyroid hormone activation of the 25-hydroxyvitamin D3-

1alpha- hydroxylase gene promoter. Proc Natl Acad Sci USA 95(4): 1387-91.

Brown EM and Hebert SC. 1997. Calcium-receptor-regulated parathyroid and renal

function. Bone 20(4): 303-9.

Burmester JK, Maeda N and DeLuca HF. 1988(a). Isolation and expression of rat

1,25-dihydroxyvitamin D3 receptor cDNA. Proc Natl Acad Sci USA 85(4): 1005-9.

Burmester JK, Wiese RJ, Maeda N and DeLuca HF. 1988(b). Structure and regulation

of the rat 1,25-dihydroxyvitamin D3 receptor. Proc Natl Acad Sci USA 85(24): 9499-

502.

Bustin SA, Gyselman VG, Williams NS and Dorudi S. 1999. Detection of

cytokeratins 19/20 and guanylyl cyclase C in peripheral blood of colorectal cancer

patients. Br J Cancer 79(11-12): 1813-20.

Cali JJ, Russell DW. 1991. Characterization of human sterol 27-hydroxylase. A

mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile

acid biosynthesis. J Biol Chem 266(12): 7774-8.

Cantley LK, Russell J, Lettieri D and Sherwood LM. 1985. 1,25-Dihydroxyvitamin

D3 suppresses parathyroid hormone secretion from bovine parathyroid cells in tissue

233

culture. Endocrinology 117(5): 2114-9.

Celic S, Katayama Y, Chilco PJ, Martin TJ and Findlay DM. 1998. Type I collagen

influence on gene expression in UMR106-06 osteoblast-like cells is inhibited by

genistein. J Endocrinol 158(3): 377-88.

Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H,

Montminy M and Evans RM. 1996. Role of CBP/P300 in nuclear receptor signalling.

Nature 383(6595): 99-103.

Chan YL, McKay C, Dye E and Slatopolsky E. 1986. The effect of 1,25

dihydroxycholecalciferol on parathyroid hormone secretion by monolayer cultures of

bovine parathyroid cells. Calcif Tissue Int 38(1): 27-32.

Chang W, Tu C, Pratt S, Chen TH and Shoback D. 2002. Extracellular Ca2+-Sensing

Receptors Modulate Matrix Production and Mineralization in Chondrogenic

RCJ3.1C5.18 Cells. Endocrinology 143(4): 1467-74.

Chapuy MC, Arlot ME, Duboeuf F, Brun J, Crouzet B, Arnaud S, Delmas PD,

Meunier PJ. 1992. Vitamin D3 and calcium to prevent hip fractures in the elderly

women. N Engl J Med 327(23): 1637-42.

Chen KS and DeLuca HF. 1995. Cloning of the human 1 alpha,25-dihydroxyvitamin

D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive

elements. Biochim Biophys Acta 1263(1): 1-9.

234

Chen ML, Boltz MA, Armbrecht HJ. 1993. Effects of 1,25-dihydroxyvitamin D3 and

phorbol ester on 25-hydroxyvitamin D3 24-hydroxylase cytochrome P450 messenger

ribonucleic acid levels in primary cultures of rat renal cells. Endocrinology 132(4):

1782-8.

Chen TL, Hauschka PV and Feldman D. 1986(a). Dexamethasone increases 1,25-

dihydroxyvitamin D3 receptor levels and augments bioresponses in rat osteoblast-like

cells. Endocrinology 118(3): 1119-26.

Chen TL, Li JM, Ye TV, Cone CM and Feldman D. 1986(b). Hormonal responses to

1,25-dihydroxyvitamin D3 in cultured mouse osteoblast-like cells--modulation by

changes in receptor level. J Cell Physiol 126(1): 21-8.

Chomczynski P and Sacchi N. 1987. Single-step method of RNA isolation by acid

guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162(1): 156-9.

Choong PF, Martin TJ and Ng KW. 1993. Effects of ascorbic acid, calcitriol, and

retinoic acid on the differentiation of preosteoblasts. J Orthop Res 11(5): 638-47.

Clark SA, Boass A and Toverud SU. 1987. Effects of high dietary contents of calcium

and phosphorus on mineral metabolism and growth of vitamin D-deficient suckling

and weaned rats. Bone Miner 2(4): 257-70.

235

Clemens TL, Garrett KP, Zhou XY, Pike JW, Haussler MR and Dempster DW. 1988.

Immunocytochemical localization of the 1,25-dihydroxyvitamin D3 receptor in target

cells. Endocrinology 122(4): 1224-30.

Clohisy DR, Bar-Shavit Z, Chappel JC and Teitelbaum SL. 1987. 1,25-

Dihydroxyvitamin D3 modulates bone marrow macrophage precursor proliferation

and differentiation. Up-regulation of the mannose receptor. Journal of Biological

Chemistry 262(33): 15922-9.

Cooke NE, Haddad JG. 1989. Vitamin D binding protein (Gc-globulin). Endocr Rev 10(3): 294-307.

Cooke NE, McLeod JF, Wang XK, Ray K. 1991. Vitamin D binding protein: genomic

structure, functional domains, and mRNA expression in tissues. J Steroid Biochem

Mol Biol 40(4-6): 787-93.

Costa EM and Feldman D. 1987. Modulation of 1,25-dihydroxyvitamin D3 receptor

binding and action by sodium butyrate in cultured pig kidney cells (LLC-PK1). J

Bone Miner Res 2(2): 151-9.

Darwish HM and DeLuca HF. 1996. Analysis of binding of the 1,25-

dihydroxyvitamin D3 receptor to positive and negative vitamin D response elements.

Arch Biochem Biophys 334(2): 223-34.

236

Davey RA, Hahn CN, May BK and Morris HA. 2000. Osteoblast gene expression in

rat long bones: effects of ovariectomy and dihydrotestosterone on mRNA levels.

Calcif Tissue Int 67(1): 75-9.

DeLuca HF. 1988. The vitamin D story: a collaborative effort of basic science and

clinical medicine. Faseb J 2(3): 224-36.

Demers C, Lemay J, Hendy GN and Gascon-Barre M. 1997. Comparative in vivo

expression of the calcitriol-24-hydroxylase gene in kidney and intestine. J Mol

Endocrinol 18(1): 37-48.

Dokoh S, Donaldson CA and Haussler MR. 1984. Influence of 1,25-dihydroxyvitamin

D3 on cultured osteogenic sarcoma cells: correlation with the 1,25-dihydroxyvitamin

D3 receptor. Cancer Res 44(5): 2103-9.

Dusso AS, Kamimura S, Gallieni M, Zhong M, Negrea L, Shapiro S and Slatopolsky

E. 1997. gamma-Interferon-induced resistance to 1,25-(Oh)2 D3 in human monocytes

and macrophages: a mechanism for the hypercalcemia of various granulomatoses. J

Clin Endocrinol Metab 82(7): 2222-32.

Dwivedi PP, Omdahl JL, Kola I, Hume DA and May BK. 2000. Regulation of rat

cytochrome P450C24 (CYP24) gene expression. Evidence for functional cooperation

of Ras-activated Ets transcription factors with the vitamin D receptor in 1,25-

dihydroxyvitamin D(3)-mediated induction. J Biol Chem 275(1): 47-55.

237

Ebeling PR, Sandgren ME, DiMagno EP, Lane AW, DeLuca HF and Riggs BL. 1992.

Evidence of an age-related decrease in intestinal responsiveness to vitamin D:

relationship between serum 1,25-dihydroxyvitamin D3 and intestinal vitamin D

receptor concentrations in normal women. J Clin Endocrinol Metab 75(1): 176-82.

Econs MJ, Lobaugh B and Drezner MK. 1992. Normal calcitonin stimulation of

serum calcitriol in patients with X- linked hypophosphatemic rickets. J Clin

Endocrinol Metab 75(2): 408-11.

Eriksen EF, Steiniche T, Mosekilde L, Melsen F. 1989. Histomorphometric analysis

of bone in metabolic bone disease. Endocrinol Metab Clin North Am 18(4): 919-54.

Eto TA, Nakamura Y, Taniguchi T, Miyamoto K, Nagatomo J, Maeda Y, Higashi S,

Okuda K and Setoguchi T. 1998. Assay of 25-hydroxyvitamin D3 1 alpha-

hydroxylase in rat kidney mitochondria. Anal Biochem 258(1): 53-8.

Forrest SM, Ng KW, Findlay DM, Michelangeli VP, Livesey SA, Partridge NC, Zajac

JD and Martin TJ. 1985. Characterization of an osteoblast-like clonal cell line, which

responds to both parathyroid hormone and calcitonin. Calcif Tissue Int 37(1): 51-6.

Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P and Blanchard JM.

1985. Various rat adult tissues express only one major mRNA species from the

glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res

13(5): 1431-42.

238

Fox J, Kollenkirchen U and Walters MR. 1991. Deficiency of vitamin D metabolites

directly stimulates renal 25- hydroxyvitamin D3-1-hydroxylase activity in rats.

Metabolism 40(4): 438-41.

Fraser DR and Kodicek E. 1973. Regulation of 25-hydroxycholecalciferol-1-

hydroxylase activity in kidney by parathyroid hormone. Nat New Biol 241(110): 163-

6.

Friedman PA, Gesek FA. 1993. Vitamin D3 accelerates PTH-dependent calcium

transport in distal convoluted tubule cells. Am J Physiol 265(2 Pt 2): F300-8.

Frolich A, Nielsen BF and Transbol I. 1990. Respective roles of 25 hydroxy-vitamin

D, PTH, phosphate and renal function for the 1-alpha-hydroxylase activity in primary

hyperparathyroidism. Miner Electrolyte Metab 16(4): 210-5.

Fu GK, Lin D, Zhang MY, Bikle DD, Shackleton CH, Miller WL and Portale AA,

1997(a). Cloning of human 25-hydroxyvitamin D-1 alpha-hydroxylase and mutations

causing vitamin D-dependent rickets type 1. Mol Endocrinol 11(13): 1961-70.

Fu GK, Portale AA, Miller WL. 1997(b). Complete structure of the human gene for

the vitamin D 1alpha-hydroxylase, P450c1alpha. DNA Cell Biol 16(12): 1499-507

Furuichi T, Kawata S, Asoh Y, Kumaki K and Ohyama Y. 1998. Differential time

course of induction of 1alpha,25-dihydroxyvitamin D3- 24-hydroxylase mRNA

expression in rats by 1alpha,25-dihydroxyvitamin D3 and its analogs. Life Sci 62(5):

453-9.

239

Galante L, Colston KW, MacAuley SJ, MacIntyre I. 1972. Effect of calcitonin on

vitamin D metabolism. Nature 238(5362): 271-3.

Gallagher JC, Riggs BL. 1990. Action of 1,25-dihydroxyvitamin D3 on calcium

balance and bone turnover and its effect on vertebral fracture rate. Metabolism 39(4

Suppl 1): 30-4.

Gallagher JC and Riggs BL. 1978. Current concepts in nutrition. Nutrition and bone

disease. N Engl J Med 298(4): 193-5.

Gallagher JC, Riggs B, Eisman J, Hamstra A, Arnaud SB, DeLuca HF. 1979.

Intestinal calcium absorption and serum vitamin D metabolites in normal subjects and

osteoporotic patients: effect of age and dietary calcium. J Clin Invest 64(3): 729-36.

Gao XH, Dwivedi PP, Choe S, Alba F, Morris HA, Omdahl JL, May BK. 2002. Basal

and parathyroid hormone induced expression of the human 25-hydroxyvitamin D

1alpha-hydroxylase gene promoter in kidney AOK-B50 cells: role of Sp1, Ets and

CCAAT box protein binding sites. Int J Biochem Cell Biol 34(8): 921-30.

Garabedian M, Holick MF, Deluca HF and Boyle IT. 1972. Control of 25-

hydroxycholecalciferol metabolism by parathyroid glands. Proc Natl Acad Sci USA

69(7): 1673-6.

240

Garrett JE, Tamir H, Kifor O, Simin RT, Rogers KV, Mithal A, Gagel RF and Brown

EM. 1995. Calcitonin-secreting cells of the thyroid express an extracellular calcium

receptor gene. Endocrinology 136(11): 5202-11.

Glass CK, Rose DW, Rosenfeld MG. 1997. Nuclear receptor coactivators. Curr Opin

Cell Biol 9(2): 222-32.

Goff JP, Reinhardt TA, Beckman MJ and Horst RL. 1990. Contrasting effects of

exogenous 1,25-dihydroxyvitamin D [1,25-(OH)2D] versus endogenous 1,25-

(OH)2D, induced by dietary calcium restriction, on vitamin D receptors.


Gray TK and Cohen MS. 1985. Vitamin D, phagocyte differentiation and immune

function. Surv Immunol Res 4(3): 200-12.

Gray R, Boyle I and DeLuca HF. 1971. Vitamin D metabolism: the role of kidney

tissue. Science 172(989): 1232-4.

Gronthos S, Stewart K, Graves SE, Hay S and Simmons PJ. 1997. Integrin expression

and function on human osteoblast-like cells. J Bone Miner Res 12(8): 1189-97.

Gruber R, Czerwenka K, Wolf F, Ho GM, Willheim M and Peterlik M. 1999.

Expression of the vitamin D receptor, of estrogen and thyroid hormone receptor

alpha- and beta-isoforms, and of the androgen receptor in cultures of native mouse

bone marrow and of stromal/osteoblastic cells. Bone 24(5): 465-73.

241

Gyetko MR, Hsu CH, Wilkinson CC, Patel S and Young E. 1993. Monocyte 1 alpha-

hydroxylase regulation: induction by inflammatory cytokines and suppression by

dexamethasone and uremia toxin. J Leukoc Biol 54(1): 17-22.

Habel B and Glaser R. 1998. Human osteoblast-like cells respond not only to the

extracellular calcium concentration but also to its changing rate. Eur Biophys J 27(4):

411-6.

Hahn CN, Kerry DM, Omdahl JL and May BK. 1994. Identification of a vitamin D

responsive element in the promoter of the rat cytochrome P450(24) gene. Nucleic

Acids Res 22(12): 2410-6.

Henry HL. 1982. The role of parathyroid hormone in the regulation of the metabolism

of 25-hydroxyvitamin D3. Miner Electrolyte Metab 8(3-4): 179-87.

Henry HL. 1985. Parathyroid hormone modulation of 25-hydroxyvitamin D3

metabolism by cultured chick kidney cells is mimicked and enhanced by forskolin.


Henry H L. 1986. Influence of a tumor promoting phorbol ester on the metabolism of

25-hydroxyvitamin D3. Biochem Biophys Res Commun 139(2): 495-500.

Henry HL. 1992. Vitamin D hydroxylases. J Cell Biochem 49(1): 4-9.

242

Henry HL, Dutta C, Cunningham N, Blanchard R, Penny R, Tang C, Marchetto G and

Chou SY. 1992. The cellular and molecular regulation of 1,25(OH)2D3 production. J

Steroid Biochem Mol Biol 41(3-8): 401-7.

Henry HL and Luntao EM. 1989. Interactions between intracellular signals involved

in the regulation of 25-hydroxyvitamin D3 metabolism. Endocrinology 124(5): 2228-

34.

Henry HL, Midgett RJ and Norman AW. 1974. Regulation of 25-hydroxyvitamin D3-

1-hydroxylase in vivo. J Biol Chem 249(23): 7584-92.

Higuchi R, Fockler C, Dollinger G and Watson R. 1993. Kinetic PCR analysis: real-

time monitoring of DNA amplification reactions. Biotechnology (N Y) 11(9): 1026-

30.

Holland PM, Abramson RD, Watson R and Gelfand DH. 1991. Detection of specific

polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of

Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 88(16): 7276-80.

Hollis BW, Pittard WB 3rd, Reinhardt TA. 1986. Relationships among vitamin D, 25-

hydroxyvitamin D, and vitamin D-binding protein concentrations in the plasma and

milk of human subjects. J Clin Endocrinol Metab 62(1): 41-4.

Horiuchi N, Suda T, Takahashi H, Shimazawa E and Ogata E. 1977. In vivo evidence

for the intermediary role of 3',5'-cyclic AMP in parathyroid hormone-induced

243

stimulation of 1alpha,25-dihydroxyvitamin D3 synthesis in rats. Endocrinology

101(3): 969-74.

Horst RL, Goff JP and Reinhardt TA. 1990. Advancing age results in reduction of

intestinal and bone 1,25-dihydroxyvitamin D receptor. Endocrinology 126(2): 1053-7.

House MG, Kohlmeier L, Chattopadhyay N, Kifor O, Yamaguchi T, Leboff MS,

Glowacki J and Brown EM. 1997. Expression of an extracellular calcium-sensing

receptor in human and mouse bone marrow cells. J Bone Miner Res 12(12): 1959-70.

Howard GA, Turner RT, Sherrard DJ and Baylink DJ. 1981. Human bone cells in

culture metabolize 25-hydroxyvitamin D3 to 1,25-dihydroxyvitamin D3 and 24,25-

dihydroxyvitamin D3. J Biol Chem 256(15): 7738-40.

Ichikawa F, Sato K, Nanjo M, Nishii Y, Shinki T, Takahashi N and Suda T. 1995.

Mouse primary osteoblasts express vitamin D3 25-hydroxylase mRNA and convert 1

alpha-hydroxyvitamin D3 into 1 alpha,25-dihydroxyvitamin D3. Bone 16(1): 129-35.

Ikegame M, Rakopoulos M, Martin TJ, Moseley JM and Findlay DM. 1996. Effects

of continuous calcitonin treatment on osteoclast-like cell development and calcitonin

receptor expression in mouse bone marrow cultures. J Bone Miner Res 11(4): 456-65.

Ishida M, Bulos B, Takamoto S and Sacktor B. 1987. Hydroxylation of 25-

hydroxyvitamin D3 by renal mitochondria from rats of different ages. Endocrinology

121(2): 443-8.

244

Itoh S, Yoshimura T, Iemura O, Yamada E, Tsujikawa K, Kohama Y and Mimura T.

1995. Molecular cloning of 25-hydroxyvitamin D-3 24-hydroxylase (Cyp-24) from

mouse kidney: its inducibility by vitamin D-3. Biochim Biophys Acta 1264(1): 26-8.

Janulis M, Tembe V and Favus MJ. 1992. Role of protein kinase C in parathyroid

hormone stimulation of renal 1,25-dihydroxyvitamin D3 secretion. J Clin Invest

90(6): 2278-83.

Jenis LG, Lian JB, Stein GS and Baran DT. 1993. 1 alpha,25-dihydroxyvitamin D3-

induced changes in intracellular pH in osteoblast-like cells modulate gene expression.

J Cell Biochem 53(3): 234-9.

Johnson JA, Beckman MJ, Pansini-Porta A, Christakos S, Bruns ME, Beitz DC, Horst

RL and Reinhardt TA. 1995. Age and gender effects on 1,25-dihydroxyvitamin D3-

regulated gene expression. Exp Gerontol 30(6): 631-43.

Jones G, Strugnell SA and DeLuca HF. 1998. Current understanding of the molecular

actions of vitamin D. Physiol Rev 78(4): 1193-231.

Kalu DN, Cockerham R, Yu BP and Roos BA. 1983. Lifelong dietary modulation of

calcitonin levels in rats. Endocrinology 113(6): 2010-6.

245

Kalu DN, Herbert DC, Hardin RR, Yu BP, Kaplan G and Jacobs JW. 1988.

Mechanism of dietary modulation of calcitonin levels in Fischer rats. J Gerontol

43(5): B125-31.

Kamei Y, Kawada T, Fukuwatari T, Ono T, Kato S and Sugimoto E. 1995. Cloning

and sequencing of the gene encoding the mouse vitamin D receptor. Gene 152(2):

281-2.

Kawashima H, Torikai S, Kurokawa K. 1981. Calcitonin selectively stimulates 25-

hydroxyvitamin D3-1 alpha-hydroxylase in proximal straight tubule of rat kidney.

Nature 291(5813): 327-9.

Kerry DM, Dwivedi PP, Hahn CN, Morris HA, Omdahl JL and May BK. 1996.

Transcriptional synergism between vitamin D-responsive elements in the rat 25-

hydroxyvitamin D3 24-hydroxylase (CYP24) promoter. J Biol Chem 271(47): 29715-

21.

Klaus G, von Eichel B, May T, Hugel U, Mayer H, Ritz E and Mehls O. 1994.

Synergistic effects of parathyroid hormone and 1,25-dihydroxyvitamin D3 on

proliferation and vitamin D receptor expression of rat growth cartilage cells.


Knutson JC, DeLuca HF. 1974. 25-Hydroxyvitamin D3-24-hydroxylase. Subcellular

location and properties. Biochemistry 13(7): 1543-8.

246

Korkor AB, Gray RW, Henry HL, Kleinman JG, Blumenthal SS and Garancis JC.

1987. Evidence that stimulation of 1,25(OH)2D3 production in primary cultures of

mouse kidney cells by cyclic AMP requires new protein synthesis. J Bone Miner Res

2(6): 517-24.

Koszewski NJ, Reinhardt TA, Beitz DC and Horst RL. 1990. Developmental changes

in rat kidney 1,25-dihydroxyvitamin D receptor. Biochem Biophys Res Commun

170(1): 65-72.

Kraichely DM and MacDonald PN. 1998. Transcriptional activation through the

vitamin D receptor in osteoblasts. Front Biosci 3: D821-33.

Kreutz M, Andreesen R, Krause SW, Szabo A, Ritz E and Reichel H. 1993. 1,25-

dihydroxyvitamin D3 production and vitamin D3 receptor expression are

developmentally regulated during differentiation of human monocytes into

macrophages. Blood 82(4): 1300-7.

Krishnan AV, Cramer SD, Bringhurst FR and Feldman D. 1997. Regulation of 1,25-

dihydroxyvitamin D3 receptors by parathyroid hormone in osteoblastic cells: role of

second messenger pathways. Endocrinology 136(2): 705-12.

Kumar R. 1984. Metabolism of 1,25-dihydroxyvitamin D3. Physiol Rev 64(2): 478-

504.

247

Kumar R, Schnoes HK and DeLuca HF. 1978. Rat intestinal 25-hydroxyvitamin D3-

and 1alpha,25-dihydroxyvitamin D3- 24-hydroxylase. J Biol Chem 253(11): 3804-9.

Langdahl BL, Mortensen L, Vesterby A, Eriksen EF, Charles P. 1996. Bone

histomorphometry in hypoparathyroid patients treated with vitamin D. Bone 18(2):

103-8.

Langub MC, Reinhardt TA, Horst RL, Malluche HH and Koszewski NJ. 2000.

Characterization of vitamin D receptor immunoreactivity in human bone cells. Bone

27(3): 383-7.

Lee LG, Connell CR and Bloch W. 1993. Allelic discrimination by nick-translation

PCR with fluorogenic probes. Nucleic Acids Res 21(16): 3761-6.

Lemay J, Demers C, Hendy GN, Delvin EE and Gascon-Barre M. 1995. Expression

of the 1,25-dihydroxyvitamin D3-24-hydroxylase gene in rat intestine: response to

calcium, vitamin D3 and calcitriol administration in vivo. J Bone Miner Res 10(8):

1148-57.

Lemire JM, Adams JS, Kermani-Arab V, Bakke AC, Sakai R and Jordan SC. 1985.

1,25-Dihydroxyvitamin D3 suppresses human T helper/inducer lymphocyte activity in

vitro. J Immunol 134(5): 3032-5.

248

Lemire JM, Adams JS, Sakai R and Jordan SC. 1984. 1 alpha,25-dihydroxyvitamin

D3 suppresses proliferation and immunoglobulin production by normal human

peripheral blood mononuclear cells. J Clin Invest 74(2): 657-61.

Lemire JM and Archer DC. 1991. 1,25-dihydroxyvitamin D3 prevents the in vivo

induction of murine experimental autoimmune encephalomyelitis. J Clin Invest 87(3):

1103-7.

Leutenegger CM, von Rechenberg B, Huder JB, Zlinsky K, Mislin C, Akens MK,

Auer J and Lutz H. 1999. Quantitative real-time PCR for equine cytokine mRNA in

nondecalcified bone tissue embedded in methyl methacrylate. Calcif Tissue Int 65(5):

378-83.

Li YC, Amling M, Pirro AE, Priemel M, Meuse J, Baron R, Delling G and Demay

MB. 1998(a). Normalization of mineral ion homeostasis by dietary means prevents

hyperparathyroidism, rickets, and osteomalacia, but not alopecia in vitamin D

receptor-ablated mice. Endocrinology 139(10): 4391-6.

Li YC, Bolt MJ, Cao LP and Sitrin MD. 2001. Effects of vitamin D receptor

inactivation on the expression of calbindins and calcium metabolism. Am J Physiol

Endocrinol Metab 281(3): E558-64.

Li YC, Pirro AE and Demay MB. 1998(b). Analysis of vitamin D-dependent calcium-

binding protein messenger ribonucleic acid expression in mice lacking the vitamin D

receptor. Endocrinology 139(3): 847-51.

249

Lidor C, Sagiv P, Amdur B, Gepstein R, Otremski I, Hallel T and Edelstein S. 1993.

Decrease in bone levels of 1,25-dihydroxyvitamin D in women with subcapital

fracture of the femur. Calcif Tissue Int 52(2): 146-8.

Liu SM, Koszewski N, Lupez M, Malluche HH, Olivera A and Russell J. 1996.

Characterization of a response element in the 5'-flanking region of the avian (chicken)

PTH gene that mediates negative regulation of gene transcription by 1,25-

dihydroxyvitamin D3 and binds the vitamin D3 receptor. Mol Endocrinol 10(2): 206-

15.

Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, Wainscoat JS, Johnson

PJ, Chang AM and Hjelm NM. 1998. Quantitative analysis of fetal DNA in maternal

plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet

62(4): 768-75.

Lobaugh B, Garner SC, Lovdal JA, Boass A, Toverud SU. 1993. Parathyroidectomy

abolishes the increase of renal 25-hydroxyvitamin D-1 alpha-hydroxylase in lactating

rats. Am J Physiol 264(6 Pt 1): E981-5.

Lockey C, Otto E and Long Z. 1998. Real-time fluorescence detection of a single

DNA molecule. Biotechniques 24(5): 744-6.

Lore F, Galli M, Franci B and Martorelli MT. 1984. Calcitonin levels in normal

subjects according to age and sex. Biomed Pharmacother 38(5): 261-3.

250

Lorenc R, Tanaka Y, DeLuca HF, Jones G. 1977. Lack of effect of calcitonin on the

regulation of vitamin D metabolism in the rat. Endocrinology 100(2): 468-72.

Lu CC, Tsai SC, Wang SW, Huang WJ and Wang PS. 1998. Age-related differences

in the secretion of calcitonin in female rats. Am J Physiol 275(5 Pt 1): E735-9.

Mahonen A and Maenpaa PH. 1994. Steroid hormone modulation of vitamin D

receptor levels in human MG-63 osteosarcoma cells. Biochem Biophys Res Commun

205(2): 1179-86.

Makin G, Lohnes D, Byford V, Ray R and Jones G. 1989. Target cell metabolism of

1,25-dihydroxyvitamin D3 to calcitroic acid. Evidence for a pathway in kidney and

bone involving 24-oxidation. Biochem J 262(1): 173-80.

Mandel ML, Moorthy B and Ghazarian JG. 1990. Reciprocal post-translational

regulation of renal 1 alpha- and 24-hydroxylases of 25-hydroxyvitamin D3 by

phosphorylation of ferredoxin. mRNA-directed cell-free synthesis and

immunoisolation of ferredoxin. Biochem J 266(2): 385-92.

Mandla S, Boneh A and Tenenhouse HS. 1990. Evidence for protein kinase C

involvement in the regulation of renal 25-hydroxyvitamin D3-24-hydroxylase.


251

Mandla S and Tenenhouse HS. 1992. Inhibition of 25-hydroxyvitamin D3-24-

hydroxylase by forskolin: evidence for a 3',5'-cyclic adenosine monophosphate-

independent mechanism. Endocrinology 130(4): 2145-51.

Martin TJ. 1999. Calcitonin, an update. Bone 24(5 Suppl): 63S-65S.

Martinez P, Moreno I, De Miguel F, Vila V, Esbrit P and Martinez ME. 2001.

Changes in osteocalcin response to 1,25-dihydroxyvitamin D(3) stimulation and basal

vitamin D receptor expression in human osteoblastic cells according to donor age and

skeletal origin. Bone 29(1): 35-41.

Masuda S, Strugnell S, Calverley MJ, Makin HL, Kremer R and Jones G. 1994. In

vitro metabolism of the anti-psoriatic vitamin D analog, calcipotriol, in two cultured

human keratinocyte models. J Biol Chem 269(7): 4794-803.

Matkovits T and Christakos S. 1995. Variable in vivo regulation of rat vitamin D-

dependent genes (osteopontin, Ca,Mg-adenosine triphosphatase, and 25-

hydroxyvitamin D3 24-hydroxylase): implications for differing mechanisms of

regulation and involvement of multiple factors. Endocrinology 136(9): 3971-82.

Matsumoto T, Igarashi C, Takeuchi Y, Harada S, Kikuchi T, Yamato H and Ogata E.

1991. Stimulation by 1,25-dihydroxyvitamin D3 of in vitro mineralization induced by

osteoblast-like MC3T3-E1 cells. Bone 12(1): 27-32.

252

Matsumoto T, Ikeda K, Morita K, Fukumoto S, Takahashi H and Ogata E. 1987.

Blood Ca2+ modulates responsiveness of renal 25(OH)D3-1 alpha- hydroxylase to

PTH in rats. Am J Physiol 253(5 Pt 1): E503-7.

Matsumoto T, Kawanobe Y and Ogata E. 1985. Regulation of 24,25-

dihydroxyvitamin D-3 production by 1,25-dihydroxyvitamin D-3 and synthetic human

parathyroid hormone fragment 1-34 in a cloned monkey kidney cell line (JTC-12).

Biochim Biophys Acta 845(3): 358-65.

McDonnell DP, Mangelsdorf DJ, Pike JW, Haussler MR and O'Malley BW. 1987.

Molecular cloning of complementary DNA encoding the avian receptor for vitamin D.

Science 235(4793): 1214-7.

McSheehy PM and Chambers TJ. 1986. Osteoblast-like cells in the presence of

parathyroid hormone release soluble factor that stimulates osteoclastic bone

resorption. Endocrinology 119(4): 1654-9.

Merke J, Nawrot M, Hugel U, Szabo A and Ritz E. 1989. Evidence for in vivo

upregulation of 1,25(OH)2 vitamin D3 receptor in human monocytes. Calcif Tissue

Int 45(4): 255-6.

Meszaros JG and Farach-Carson MC. 1997. Assay of direct effect of 1,25-

dihydroxyvitamin D3 on calcium ion influx into cultured osteoblasts. Methods

Enzymol 282: 236-43.

253

Miyamoto Y, Shinki T, Yamamoto K, Ohyama Y, Iwasaki H, Hosotani R, Kasama T,

Takayama H, Yamada S and Suda T. 1997. 1alpha,25-dihydroxyvitamin D3-24-

hydroxylase (CYP24) hydroxylates the carbon at the end of the side chain (C-26) of

the C-24-fluorinated analog of 1alpha,25-dihydroxyvitamin D3. J Biol Chem 272(22):

14115-9.

Monkawa T, Yoshida T, Wakino S, Shinki T, Anazawa H, Deluca HF, Suda T,

Hayashi M and Saruta T. 1997. Molecular cloning of cDNA and genomic DNA for

human 25-hydroxyvitamin D3 1 alpha-hydroxylase. Biochem Biophys Res Commun

239(2): 527-33.

Moorehead WR and Biggs HG. 1974. 2-Amino-2-methyl-1-propanol as the alkalizing

agent in an improved continuous-flow cresolphthalein complexone procedure for

calcium in serum. Clin Chem 20(11): 1458-60.

Morgan DB. 1972. Calcium and phosphate metabolism and the bone. Prog Surg 10:

24-75.

Murayama A, Takeyama K, Kitanaka S, Kodera Y, Hosoya T and Kato S. 1998. The

promoter of the human 25-hydroxyvitamin D3 1 alpha-hydroxylase gene confers

positive and negative responsiveness to PTH, calcitonin, and 1 alpha, 25(OH)2D3.

Biochem Biophys Res Commun 249(1): 11-6.

Murayama A, Takeyama K, Kitanaka S, Kodera Y, Kawaguchi Y, Hosoya T and Kato

S. 1999. Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alpha-

254

hydroxylase gene by parathyroid hormone, calcitonin, and 1alpha, 25(OH)2D3 in

intact animals. Endocrinology 140(5): 2224-31.

Murayama A, Kim M, Unno K, Takeyama K and Kato S. 2001. A novel mechanism

of the vitamin Ddependant transcriptional repression through the human 25-

hydroxyvitamin D3-1α-hydroxylase nVDRE. J Bone Miner Res 16:S229

Nakagawa K, Tsugawa N, Okamoto T, Kishi T, Ono T, Kubodera N and Okano T.

1999. Rapid control of transmembrane calcium influx by 1alpha,25-dihydroxyvitamin

D3 and its analogues in rat osteoblast-like cells. Biol Pharm Bull 22(10): 1058-63.

Neer RM, Holick MF, DeLuca HF and Potts JT Jr. 1975. Effects of 1alpha-hydroxy-

vitamin D3 and 1,25-dihydroxy-vitamin D3 on calcium and phosphorus metabolism

in hypoparathyroidism. Metabolism 24(12): 1403-13.

Nesbitt T and Drezner MK. 1990. Abnormal parathyroid hormone-related peptide

stimulation of renal 25- hydroxyvitamin D-1-hydroxylase in Hyp mice: evidence for a

generalized defect of enzyme activity in the proximal convoluted tubule.


Nesbitt T, Drezner MK and Lobaugh B. 1986. Abnormal parathyroid hormone

stimulation of 25-hydroxyvitamin D-1 alpha- hydroxylase activity in the

hypophosphatemic mouse. Evidence for a generalized defect of vitamin D

metabolism. J Clin Invest 77(1): 181-7.

255

Nesbitt T, Lobaugh B and Drezner MK. 1987. Calcitonin stimulation of renal 25-

hydroxyvitamin D-1 alpha-hydroxylase activity in hypophosphatemic mice. Evidence

that the regulation of calcitriol production is not universally abnormal in X-linked

hypophosphatemia. J Clin Invest 79(1): 15-9.

Nishimura A, Shinki T, Jin CH, Ohyama Y, Noshiro M, Okuda K and Suda T. 1994.

Regulation of messenger ribonucleic acid expression of 1 alpha,25- dihydroxyvitamin

D3-24-hydroxylase in rat osteoblasts. Endocrinology 134(4): 1794-9.

Nordin BE. 1997. Calcium and osteoporosis. Nutrition 13(7-8): 664-86.

Nordin BE and Morris HA. 1992. Osteoporosis and vitamin D. J Cell Biochem 49(1):

19-25.

Nordin BE, Need AG, Steurer T, Morris HA, Chatterton BE and Horowitz M. 1998.

Nutrition, osteoporosis, and aging. Ann N Y Acad Sci 854: 336-51.

Ohtera K, Ishii S and Matsuyama T. 2001. Influence of the vitamin D receptor alleles

on human osteoblast-like cells. J Bone Joint Surg Br 83(1): 134-8.

Ohyama Y, Noshiro M, Eggertsen G, Gotoh O, Kato Y, Bjorkhem I and Okuda K.

1993. Structural characterization of the gene encoding rat 25-hydroxyvitamin D3 24-

hydroxylase. Biochemistry 32(1): 76-82.

256

Ohyama Y, Noshiro M and Okuda K. 1991(a). Cloning and expression of cDNA

encoding 25-hydroxyvitamin D3 24- hydroxylase. FEBS Lett 278(2): 195-8.

Ohyama Y and Okuda K. 1991(b). Isolation and characterization of a cytochrome P-

450 from rat kidney mitochondria that catalyzes the 24-hydroxylation of 25-

hydroxyvitamin D3. J Biol Chem 266(14): 8690-5.

Ohyama Y, Ozono K, Uchida M, Shinki T, Kato S, Suda T, Yamamoto O, Noshiro M

and Kato Y. 1994. Identification of a vitamin D-responsive element in the 5'-flanking

region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene. J Biol Chem 269(14):

10545-50.

Okuda K, Usui E and Ohyama Y. 1995. Recent progress in enzymology and

molecular biology of enzymes involved in vitamin D metabolism. J Lipid Res 36(8):

1641-52.

Oliveira JG, Prados RZ, Guedes AC, Ferreira PC and Kroon EG. 1999. The

housekeeping gene glyceraldehyde-3-phosphate dehydrogenase is inappropriate as

internal control in comparative studies between skin tissue and cultured skin

fibroblasts using Northern blot analysis. Arch Dermatol Res 291(12): 659-61.

O'Loughlin PD and Morris HA. 1994. Oophorectomy in young rats impairs calcium

balance by increasing intestinal calcium secretion. J Nutr 124(5): 726-31.

257

Orlando C, Pinzani P and Pazzagli M. 1998. Developments in quantitative PCR. Clin

Chem Lab Med 36(5): 255-69.

Overbergh L, Valckx D, Waer M and Mathieu C. 1999. Quantification of murine

cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine

11(4): 305-12.

Page K. 1977. Bone and preparation of bone sections. In: Bancroft J.D, Stevens, A.

(eds) Theory and Practise of Histological Techniques. 1st edition, Churchill

Livingstone, London, pp 223-48.

Panda DK, Al Kawas S, Seldin MF, Hendy GN and Goltzman D. 2001(a). 25-

hydroxyvitamin D 1alpha-hydroxylase: structure of the mouse gene, chromosomal

assignment, and developmental expression. J Bone Miner Res 16(1): 46-56.

Panda DK, Miao D, Tremblay ML, Sirois J, Farookhi R, Hendy GN and Goltzman D.

2001(b). Targeted ablation of the 25-hydroxyvitamin D 1alpha -hydroxylase enzyme:

evidence for skeletal, reproductive, and immune dysfunction. Proc Natl Acad Sci

USA 98(13): 7498-503.

Papapoulos SE, van der Berg H, Frolich M and Valentijn RM. 1988. Circulating 1,25-

dihydroxycholecalciferol after intravenous injections of 1 alpha-

hydroxycholecalciferol in patients on regular haemodialysis. Nephrol Dial Transplant

3(5): 647-50.

258

Papapoulos SE, Clemens TL, Fraher LJ, Lewin IG, Sandler LM and O'Riordan JL.

1979. 1, 25-dihydroxycholecalciferol in the pathogenesis of the hypercalcaemia of

sarcoidosis. Lancet 1(8117): 627-30.

Parfitt AM, Han ZH, Palnitkar S, Rao DS, Shih MS and Nelson D. 1997. Effects of

ethnicity and age or menopause on osteoblast function, bone mineralization, and

osteoid accumulation in iliac bone. J Bone Miner Res 12(11): 1864-73.

Pettifor JM, Marie PJ, Sly MR, du Bruyn, DB, Ross F, Isdale JM, de Klerk WA and

van der Walt WH. 1984. The effect of differing dietary calcium and phosphorus

contents on mineral metabolism and bone histomorphometry in young vitamin D-

replete baboons. Calcif Tissue Int 36(6): 668-76.

Pikuleva IA, Bjorkhem I and Waterman MR. 1997. Expression, purification, and

enzymatic properties of recombinant human cytochrome P450c27 (CYP27). Arch

Biochem Biophys 343(1): 123-30.

Pols HA, Birkenhager JC, Schilte JP and Visser TJ. 1988. Evidence that the self-

induced metabolism of 1,25-dihydroxyvitamin D-3 limits the homologous up-

regulation of its receptor in rat osteosarcoma cells. Biochim Biophys Acta 970(2):

122-9.

Pols HA, Birkenhager JC, Schilte JP, Bos MP and van Leeuwen JP. 1991. The effects

of MC903 on 1,25-(OH)2D3 receptor binding, 24-hydroxylase activity and in vitro

bone resorption. Bone Miner 14(2): 103-11.

259

Pondel M. 2000. Calcitonin and calcitonin receptors: bone and beyond. Int J Exp

Pathol 81(6): 405-22.

Portale AA and Miller WL. 2000. Human 25-hydroxyvitamin D-1alpha-hydroxylase:

cloning, mutations, and gene expression. Pediatr Nephrol 14(7): 620-5.

Pryke AM, Duggan C, White CP, Posen S and Mason RS. 1990. Tumor necrosis

factor-alpha induces vitamin D-1-hydroxylase activity in normal human alveolar

macrophages. J Cell Physiol 142(3): 652-6.

Puzas JE, Turner RT, Howard GA, Brand JS, Baylink DJ. 1987. Synthesis of 1,25-

dihydroxycholecalciferol and 24,25-dihydroxycholecalciferol by calvarial cells.

Characterization of the enzyme systems. Biochem J 245(2): 333-8.

Rader JI, Howard GA, Feist E, Turner RT and Baylink DJ. 1979. Bone mineralization

and metabolism of 3H-25-hydroxyvitamin D3 in thyroparathyroidectomized rats

treated with parathyroid extract. Calcif Tissue Int 29(1): 21-6.

Rasmussen H, Wong M, Bikle D and Goodman DB. 1972. Hormonal control of the

renal conversion of 25-hydroxycholecalciferol to 1,25-dihydroxycholecalciferol. J

Clin Invest 51(9): 2502-4.

260

Reddy GS, Tserng KY. 1989. Calcitroic acid, end product of renal metabolism of

1,25- dihydroxyvitamin D3 through C-24 oxidation pathway. Biochemistry 28(4):

1763-9.

Reichel H, Bishop JE, Koeffler HP and Norman AW. 1991. Evidence for 1,25-

dihydroxyvitamin D3 production by cultured porcine alveolar macrophages. Mol Cell

Endocrinol 75(2): 163-7.

Reichel H, Koeffler HP, Barbers R and Norman AW. 1987(a). Regulation of 1,25-

dihydroxyvitamin D3 production by cultured alveolar macrophages from normal

human donors and from patients with pulmonary sarcoidosis. J Clin Endocrinol Metab

65(6): 1201-9.

Reichel H, Koeffler HP, Bishop JE and Norman AW. 1987(b). 25-Hydroxyvitamin

D3 metabolism by lipopolysaccharide-stimulated normal human macrophages. J Clin


Reichel H, Koeffler HP and Norman AW. 1987(c). 25-Hydroxyvitamin D3

metabolism by human T-lymphotropic virus- transformed lymphocytes. J Clin


Reichel H, Koeffler HP and Norman AW. 1987(d). Synthesis in vitro of 1,25-

dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 by interferon-gamma-

stimulated normal human bone marrow and alveolar macrophages. J Biol Chem

262(23): 10931-7.

261

Reinhardt TA and Horst RL. 1990. Parathyroid hormone down-regulates 1,25-

dihydroxyvitamin D receptors (VDR) and VDR messenger ribonucleic acid in vitro

and blocks homologous up-regulation of VDR in vivo. Endocrinology 127(2): 942-8.

Reinhardt TA, Horst RL. 1989. Self-induction of 1,25-dihydroxyvitamin D3

metabolism limits receptor occupancy and target tissue responsiveness. J Biol Chem

264(27): 15917-21.

Reinholz GG and DeLuca HF. 1998. Inhibition of 25-hydroxyvitamin D3 production

by 1, 25-dihydroxyvitamin D3 in rats. Arch Biochem Biophys 355(1): 77-83.

Rickard DJ, Kazhdan I and Leboy PS. 1995. Importance of 1,25-dihydroxyvitamin D3

and the nonadherent cells of marrow for osteoblast differentiation from rat marrow

stromal cells. Bone 16(6): 671-8.

Rosenthal AM, Jones G, Kooh SW and Fraser D. 1980. 25-hydroxyvitamin D3

metabolism by isolated perfused rat kidney. Am J Physiol 239(1): E12-20.

Rost CR, Bikle DD and Kaplan RA. 1981. In vitro stimulation of 25-

hydroxycholecalciferol 1 alpha-hydroxylation by parathyroid hormone in chick

kidney slices: evidence for a role for adenosine 3',5'-monophosphate. Endocrinology

108(3): 1002-6.

262

Roy S, Martel J and Tenenhouse HS. 1995. Comparative effects of 1,25-

dihydroxyvitamin D3 and EB 1089 on mouse renal and intestinal 25-hydroxyvitamin

D3-24-hydroxylase. J Bone Miner Res 10(12): 1951-9.

Sagiv P, Lidor C, Hallel T and Edelstein S. 1992. Decrease in bone level of 1,25-

dihydroxyvitamin D in women over 45 years old. Calcif Tissue Int 51(1): 24-6.

Sambrook J, Fritsch EF, Maniatis J. 1989. Molecular cloning, a laboratory manual. 2nd

ed. Cold Springs Harbour Laboratory Press, USA. Pp 141, 7.22, 7.8.

Sandgren ME and DeLuca HF. 1990. Serum calcium and vitamin D regulate 1,25-

dihydroxyvitamin D3 receptor concentration in rat kidney in vivo. Proc Natl Acad Sci

USA 87(11): 4312-4.

Santiso-Mere D, Sone T, Hilliard GM, Pike JW and McDonnell DP. 1993. Positive

regulation of the vitamin D receptor by its cognate ligand in heterologous expression

systems. Mol Endocrinol 7(7): 833-9.

Schaafsma G, Visser WJ, Dekker PR and Van Schaik M. 1987. Effect of dietary

calcium supplementation with lactose on bone in vitamin D-deficient rats. Bone 8(6):

357-62.

Sexton PM, Findlay DM and Martin TJ. 1999. Calcitonin. Curr Med Chem 6(11):

1067-93.

263

Shalhoub V, Aslam F, Breen E, van Wijnen A, Bortell R, Stein GS, Stein JL and Lian

JB. 1998. Multiple levels of steroid hormone-dependent control of osteocalcin during

osteoblast differentiation: glucocorticoid regulation of basal and vitamin D stimulated

gene expression. J Cell Biochem 69(2): 154-68.

Shigematsu T, Horiuchi N, Ogura Y, Miyahara T and Suda T. 1986. Human

parathyroid hormone inhibits renal 24-hydroxylase activity of 25- hydroxyvitamin D3

by a mechanism involving adenosine 3',5'- monophosphate in rats. Endocrinology

118(4): 1583-9.

Shinki T.1998. Cloning and expression of 25-hydroxyvitamin D3-1 alpha-

hydroxylase gene. Nippon Rinsho 56(6): 1440-6.

Shinki T, Jin CH, Nishimura A, Nagai Y, Ohyama Y, Noshiro M, Okuda K and Suda

T. 1992. Parathyroid hormone inhibits 25-hydroxyvitamin D3-24-hydroxylase mRNA

expression stimulated by 1 alpha,25-dihydroxyvitamin D3 in rat kidney but not in

intestine. J Biol Chem 267(19): 13757-62.

Shinki T, Shimada H, Wakino S, Anazawa H, Hayashi M, Saruta T, DeLuca HF and

Suda T. 1997. Cloning and expression of rat 25-hydroxyvitamin D3-1alpha-

hydroxylase cDNA. Proc Natl Acad Sci USA 94(24): 12920-5.

Shinki, T, Ueno, Y, DeLuca, H. F. and Suda, T. 1999. Calcitonin is a major regulator

for the expression of renal 25-hydroxyvitamin D3-1alpha-hydroxylase gene in

normocalcemic rats. Proc Natl Acad Sci USA 96(14): 8253-8.

264

Spanos E, Freake H, MacAuley SJ and MacIntyre I. 1981. Regulation of vitamin D

metabolism by calcium and phosphate ions in isolated renal tubules. Biochem J

196(1): 187-93.

Staal A, van den Bemd GJ, Birkenhager JC, Pols HA and van Leeuwen JP. 1997.

Consequences of vitamin D receptor regulation for the 1,25- dihydroxyvitamin D3-

induced 24-hydroxylase activity in osteoblast-like cells: initiation of the C24-

oxidation pathway. Bone 20(3): 237-43.

Stanford CM, Jacobson PA, Eanes ED, Lembke LA and Midura RJ. 1995. Rapidly

forming apatitic mineral in an osteoblastic cell line (UMR 106-01 BSP). J Biol Chem

270(16): 9420-8.

St-Arnaud R, Arabian A, Travers R, Barletta F, Raval-Pandya M, Chapin K,

Depovere J, Mathieu C, Christakos S, Demay MB, Glorieux FH. 2000. Deficient

mineralization of intramembranous bone in vitamin D-24-hydroxylase-ablated mice is

due to elevated 1,25-dihydroxyvitamin D and not to the absence of 24,25-

dihydroxyvitamin D. Endocrinology 141(7): 2658-66.

St-Arnuad R, Messerlian S, Moir JM, Omdahl JL and Glorieux FH. 1997. The 25-

hydroxyvitamin D 1-alpha-hydroxylase gene maps to the pseudovitamin D-deficiency

rickets (PDDR) disease locus. J Bone Miner Res 12(10): 1552-9.

265

Strom M, Sandgren ME, Brown TA and DeLuca HF. 1989. 1,25-Dihydroxyvitamin

D3 up-regulates the 1,25-dihydroxyvitamin D3 receptor in vivo. Proc Natl Acad Sci

USA 86(24): 9770-3.

Suda T, Shinki T and Kurokawa K. 1994. The mechanisms of regulation of vitamin D

metabolism in the kidney. Curr Opin Nephrol Hypertens 3(1): 59-64.

Suda T, Udagawa N, Nakamura I, Miyaura C and Takahashi N. 1995. Modulation of

osteoclast differentiation by local factors. Bone 17(2 Suppl): 87S-91S.

Swarthout JT, D'Alonzo RC, Selvamurugan N and Partridge NC. 2002. Parathyroid

hormone-dependent signalling pathways regulating genes in bone cells. Gene 282(1-

2): 1-17.

Szabo A, Merke J, Beier E, Mall G and Ritz E. 1989. 1,25(OH)2 vitamin D3 inhibits

parathyroid cell proliferation in experimental uremia. Kidney Int 35(4): 1049-56.

Takamoto S, Seino Y, Sacktor B and Liang CT. 1990. Effect of age on duodenal 1,25-

dihydroxyvitamin D-3 receptors in Wistar rats. Biochim Biophys Acta 1034(1): 22-8.

Takeda S, Yoshizawa T, Nagai Y, Yamato H, Fukumoto S, Sekine K, Kato S,

Matsumoto T and Fujita T. 1999. Stimulation of osteoclast formation by 1,25-

dihydroxyvitamin D requires its binding to vitamin D receptor (VDR) in osteoblastic

cells: studies using VDR knockout mice. Endocrinology 140(2): 1005-8.

266

Takeda T, Arakawa M, Kuwano R. 1994. Organization and expression of the mouse

spot35/calbindin-D28k gene: identification of the vitamin D-responsive promoter

region. Biochem Biophys Res Commun 204(2): 889-97.

Takeyama K, Kitanaka S, Sato T, Kobori M, Yanagisawa J and Kato S. 1997. 25-

Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis. Science 277(5333):

1827-30.

Tanaka H, Abe E, Miyaura C, Kuribayashi T, Konno K, Nishii Y, Suda T. 1982. 1

alpha,25-Dihydroxycholecalciferol and a human myeloid leukaemia cell line (HL-60).

Biochem J 204(3): 713-19.

Tanaka Y, Castillo L and DeLuca HF. 1977. The 24-hydroxylation of 1,25-

dihydroxyvitamin D3. J Biol Chem 252(4): 1421-4.

Tanaka Y, Chen TC and Deluca HF. 1972. Dependence of 25-hydroxycholecalciferol-

1-hydroxylase regulation on RNA and protein synthesis. Arch Biochem Biophys

152(1): 291-8.

Tanaka Y and DeLuca HF. 1974. Stimulation of 24,25-dihydroxyvitamin D3

production by 1,25- dihydroxyvitamin D3. Science 183(130): 1198-200.

Tanaka Y and DeLuca HF. 1984. Rat renal 25-hydroxyvitamin D3 1- and 24-

hydroxylases: their in vivo regulation. Am J Physiol 246(2 Pt 1): E168-73.

267

Tanaka Y, Lorenc RS and DeLuca HF. 1975. The role of 1,25-dihydroxyvitamin D3

and parathyroid hormone in the regulation of chick renal 25-hydroxyvitamin D3-24-

hydroxylase. Arch Biochem Biophys 171(2): 521-6.

Thakker RV, Fraher LJ, Adami S and Karmali R. 1986. Circulating concentrations of

1,25-dihydroxyvitamin D3 in patients with primary hyperparathyroidism. Bone Miner

1(2): 137-44.

Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G, Grisar T, Igout

A and Heinen E. 1999. Housekeeping genes as internal standards: use and limits. J

Biotechnol 75(2-3): 291-5.

Tiegs RD, Body JJ, Barta JM and Heath H 3rd. 1986. Secretion and metabolism of

monomeric human calcitonin: effects of age, sex, and thyroid damage. J Bone Miner

Res 1(4): 339-49.

Tiosano D, Weisman Y and Hochberg Z. 1998. The role of the vitamin D receptor in

regulating vitamin D metabolism: a study of vitamin D-dependent rickets, type II. J

Clin Endocrinol Metab 86(5): 1908-12.

Tomon M, Tenenhouse HS, Jones G. 1990(a). 1,25-Dihydroxyvitamin D3-inducible

catabolism of vitamin D metabolites in mouse intestine. Am J Physiol 258(4 Pt 1):

G557-63.

268

Tomon M, Tenenhouse HS, Jones G. 1990(b). Expression of 25-hydroxyvitamin D3-

24-hydroxylase activity in Caco-2 cells. An in vitro model of intestinal vitamin D

catabolism. Endocrinology 126(6): 2868-75.

Toromanoff A, Ammann P, Mosekilde L, Thomsen JS and Riond JL. 1997.

Parathyroid hormone increases bone formation and improves mineral balance in

vitamin D-deficient female rats. Endocrinology 138(6): 2449-57.

Tsai CL, Wong TY, Tsai SC, Lau CP, Chen YZ, Hwang GS and Wang PS. 1991.

Age-related differences in the hypocalcemic effect of calcitonin and calcium excretion

in female rats. Chin J Physiol 34(4): 455-62.

Tso JY, Sun XH, Kao TH, Reece KS and Wu R. 1985. Isolation and characterization

of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic

complexity and molecular evolution of the gene. Nucleic Acids Res 13(7): 2485-502.

Tucker G 3rd, Gagnon RE, Haussler MR. 1973. Vitamin D 3 -25-hydroxylase: tissue

occurrence and apparent lack of regulation. Arch Biochem Biophys 155(1): 47-57.

Turner RT, Puzas JE, Forte MD, Lester GE, Gray TK, Howard GA and Baylink DJ.

1980. In vitro synthesis of 1 alpha,25-dihydroxycholecalciferol and 24,25-

dihydroxycholecalciferol by isolated calvarial cells. Proc Natl Acad Sci USA 77(10):

5720-4.

269

Uhland-Smith A and DeLuca HF. 1993. The necessity for calcium for increased renal

vitamin D receptor in response to 1,25-dihydroxyvitamin D. Biochim Biophys Acta

1176(3): 321-6.

Van Cromphaut SJ, Dewerchin M, Hoenderop JG, Stockmans I, Van Herck E, Kato S,

Bindels RJ, Collen D, Carmeliet P, Bouillon R and Carmeliet G. 2001. Duodenal

calcium absorption in vitamin D receptor-knockout mice: functional and molecular

aspects. Proc Natl Acad Sci USA 98(23): 13324-9.

van Leeuwen JP, Birkenhager JC, Vink-van Wijngaarden T, van den Bemd GJ and

Pols HA. 1992. Regulation of 1,25-dihydroxyvitamin D3 receptor gene expression by

parathyroid hormone and cAMP-agonists. Biochem Biophys Res Commun 185(3):

881-6.

Varghese S, Lee S, Huang YC, Christakos S. 1988. Analysis of rat vitamin D-

dependent calbindin-D28k gene expression. J Biol Chem 263(20): 9776-84.

Walker AT, Stewart AF, Korn EA, Shiratori T, Mitnick MA and Carpenter TO. 1990.

Effect of parathyroid hormone-like peptides on 25-hydroxyvitamin D-1 alpha-

hydroxylase activity in rodents. Am J Physiol 258(2 Pt 1): E297-303.

Wang AM, Doyle MV and Mark DF. 1989. Quantitation of mRNA by the polymerase

chain reaction. Proc Natl Acad Sci USA 86(24): 9717-21.

270

Wasserman RH, Fullmer CS. 1995. Vitamin D and intestinal calcium transport: facts,

speculations and hypotheses. J Nutr 125(7 Suppl): 1971S-1979S.

Weinstein RS, Underwood JL, Hutson MS and DeLuca HF. 1984. Bone

histomorphometry in vitamin D-deficient rats infused with calcium and phosphorus.

Am J Physiol 246(6 Pt 1): E499-505.

Weisinger JR, Favus MJ, Langman CB and Bushinsky DA. 1989. Regulation of 1,25-

dihydroxyvitamin D3 by calcium in the parathyroidectomized, parathyroid hormone-

replete rat. J Bone Miner Res 4(6): 929-35.

Welsh J, Weaver V and Simboli-Campbell M. 1991. Regulation of renal 25(OH)D3 1

alpha-hydroxylase: signal transduction pathways. Biochem Cell Biol 69(12): 768-70.

Wiese RJ, Uhland-Smith A, Ross TK, Prahl JM and DeLuca HF. 1992. Up-regulation

of the vitamin D receptor in response to 1,25-dihydroxyvitamin D3 results from

ligand-induced stabilization. J Biol Chem 267(28): 20082-6.

Yamaguchi T, Chattopadhyay N, Kifor O and Brown EM. 1998(a). Extracellular

calcium (Ca2+(o))-sensing receptor in a murine bone marrow-derived stromal cell

line (ST2): potential mediator of the actions of Ca2+(o) on the function of ST2 cells.


Yamaguchi T, Chattopadhyay N, Kifor O, Butters RR Jr, Sugimoto T and Brown EM.

1998(b). Mouse osteoblastic cell line (MC3T3-E1) expresses extracellular calcium

271

(Ca2+o)-sensing receptor and its agonists stimulate chemotaxis and proliferation of

MC3T3-E1 cells. J Bone Miner Res 13(10): 1530-8.

Yamaguchi T, Chattopadhyay N, Kifor O, Ye C, Vassilev PM, Sanders JL and Brown

EM. 2001. Expression of extracellular calcium-sensing receptor in human osteoblastic

MG-63 cell line. Am J Physiol Cell Physiol 280(2): C382-93.

Yamaguchi T, Kifor O, Chattopadhyay N, Bai M and Brown EM. 1998(c).

Extracellular calcium (Ca2+o)-sensing receptor in a mouse monocyte-macrophage

cell line (J774): potential mediator of the actions of Ca2+o on the function of J774

cells. J Bone Miner Res 13(9): 1390-7.

Yamaguchi T, Olozak I, Chattopadhyay N, Butters RR, Kifor O, Scadden DT and

Brown EM. 1998(d). Expression of extracellular calcium (Ca2+o)-sensing receptor in

human peripheral blood monocytes. Biochem Biophys Res Commun 246(2): 501-6.

Yamamoto M, Kawanobe Y, Takahashi H, Shimazawa E, Kimura S and Ogata E.

1984. Vitamin D deficiency and renal calcium transport in the rat. J Clin Invest 74(2):

507-13.

Yang W, Friedman PA, Kumar R, Omdahl JL, May BK, Siu-Caldera ML, Reddy GS

and Christakos S. 1999. Expression of 25(OH)D3 24-hydroxylase in distal nephron:

coordinate regulation by 1,25(OH)2D3 and cAMP or PTH. Am J Physiol 276(4 Pt 1):

E793-805.

272

Yin JL, Shackel NA, Zekry A, McGuinness PH, Richards C, Putten KV, McCaughan

GW, Eris JM and Bishop GA. 2001. Real-time reverse transcriptase-polymerase chain

reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression

with fluorogenic probes or SYBR Green I. Immunol Cell Biol 79(3): 213-21.

Yoshida N, Yoshida T, Nakamura A, Monkawa T, Hayashi M and Saruta T. 1999.

Calcitonin induces 25-hydroxyvitamin D3 1alpha-hydroxylase mRNA expression via

protein kinase C pathway in LLC-PK1 cells. J Am Soc Nephrol 10(12): 2474-9.

Zehnder D, Bland R, Walker EA, Bradwell AR, Howie AJ, Hewison M and Stewart

PM. 1999. Expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in the human

kidney. J Am Soc Nephrol 10(12): 2465-73.

Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM and

Hewison M. 2001. Extrarenal expression of 25-hydroxyvitamin d(3)-1 alpha-

hydroxylase. J Clin Endocrinol Metab 86(2): 888-94.

Zehnder D and Hewison M. 1999. The renal function of 25-hydroxyvitamin D3-

1alpha-hydroxylase. Mol Cell Endocrinol 151(1-2): 213-20.

Zhou A, Elgort MG and Allegretto EA. 1997. Retinoid X receptor (RXR) ligands

activate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR

heterodimer binding to two vitamin D- responsive elements and elicit additive effects

with 1,25- dihydroxyvitamin D3. J Biol Chem 272(30): 19027-34.

273

Zhou H, Hammonds RG Jr, Findlay DM, Fuller PJ, Martin TJ and Ng KW. 1991.

Retinoic acid modulation of mRNA levels in malignant, nontransformed, and

immortalized osteoblasts. J Bone Miner Res 6(7): 767-77.

Zierold C, Darwish HM and DeLuca HF. 1995. Two vitamin D response elements

function in the rat 1,25- dihydroxyvitamin D 24-hydroxylase promoter. J Biol Chem

270(4): 1675-8.

Zierold C, Reinholz GG, Mings JA, Prahl JM and DeLuca HF. 2000. Regulation of

the procine 1,25-dihydroxyvitamin D3-24-hydroxylase (CYP24) by 1,25-

dihydroxyvitamin D3 and parathyroid hormone in AOK-B50 cells. Arch Biochem

Biophys 381(2): 323-7.

Zineb R, Zhor B, Odile W and Marthe RR. 1998. Distinct, tissue-specific regulation

of vitamin D receptor in the intestine, kidney, and skin by dietary calcium and vitamin

D. Endocrinology 139(4): 1844-52.

Zou A, Elgort MG and Allegretto EA. 1997. Retinoid X receptor (RXR) ligands

activate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR

heterodimer binding to two vitamin D- responsive elements and elicit additive effects

with 1,25- dihydroxyvitamin D3. J Biol Chem 272(30): 19027-34.

Documents

THE REGULATION OF VITAMIN D METABOLISM IN THE KIDNEY … › dspace › bit... · 1.6 Evidence For Bone Vitamin D Metabolism 18 1.6.1 Bone 1α-Hydroxylation 18 1.6.2 Bone 24-hydroxylation