i
THE REGULATION OF VITAMIN D METABOLISM
IN THE KIDNEY AND BONE
Paul Hamill Anderson B.Sc. (Hons.)
Department of Physiology
The University of Adelaide
South Australia
A thesis submitted for the degree of
Doctor of Philosophy
to
The University of Adelaide
June 2002
ii
Table of Contents
ABSTRACT xiv
DECLARATION xvii
ACKNOWLEDGEMENTS xviii
PUBLICATIONS ARISING xix
PRESENTATIONS ARISING xix
AWARDS ARISING xx
LIST OF FIGURES xxi
LIST OF TABLES xxv
1 CHAPTER 1: VITAMIN D METABOLISM IN KIDNEY AND
BONE
1
1.1 Introduction 1
1.2 Vitamin D Metabolism 3
1.2.1 Hepatic 25-Hydroxylation 3
1.2.2 Renal 1α-Hydroxylation 4
1.2.3 24-hydroxylation 6
1.3 Molecular Mechanism For The Action Of Vitamin D 9
1.4 Biological Actions of 1,25D 9
iii
1.4.1 Intestine 10
1.4.2 Bone 11
1.4.3 Parathyroid glands 12
1.4.4 Kidney 13
1.5 Factors That Effect The Kidney Vitamin D Metabolism 13
1.5.1 PTH 14
1.5.2 Calcium 15
1.5.3 Calcitonin 16
1.5.4 1,25D 17
1.6 Evidence For Bone Vitamin D Metabolism 18
1.6.1 Bone 1α-Hydroxylation 18
1.6.2 Bone 24-hydroxylation 21
1.7 Aims And Hypotheses 22
1.7.1 Detection and quantification of CYP27B1, CYP24 and VDR mRNA by
Real-Time RT-PCR
23
1.7.2 The effect of age on the metabolism of vitamin D in kidney and bone 23
1.7.3 The effect of dietary calcium on vitamin D metabolism in kidney and
bone
24
1.7.4 The effect of vitamin D-depletion on vitamin D metabolism in kidney and
bone
25
1.7.5 The effect of dietary calcium during vitamin D-depletion on vitamin D
metabolism in kidney and bone
26
2 CHAPTER 2: MATERIALS AND METHODS 27
2.1 Introduction 27
iv
2.2 Materials 27
2.3 Animals 28
2.3.1 Housing 28
2.3.2 Diet 28
2.3.2.1 Semi-Synthetic diet 28
2.3.3 Blood sample collection 31
2.4 Blood Biochemistry 31
2.4.1 Serum calcium and phosphate 31
2.4.2 Serum 1,25 dihydroxyvitamin D3 32
2.4.3 Serum 25 hydroxyvitamin D3 32
2.4.4 Serum parathyroid hormone 33
2.4.5 Serum calcitonin 33
2.5 Statistical Analyses 33
2.5.1 One-way analysis of variance 33
2.5.2 Two-way analysis of variance 34
2.5.3 Tukey’s post-hoc test 34
2.5.4 Linear and multiple-linear regression analysis 34
2.6 Molecular Biology Techniques 35
2.6.1 Materials and preparation of reagents 35
2.6.1.1 Antibiotics 35
2.6.1.2 RNase inhibiting solution 35
2.6.1.3 Buffer solutions 35
2.6.1.4 Formamide 35
2.6.1.5 Loading buffers for electrophoresis 36
2.6.2 Preparation of cDNA 36
v
2.6.2.1 Transformation of plasmids into competent cells 36
2.6.2.2 Plasmid screening procedure 37
2.6.2.3 Growth of bacterial cultures 37
2.6.2.4 Isolation of plasmid DNA 37
2.6.2.5 Quantificantion of DNA 38
2.6.2.6 Digestion and isolation of cDNA fragments 39
2.6.3 Extraction of total RNA for kidney and bone tissue 40
2.6.3.1 Collection of rat kidneys and bones for RNA extraction 40
2.6.3.2 Extraction of RNA 40
2.6.3.3 Quantification of RNA 41
2.6.4 First-strand cDNA synthesis 42
2.7 Quantitative Real-Time Reverse Transcriptase - Polymerase Chain Reaction
43
2.7.1 Real-time RT-PCR primers and probes 43
2.7.2 Polymerase chain reaction conditions 44
2.8 Ribonuclease Protection Assay 46
2.8.1 Labelling reaction and removal of template DNA 46
2.8.2 Gel purification of radio-labelled riboprobe 46
2.8.3 Determination of the quantity of total RNA used in ribonuclease
protection assay
47
2.8.4 Riboprobe: target RNA hybridisation 48
2.8.5 RNase digestion of unbound RNA 48
2.8.6 Separation and detection of riboprobe bound target mRNA 48
2.9 In Situ Hybridisation 49
2.9.1 In vitro transcription with digoxigenin-11-UTP 49
2.9.2 Estimation of the riboprobe yield 49
vi
2.9.3 Tissue preparation 49
2.9.4 Section pre-treatment 50
2.9.5 Hybridisation 50
2.9.6 Post-hybridisation wash 51
2.9.7 Antibody hybridisation / colour reactions 51
3 CHAPTER 3: EVALUATION OF THE QUANTIFICATION OF
CYP27B1, CYP24, VDR AND GAPDH mRNA USING THE REAL-TIME
REVERSE TRANSCRIPTASE-POLYMERASE CHAIN REACTION.
52
3.1 Introduction 52
3.2 Protocol 54
3.2.1 Experimental procedure 54
3.2.2 Estimation of cDNA standard copy number 55
3.2.3 Calculation of the slope of the linear regression line for optimal PCR
amplification
55
3.2.4 Data expression and statistical analysis 56
3.3 Results 57
3.3.1 Optimisation of the fluorogenic probe concentration 57
3.3.2 Range and sensitivity of fluorogenic detection 57
3.3.3 Standard curves 58
3.3.4 Reproducibility of cDNA standard detection 58
3.3.5 Comparison of copy numbers of mRNA obtained from standard curves
generated in different assays
64
3.3.6 Accuracy of the estimation of mRNA levels by reverse-transcription and
real-time PCR amplification
65
vii
3.3.7 Reproducibility of mRNA detection 69
3.3.8 Assessment of GAPDH and total RNA as the referent for mRNA
quantitation
72
3.4 Discussion 75
4 CHAPTER 4: THE EFFECTS OF AGE ON THE
REGULATION OF CYP27B1, CYP24 AND VDR mRNA
EXPRESSION
81
4.1 Introduction 81
4.2 Protocol 83
4.2.1 Experimental procedure 83
4.2.2 Biochemical analysis 83
4.2.3 Messenger RNA analyses 83
4.2.4 Data expression and statistical analyses 84
4.3 Results 84
4.3.1 Body weight and serum biochemistry 84
4.3.1.1 Serum Calcium 84
4.3.1.2 Serum 25D 84
4.3.1.3 Serum 1,25D 85
4.3.1.4 Serum PTH 85
4.3.1.5 Serum Calcitonin 85
4.3.2 Gene Expression in the Kidney 88
4.3.2.1 CYP27B1 mRNA 88
4.3.2.2 Relationship between serum 1,25D and kidney CYP27B1 mRNA 88
viii
4.3.2.3 Relationship between serum calcitonin and kidney CYP27B1 mRNA 88
4.3.2.4 CYP24 mRNA 92
4.3.2.5 Relationship between serum 1,25D and kidney CYP24 mRNA 92
4.3.2.6 Relationship between kidney CYP27B1 mRNA and kidney CYP24
mRNA
92
4.3.2.7 Relationship between serum calcitonin and kidney CYP24 mRNA 96
4.3.2.8 VDR mRNA 96
4.3.2.9 Relationship between kidney CYP24 mRNA and kidney VDR mRNA 96
4.3.3 Gene Expression in the bone 100
4.3.3.1 CYP27B1 mRNA 100
4.3.3.2 Relationship between serum calcium and bone CYP27B1 mRNA 100
4.3.3.3 Relationship between serum PTH and bone CYP27B1 mRNA 100
4.3.3.4 CYP24 mRNA 104
4.3.3.5 Relationship between bone CYP27B1 mRNA and bone CYP24
mRNA
104
4.3.3.6 Relationship between serum PTH and bone CYP24 mRNA 104
4.3.3.7 VDR mRNA 108
4.3.3.8 Relationship between serum 1,25D and bone VDR mRNA 108
4.4 Discussion 108
4.4.1 Determinants of serum 1,25D 108
4.4.2 Determinants of serum 25D 111
4.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA 111
4.4.3.1 Determinants of kidney CYP27B1 mRNA 111
4.4.3.2 Determinants of kidney CYP24 mRNA 114
4.4.3.3 Determinants of kidney VDR mRNA 116
ix
4.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA 118
4.4.4.1 Determinants of bone CYP27B1 118
4.4.4.2 Determinants of bone CYP24 119
4.4.4.3 Determinants of bone VDR 120
4.4.5 Comparisons of kidney and bone vitamin D endocrine systems 122
4.4.6 Summary 125
5 CHAPTER 5: THE EFFECT OF DIETARY CALCIUM AND
VITAMIN D ON CYP27B1, CYP24 AND VDR mRNA
EXPRESSION
127
5.1 Introduction 127
5.2 Protocol 128
5.2.1 Experimental procedure 128
5.2.2 Biochemical analysis 129
5.2.3 Bone histomorphometry 130
5.2.3.1 Bone fixation, cutting and resin embedding 130
5.2.3.2 Section Production 130
5.2.3.3 Modified von Kossa method for identification of calcified tissue 131
5.2.3.4 Von Kossa method for sites of calcium deposition with haematoxylin
and eosin counterstain
131
5.2.4 Messenger RNA Analyses 132
5.2.5 Data expression and statistical analysis 132
5.3 Results 132
5.3.1 Serum biochemistry 132
x
5.3.1.1 Serum 25D 133
5.3.1.2 Serum 1,25D 133
5.3.1.3 Serum calcium 133
5.3.1.4 Serum phosphate 133
5.3.1.5 Serum PTH 134
5.3.1.6 Serum calcitonin 134
5.3.2 Bone histomorphometry 138
5.3.2.1 Relationship between serum calcium and BV/TV in the D(-) animals 138
5.3.3 Gene expression in the kidney 141
5.3.3.1 CYP27B1 mRNA 141
5.3.3.2 Relationship between serum PTH and kidney CYP27B1 mRNA levels 141
5.3.3.3 CYP24 mRNA 144
5.3.3.4 Relationship between serum 25D and kidney CYP24 mRNA levels 144
5.3.3.5 Relationship between serum 1,25D and kidney CYP24 mRNA levels 144
5.3.3.6 Relationship between serum calcium and kidney CYP24 mRNA levels 149
5.3.3.7 Relationship between serum PTH and kidney CYP24 mRNA levels 149
5.3.3.8 Relationship between serum calcitonin and kidney CYP24 mRNA 149
5.3.3.9 Kidney VDR mRNA 149
5.3.4 Gene expression in the bone 155
5.3.4.1 CYP27B1 mRNA 155
5.3.4.2 Relationship between serum calcitonin and bone CYP27B1 mRNA
levels in D(+) animals
155
5.3.4.3 Relationship between serum PTH and bone CYP27B1 mRNA levels
in D(-) animals
155
5.3.4.4 Relationship between serum calcium and bone CYP27B1 mRNA
levels in D(-) animals
159
xi
5.3.4.5 Relationship between BV/TV and bone CYP27B1 mRNA in D(-)
animals
159
5.3.4.6 Bone CYP24 mRNA 163
5.3.4.7 Relationship between bone CYP27B1 and bone CYP24 mRNA levels 163
5.3.4.8 Relationship between serum PTH and bone CYP24 mRNA 163
5.3.4.9 Bone VDR mRNA 163
5.3.4.10 Relationship between serum calcium and bone VDR mRNA levels 168
5.3.4.11 Relationship between serum PTH and bone VDR mRNA levels 168
5.3.5 Assessment of CYP27B1 mRNA levels in kidney and bone by
ribonuclease protection assay
168
5.4 Discussion 172
5.4.1 Determinants of serum calcium levels 172
5.4.2 Determinants of serum 1,25D levels 172
5.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA 174
5.4.3.1 Determinants of CYP27B1 mRNA levels 174
5.4.3.2 Determinants of CYP24 mRNA levels 176
5.4.3.3 Determinants of VDR mRNA levels 178
5.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA 179
5.4.4.1 Determinants of CYP27B1 mRNA levels 179
5.4.4.2 Determinants of CYP24 mRNA levels 184
5.4.4.3 Determinants of VDR mRNA levels 185
5.4.5 Comparisons of the kidney and bone vitamin D endocrine systems 185
5.4.6 Summary 188
xii
6 CHAPTER 6: IDENTIFICATION OF BONE CELL TYPES
WITH THE CAPACITY TO METABOLISE VITAMIN D
190
6.1 Introduction 190
6.2 Protocol 191
6.2.1 Experimental procedures 191
6.2.2 Cell culture 192
6.2.3 Messenger RNA analyses 192
6.2.4 Insitu hybridisation 193
6.2.5 Data expression and statistical analyses 193
6.3 Results 193
6.3.1 Expression of CYP27B1 mRNA in the separate bone fractions 193
6.3.2 Expression of CYP24 mRNA in the separate bone fractions 195
6.3.3 Relationship between the expression of CYP27B1 and CYP24 mRNA 195
6.3.4 Expression of VDR mRNA in the separate bone fractions 195
6.3.5 Expression of CYP27B1 mRNA in bone cells 199
6.3.6 Expression of CYP24 mRNA in bone cells 199
6.3.7 Expression of VDR mRNA in bone cells 199
6.3.8 Detection of CYP27B1 mRNA by in situ hybridisation 203
6.4 Discussion 203
6.4.1 Expression of CYP27B1, CYP24 and VDR mRNA in specific bone
regions
203
6.4.1.1 CYP27B1 mRNA 203
6.4.1.2 CYP24 mRNA 206
6.4.1.3 VDR mRNA 207
xiii
6.4.2 Expression of CYP27B1, CYP24 and VDR mRNA in bone cells 208
6.4.2.1 CYP27B1 mRNA 208
6.4.2.2 CYP24 mRNA 209
6.4.2.3 VDR mRNA 210
6.4.3 Insitu identification of CYP27B1 mRNA in rat femora 212
6.4.4 Summary 213
7 CHAPTER 7: SUMMARY AND CONCLUSIONS 215
7.1 Summary 215
7.2 Limitations 223
7.3 Future Directions 225
8 BIBLIOGRAPHY 226
xiv
Abstract
The activation of 1,25D-dihydroxyvitamin D3 (1,25D) is catalysed by the enzyme 25-
hydroxyvitamin D-1α-hydroxylase (CYP27B1) in the kidney, which is the primary
producer of 1,25D in the body. Although the synthesis of 1,25D by CYP27B1 and the
catabolism of 1,25D by 25-hydroxyvitamin D-24-hydroxylase (CYP24) also take
place in the bone, the significance of the bone cell-specific metabolism of vitamin D
remains largely unknown. This thesis investigates the regulation of the expression of
CYP27B1, CYP24 and vitamin D receptor (VDR) mRNA, both in the bone and in the
kidney, with the aim to determine whether the regulation of the vitamin D metabolism
in the bone is independent from that in the kidney. The effects of age, dietary calcium
and vitamin D status on the expression these genes in both the kidney and the bone, as
well as on a number of biochemical factors known to regulate the renal metabolism of
1,25D, such as PTH, calcium and 1,25D itself, were examined. CYP27B1 mRNA
expression was also studied in histological sections of rat femoral bone. Furthermore,
CYP27B1, CYP24 and VDR mRNA expression were also identified in specific
regions of the rat femur and in a number of bone cell lines, with the aim to identify the
bone cell types that have the capacity to metabolise and/or to respond to vitamin D.
The age-related decrease in the circulating levels of 1,25D detected in animals ranging
in age from 3 weeks to 2 years old, was a direct result of a reduction in the expression
of CYP27B1 mRNA and an increase in the expression of CYP24 and VDR mRNA in
the kidney. In contrast, the expression of CYP27B1 and CYP24 mRNA in the bone is
high from 3 to 15 weeks of age, which is the period of rapid growth and development.
The expression of CYP27B1 mRNA in the bone was positively correlated with the
circulating levels of calcium throughout aging, which suggests that the 1,25D
xv
produced in the bone may be involved in the mineralisation process. The positive
correlation found between the expression of CYP27B1 and CYP24 mRNA in the
bone was in contrast with the negative correlation found between the expression of
these two enzymes in the kidney. This suggests that the 1,25D produced locally in the
bone, rather than the 1,25D produced in the kidney, is the primary determinant of the
CYP24 activity in the bone.
In vitamin D-deplete animals, fed a 0.1% calcium diet (D(-)/LC), the expression of
CYP27B1 mRNA was induced and the expression of CYP24 mRNA was suppressed
in the kidney. In contrast, both the expression of CYP27B1 and CYP24 mRNA were
low in the bones of these D(-)/LC animals. When vitamin D-deplete animals were fed
a 1% calcium diet (D(-)/HC), the expression of both CYP27B1 and CYP24 mRNA
was high in the bone, which was in direct contrast with the low expression of these
genes detected in the kidney. Besides this, a positive correlation was found between
the expression of CYP27B1 mRNA in the bone, serum calcium levels and bone
mineral volume (BV/TV) in the epiphysis, which supports the findings for the age
study that the locally produced 1,25D may be involved in the promotion of bone
mineralisation. Although serum PTH levels was positively correlated with the
expression of CYP27B1 mRNA in the kidneys of hypocalcaemic animals, there was
no such relationship detected between the levels of serum PTH and the expression of
CYP27B1 mRNA in the bone. This finding suggests that the regulation of the
expression of CYP27B1 mRNA in the bone is different from the regulation found in
the kidney. The identification of CYP27B1 mRNA in osteoblasts-like cells, taken
together with the associations between serum calcium and CYP27B1 mRNA
expression in the previous studies, suggests that 1,25D produced in osteoblasts may
xvi
play a significant role in the bone mineralisation process. The detection of CYP27B1
mRNA expression in a number of bone marrow cells suggests that locally produced
1,25D may also play a role in the growth and differentiation of hematopoietic cells.
17
Declaration
This thesis contains no material which has been accepted for the award of any other
degree or diploma in any university or other tertiary institution and, to the best of my
knowledge and belief, contains no material previously published or written by another
person, except where due reference has been made in the text.
I give my consent to this copy of my thesis, when deposited in the University Library,
being available for loan and photocopying.
Signature ………………………….
Date ………./………./……….
18
Acknowledgements
I wish to thank Associate Professor Howard Morris for his guidance and support as
my supervisor. Without his encouragement and support throughout my studies, I
would not be writing this now. I would also like to thank Associate Professor Alan
Need for allowing me to undertake this study in The Division of Clinical
Biochemistry at The Institute of Medical and Veterinary Science.
Thanks must also go to Dr Brian May and The Biochemistry Department of The
University of Adelaide for their invaluable advice and assistance.
Special thanks must go to Dr. Malcolm Cochran for his support and contributions
during my studies.
I would like to acknowledge Dr. Peter O’loughlin and my colleagues Dr Shunji Iida,
Alison Moore, Sonia Shulz of the Endocrine Research unit as well as Dr Rachel
Davey of the Department of Medicine, University of Melbourne, for their invaluable
advice, practical assistance and encouragement. Thanks must also go to the Endocrine
diagnostic laboratory, the Division of Molecular Pathology, the Animal care staff of
the Institute of Medical and Veterinary Science for their time and assistance.
Finally, I would like to thank my Mum, Dad, Kathryn, Allan, Robert, Ingrid and
Rachel for their support and encouragement throughout my years of study. I would
especially like to thank Ivanka Hendrix for her support and encouragement for me
both in the laboratory as my colleague and out of the laboratory as my partner. Her
belief in me gave me motivation to endure my studies.
19
Publications Arising
Anderson PH, Iida S, Cochran M, May B and Morris H. 2000 Regulation of vitamin
D metabolism in the bone. Bone 27 (4): 8s
Anderson PH, Iida S, Moore A, Cochran M, O’Loughlin P, May B and Morris H.
2001 Bone CYP27B1 mRNA is regulated by dietary calcium and not vitamin D.
Journal of Bone and Mineral Research 16 (1): 313s
Anderson PH, Iida S, Moore A, Cochran M, May B and Morris H. 2001 Bone Cell
regulation of Vitamin D metabolism. Bone 28 (5): 245s
Presentations Arising
International
Anderson PH, Iida S, Cochran M, May BK and Morris HA. 2001 Bone cell regulation
of vitamin D metabolism. International Bone and Mineral Society Conference. Bone
28 (5): 245s
Anderson PH, Iida S, Cochran M, O’Loughlin PD, May BK and Morris HA. 2001
Bone 25-hydroxyvitmain D-1�-hydroxlase is regulated by dietary calcium but not
PTH. American Society of Bone and Mineral Research Conference. Journal of Bone
and Mineral Research 16 (1): 313s
National
Anderson PH, Iida S, Moore AJ, Cochran M, May BK, Morris HA. 2000 Regulation
of vitamin D metabolism in bone. Australian & New Zealand Bone and Mineral
Society. p11, Abstract O3.
20
Anderson PH, Iida S, Moore AJ, Cochran M, May BK, Morris HA. 2000 Regulation
of vitamin D metabolism in bone. National Australian Society for Medical Research
Conference.
Anderson PH, Iida S, Dunn S, Stilliano A, Cochran M, May BK and Morris HA. 2001
Bone 25-hydroxyvitmain D-1α-hydroxlase is regulated by age, dietary calcium but
not PTH. Australian & New Zealand Bone and Mineral Society. p25, Abstract O1.
Anderson PH, Iida S, Dunn S, Stilliano A, Cochran M, May BK and Morris HA. 2001
Bone 25-hydroxyvitmain D-1α-hydroxlase: regulation by age and dietary calcium but
not vitamin D or PTH. National Australian Society for Medical Research Conference.
Awards Arising
Young Investigator Award Finalist. 2000 National Australian & New Zealand Bone
and Mineral Society Conference. Hamilton Island, Queensland.
Young Investigator Award Finalist. 2001 National Australian & New Zealand Bone
and Mineral Society Conference. Auckland, New Zealand.
IBMS Travel Award. 2001 International Bone and Mineral Society Research
Conference. Madrid, Spain.
Medibank Private Young Investigator Award. 2001 National Australian Society of
Medical Research Conference. Melbourne, Australia.
21
List of Figures 1.1 The structure of vitamin D and the addition of hydroxyl groups to either
activate or deactivate vitamin D.
8
3.1 Optimisation of the CYP27B1 probe concentration. 60
3.2 Amplification plots of three CYP27B1 cDNA standards. 62
3.3 Standard curves of CYP27B1, CYP24, VDR, and GAPDH cDNA. 64
3.4 Reproducibility of CT values obtained from cDNA samples of CYP27B1,
CYP24, VDR and GAPDH.
67
3.5 Reproducibility of fluorogenic detection of CYP27B1, CYP24, VDR and
GAPDH mRNA in total RNA samples.
71
4.1 Relationship between rat age (weeks) and serum 1,25D levels (pmol/L). 88
4.2 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA)
with age (weeks).
90
4.3 Relationship between serum 1,25D (pmol/L) and kidney CYP27B1
mRNA levels (copy numbers/µg total RNA).
91
4.4 Relationship between serum calcitonin (pmol/L) and kidney CYP27B1
mRNA levels (copy numbers/µg total RNA).
92
4.5 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) with
age (weeks).
94
4.6 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA).
95
4.7 Relationship between kidney CYP27B1 mRNA (copy numbers/µg total
RNA) and kidney CYP24 mRNA levels (copy numbers/µg total RNA).
96
4.8 Relationship between serum calcitonin (pmol/L) and kidney CYP24
mRNA levels (copy numbers/µg total RNA).
98
4.9 Expression of kidney VDR mRNA (copy numbers/µg total RNA) with age
(weeks).
99
4.10 Relationship between kidney CYP24 and kidney VDR mRNA expression
(copy numbers/µg total RNA).
100
4.11 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) with
age (weeks)
102
22
age (weeks). 4.12 Relationship between serum calcium (mmol/L) and bone CYP27B1
mRNA (copy numbers/µg total RNA).
103
4.13 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA
(copy numbers/µg total RNA).
104
4.14 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) with
age (weeks).
106
4.15 Relationship between bone CYP27B1 and bone CYP24 mRNA
expression (copy numbers/µg total RNA).
107
4.16 Relationship between serum PTH (pmol/L) levels and bone CYP24
mRNA (copy numbers/µg total RNA).
108
4.17 Expression of bone VDR mRNA (copy numbers/µg total RNA) with age
(weeks).
110
4.18 Relationship between serum 1,25D levels (pmol/L) and bone VDR
mRNA (copy numbers/µg total RNA).
111
5.1 Relationship between serum calcium (mmol/L) and serum PTH levels
(pmol/L).
136
5.2 Relationship between serum calcium (mmol/L) and serum calcitonin
levels (pmol/L).
137
5.3 Representative bone histology from each rat treatment group. 139
5.4 Relationship between serum calcium levels (pmol/L) and BV/TV (%) in
the epiphysis of the D(-) animals.
140
5.5 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA) in
each dietary treatment group.
142
5.6 Relationship between serum PTH (pmol/L) and CYP27B1 mRNA levels
(copy numbers/µg total RNA) in the kidney.
143
5.7 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) in
each dietary treatment group.
145
5.8 Relationship between serum 25D (nmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(+) animals.
146
5.9 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(+) animals.
147
23
5.10 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(-) animals.
148
5.11 Relationship between serum calcium (mmol/L) and CYP24 mRNA levels
(copy numbers/µg total RNA) in the kidney.
150
5.12 Relationship between serum PTH (pmol/L) and CYP24 mRNA levels
(copy numbers/µg total RNA) in the kidney.
151
5.13 Relationship between serum calcitonin (pmol/L) and CYP24 mRNA
levels (copy numbers/µg total RNA) in the kidney.
152
5.14 Expression of kidney VDR mRNA (copy numbers/µg total RNA) in each
dietary treatment group.
154
5.15 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) in
each dietary treatment group.
156
5.16 Relationship between serum calcitonin (pmol/L) and bone CYP27B1
mRNA levels (copy numbers/µg total RNA) in the D(+) animals.
157
5.17 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA
levels (copy numbers/µg total RNA) in the D(-) animals.
158
5.18 Relationship between serum calcium (mmol/L) and bone CYP27B1
mRNA levels (copy numbers/µg total RNA) in the D(-) animals.
160
5.19 Relationship between bone CYP27B1 mRNA levels (copy numbers/µg
total RNA) and BV/TV (%) in the epiphysis of the D(-) animals.
161
5.20 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) in each
dietary treatment group.
164
5.21 Relationship between bone CYP27B1 mRNA (copy numbers/µg total
RNA) and bone CYP24 mRNA (copy numbers/µg total RNA).
165
5.22 Relationship between serum PTH (pmol/L) and bone CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(-) animals.
166
5.23 Expression of bone VDR mRNA (copy numbers/µg total RNA) in each
dietary treatment group.
167
5.24 Relationship between serum calcium (mmol/L) and VDR mRNA levels
(copy numbers/µg total RNA) in the bone.
169
5.25 Relationship between serum PTH (pmol/L) and bone VDR mRNA levels
(copy numbers/µg total RNA) in the D(+) animals.
170
24
5.26 Ribonuclease protection assay for CYP27B1 mRNA detected in total
RNA isolated from kidney and bone tissue from each animals dietary
treatment group.
171
6.1 The expression of CYP27B1 mRNA levels (copy number/µg total RNA)
in rat bone marrow, femoral head and cortical bone.
194
6.2 The expression of CYP24 mRNA levels (copy number/µg total RNA) in
the rat bone marrow, femoral head and cortical bone.
196
6.3 The relationship between the expression of CYP27B1 and of CYP24
mRNA levels (copy numbers/µg total RNA) in the bone marrow, the
femoral head and in the cortical bone fractions.
197
6.4 The expression of VDR mRNA levels (copy number/µg total RNA in the
rat bone marrow, femoral head and cortical bone.
198
6.5 The expression of CYP27B1 mRNA levels (copy number/GAPDH copy
number) in primary bone cells, UMR 201, and UMR 106 cells.
200
6.6 The expression of CYP24 mRNA levels (copy number/GAPDH copy
number) in primary bone cells, UMR 201, and UMR 106 cells.
201
6.7 The expression of VDR mRNA levels (copy number/ GAPDH copy
number) in primary bone cells, UMR 201, and UMR 106 cells.
202
6.8 The expression of CYP27B1 mRNA in rat bone marrow. 204
6.9 The expression of CYP27B1 mRNA in the rat femur. 205
7.1 Diagram representing the proposed effects of the vitamin D-replete/low
calcium (D(+)/LC) diet on the expression of CYP27B1 and CYP24 in the
kidney and bone.
217
7.2 Diagram representing the proposed effects of the vitamin D-replete/high
calcium (D(+)/HC) diet on the expression of CYP27B1 and CYP24 in the
kidney and bone.
218
7.3 Diagram representing the proposed effects of the vitamin D-deplete/low
calcium (D(−)/LC) diet on the expression of CYP27B1 and CYP24 in the
kidney and bone.
221
7.4 Diagram representing the proposed effects of the vitamin D-deplete/high
calcium (D(−)/HC) diet on the expression of CYP27B1 and CYP24 in the
kidney and bone.
222
25
List of Tables
2.1 Components of the Semi-Synthetic Diet 29
2.2 Components of the Mineral Mix 30
2.3 Fluorogenic probe and primer sets 45
3.1 Threshold cycle (CT) values for the optimisation of fluorogenic probe
concentrations for mRNA quantification.
61
3.2 Sensitivity of fluorogenic probe for detection. 63
3.3 Equation of the line-of-best-fit for mRNA copy number estimations
determined from separate standard curves.
68
3.4 Efficiency of mRNA amplification of kidney and bone samples. 69
3.5 Reproducibility of amplification of reverse-transcribed mRNA samples
assessed by the comparison of the equations of line-of-best-fit and the
line-of unity.
72
3.6 GAPDH threshold cycle (CT) values from various rats treatment groups
from kidney and bone.
74
3.7 Comparison of expression levels when using total RNA or GAPDH as
the referent.
75
4.1 Body weight and serum biochemistry of 25D, 1,25D, PTH, calcitonin and
calcium with respect to age.
87
5.1 Allocation of animals into the dietary treatment groups at 6 months of
age.
129
5.2 Serum biochemistry of 25D, 1,25D, calcium, phosphate, PTH and
calcitonin in animals from each dietary treatment group.
135
5.3 Single and multiple linear regression equations for serum calcium,
serum PTH and serum calcitonin as determinants of kidney CYP24
mRNA levels.
153
5.4 Single and multiple linear regression equations for serum calcium,
serum PTH and bone CYP27B1 mRNA levels as determinants of
epiphyseal BV/TV in the D(-) animals.
162
1
Chapter 1: Vitamin D metabolism in kidney and bone
1.1 Introduction
The primary role of the vitamin D endocrine system is to maintain calcium
homeostasis. The tight regulation of serum calcium levels is essential to support
normal nerve and muscle function as well to provide sufficient calcium for the
maintenance of mineralised bone. The most critical role of vitamin D is to enhance the
absorption of dietary calcium in the small intestine. In response to hypocalcemia, 25-
hydroxyvitamin D3 (25D) is activated to 1,25-dihydroxyvitamin D3 (1,25D) in the
kidney, which in turn, enhances the absorption of calcium from the intestine. In
addition, 1,25D is also essential for the maintenance of a mineralised skeleton. A lack
of vitamin D, through poor nutrition or inadequate exposure to the sun, results in bone
mineralisation defects, such as rickets and osteomalacia.
Vitamin D-deficiency is associated with an increased risk of hip fracture, arguably the
most devastating complication of osteoporosis (Chapuy et al 1992). In hip fracture
patients, it has been shown that, although circulating levels of 25D are deficient, the
circulating 1,25D levels are normal or slightly raised (Nordin and Morris 1992;
Nordin et al 1998). It is unclear why the normal circulating 1,25D levels in these hip
fracture patients are unable to normalise bone turnover. Interestingly, while patients
with hip fractures had normal levels of circulating 1,25D, the levels of 1,25D in the
bone were decreased when compared to subjects that had not had a hip fracture (Lidor
et al 1993). This suggests that the circulating level of 1,25D does not predict the level
of 1,25D in the bone.
2
The local synthesis of 1,25D by bone cells has recently been proposed to explain the
paradox between normal circulating 1,25D levels, vitamin D deficiency in bone tissue
and the initiation of the clinical features of vitamin D-deficiency. This proposal is
possible since it was found more than two decades ago that bone cell synthesise 1,25D
from 25D in vitro (Howard et al 1981). Few studies, however, have investigated the
regulation of the synthesis of 1,25D in the bone and the physiological role of the
locally produced 1,25D in the maintenance of healthy bone remains unresolved.
The enzyme 25-hydroxyvitamin D3-1α-hydroxylase (CYP27B1) is responsible for the
synthesis of 1,25D. This enzyme, which was first found in the kidney, has also been
identified in the bone. While a number of biological factors have been shown to
control the expression of CYP27B1 mRNA in the kidney, the regulation of CYP27B1
mRNA expression in bone has not been examined. The enzyme 25-hydroxyvitamin
D3-24-hydroxylase (CYP24) is responsible for the breakdown of 1,25D. The wide
tissue distribution of CYP24, including a number of different bone cell types, is
consistent with the tissue distribution of the vitamin D receptor (VDR). The regulation
of CYP24 activity in the bone, as well as in the kidney, has been well described.
The comparison of the vitamin D endocrine systems in the kidney and bone, based on
the activity of CYP27B1 and CYP24 and on the levels of VDR found in these tissues,
may help elucidate the physiological role for the locally produced 1,25D in processes
involved in bone metabolism. The studies described in this thesis were based on the
hypothesis that vitamin D metabolism in the bone is regulated independently of the
vitamin D metabolism in the kidney.
3
1.2 Vitamin D metabolism
Vitamin D, in the form of vitamin D3, is made from 7-dehydrocholesterol in the skin
by exposure to ultraviolet light (270–300 nm) from the sun. Alternatively, vitamin D,
in the form of either vitamin D2 or vitamin D3, can be derived from dietary sources
(DeLuca 1988). Vitamin D3 undergoes an activation process, involving first a 25-
hydroxylation in the liver, followed by 1α-hydroxylation in the kidney, to make the
biologically active compound 1,25D. While the synthesis of 25-hydroxyvitamin D3
(25D) by the liver is constitutive, the synthesis of 1,25D by the renal CYP27B1 is
tightly regulated (Jones et al 1998). CYP24 catabolises 1,25D to produce 1,24,25-
trihydroxyvitamin D3 (1,24,25D), which is the first step of 1,25D degradation, known
as the C-24 oxidation pathway (Henry 1992). The synthesis of 1,25D by CYP27B1
and degradation of 1,25D by CYP24 are subject to a high degree of control, which
confers specificity to 1,25D-mediated activity.
1.2.1 Hepatic 25-Hydroxylation
The 25-hydroxylation of vitamin D is the first step in the activation of vitamin D. This
step is catalysed by the liver enzyme, 25-hydroxylase (Blunt et al 1968), which has a
high affinity for vitamin D (Andersson et al 1989; Cali and Russell 1991; Takeda et al
1994; Okuda et al 1995). 25-hydroxylase is commonly named CYP27 because of its
27-hydroxylase activity on cholesterol from the bile-acid pathway (Pikuleva et al
1997). Although the liver is the primary site of 25-hydroxylation in vivo, there are
reports of CYP27 activity in skin, intestinal and renal extracts (Tucker et al 1973).
The CYP27 enzyme exists in both the microsomal and mitochondrial fractions of the
liver (Bhattacharyya and DeLuca 1974). The product of the 25-hydroxylation of
vitamin D, 25D is the major circulating metabolite of vitamin D (Hollis et al 1986),
4
which due largely to the stability of 25D when bound to the vitamin D-binding protein
in blood (Cooke and Haddad 1989; Cooke et al 1991). The level of 25D in the
circulation increases in proportion to vitamin D intake, and for this reason, the level of
serum 25D is commonly used as a clinical indicator of vitamin D status. The
metabolic fate of 25D is dependent on the calcium requirements of the animal. An
urgent need for calcium results in renal 1α-hydroxylation of 25D, whereas an
abundance of calcium results in 24-hydroxylation of 25D.
1.2.2 Renal 1α-Hydroxylation
The second step of vitamin D activation is the conversion of 25D to 1,25D. The
enzyme, CYP27B1, catalyses the introduction of a hydroxyl group into the 1α
position of the A ring of 25D to form 1,25D. CYP27B1 was named due to its
structural similarity to the liver CYP27 enzyme. The kidney was shown to be the
major source for the synthesis of 1,25D. Fraser and Kocidek (1970) used
nephrectomised animals to demonstrate that CYP27B1 enzyme activity was
predominantly in the kidney. More recently, CYP27B1 has been shown to be
expressed in a number of other tissues such as skin, intestine, brain, testis,
macrophages and bone (Zhender et al 2001; I Hendrix, personal observations).
Experiments investigating the regulation of CYP27B1 enzyme activity and
transcriptional activity in vivo have proved difficult due to the negative feedback
mechanisms that tightly control the metabolism of vitamin D. It was shown, however,
that the ability to convert 25D to 1,25D in the kidney is more efficient in 2-month-old
rats than older animals and this activity reduced gradually with age until 2 years of
age (Ishida et al 1987). More recently, studies of the mechanisms involved in
CYP27B1 gene regulation have been made possible with the cloning of mouse, rat
5
and human cDNA and genomic clones for CYP27B1 (Fu et al 1997(a); Monkawa et
al 1997; Shinki et al 1997; St Arnaud at al 1997; Takeyama et al 1997). Takeyama
and co-workers (1997) were the first to isolate a CYP27B1 cDNA. Using a VDR
knockout mouse, they were able to isolate the over-expressing CYP27B1 protein and
candidate cDNA, which occurred as a result of the absence of functional VDR.
Subsequent cloning of a human CYP27B1 cDNA was achieved using mRNA from
cultured human keratinocytes (Fu et al 1997(a)), which have previously been shown
to synthesize 1,25D (Pillai et al 1988). A full-length cDNA of 2·4kb was shown to
encode a 508-amino-acid protein with a predicted size of 56kDa.
CYP27B1 mRNA expression and protein has been found to be located to the renal
proximal tubules (Zehnder et al 1999), and, to a lesser extent, in distal tubules and
collecting ducts. There are, however, a number of studies that have shown the presence
of the CYP27B1 enzymes in a number of non-renal tissues and cells. The original
description of extra-renal CYP27B1 enzyme activity was based on studies of the
granulomatous disease sarcoidosis, which frequently presents with hypercalcaemia
(Papapoulos et al 1979, Barbour et al 1981). Since then, a number of sites for
CYP27B1 expression have been found such as skin, bone and lymph nodes, and more
recently the cerebellum, placenta, and pancreas (Panda et al 1999; Zehnder et al 2001).
While the regulation of CYP27B1 activity in non-renal tissues is largely unknown,
CYP27B1 mRNA expression and protein synthesis in the kidney has been extensively
studied and has been shown to be tightly regulated by a number of factors. PTH is a
potent stimulator of CYP27B1 transcription and activity in the kidney, which is
mediated through a cAMP signal transduction mechanism (Henry & Luntao 1989).
6
More recent reports have highlighted potential cAMP response elements (CREs) in
downstream areas of the CYP27B1 promoter, which are PTH-responsive (Brenza et al
1998; Murayama et al 1998; Murayama et al 1999; Brenza and DeLuca 2000). On the
other hand, 1,25D has been shown to down-regulate the PTH-stimulation of
CYP27B1 gene transactivation (Brenza and DeLuca 2000). 1,25D appears to achieve
its effects indirectly given that 1,25D was unable to suppress CYP27B1 promoter
activity in AOK-B50 kidney cells, but was able to suppress kidney CYP27B1 mRNA
expression in vivo (Brenza and DeLuca 2000). Furthermore, no vitamin D response
elements (VDREs) have been identified in the 1·4kb promoter of the CYP27B1 gene
(Murayama et al 1998; Portale and Miller 2000), which suggests the regulation of
CYP27B1 mRNA by 1,25D is mediated through an indirect mechanism. Murayama
and co-workers (2001) have identified a region on the promoter of the CYP27B1
gene, which is negatively regulated by 1,25D and requires the VDR for the inhibition
to occur. The VDR does not, however, directly bind to this region in the promoter and
the mechanism, to date, has not been fully elucidated. The regulation of renal
CYP27B1 mRNA expression and enzyme activity is discussed further in Chapter 1.5.
1.2.3 24-hydroxylation
The high potency of 1,25D in elevating serum calcium and phosphate levels requires
its circulating levels to be tightly regulated. The activity of 1,25D is attenuated by the
addition of a hydroxyl group in the C-24 position, which is catalysed by the enzyme,
CYP24. CYP24 is a multicatalytic enzyme, which in addition to the 24-hydroxylation
of either 25D or 1,25D, is able to catalyse the side chain hydroxylations at the C23
and C26 positions (Miyamoto et al 1997). These hydroxylation steps of the C-24
oxidation pathway converts 25D and 1,25D, which ultimately results in the formation
of water-soluble calcitroic acid, which is excreted (Makin et al 1989; Reddy & Tserng
7
1989). The catabolism of 1,25D limits the action of 1,25D in target cells once the
initial wave of 1,25-mediated gene expression has been initiated.
The first report of CYP24 enzyme activity was first shown in chicken kidney tissue
(Knutson & DeLuca 1974). Since then, CYP24 has been found in the intestine, bone
(Kumar 1984) and number other vitamin D-responsive tissues (Reinhardt & Horst
1989; Tomon et al 1990(a); Masuda et al 1994). Under normal physiological
circumstances, renal CYP24 activity was shown to be lowest in 2-month-old female
rats and gradually increased with age until 2 months of age (Ishida et al 1987), which
is converse to the reduced CYP27B1 activity with age described earlier. 1,25D
potently stimulates CYP24 enzyme activity, which has been shown in a variety of
renal and non-renal systems (Tanaka & DeLuca 1974; Tanaka et al 1977; Kumar et al
1978; Armbrecht and Boltz 1991; Armbrecht and Hodam 1994; Lemay et al 1995;
Roy et al 1995; Armbrecht et al 1997(a); Armbrecht et al 1998; Zierold et al 2000).
The first demonstration of the 1,25D-mediated induction of CYP24 activity in mature
osteoblasts cell cultures (Makin et al 1989) has led to a number of studies
investigating the regulating mechanism of CYP24 gene expression in bone. CYP24
was cloned in the early 1990s (Ohyama et al 1991(a); Chen et al 1993; Itoh et al 1995)
and the gene has been described for mouse, rat and human. In each case, the CYP24
gene possesses two VDREs in its promoter (Ohyama et al 1994(b); Chen and DeLuca
1995; Zhou et al 1997; Zierold et al 1995). The two VDREs in the CYP24 promoter
allow for the direct 1,25D/VDR-mediated up-regulation of CYP24 mRNA expression
(Hahn et al 1994; Kerry et al 1996).
8
Figure 1.1 The structure of vitamin D and the addition of hydroxyl groups to either
activate (green) or deactivate (red) vitamin D. The enzymes responsible for the these
hydroxylations are associated with each of the hydroxyl groups.
25-hydroxylase(CYP27)
25-hydroxyvitamin D-24-hydroxylase(CYP24)
25-hydroxyvitamin D-1α-hydroxylase(CYP27b1)OH
OH
OH
(CYP27B1)
9
1.3 Molecular Mechanism for the action of vitamin D
The biological activity of 1,25D is mediated by a high-affinity receptor, VDR, which
acts as a ligand-activated transcription factor. The VDR was found originally in the
organs involved in calcium homeostasis including the intestine, bone, kidney, and the
parathyroid glands. The isolation of cDNAs coding for the avian, human, mouse, and
rat VDR (McDonnell et al 1987; Baker et al 1988; Burmester et al 1988(a); Kamei et
al 1995) has led to VDR being detected in many other non-classical tissues and cell
types. The action of 1,25D in these tissue have been associated with a diverse range of
biological systems such as modulation of immune function, inhibition of cell growth,
and induction of cell differentiation.
Upon ligand binding, the cytoplasmic VDR rapidly translocates to the nucleus
whereby it forms a heterodimer with retinoic X receptor (RXR). This induces a VDR
conformation that is essential for VDR transactivation. The VDR-RXR heterodimer is
directed to the VDRE in the promoter region of 1,25D-regulated genes, with the RXR
binding the 5' half site and the VDR occupying the 3' half site of the VDRE (Haussler
et al 1998). This association serves to recruit nuclear proteins as co-activitators or co-
repressors necessary for VDR-mediated transcriptional regulation. In short, the
interactions of the 1,25D-bound VDR-RXR complex with nuclear proteins forms a so
called “pre-initiation complex”, which regulates the rate of transcription of the target
gene (Chakravarti et al 1996; Glass et al 1997).
1.4 Biological actions of 1,25D
Maintaining calcium homeostasis involves a coordinated mechanism largely from the
intestine, kidney, bone and parathyroid glands. The complex interactions of these
10
tissues ensure that the availability of calcium is adequate for a number of biological
functions, such as nerve and muscle functions as well the maintenance of mineralised
bone. More recently, 1,25D has been shown to be associated with biological functions
in other tissues, including keratinocytes, T cells and macrophages of the immune
system, islet cells of the pancreas, ovarian cells of the female and certain neuronal
tissue. In most cases, the precise roles for 1,25D in these tissues are still to be
determined, however, it is clear the vitamin D endocrinology has a variety of
biological effects beyond calcium homeostasis.
1.4.1 Intestine
Arguably the most important role for 1,25D is its ability to stimulate dietary calcium
absorption in the small intestine. This was convincingly shown in VDR knockout
mice, which developed marked hypocalcemia as a result of calcium malabsorption (Li
et al 1998(a)). Hence, it was shown that 1,25D increases intestinal calcium absorption
through a VDR-mediated transcription of specific genes involved in active calcium
absorption. A number of proteins have been shown to be essential for the entry of
calcium through the basement membrane into the enterocyte, the movement of
calcium through the cytoplasm, and the transfer of calcium across the basolateral
membrane into the circulation. The cytosolic calcium-binding protein, calbindin-D9k,
is thought to be particularly important in the translocation of calcium across the
enterocyte. 1,25D is able to up-regulate the expression of calbindin-D9k through the
VDRE in the proximal promoter of the gene (Darwish and DeLuca 1996). The direct
action of 1,25D on calbindin-D9k was also shown when the levels of mRNA and
protein for calbindin-D9k were dramatically reduced in the intestines of VDR
knockout mice (Li et al 1998(b)). The role of 1,25D in the regulation of other proteins
involved in the absorption of calcium is less clear. For example, while the extrusion of
11
calcium from the cell into the extracellular fluid by plasma membrane calcium
ATPase pump (PMCA) has been shown to respond to 1,25D treatment in vitamin D
deficient rats (Matkovits and Christakos 1995), no classical VDRE’s have been
identified in the promoter of this gene (Wasserman and Fullmer 1995). Although a
recently cloned epithelial calcium channel, ECaC, which is located in the basement
membrane of the enterocyte, has been shown to be reduced in the duodenum of VDR
knockout mice (Van Cromphaut et al 2001), the role of 1,25D in the regulation of this
ECaC gene expression is not fully understood.
1.4.2 Bone
Vitamin D deficiency leads to defects in bone mineralisation such as is found in
rickets and osteomalacia (Gallagher and Riggs 1978). In VDR-knockout mice, severe
impairment in bone mineralisation characterised by an increase in osteoid levels and
impaired calcein deposition was also shown (Amling et al 1999). Interestingly, normal
bone mineralisation could occur in these animals when they were fed a high calcium
diet, which was similar to the findings shown in calcium-supplemented vitamin D-
deficient animals (Weinstein et al 1984). This suggests that 1,25D is not absolutely
essential for bone mineralisation and the decreased availability of calcium and
phosphorus through impaired intestinal absorption may be the basis of the
mineralisation defect seen in vitamin D deficiency.
Nonetheless, 1,25D has been shown to play an important role in vitro in regulating
osteoblast gene transcription, differentiation and mineralisation (Matsumoto et al
1991; Rickard et al 1995). 1,25D directly stimulates the transcription of two genes
encoding for the bone matrix proteins, osteopontin and osteocalcin, which both
possess vitamin D response elements (VDRE) in their promoter. 1,25D also stimulates
12
osteoclastogenesis by differentiating pro-myelocytes and monocytes to active
osteoclasts (Abe et al 1981; Tanaka et al 1982). The 1,25D stimulation of osteoclastic
differentiation occurs indirectly, however, through osteoblasts to generate an
osteoblast-derived factor, which in turn promotes osteoclastic differentiation (Suda et
al 1995). It was shown that osteoblasts from VDR knockout mice were unable to
stimulate the differentiation of osteoclasts, which clearly indicates the presence of the
VDR in osteoblast is essential for this 1,25D-mediated effect (Takeda et al 1999).
It is thought that in order to maintain normal serum calcium levels, 1,25D can induce
osteoclastic bone resorption in order to mobilise calcium stores from the bone.
However, evidence that suggests 1,25D can also mediate the mineralisation processes,
suggests that 1,25D may be central in the initiation of bone re-modelling processes for
the repair microfracture (Gallagher & Riggs 1990; Langdahl et al 1996). That is, the
1,25D induced osteoclastic activity may provide calcium for the coupled bone
mineralisation process, rather than to maintain serum calcium levels (Eriksen et al
1989).
1.4.3 Parathyroid glands
While PTH stimulates the renal production of 1,25D in response to hypocalcemia,
1,25D can exert a negative feedback signal on the parathyroid glands to suppress
further synthesis and secretion of PTH (Cantley et al 1985; Chan et al 1986).
Furthermore 1,25D has been shown to control parathyroid cell growth (Szabo et al
1989). The PTH gene promoter contains a VDRE, which allows for the direct
regulation of PTH gene transcription by the 1,25D-VDR/RXR complex (Liu et al
1996). The lack of 1,25D feedback of the PTH promoter during vitamin D deficiency
is pronounced causing parathyroid hyperplasia and secondary hyperparathyroidism.
13
The correction of parathyroid gland growth and serum PTH levels in the VDR-
knockout mice through dietary supplementation, suggests that the feedback of 1,25D
on PTH production is not essential. It is likely, therefore, that both 1,25D and calcium
are regulators of PTH synthesis and parathyroid cell proliferation (Li et al 1998(a);
Takeda et al 1999).
1.4.4 Kidney
While perhaps the most important effect of 1,25D in the kidney is the negative
feedback on its own production through the suppression of CYP27B1 activity and the
stimulation of CYP24 activity, there is evidence that 1,25D is involved in calcium
reabsorption. 1,25D increases the expression of the renal calcium-transport protein,
calbindin-D28k (Varghese et al 1988; Bar et al 1990). Armbrecht and coworkers
(1989) showed that serum 1,25D levels correlate strongly with the expression of
calbindin-28k in the kidney measured in wide range of rat age groups. Furthermore,
1,25D has been shown to facilitate renal calcium reabsorption and promotes the PTH-
dependent calcium transport in the distal tubule where active calcium reabsorption
occurs (Yamamoto et al 1984; Friedman and Gesek 1993).
1.5 Factors that effect the kidney vitamin D metabolism
In normal physiological circumstances, the factors that regulate vitamin D
metabolism, such as PTH, calcium, calcitonin and 1,25D itself, are inextricably linked
to ensure that extracellular fluid calcium is tightly controlled within a narrow
concentration range. The response to even slight hypocalcaemia, results in a cascade
of biological processes with the aim to return serum calcium to normal levels. The
effects of a number of factors on vitamin D metabolism may occur indirectly or in
concert with other factors. Hence, experiments investigating the in vivo regulation of
14
vitamin D metabolism have proved difficult. The cloning of the genes for CYP27B1,
CYP24 and VDR, however, has been useful to investigate the direct transcriptional
regulation of the genes involved in vitamin D metabolism and activity.
1.5.1 PTH
While low serum calcium concentrations increases serum 1,25D levels, the release of
PTH during hypocalcemia is the predominant stimulator of renal 1,25D production.
PTH up-regulates the CYP27B1 mRNA levels (St-Arnuad et al 1997) and enzyme
activity (Garabedian et al 1972) predominantly in proximal tubular cells of the kidney.
In parathyroidectomised animals, no stimulation of renal CYP27B1 activity was
detected in response to hypocalcemia (Booth et al 1977; Horiuchi et al 1977). PTH
administration to these animals, however, was able to restore the induction of
CYP27B1 enzyme activity (Weisinger et al 1989; Lobaugh et al 1993). Addition of
PTH to AOK-B50 cells resulted in a 17-fold increase in the full-length CYP27B1
promoter-directed synthesis of luciferase (Brenza et al 1998). Gao et al (2002) showed
a PTH-mediated induction 2.5-fold in the first 305bp of the CYP27B1 promoter in
AOK-B50 cells. While the molecular mechanism behind the PTH-mediated regulation
of CYP27B1 activity is not fully understood, it appears likely that PTH induces
CYP27B1 activity, in part, through a receptor-mediated cAMP/phosphatidylinositol
4,5-bisphosphate (PIP2) signal transduction mechanism (Henry 1997). Three potential
CRE sites have been identified in the promoter of the CYP27B1 gene (Shinki et al
1998), which is suggestive of a direct effect of cAMP on the regulation of the
transcriptional activity of the CYP27B1 gene. CYP27B1 gene expression can be up-
regulated by forskolin, which is a specific cAMP-inducer, but not to the same extent
as was found with PTH-induction of CYP27B1 promoter activity (Brenza et al 1998).
15
Besides stimulating the activity of the CYP27B1 enzyme, PTH also markedly
suppresses the activity of the renal CYP24 enzyme activity (Shinki et al 1992).
Forskolin has been found to mimic the PTH-mediated suppression of renal CYP24
transcriptional activity (Mandla and Tenenhouse 1992), suggesting that cAMP
signalling may be involved in the regulation of CYP24 activity. No conventional CRE
sites have, however, been identified in the proximal promoter of the CYP24 gene. The
suppressive effect of PTH on CYP24 in the kidney does not necessarily occur in other
tissues. PTH has, for example, no effect on the expression of CYP24 mRNA in the
intestine (Shinki et al 1992), which is likely to be due to the absence of PTH receptors
in the intestine (Abou-Samra et al 1994). PTH does, however, stimulate 1,25D
induction of CYP24 mRNA in osteoblast-like cell lines (Armbrecht and Hodam
1994). The PTH-mediated up-regulation of CYP24 in osteoblast-like cells has been
shown to coincide with a rise in VDR mRNA levels (van Leeuwen et al 1992).
Similarly, the PTH-mediated down-regulation of CYP24 in the kidney has been
shown to correspond with a reduction in renal VDR mRNA and protein levels
(Reinhardt and Horst 1990). This suggests that the mechanism for the effect of PTH
on CYP24 activity involves the regulation of VDR expression. Despite the fact that
the mechanism for the PTH-mediated regulation of vitamin D metabolism is
unresolved, it is clear that PTH-mediated stimulation of CYP27B1 activity and
inhibition of renal CYP24 activity results in a marked elevation of circulating plasma
levels of 1,25D (Thakker et al 1986).
1.5.2 Calcium
Calcium primarily affects the renal production of 1,25D by interacting with the
calcium-sensing receptors (CaR) located in the parathyroid gland. In response to a
decrease in circulating serum calcium levels, the parathyroid cells rapidly secrete
16
PTH, which in turn, stimulates the renal production of 1,25D in the kidney. It has,
however, been shown that calcium can also directly regulate the metabolism of
vitamin D in the kidney. Studies, using parathyroidectomised, PTH-replete rats have
shown that elevated levels of serum calcium are able to reduced the circulating levels
of 1,25D (Matsumoto et al 1987; Weisinger et al 1989). Bland et al (1999) found a 5-
fold increase in the 1,25D production in the human proximal tubule cell line, HKC-8,
when treated with a low serum calcium medium. When these cells were treated with a
medium containing high level of calcium, the 1,25D production was significantly
reduced. The direct effect of calcium was suggested to be mediated by the CaR, which
is present in all segments of the nephron. The exact mechanism, however, of the CaR-
mediated inhibition of CYP27B1 mRNA expression is not known.
1.5.3 Calcitonin
When the circulating levels of calcium are high, the parathyroid gland halts the
secretion of PTH and the parafollicular cells of the thyroid gland turn on the secretion
of the hormone, calcitonin. Calcitonin directly acts on osteoclasts and osteocytes,
which results in a reduction of bone resorption and calcium mobilisation from the
skeleton, which results in the lowering of the circulating levels of calcium (Martin
1999). Although the role of calcitonin in vitamin D metabolism is suggested by some
to be secondary to the role of PTH (Lorenc et al 1977; Jones et al 1998), there have
been a number of studies that demonstrate a direct role for calcitonin in the
metabolism of vitamin D (Galante et al 1972; Beckman et al 1994). Of particular
interest, is the report that calcitonin stimulates the expression of CYP27B1 mRNA in
the kidney when serum calcium levels are normal (Shinki et al 1999). This study
showed that while the PTH-mediated stimulation of the expression of CYP27B1
mRNA occurred during hypocalcemia, only calcitonin was able to stimulate the
17
expression of CYP27B1 mRNA during normocalcemia. This finding is supported by
the identification of a positive regulatory site for calcitonin in the promoter of the
CYP27B1 gene (Murayama et al 1998). Recently, in vitro studies have shown that
calcitonin can up-regulate CYP24 promoter activity in the human kidney cell line,
AOK-B50 (unpublished data, Gao and May). The mechanism by which this up-
regulation occurs is, however, yet to be determined. In contrast to the kidney,
calcitonin has been found to inhibit the intestinal transcriptional regulation and
enzyme activity of CYP24. In thyroparathyroidectomised rats, a single dose of
calcitonin was found to return intestinal CYP24 mRNA expression levels to normal
(Beckman et al 1994). Although it has been shown that calcitonin may effect the
regulation CYP27B1 and CYP24 gene expression, the precise role of calcitonin in
mediating vitamin D metabolism remains unclear.
1.5.4 1,25D
The most striking effect of 1,25D on the metabolism of vitamin D is the up-regulation
of CYP24 activity. In fact, in vivo studies show that 1,25D is the most potent
stimulator of CYP24 activity. The 1,25D-mediated up-regulation of CYP24 activity
was first shown in the kidney and intestine (Tanaka and DeLuca 1974; Tanaka et al
1975; Tanaka et al 1977; Kumar et al 1978), and has also been shown in other tissues,
such as in bone (Howard et al 1981; Puzas et al 1987). 1,25D, bound to the VDR, has
been shown to directly stimulate the expression of CYP24 mRNA expression, by
interacting with the two VDREs found on the promoter of the CYP24 gene (Hahn et
al 1994; Kerry et al 1996). The induction of CYP24 and catabolism of 1,25D by
1,25D itself is an important feedback loop, which modulates the 1,25D-mediated
signalling in target tissues.
18
When 1,25D was administered to vitamin D-deficient rats, CYP24 activity in the
kidney was markedly induced and a reciprocal disappearance of renal CYP27B1
activity was found (Tanaka et al 1977). During vitamin D-deficiency, CYP27B1
activity is increased, which is attributed, in part, to the lack of negative feedback by
1,25D on CYP27B1 activity (Brunette et al 1977; Kawashima et al 1981; Fox et al
1991). The apparent down-regulation of CYP27B1 activity by 1,25D takes 2–4 hours
and is blocked by inhibitors of protein synthesis and transcription (Rosenthal et al
1980). The mechanism behind the effect of 1,25D on the regulation of CYP27B1 gene
transcription is not well understood, particularly since no classical VDREs have been
identified in the proximal promoter of the CYP27B1 gene. Murayama and co-workers
(1998) were able to locate a response region within the murine CYP27B1 promoter
that responded negatively to 1,25D. The exact mechanism behind this process,
however, has not been fully elucidated. While it is likely that 1,25D achieves its
effects on CYP27B1 by an indirect mechanism, an atypical negative VDRE within the
CYP27B1 gene promoter cannot be ruled out. Recently, Brenza and DeLuca (2000),
who showed the kidney CYP27B1 mRNA suppression by 1,25D administration in
vivo, were unable to show 1,25D-mediated suppression of CYP27B1 promoter
activity in AOK-B50 kidney cells. They suggested, therefore, that the mechanism of
1,25D-mediated suppression of CYP27B1 activity in vivo is indirect and may involve
other factors such as calcium and PTH.
1.6 Evidence for bone vitamin D metabolism
1.6.1 Bone 1α-hydroxylation
Although bone cells have has been known for over two decades to synthesise 1,25D,
surprisingly little is known about the regulation of CYP27B1 activity in the bone and
19
about the importance of the locally produced 1,25D. The first report that bone cells
could synthesise their own 1,25D came from Turner and co-workers (1980). They
found that primary cultures of human bone cells, taken from iliac crest biopsies and
incubated with 25D for 4 hours, synthesised both 1,25D and 24,25D, with specific
activities similar in magnitude to those of the enzymes found in kidney cells. The
suppression of CYP27B1 activity and stimulation of CYP24 activity by 1,25D itself in
these bone cells supported the proposition of Turner and co-workers that the
production of 1,25D in bone cells could be regulated in order to mediate bone mineral
metabolism.
Bone marrow macrophages have also been found to convert 25D into either 1,25D or
24,25D. Reichel and co-workers (1987(d)) demonstrated that, upon exposure to
recombinant human interferon-gamma (IFN-γ), bone marrow-derived macrophages
initially synthesised 1,25D from 25D. A delay in the breakdown of 25D to 24,25D,
suggested that the production of 24,25D was stimulated by high intracellular levels of
1,25D rather than by the IFN- γ. The 1,25D synthesised in the bone marrow
macrophages was found to promote the differentiation of pro-myelomonocytic HL-60
cells into macrophage-like cells, which suggests that locally produced 1,25D may act
in a paracrine or autocrine manner to modulate cell differentiation. The
myelomonocytic cell line, HD-11, was also shown to synthesise 1,25D from 25D.
Since this cell line is known to express the VDR, it is suggested that locally produced
1,25D may be involved in autocrine signalling (Adams et al 1990).
More recently, CYP27B1 mRNA has been identified in bone tissue by our laboratory
(unpublished data) and by other investigators (Panda et al 2001(a)). Panda and co-
20
workers were able to show by qualitative RT-PCR that the expression of CYP27B1
mRNA in rats was significantly higher in foetal bone than in adult bone. Furthermore,
they identified CYP27B1 mRNA expression in growth plate chondrocytes and
osteoblasts by in situ hybridisation. They were unable, however, to detect CYP27B1
mRNA in osteoclast or in the bone marrow using this method.
Although it is clear that specific bone cells contain the CYP27B1 enzyme and are able
to convert 25D to 1,25D, the functional relevance of this locally produced 1,25D is
still unknown. Of considerable interest is the study of 1,25D levels in human bone
conducted by Sagiv and co-workers (1993). They found that, although serum 1,25D
levels were similar in all age groups studied, the levels of 1,25D in the bone were
higher in women of 45 years of age and less when compared to those found in older
age groups (46-60 years and 61+ years of age). The same research team also
discovered that women of approximately 80 years of age, who had had a subcapital
fracture of the femur, had 5-times lower levels of 1,25D in the bone when compared
to those detected in aged matched women who had not had a fracture (Lidor et al
1993). This was despite the fact that the serum 1,25D levels were only slightly lower
in these women than in normal individuals. The association between low 1,25D levels
in the bone, aging and subcapital fracture may be significant in the understanding of
why normal circulating levels of 1,25D in hip fracture patients are not able to
normalise bone turnover. Moreover, the findings from these clinical studies suggest
that the 1,25D production in the bone may in deed be important in the bone
mineralisation processes.
21
1.6.2 Bone 24-hydroxylation
The identification of CYP24 activity in the intestine (Kumar et al 1978), was soon
followed by the finding that bone cells also have the ability to catabolise 1,25D.
Isolated rat calvarial cells were found to produce 24,25D following incubation with
25D (Turner et al 1980). The regulation of the activity of CYP24 in osteoblasts and
other bone cells has, however, only been extensively studied since the structural
characterisation and cloning of the gene for CYP24 (Ohyama et al 1993; Chen and
DeLuca 1995). The role for bone CYP24 in modulation of the activity of 1,25D was
illustrated best using a CYP24-knockout mouse model (St-Arnaud et al 2000). The
CYP24-knockout mice exhibited abnormal bone histology, characterised by excessive
un-mineralised bone matrix. It was suggested that the inability of bone cells, such as
osteoblasts, to catabolise 1,25D resulted in an unabated continuation of 1,25D-
mediated processes in these cells. This concept was shown to be likely when a VDR-
knockout mouse was crossed with the CYP24-knockout mouse expressing an
abnormal bone phenotype (St-Arnaud et al 2000). The bones of the double-knockout
mouse were phenotypically normal, provided a sufficient amount of calcium was
given to these animals in their diet. In the absence of the VDR, the high levels of
1,25D, which occurred as a consequence of the cells inability to catabolise 1,25D,
were unable to instigate its toxic effects on the bone. The finding that these animals
had normal bones, despite the absence of CYP24 activity, disproved the theory that
24,25D, produced by 24-hydroxylating 25D, was an important in the process of bone
development (St-Arnaud et al 2000).
Nishimura and co-workers (1994) were amongst the first to show that the
administration of 1,25D to rats resulted in an increase in the expression of CYP24
22
mRNA in the bone. They also found that the 1,25D induction of CYP24 mRNA
expression in the rat immature osteoblastic cells line, C-26, was greater than the
induction in the mature osteoblast cell line, C-11. PTH did not down-regulate the
1,25D-mediated expression of CYP24 mRNA in either the C-26 or the C-11 cell line,
which is in contrast with the finding that PTH suppresses the expression of CYP24
mRNA in the kidney. These findings suggest that the control of the expression of
CYP24 mRNA is tissue-specific. While the stimulation of CYP24 activity by 1,25D
in the bone clearly shows that it is involved in the modulation of 1,25D-mediated
processes, it is less clear whether the induction of CYP24 activity occurs
predominantly in response to the circulating levels of 1,25D or to the locally produced
1,25D in the bone.
1.7 Aims and hypotheses
The studies, described in this thesis, were based on the hypothesis that the metabolism
of vitamin D in bone cells is regulated independently from the metabolism of vitamin
D in the kidney. The recent characterisation of the CYP27B1 gene allows for the
study of the expression of CYP27B1 in the bone at the molecular level. Investigation
into the effects of age, dietary calcium and vitamin D, on the expression of CYP27B1,
CYP24 mRNA and VDR mRNA in rat kidney and bone tissue, provides valuable
insight into the control of the metabolism of vitamin D in both the kidney and bone.
Furthermore, by investigating the association between the synthesis of 1,25D in the
bone and bone cell processes such as mineralisation, a role for the locally produced
1,25D can be proposed.
23
1.7.1 Detection and quantification of CYP27B1, CYP24 and VDR
mRNA by Real-Time RT-PCR
The accurate quantification of CYP27B1 and CYP24 mRNA, has been difficult due to
the limitations in the ability to detect these lowly expressed mRNA species. While the
detection of CYP27B1, CYP24 and VDR mRNA by reverse transcriptase-polymerase
chain reaction (RT-PCR) has been performed in a number of studies, the accurate
quantification of these mRNA species by the relatively new technique of Real-Time
RT-PCR, has not been attempted. Furthermore, there are no reports of the
quantification of mRNA that has been extracted from mineralised bone by Real-Time
RT-PCR. The thorough assessment of the procedure for detecting levels of lowly
expressed mRNA species, provides a reliable method of mRNA quantification, which
other analytical procedures have not been able to provide.
1.7.2 The effect of age on the metabolism of vitamin D in kidney and
bone
The renal production of 1,25D has been shown to decline with age. This decline is
caused by a reduction in the activity of the CYP27B1 enzyme and an increase in the
activity of the CYP24 enzyme. While a number of different bone cells have been
shown to express the CYP27B1 and CYP24 genes, there is no documentation on the
regulation of the CYP27B1 and CYP24 mRNA expression in the bone with age.
While the inverse relationship between the expression of CYP27B1 and CYP24
mRNA in the kidney with age has been established, the relationship between the
expression of CYP27B1 and CYP24 mRNA in the bone is not known. Furthermore,
while VDR is essential for the expression of CYP24 mRNA in the kidney, the
24
relationship between the expression of CYP24 and VDR mRNA in the bone is
unclear.
Hypothesis 1: The role of the kidney in the supply of vitamin D-responsive tissues
with 1,25D is well documented. Since it is likely that the 1,25D produced in the bone
is used for autocrine or paracrine signalling processes, rather than for the maintenance
of circulating 1,25D levels, we hypothesise that the regulation of the metabolism of
vitamin D in the bone with age will specifically reflect the requirements of the 1,25D-
mediated processes that occur in the bone during the process of aging. That is, the
production of 1,25D will be highest in younger rats during periods of rapid bone
growth, metabolism and mineralisation.
1.7.3 The effect of dietary calcium on vitamin D metabolism in kidney
and bone
The effects of dietary calcium on the metabolism of vitamin D in the kidney have
been well described. A low calcium diet increases the renal production of 1,25D by
increasing the expression of CYP27B1 mRNA and reducing the expression of CYP24
mRNA, largely through transcriptional regulation by PTH. The effects of dietary
calcium concentration, however, on the expression of CYP27B1, CYP24 and VDR
mRNA in the bone, have not been documented.
Hypothesis 2: 1,25D has been found to promote the maturation of osteoblasts. Bone
mineralisation is also enhanced in the presence of a high concentration of calcium.
However, the mechanism by which a high calcium diet increases bone formation
when the circulating levels of 1,25D are suppressed is unknown. We hypothesise that,
in animals fed a high calcium diet, the production of 1,25D in the bone will be
25
increased. When circulating levels of 1,25D are low due to the high calcium diet, the
expression of CYP27B1 mRNA will be increased and the expression of CYP24
mRNA will be decreased to maximise the local 1,25D production, with the aim to
maintain the 1,25D-mediated bone formation process.
1.7.4 The effect of vitamin D-depletion on vitamin D metabolism in
kidney and bone
Vitamin D-deficiency has been shown to increase the expression of CYP27B1 mRNA
and to abolish the expression of CYP24 mRNA in the kidney. As well, vitamin D-
deficiency reduces VDR mRNA levels in parallel with the reduction in CYP24
mRNA expression. The inverse relationship between the expression of CYP27B1 and
CYP24 mRNA during vitamin D-depletion is consistent with the fact that the kidney
is the main supplier of 1,25D for the circulation. While the activity of CYP24 in rat
osteoblasts-like cells is known to be reduced in the absence of 1,25D, the effect of
vitamin D-depletion on the activity of CYP27B1 in the bone is unknown. The in vivo
effect of vitamin D-depletion on the metabolism of vitamin D in the bone has not been
investigated.
Hypothesis 3: While production of 1,25D in the kidney will be maximised in
response to vitamin D-depletion in an effort to restore circulating levels of 1,25D, the
production of 1,25D in the bone will be increased to compensate for the shortfall in
circulating levels of 1,25D. We hypothesise that, in the bone, the expression of
CYP27B1 mRNA will increase and the expression of CYP24 mRNA will decrease in
response to vitamin D-depletion.
26
1.7.5 The effect of dietary calcium during vitamin D-depletion on
vitamin D metabolism in kidney and bone
During vitamin D-deficiency, calcium absorption in the intestine is impaired, which
can lead to reduced serum calcium levels and reduction in the mineralisation of bone.
It has been shown that normal mineralisation of bone can occur during vitamin D-
deficiency when a high level of calcium is added to the diet. It is not known, however,
what the mechanism is that allows a high calcium diet to increase bone formation
when circulating 1,25D levels are deficient. The up-regulation of the production of
1,25D in the bone when fed a high calcium diet may mediate the mineralisation of
bone in the absence of circulating 1,25D levels.
Hypothesis 4: We hypothesise that, during vitamin D-depletion, a high calcium diet
will stimulate the synthesis of 1,25D in the bone, to an extent that does not occur in
the kidney, by increasing bone CYP27B1 mRNA expression and reducing CYP24
mRNA expression. This local production of 1,25D would allow for normal 1,25D-
mediated bone mineralisation to occur.
27
CHAPTER 2: MATERIALS AND METHODS
2.1 Introduction
Although many studies have extracted RNA from a variety of soft tissues, few have
extracted RNA from hard bone tissue. RNA, extracted from hard bone tissue, can be
contaminated with proteoglycans, which can affect the normal electrophoretic
migration of RNA through an agarose gel. This chapter describes a modified
technique for RNA extraction, based on the method from Chomczynski and Sacchi
(1991), that yields pure, un-degraded, proteoglycan-free RNA that can be used in a
real-time reverse-transcriptase polymerase chain reaction (RT-PCR). Previous studies
have examined the levels of expression of CYP27B1, CYP24, and VDR, by using a
semi-quantitative PCR technique or by performing Northern blot analysis. The low
levels of expression of CYP27B1 and CYP24, however, make a quantitative analysis
of the levels of mRNA expression difficult by these methods. This chapter describes
the relatively new technique of real-time RT-PCR, that is used to quantify the
absolute levels of target mRNA and overcome the shortfalls of other methods. The
technique for ribonuclease protection assay is also described to verify the results that
are obtained by using the real-time RT-PCR method. Furthermore, the dietary
treatments, specimen collection procedures and the techniques used to measure the
biochemical factors that are associated with calcium homeostasis and vitamin D
metabolism are described.
2.2 Materials
All chemicals and consumables used in the experiments were purchased from Sigma
Chemical Company (Milwaukee, USA), unless otherwise stated.
28
2.3 Animals
All animals used in the experiments were female Sprague-Dawley rats, which were
obtained from the Gilles Plains Animal Resource Centre (Gilles Plains, South
Australia). Animals used to investigate the effects of age (Chapter 4) were virgin. The
animals raised to be vitamin D-deplete were bred from mothers fed a vitamin D-
deficient diet. All other animals were retired-breeders of 5 months of age.
2.3.1 Housing
All animals were housed at 24°C with a 12-hour light/dark cycle. Animals raised to be
vitamin D-deplete were exposed to incandescent lighting. All other animals were
exposed to standard lighting.
2.3.2 Diet
Rats were fed either a commercial rat chow ad libitum (Table 2.1), containing 1%
calcium, 0.6% phosphorus and 4000U/Kg vitamin D (Milling Industries Pty Ltd.,
South Australia) or 40g per day of the AIN-93-VX semi-synthetic diet (American
Institute of Nutrition 1977, American Institute of Nutrition 1980) with the levels of
dietary calcium and vitamin D modified for the different experimental procedures.
Tap water was supplied ad libitum to all animals.
2.3.2.1 Semi-Synthetic diet
The semi synthetic diets were prepared in the laboratory according to a standard
formula (Table 1). The components of the mineral mix were weighed, crushed and
thoroughly mixed in a plastic container. Casein, cornstarch and cellulose were mixed
for 30 minutes in a pizza dough mixer (OEM, VE201, Bozzolo (MN) Italy). DL-
methionine, choline bitartrate, mineral mix (Table 2.3), CaCO3
29
Table 2.1 Components of the Semi-Synthetic Diet
Ingredient (g/Kg mix)
Casein 200
Corn Starch 650
Cellulose 50
DL-Methionine 3
Choline Bitartrate 2
Mineral Mix* 35
AIN-93-VX Vitamin Mix# 10
Calcium Carbonate (0.1%-1%) 25-250
Corn oil 50
The Composition of the AIN-93-VX vitamin mix (ICN Biomedicals Australasia,
Seven Hills, Australia) was as follows (mg/kg diet): Thiamine hydrochloride, 6;
Riboflavin, 6; Pyridoxine hydrochloride, 7; Nicotinic acid, 30; D-calcium
pantothenate, 16; Folic acid, 2; D-biotin, 0.2; Cyanocobalamin, 0.01; Retinyl
palmitate, 16; DL-α-tocopherol acetate, 200; Cholecalciferol, 2.5; Menadione sodium
bisulphite complex, 0.5; Finely powdered sucrose, 9729. * see Table 2.2 for mineral
mix components. # The AIN-93-VX Vitamin Mix is replaced by the AIN Special
vitamin D fortification mixture-Vitamin D-deficient, when preparing the diet for the
vitamin D-deplete animals.
30
Table 2.2 Components of the Mineral Mix*
Ingredient (g/Kg mix)
Sodium di-hydrogen phosphate (2H20) 197
Potassium di-hydrogen phosphate 275
Potassium sulphate 52
Magnesium oxide 24
Manganous carbonate 3.5
Ferric citrate 6
Zinc carbonate 1.6
Cupric carbonate 0.3
Potassium iodate 0.01
Sodium selenite 0.01
Chromium potassium sulphate 0.55
Sucrose (finely powdered) 440.03
31
(BDH, Kilsyth, Australia) and vitamin mix, (ICN Biomedicals Australasia, Seven
Hills, Australia) were combined and mixed thoroughly before being blended into the
casein, cornstarch and cellulose mixture. The amount of CaCO3 added was varied to
obtain either a 0.1% calcium diet or a 1% calcium diet. The vitamin mix either
contained the recommended levels of vitamin D (AIN-93-VX, ICN Biomedicals
Australasia, Seven Hills, Australia) or did not contain any vitamin D (Special vitamin
D fortification mixture-Vitamin D-deficient, ICN Biomedicals Australasia, Seven
Hills, Australia). Mixing was allowed to continue for a further 30 minutes. While the
dough mixer was in motion, corn oil was added to the mixture and mixing continued
for a further 30 minutes or until the mixture was consistent. Sufficient water was
added to form a dough, which was pressed into trays to a 3cm thickness. The dough
was allowed to dry overnight before it was divided up and frozen at -20°C.
2.3.3 Blood sample collection
All blood samples were taken from the tail vein under halothane anaesthesia. 2.5mLs
of blood was collected by removing 2mm from the tip of the tail with a scalpel. The
blood was collected in tubes with a clotting activator and centrifuged at 3,500 rpm for
15 minutes to collect the serum. A 250µl aliquot of serum from each blood sample
collected was stored separately for parathyroid hormone analysis. All serum samples
were frozen at –20°C until required for analysis.
2.4 Blood biochemistry
2.4.1 Serum calcium and phosphate
Serum calcium was measured according to the method of Moorehead and Biggs
(1974). Calcium reacts with cresolphtalein complexone in alkaline solution to form a
32
purple coloured complex. The intensity of the purple colour formed is proportional to
the calcium concentration and can be measured photometrically at 575nm. Serum
calcium was measured on a Clinical chemistry analyser (Cobas Bio, IN, USA), using
reagents manufactured by Trace Scientific (Victoria, Australia).
2.4.2 Serum 1,25 dihydroxyvitamin D3
Serum 1,25 dihydroxyvitamin D3 (1,25D) was measured by a 125I radioimmunoassay
(RIA) (Immunodiagnostic Systems Ltd, Bolden, UK). The serum samples are
delipidated and 1,25D is extracted from potential cross-reactants by incubation with a
highly specific, solid phase, monoclonal anti-1,25D antibody. The purified 1,25D
eluate is incubated with a highly specific sheep anti-1,25D antibody. Separation of the
antibody-bound tracer from the free tracer is achieved by a short incubation with anti-
sheep IgG cellulose. The bound radioactivity is inversely proportional to the
concentration of 1,25D. The minimum detectable concentration of the assay was
5pmol/L and at 118pmol/L, the interassay coefficient of variation was 5%.
2.4.3 Serum 25 hydroxyvitamin D3
Serum 25 hydroxyvitamin D3 (25D) was measured by a 125I radioimmunoassay (RIA)
(Immunodiagnostic Systems Ltd, Bolden, UK). This method involves the extraction
of 25D, followed by an incubation with both 125I-25D and a highly specific sheep anti-
25D-antibody. Separation of the antibody-bound tracer from the free tracer is
achieved during a short incubation step with an anti-sheep IgG cellulose. The bound
radioactivity is inversely proportional to the concentration of 25D. The minimum
detectable concentration of the assay was 3.0ηmol/L and at 136nmol/L, the interassay
coefficient of variation was 7.3%.
33
2.4.4 Serum parathyroid hormone
Serum parathyroid hormone (PTH) was measured using a rat-specific, two-site
immunoradiometric assay (IRMA) (Immutopics, Inc., San Clemente, CA USA). Both
intact PTH (1-84 amino acids) and N-terminal PTH (1-34 amino acids) are
immunologically bound by an immobilised antibody and a radiolabelled antibody, to
form a sandwich complex. The levels of the radioactively bound complex are then
measured in a gamma counter (Crystal II, Multidetector RIA System, Packard
Instruments Inc, Illinios, USA). The minimum detectable concentration of the assay
was 1.0 pg/mL and at 50 pg/mL, the interassay coefficient of variation was 4%.
2.4.5 Serum calcitonin
Serum calcitonin was measured by a rat specific, two-site immunoradiometric assay
(IRMA) (Immutopics, Inc., San Clemente, CA USA). A monoclonal antibody is
immobilised on plastic beads and captures both calcitonin and an affinity purified,
radiolabelled, polyclonal antibody, thereby forming a sandwich complex, which can
be detected. The radioactively labelled complex is then measured in a gamma counter
(Crystal II, Multidetector RIA System, Packard Instruments Inc, Illinios, USA). The
minimum detectable concentration of the assay was 0.6 pg/mL and at 33 pg/mL, the
interassay coefficient of variation was 3%.
2.5 Statistical analyses
2.5.1 One-way analysis of variance
One-way analysis of variance was used to analyse the effects of age on the expression
of CYP27B1, CYP24 and VDR mRNA and on the levels of serum biochemical
markers. The changes in bone cell mRNA levels for CYP27B1, CYP24 and VDR in
34
different bone fractions were also determined using this statistical test. The data were
analysed in Microsoft Excel 2000 (version 9.0.2720), which was run on a personal
computer. A value of p<0.05 was considered to be statistically significant.
2.5.1 Two-way analysis of variance
Two-way analysis of variance was used to analyse the effects of dietary calcium and
vitamin D treatment on the levels of mRNA expression and to analyse the interaction
between the two dietary treatments. The data were analysed in Microsoft Excel 2000
(version 9.0.2720), which was run on a personal computer. A value of p<0.05 was
considered to be statistically significant.
2.5.2 Tukey’s post-hoc test
A Tukey’s post-hoc test was used to identify the mean values that were significantly
different from each other within a data set that had been found to be statistically
significant with either a one- or two-way analysis of variance. The data were analysed
in PostHoc MS-DOS program (version 1.1), which was run on a personal computer.
2.5.3 Linear and multiple-linear regression analysis
Linear regression analysis was used, based on the "least squares" method to fit a line-
of-best-fit through a set of observations and to obtain a coefficient of determination
(R2) for the correlation between the observations recorded. When two or more
independent variables were analysed, a multiple linear regression analysis was used to
identify the determinants of a particular dependent variable. The data were analysed in
Microsoft Excel 2000 (version 9.0.2720), which was run on a personal computer. A
value of p<0.05 was considered to be statistically significant.
35
2.6 Molecular biology techniques
2.6.1 Materials and preparation of reagents
2.6.1.1 Antibiotics
A 100mg/mL stock solution of ampicillin and a 100mg/mL stock solution of
tetracycline were prepared in deionised H2O and sterilised through a 0.2µm Minisart
(Sartorius AG, Göttingen, Germany).
2.6.1.2 RNase inhibiting solution
RNase inhibiting solution (solution D) was prepared by dissolving 4M guanidine
isothiocynate (Gibco BRL Life Technologies Inc., MD, USA), 25mM sodium citrate,
pH 7 (BDH Chemicals, Kilsyth, Australia) and 0.5% sarcosyl at 60ºC. 2-
mercaptoethanol was added to obtain a concentration of 0.1M prior to use.
2.6.1.3 Buffer solutions
The buffer used for storing RNA and DNA (TE) consisted of 10mM Tris and 1mM
EDTA, pH 7.5. The electrophoresis buffer used for RNA and DNA electrophoresis
(TAE) consisted of 2mM Tris-acetate and 0.1mM EDTA, pH 8.2. The electrophoresis
buffer for ribonuclease protection assay (TBE) consisted of 10mM Tris, 9mM boric
acid, and 0.1mM EDTA, pH 8.3. The buffer used in the in situ hybridisation process
(SSC) consisted of 0.15M sodium chloride (BDH Chemicals, Kilsyth, Australia) and
15mM sodium citrate (BDH Chemicals, Kilsyth, Australia).
2.6.1.4 Formamide
Formamide (BDH Chemicals, Kilsyth, Australia) was deionised by adding 5% of ion
exchange resin (AG-501-X8 resin, BioRad, CA, USA) and stirring at room
36
temperature for 30 minutes. The formamide was filtered twice through No.1 Whatman
paper (Whatman International Ltd., Maidstone, UK) and was stored at 4°C.
2.6.1.5 Loading buffers for electrophoresis
Urea loading buffer (3 x concentrated) used for DNA agarose gel electrophoresis, was
prepared by dissolving 4M urea (BDH Chemicals, Kilsyth, Australia), 50% sucrose
(BDH Chemicals, Kilsyth, Australia), 50mM EDTA and 0.1% bromophenol blue at
37°C and stirring for 30 minutes. Loading buffer used for RNA agarose gel
electrophoresis (5 x concentrated), consisted of 25% glycerol, 0.5% sodium dodecyl
sulphate (SDS), 0.025% bromophenol blue, 1% xylene cyanole and 25mM EDTA
pH7.4. Loading buffers were stored at -20°C.
2.6.2 Preparation of cDNA
The cDNA for 25-hydoxyvitamin D 1α-hydroxylase (CYP27B1) (St-Arnaud 1997),
25-Hydoxyvitamin D 24-hydroxylase (CYP24) (Ohyama et al 1991(a)), Vitamin D
receptor (VDR) (Burmester et al 1988(a); Kamei et al 1995) and glyceraldehyde 3-
phosphate dehydrogenase (GAPDH) (Tso et al 1985, Fort et al 1985) were kindly
donated by Dr Brian May (Department of Molecular Biosciences, The University of
Adelaide, Australia).
2.6.2.1 Transformation of plasmids into competent cells.
5ng of plasmid was added to 20 µL of chemically competent DHα-Rec A- cells
(Donated by Dr Brian May, Department of Biochemistry) and this mixture was
incubated on ice for 20 minutes. The cells were heated for 2.5 minutes at 42°C and
then incubated for a further 2 minutes. The cells were recovered with 1 mL of L-
Broth, containing 0.01% Bactotryptone (Difco Laboratories, Michigan, USA),
0.005% Bacto yeast extract (Difco Laboratories, Michigan, USA), 0.01% sodium
37
chloride (BDH Chemicals, Kilsyth, Australia) and 20mM glucose (BDH Chemicals,
Kilsyth, Australia) in a shaking water bath for 30 minutes at 37°C. The pelleted cells
were plated onto Bactoagar (Difco Laboratories, Michigan, USA) agar plates (15g/L
L-broth), containing either 50ug/mL of ampicllin or 12.5µg/mL of tetracycline
according to antibiotic resistance of the plasmid prepared. Agar plates are incubated
inverted at 37°C overnight.
2.6.2.2 Plasmid screening procedure
Th plasmids were isolated by inoculating 500uL of L-broth with a colony from the
agar plate (Chapter 2.5.2.1) and incubated for 30 minutes at 65°C. The lysed cells
were centrifuged and 1µl of the supernatant was mixed with urea loading buffer
(Chapter 2.5.1.5) and was analysed along side 1µg of DMW-500 molecular weight
marker (Geneworks, Thebarton, Australia), in a 1% agarose-TAE electrophoresis gel
(Promega Company, Annadale, Australia) in TAE buffer (Chapter 2.5.1.3) at 80 volts
for 30 minutes. The agarose gel was stained in a 1mg/L ethidium bromide solution
and imaged by FluorImager 595 (Molecular Dynamics Inc., CA, USA) and
ImageQuant version 3.3 software (Molecular Dynamics Inc., CA, USA), which was
rum on a personal computer.
2.6.2.3 Growth of bacterial cultures
A colony was selected from the agar plate and used to inoculate a starter culture of
20mL L-broth containing either 50µg/mL ampicillin (Chapter 2.5.1.1) for the
CYP27B1, CYP24 and VDR plasmids or 12.5µg/mL tetracycline (Chapter 2.5.1.1)
for the GAPDH plasmid, and was incubated for 6 hours at 37°C. The starter culture
was then added to another 500mL of antibiotic L-broth and incubated at 37°C on an
38
orbital shaker over-night. 300µL of 80% glycerol was added to 300µL of the cell
culture and was stored at -70°C for future preparations of plasimds.
2.6.2.4 Isolation of plasmid DNA
To collect the cells, the bacterial cultures were centrifuged at 5,000rpm at 4°C for 15
minutes. The cell pellets were resuspended in mixture of 5mL TES (25mM Tris,
10mM EDTA, 15% (w/v) sucrose) and 1mL lysozyme (12 mg/mL dissolved in TES)
and incubated at 4°C for 40 minutes. 1% SDS and 0.2M sodium hydroxide (BDH
Chemicals, Kilsyth, Australia) were added and the cells were incubated on ice for a
further 10 minutes. 7.5ml of 3M sodium acetate, pH 4.6, was added to neutralise the
sodium hydroxide. The cells were incubated on ice for a further 10 minutes before
being centrifuged at 14,000 rpm at 4°C for 15 minutes to remove cell debris. The
supernatant was treated with 100µL RNase A (10mg/mL in 10mM Tris-HCl, pH 8.0
and 15mM sodium acetate) for 2 hours. The plasmid DNA was extracted twice by
adding 1 volume of phenol, pH 8.0 (saturated with 10mM Tris-HCl and 1mM EDTA)
and 1 volume of 24:1 chloroform/isoamyl alcohol (BDH Chemicals, Kilsyth,
Australia) and centrifuged at 13,000rpm at 4ºC for 5 minutes. The aqueous phase was
then mixed with 2 volumes of ethanol and incubated room temperature for 5 minutes
before being centrifuged at 13,000rpm for 15 minutes to recover the DNA. The DNA
was washed in 70% ethanol, re-centrifuged, air dried at room temperature and re-
dissolved in 1mL of TE buffer (Chapter 2.5.1.3). The DNA, together with 1µg of
DMW-500 molecular weight marker (Geneworks, Thebarton, Australia) was analysed
by electrophoresis on a 1% agarose-TAE gel (Promega Company, Annadale,
Australia) in a 1 x TAE buffer (Chapter 2.5.1.3) at 80 volts for 30 minutes. The
agarose gel was stained in a 1mg/L ethidium bromide solution and imaged by
39
FluorImager 595 (Molecular Dynamics Inc., CA, USA) and ImageQuant version 3.3
software (Molecular Dynamics Inc., CA, USA).
2.6.2.5 Quantification of DNA
The concentration of plasmid DNA was quantified by measuring the absorbance at
260nm on a spectrophotometer (Beckman Instruments, CA, USA). DNA samples
were diluted by adding 1µL of the plasmid DNA to 99µL of deionised H2O and were
then measured at a wavelength of 260nm DNA concentration was calculated with the
following formula:
DNA concentration (µg/µL) = Absorbance at 260nm x 50 x 100 (dilution factor)
Where Absorbance at 260nm = 1 for a 50µg/mL DNA solution (Sambrook et al 1989)
2.6.2.6 Digestion and isolation of cDNA fragments
Specific restriction enzymes were used to excise the cDNA from the host plasmid
(pBS−CYP27B1, EcoR1 and Nar1; pBSSK-CYP24, EcoR1 and Kpn1; pRSV-VDR, Eco
R1 and BamH1; pBR322-GAPDH, Pst1). The amount of restriction enzyme and one-
phor-all reaction buffer (100mM tris-acetate, pH 7.5, 100mM Magnesium acetate,
500mM potassium acetate) used to digest the plasmid was according to manufacturer
recommendations (Pharmacia Biotech, Uppsala, Sweden). The reaction mixtures were
incubated for 2 hours at 37°C. The digested mixtures were separated in a 1% agarose
gel (Promega Company, Annadale, Australia) together with 1µg of the DMW-500
molecular weight marker (Geneworks, Thebarton, Australia) at 80 volts for 30
minutes. The gel was stained in a 1mg/L ethidium bromide solution and viewed under
UV light. The cDNA band was excised from the remaining gel and the cDNA was
extracted from the agarose gel using a gel extraction kit (Quiagen GmbH, Hilden,
Germany). Briefly, the gel slice that contained the DNA was solubilised by adding 3
1000 1
40
volumes of a highly concentrated chaotropic salt buffer in the presence of silica
particles. DNA absorbs to the silica particles in the presence of high salt
concentrations. The high salt buffer was then used to wash the DNA bound silica,
which was followed by two washes in a 60% ethanol buffer to remove residual
agarose and salt contaminants. The silica particles were air-dried and the DNA was
eluted in TE buffer (Chapter 2.5.1.3). 1µL of the purified cDNA was electrophoresed
with 2µL of 3x urea loading buffer (Chapter 2.6.1.5) and 3µL H2O on a 1% agarose-
TAE gel (Promega Company, Annadale, Australia) in a 1 x TAE buffer (Chapter
2.6.1.3) at 80 volts for 30 minutes. The agarose gel was stained in a 1mg/L ethidium
bromide solution and imaged by FluorImager 595 (Molecular Dynamics Inc., CA,
USA) and ImageQuant version 3.3 software (Molecular Dynamics Inc., CA, USA).
Estimation of the cDNA concentration was estimated by comparing the intensity of
the cDNA band with the intensity of the band of 1µg of SPP-1/Eco R1 molecular
weight marker (Geneworks, Thebarton, Australia).
2.6.3 Extraction of total RNA from kidney and bone tissue
2.6.3.1 Collection of rat kidneys and bones for RNA extraction
The rats were anaesthetised with halothane and sacrificed by cervical dislocation. The
kidneys and femora were excised and all soft tissues surrounding the organs were
removed. The bone and kidneys were placed in 5mL collection pots and snap frozen
in liquid nitrogen and stored at –70°C until required for analysis. The tissues were
homogenised in 10mL of solution D (Chapter 2.6.1.2) in a 30mL sterile container
(Techno-Plas, Adelaide, Australia) using an Ultra-Tarrax (Janke and Kunkel, Staufen,
Germany).
2.6.3.2 Extraction of RNA
41
The extraction of RNA from the tissue lysate was based on a modified method of
Chomczynski and Sacchi (1987) and Davey et al (2000). Aliquots of 700µL of lysate
from each homogenised tissue were transferred into 2mL eppendorf tubes. The lysate
in each tube was mixed by inversion, with 700µL of 0.1M citrate buffer saturated
phenol, pH 4.3, 100µL of 2M sodium acetate and 200 µL of 24:1 chloroform/isoamyl
alcohol and then incubated on ice for 10 minutes. The aqueous phase, containing the
RNA, was removed after centrifuging the mixture at 13,000 rpm at 4ºC for 15 minutes
and mixed in a new tube with at least 1 volume of isopropanol and kept overnight at –
70°C. The samples were thawed and centrifuged at 13,000 rpm for 15 minutes to
recover the RNA. The supernatant was removed and the RNA pellet was redissolved
in 200µL of TE buffer (Chapter 2.5.1.3), mixed with 600µL of 4M sodium acetate
(BDH Chemicals, Kilsyth, Australia), and kept overnight at –70°C. The samples were
thawed and centrifuged at 13,000rpm for 15 minutes to recover the pure RNA. The
RNA pellets were washed with 500µL of 70% ethanol, re-centrifuged at 13,000rpm
for 10 minutes, dried at room temperature, and finally dissolved in 50µL of TE buffer
(Chapter 2.5.1.3). The integrity of the extracted RNA was determined by firstly
combining 1µL of RNA with 2µL of 3x urea loading buffer (Chapter 2.6.1.5) and 3µL
of sterile deionised H2O, which was then heated at 65°C for 5 minutes to denature the
ribosomal RNA. The samples were then cooled immediately on ice and separated by
electrophoresis in a 1% agarose gel (Promega Company, Annadale, Australia) in TAE
buffer (Chapter 2.6.1.3) at 80 volts for 30 minutes. The gel was stained in a 1mg/L
ethidium bromide solution and imaged by FluorImager 595 (Molecular Dynamics
Inc., CA, USA) and ImageQuant version 3.3 software (Molecular Dynamics Inc., CA,
USA) to determine the integrity of the RNA. Pure, undegraded RNA is indicated by
the presence of the ribosomal RNA bands 26s, 18s and 4s.
42
2.6.3.3 Quantification of RNA
Purified RNA was quantified on a spectrophotometer (Beckman Instruments, CA,
USA). The RNA samples were diluted by adding 1µL of RNA extract to 99µL of
deionised H2O and then measured at wavelengths of 260 and 280nm. The RNA
concentration was calculated with the following formula:
RNA concentration (µg/µL) = Absorbance at 260nm x 40 x 100 (dilution factor)
Where absorbance at 260nm = 1 for a 40µg/mL RNA solution
(Sambrook et al 1989)
The purity of RNA is indicated by the ration between the absorbance at 260nm and
the absorbance at 280nm. The RNA was considered to be adequately pure when the
ratio between A260 and A280 was 1.8 or higher (Sambrook et al 1989).
2.6.4 First-strand cDNA synthesis
The RNA was reverse-transcribed to generate first strand cDNA. 5µg of RNA was
incubated with 200ng oligo-dT primer (Geneworks, Adelaide, Australia) and
deionised H2O in a total volume of 8µL at 70°C for 10 minutes and the mixture was
immediately cooled on ice. A reaction mixture of 1nM of dATP, dTTP, dGTP and
dCTP (Geneworks, Adelaide, Australia), 10nM DTT, reaction buffer (250mM Tris-
HCL, pH8.3, 375mM potassium chloride, 15mM MgCl2) and 200U of Moloney
Murine Leukaemia Virus-Reverse Transcriptase enzyme (MMLV-RT) (Gibco BRL,
Melbourne, Australia) was added to a total reaction volume of 20µL. The reaction
mixture was first incubated at 37°C for 1 hour and then at 90°C for 5 minutes to
denature the enzyme.
1000 1
43
2.7 Quantitative Real-time reverse transcriptase-polymerase
chain reaction
Quantification of the PCR reaction exploits the 5’ nuclease activity of DNA
Polymerase (AmpliTaq Gold™, Perkin-Elmer Applied Biosystems, CA, USA) to
cleave the fluorogenic probe (TaqMan® probe, Perkin-Elmer Applied Biosystems,
CA, USA) during the PCR reaction. The fluorogenic probe contains a reporter dye at
the 5’ end and a quencher dye at the 3’ end of the probe. When the probe is intact, the
proximity of the reporter dye to the quencher dye allows the quencher dye to suppress
the fluorescence of the reporter dye. If the target cDNA is present, the probe will
specifically anneal between the forward and reverse primer sites. During the reaction,
the DNA polymerase will cleave the probe, thereby separating the reporter dye from
the quencher dye, which results in an increase in the fluorescence of the reporter. The
accumulation of PCR products is directly detected by monitoring the increase in
fluorescence of the reporter dye. The point at which the Sequence Detection
Application software (Perkin-Elmer Applied Biosystems, CA, USA) detects an
increase in signal, which is associated with an exponential increase of PCR product, is
called the Threshold Cycle or CT.
2.7.1 Real-time RT-PCR primers and probes.
The sequence of the primers and fluorogenic probe were based on published
sequences for CYP27B1, CYP24, VDR and GAPDH (Genebank, PubMed) and the
primers and probed were designed using Primer Express 1.0 (Perkin-Elmer Applied
Biosystems, CA, USA) (Table 2.3). Briefly, the specifications for primer selection
include: the GC content within 20-80%, runs of four or more Gs to be avoided, Tm of
the primers to be between 58 and 60ºC and the five nucleotides at the 3’ end of the
44
primer should not have more than two Gs and/or Cs. The specifications for the
selection of the probe include: the GC content within 20-80%, runs of four or more Gs
to be avoided, Tm of the primers to be between 68 and 70°C and no G should be occur
on the 5’ end of the probe. The fluorogenic primers and probes were designed to
amplify products of 150 base pairs or less. To prevent amplification of contaminating
genomic DNA, all primers and probes were designed such that the amplicon crossed
an intronic sequence (Table 2.3). All probes, except for the GAPDH probe, were
labelled with FAM Reporter dye at its 5’-end and a TAMRA Quencher dye at its 3’-
end. The GAPDH probe was labelled with a VIC reporter dye. The labelling of the
GAPDH probe with a different reporter dye allows multiplexing of the PCR reaction.
Multiplex reactions were not, however, used in these experiments. All probes were
synthesised by PE Applied Biosystems (CA, USA). All primers were synthesised by
Geneworks (Adelaide, Australia).
2.7.2 Polymerase chain reaction conditions
All PCR reactions were carried out in a final volume of 25 µl and were performed in
duplicate for each cDNA standard in the ABI PRISM 7700 Sequence Detection
System (PE Applied Biosystems, CA, USA). The reaction mix consisted of Universal
Master Mix (1x TaqMan buffer, 5.5mM MgCl2, 200 µM dNTPs, 0.01 unit/µl
AmpErase UNG, 0.05 unit/µl AmliTaq Gold) (PE Applied Biosystems, CA, USA),
200nM probe and 300nM each of the forward and reverse primers. The PCR
condition was 50°C for 2 minutes and 95°C for 10 minutes, which was followed by 40
cycles of 95°C for 15 sec and 60°C for 1 minute. Each standard curve PCR reaction
was repeated one week later.
45
TABLE 2.3 Fluorogenic probe and primer sets
For. GAGATCACAGGCGCTGTGAAC 1030-1050 107
Rev. TCCAACATCAACACTTCTTTGATCA 1138-1114
CY
P27B
1
Probe 6FAM-TGTCCCAGCTACCCCTGCTAAAGGCT-TAMRA 1087-1112 For. TGGATGAGCTGTGCGATGA 1333-1351 75 Rev. TGCTTTCAAAGGACCACTTGTTC 1407-1385 C
YP2
4
Probe 6FAM-CGAGGCCGCATCCCAGACCTG-TAMRA 1353-1373 For. TGACCCCACCTACGCTGACT 523-542 79 Rev. CCTTGGAGAATAGCTCCCTGTACT 599-576 V
DR
Probe 6FAM-ACTTCCGGCCTCCAGTTCGTATGGAC-TAMRA 549-572 For. TGCACCACCAACTGCTTA 519-536 177 Rev. GGATGCAGGGATGATGTT 589-572
GA
PDH
Probe VIC-CAGAAGACTGTGGATGGCCCCTC-TAMRA 556-578
All primer/probe sets were designed to span an intronic sequence. Exon/Intron
boundaries are shown as underlined bases. For GAPDH, the boundary occurs between
the forward primer and the probe. Fluorogenic probes are FAM-labelled at the 5’ end
and TAMRA-labelled at the 3’ end. All cDNA sequences were obtained from the
Genebank® database. CYP27B1, 25-hydroxyvitamin 1α-hyroxylase; CYP24, 25-
hydroxyvitamin 24-hyroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-
3-phosphate dehydrogenase.
Gen
e
Sequence 5’→ 3’ Ampliconlength (bp)
Primer/ Probe
Sequence Number
46
2.8 Ribonuclease protection assay
2.8.1 Labelling reaction and removal of template DNA
A random primer extension kit (Maxiscript™, Ambion, TX, USA) and [α32P]-dUTP
(Geneworks, Adelaide, Australia) was used to radioactively label the RNA probe
(riboprobe) that was complementary to the cDNA template (Chapter 2.6.2.6). 150ng
of cDNA template and 2µl of 10xTranscription buffer (Maxiscript™, Ambion, TX,
USA) were added prior to the addition of 1µl each of 10mM dATP, dCTP, dGTP and
5µl of [α32P]-dUTP. 1 unit of T7 Polymerase enzyme was added and this mixture was
incubated for 30 minutes at 37°C to allow for the synthesis of the radiolabelled
riboprobe. Template cDNA was removed from the reaction mix by adding DNase 1
and incubating at 37°C for a further 15 minutes.
2.8.2 Gel purification of radio-labelled riboprobe
The radiolabelled riboprobe was purified using polyacrylamide gel electrophoresis.
The 5% polyacrylamide gel was prepared by dissolving 24.48g of urea (8M) in 5.1ml
of 10xTBE (Chapter 2.5.1.3), 6.38ml of 40% acylamide:bisacrylamide and 51ml of
deionised H20. 408µl of 10% ammonium persulphate and 54.4 µl of TEMED were
added to the mixture and mixed prior to pouring the liquid gel into the gel cast. The
gel was allowed to polymerise and was loaded into the vertical electrophoresis tank.
10µl of gel loading buffer was added to the radiolabelled riboprobe, heated to 95°C,
chilled on ice and loaded into the wells of the gel submerged in TBE. The
electrophoresis of the riboprobe was run at 200V (Chapter 2.5.1.3) until the loading
buffer band approached the bottom of the gel. The gel was wrapped in plastic wrap
before being exposed to autoradiography film for 10 seconds, making sure to mark the
47
position of the film on the gel for reference. Once the film was processed (X-Ray film
Developer), the gel bands associated with the full-length radiolabelled riboprobe were
located by using the film as the guide and excised with a clean scalpel blade. The
remaining gel was re-exposed to new film to determine whether the probe was fully
excised. The gel containing the probe was placed in an eppendorf tube and incubated
overnight in 350µl of Elution buffer (Maxiscript™, Ambion, TX, USA) at 37°C. This
was done to obtain a pure, full-length probe for both CYP27B1 and GAPDH.
2.8.3 Determination of the quantity of total RNA used in ribonuclease
protection assay
It is essential that the riboprobe is present in excess when compared to the amount of
the target mRNA present in a sample. A pilot experiment was conducted to determine
the amount of total RNA to be used in the assay. Increasing amounts of total RNA
from kidneys of vitamin D-deplete rats fed a 0.1% calcium diet (ranging from 2.5µg-
30µg) were assayed with 6 x 104 cpm of GAPDH riboprobe. After the hybridisation
and RNase digestion of unbound RNA, the samples were separated on a 5%
polyacrylamide/8M urea gel (Chapter 2.7.2) and exposed to autoradiography film.
The intensity of the major protected fragment on the autoradiograph increased when
the amount of total RNA that was assayed was increased from 2.5µg to 20µg,
indicating that the riboprobe was present in molar excess over the mRNA in these
reactions (data not shown). When the amount of total RNA was increased from 20 to
30µg, the intensity of the major protected fragment failed to increase, indicating that
at 30µg the riboprobe was no longer in molar excess. The amount of total RNA to be
used in the assay was, therefore, determined to be 20 µg.
48
2.8.4 Riboprobe: target RNA hybridisation
20 µg of total RNA, either from rat bone or kidney, was mixed with 6 x 104 cpm of
CYP27B1 riboprobe and GAPDH riboprobe. 5M ammonium acetate was added to the
mixture to the final concentration of 0.5M. 100% ethanol (2.5 x vol) was then added
before being incubated for 15 minutes at –20°C. The mixture was pelleted by
centrifugation at 13,000 rpm for 15 minutes and the supernatant was removed. The
pellet was resuspended in 10µl of Hybridisation buffer (RPA III™, Ambion, TX,
USA), denatured at 95°C for 3 minutes and incubated overnight at 42°C.
2.8.5 RNase digestion of unbound RNA
150µl of a 1:100 dilution of RNase A/RNase T1 in RNase buffer (RPA III™,
Ambion, TX, USA) was added to each RNA hybridisation tube and incubated at 37°C
for 30 minutes. 225µl of RNase inactivation/precipitation solution (RPA III™,
Ambion, TX, USA) was added to each sample and the tubes were placed in –20°C for
15 minutes.
2.8.6 Separation and detection of riboprobe bound target mRNA
To recover the protected target mRNA, the tubes were centrifuged at 13,000 rpm for
15 minutes at 4°C and the supernatant was removed. The RNA pellet in each tube
were resuspended in 8µl of Gel loading buffer (RPA III™, Ambion, TX, USA) and
denatured at 95°C for 3 minutes, before being loaded into a 5% polyacrylamide/8M
urea gel and separated at 200V until the band of the loading buffer approached the end
of the gel (Chapter 2.7.2). The gel was wrapped in plastic wrap before being exposed
to autoradiography film overnight. The film was processed (X-Ray film Developer)
the next days to reveal the bands of protected target mRNA.
49
2.9 In situ hybridisation
2.9.1 In vitro transcription with digoxigenin-11-UTP
To generate the antisense and sense CYP27B1 riboprobe for in situ hybridisation,
PCR amplification of a 335-bp fragment of the rat CYP27B1 gene was amplified
using the following forward and reverse primers (Forward: 5’-CCG
TGTCCCAGACAGAGAC-3’; Reverse: 5’-CAGGACAGTCCGGGTCATGG-3’).
The PCR product was ligated into the T7/SP6 site of a pGEM-T vector (Promega,
Sydney, NSW), transfected into competent cells (Chapter 2.5.2.1), grown up
according to the methods described in Chapter 2.5.2.3 and the vector was isolated
according to Chapter 2.5.2.4. Before generating digoxigenin-labelled probes, the
plasmid was linearised with either the Nco I or the Not I restriction enzyme to allow
for the generation of the antisense or sense probe respectively. Digoxigenin-labelled
probes were synthesised according to kit instructions (Boehringer Mannheim-GmBH,
Mannheim, Germany). The antisense probe was synthesised using SP6 RNA
polymerase and the sense probe was synthesised using T7 RNA polymerase.
2.9.2 Estimation of the riboprobe yield
The riboprobe was serially diluted by 10-fold to generate 5 dilutions of the probe. A
drop of each these dilutions of the riboprobe were placed on a nylon membrane,
together with serial dilutions of Digoxigenin-labelled control RNA (Boehringer
Mannheim-GmBH, Mannheim, Germany). The membrane was exposed to UV
radiation (UV Cross-linker, Ultra-Lum, Adelaide, Australia) at 1200 kilojoules for 30
seconds to cross-link the riboprobe to the membrane. The membrane was incubated
with diluted anti-digoxigenin antibody for 30 minutes and was then incubated in 5%
NBT/BCIP (Boehringer Mannheim-GmBH, Mannheim, Germany). When the colour
50
developed to a sufficient intensity, the reaction was stopped by rinsing the membrane
in TE buffer (Chapter 2.5.1.3) for 5 minutes. An estimation of the riboprobe
concentration was achieved by comparing the colour intensity of the dots of the
riboprobe dilutions with the colour intensity of the dots of the control RNA samples.
2.9.3 Tissue preparation
The distal 20 mm of the femora were bisected in the sagittal plane. Cutting was
performed using a low speed saw (Buehler, Ltd., Evanston, IL, U.S.A.), with a
diamond tipped cutting blade. The femora were then fixed overnight in a 4%
paraformaldehyde/0.1% phosphate buffer at 4°C and then decalcified in a 1% EGTA,
9.5% nitric acid solution to leach out the calcium mineral. Once the femora were free
of calcium mineral, they were processed for dehydration and infiltration (TissueTech
VIP, Sakura, Japan) and embedded in paraffin wax. Five-micrometer thick
longitudinal sections were then cut using a microtome (Reichert, Heidelberg,
Germany), mounted on to salianised slides and stored until needed.
2.9.4 Section pre-treatment
The sections were placed in xylene for 15 minutes, before being placed in ethanol at
100, 95 and 80% for 5 minutes each. The sections were washed twice in PBS for 2.5
minutes, placed in 0.2 M HCl for 20 minutes and again washed in PBS. The dried
sections were then digested with 250µl of a freshly prepared 50µg/ml proteinase K
solution for 15 minutes at room temperature. The sections were washed with 2mg/ml
glycine/PBS for 5 minutes, 4% paraformal saline for 15 minutes, 0.25% acetic
anhydride/0.1M triethanolamine for 10 minutes and 0.5mM levamisole/0.1M Tris for
1 hour. Each section was washed with PBS between the incubations in the different
solutions. When the slides were dried, 250 µl of hybridisation buffer was added
51
containing, 50% deionised formamide (Chapter 2.5.1.4), 5 x SSC (Chapter 2.5.1.3),
2% Blocking reagent (Boehringer Mannheim-GmBH, Mannheim, Germany), 0.1% N-
lauryl sarcosine and 0.02% SDS. After the addition of the pre-hybridisation solution,
sections were first incubated for 30 minutes at room temperature and then for 2 hours
at 37°C.
2.9.5 Hybridisation
10ng of riboprobe, either antisense or sense, was added to the dried sections in 100µl
of hybridisation buffer and cover slips were carefully placed over the sections. The
slides were then incubated over-night at 42°C in a humidifying chamber.
2.9.6 Post-hybridisation wash
The sections were placed in 2x SSC (Chapter 2.5.1.3) for 5 minutes at 37°C and then
transferred into fresh 2x SSC (Chapter 2.5.1.3), leaving the cover slips behind. After
incubating for a further 25 minutes at 37°C, the sections were first placed in a 1x
SSC/30% deionised formamide (Chapters 2.5.1.3 and 2.5.1.4) solution for 30 minutes
at 37°C and followed by a 0.1x SSC (Chapter 2.5.1.3) solution for 30 minutes at
37°C.
2.9.7 Antibody hybridisation / colour reactions
The sections were prepared for the antibody hybridisation by placing then in a
washing buffer consisting of 0.003% Tween, 0.1M maleic acid, 0.15M sodium
chloride for 1 minute and then by incubating in a 1% blocking agent (Boehringer
Mannheim-GmBH, Mannheim, Germany) for 1 hour at room temperature. To each
dried section, 250µl of anti-DIG antibody, diluted 1:500 in blocking solution, was
added and the sections were incubated for 30 minutes at room temperature. The
excess solution was removed and sections were washed twice in washing buffer for 15
52
minutes and then washed once in a detection buffer containing 10% blocking reagent
(Boehringer Mannheim-GmBH, Mannheim, Germany), 0.1M maleic acid and 0.15M
sodium chloride for 2 minutes. Once the sections were dried, 250 µl of 1% NBT/BCIP
and 1mM levamisole in detection buffer was added to each section and the sections
were incubated until a colour developed (30 minutes to 16 hours). When the
developed colour was sufficiently intense, the sections were washed briefly in TE
(Chapter 2.5.1.3).
53
CHAPTER 3: Evaluation of the quantification of CYP27B1, CYP24, VDR and GAPDH mRNA using the Real-Time Reverse Transcriptase-Polymerase Chain Reaction.
3.1 INTRODUCTION
The Reverse Transcription-Polymerase Chain Reaction (RT-PCR) is the most sensitive
method currently used to detect low-abundance mRNA. There are, however,
substantial problems associated with its true sensitivity, reproducibility and specificity
and, as a quantitative method, it suffers from the problems inherent in PCR. A
fluorescence-based RT-PCR method, which overcomes limitations of other mRNA
analysis procedures, has recently been developed to quantify absolute mRNA levels.
Holland et al (1991) were the first to demonstrate that the cleavage of a labelled probe
by Taq DNA polymerase during a PCR reaction, could be used to detect the level of
amplification of a specific PCR product. In addition to the components of a typical
PCR reaction mixture, a 32P-labelled consensus probe, which binds to an internal
region of the target nucleotide template, was added. During amplification, the annealed
probe is cleaved by the 5’ exonuclease activity of Taq DNA polymerase extending
from an upstream primer into the region of the probe. After the PCR, Holland et al
measured the level of cleavage of the probe, by using thin layer chromatography to
separate the cleavage fragments from the intact probe. The development of fluorogenic
probes by Lee et al (1993) made it possible to eliminate the post-PCR processing to
analyse the levels of probe degradation. The cleavage of duel-labelled fluorogenic
54
probes with each cycle of PCR amplification, resulted in the release of a fluorescent
reporter. By measuring the emitted fluorescence, it was possible to measure product
accumulation in “real-time”. Since then, real-time PCR has been extensively used for
the detection of specific DNA including viral infections (Lockey et al 1998), parental
determination (Lo et al 1998) and for the determination of changes in the genetic code
through insertion or deletion of bases (Higuchi et al 1993; Orlando et al 1998).
More recently, real-time PCR has been applied to quantitate mRNA levels. Reverse-
transcription of mRNA to cDNA is followed by real-time PCR, using a specific
fluorogenic probe and a set of primers designed to specifically amplify the target
cDNA, without co-amplifying contaminating genomic DNA. During the reaction, the
cycle of amplification at which the fluorescence signal is higher than the background
emissions, termed the threshold cycle (CT), can be determined. The CT value is a
measure of the target sequence abundance. The higher the starting amounts of target
sequence, the sooner a significant increase in fluorescence is observed. The starting
copy number of mRNA can be determined absolutely from a standard curve made with
target DNA. This requires the quantification of the cDNA by measuring the cDNA
concentration and converting it to the number of cDNA copies using the molecular
weight of the DNA and Avogadro’s number (2.063 x 1023) as shown in the methods
below.
The real-time PCR method provides several advantages over other techniques of
mRNA analysis. It is a closed-tube PCR reaction, which avoids time-consuming post-
PCR manipulation and the risk of PCR contamination. Monitoring of the whole
reaction during real-time RT-PCR, permits the quantification to be based on the early,
55
linear part of the reaction curve, rather than the amount of end product. In this way the
problems with reagent-limiting amplification, associated with semi-quantitative PCR
procedures, are avoided. The sensitivity of real-time PCR for the detection of low
abundance mRNA species greatly exceeds the Northern blot analysis and therefore
significantly smaller amounts of starting material are required than in Northern blot
procedures.
The objective of the current study was to validate the sensitivity and accuracy of Real-
time RT-PCR assay when used to measure absolute abundance of mRNA for rodent
25-hydroxyvitamin D-1α−hydroxylase (CYP27B1), 25-hydroxyvitamin D-24-
hydroxylase (CYP24), vitamin D receptor (VDR) and glyceralderhyde-3-phosphate
dehydrogenase (GAPDH) in rat kidney and bone tissue.
3.2 PROTOCOL
3.2.1 Experimental procedure
The transformation of plasmid cDNA into competent cells, the growth of transformed
cells, and isolation of cDNA are described in Chapter 2.5.2. Messenger RNA
extraction, purification and quantification from rat kidney and bone tissue are
described in Chapter 2.5.3. First Strand cDNA synthesis from mRNA is described in
Chapter 2.5.4. The design of real-time RT-PCR probes and primers for CYP27B1,
CYP24, VDR and GAPDH mRNA is described in Chapter 2.6.1. The reaction
temperature, reagent mixture composition and conditions for real-time RT-PCR are
described in Chapter 2.6.2.
56
3.2.2 Estimation of cDNA standard copy number
The concentration of pure plasmid cDNA for each target mRNA species was
estimated by measuring the A260 in triplicate, using a spectrophotometer. The copy
number was calculated using the following formula:
copies/mL = 6.023x1023 x C x A260
where C = 50 µg/mL for dsDNA; MWt = cDNA molecular weight (base pairs x 6.5 x
102 Daltons)
Serial dilution for each cDNA species was done such that the diluted samples would
all provide CT values spanning the range of CT values expected from unknown
samples. The cDNA standards were stored at –20°C.
3.2.3 Calculation of the slope of the linear regression line for optimal
PCR amplification
When the efficiency of the PCR amplification is maximal, every amplicon transcript
is replicated in each cycle of PCR amplification. This duplication of transcripts with
each cycle of PCR amplification, results in an exponential increase in PCR product.
Generating a set of exponentially increasing numbers and plotting the logarithmic
values of these numbers against arbitrary cycle numbers, allows the slope of the line
to be calculated by linear regression analysis. A slope of -3.32 is the theoretical
maximal slope obtained by regression analysis of a PCR reaction of optimal
efficiency.
MW
57
3.2.4 Data expression and statistical analysis
For each assay, a standard curve was prepared by running a ranging of samples of a
known number of CYP27B1, CYP24, VDR or GAPDH cDNA molecules. All
samples for comparison were run in the same assay. After completion of the PCR
amplification, data were analysed with Sequence Detector 1.7 software (PE Applied
Biosystems, Foster City, CA). To maintain consistency, the baseline was set
automatically by this software using data collected from cycles 3 to 15, unless the CT
value obtained from samples was less than 15 cycles. In this circumstance, it was
necessary to manually set a narrower range of cycles to determine baseline. The
increase in intensity of the fluorescence emitted by the reporter dye (∆Rn) was
plotted against the cycle number. The CT was calculated by the sequence detection
software as the cycle number at which the amplification plot crossed the baseline. CT
values, obtained by running a set of samples ranging in cDNA concentration, were
plotted against copy numbers of cDNA to generate a standard curve. By obtaining the
CT values of unknown samples for a particular target cDNA sequence, the cDNA
copy number can be obtained from the relevant standard curve and the mRNA levels
in these samples for either CYP72b1, CYP24, VDR or GAPDH can therefore be
determined.
Efficiency of real-time RT-PCR was tested by the "least squares" method of linear
regression statistical analysis. Amplification efficiency in the cDNA standard curves
was tested by comparing the line-of-best-fit with a theoretical line representing the
maximum amplification efficiency. Linear regression analysis was used to determine
whether there was a difference between CT values from a theoretically maximal
amplification and CT values obtained in the cDNA amplification reactions performed.
58
The same statistical procedure was used to determine the mRNA amplification
efficiency. Linear regression analysis was used to test the reproducibility of real-time
RT-PCR by comparing the line-of-unity with the line-of-best-fit for the X-Y scatter
plot of CT values obtained from two separate real-time RT-PCR assays.
3.3 RESULTS
3.3.1 Optimisation of the fluorogenic probe concentration
To determine the optimal fluorogenic probe concentration, amplification plots were
obtained from cDNA samples with probe concentrations for each gene of interest
between 25nM and 300nM in the reaction mixture. Figure 3.1 shows the amplification
plot of CYP27B1 cDNA prepared from rat kidney mRNA with varying concentrations
of the CYP27B1 probe. The CT values obtained with varying probe concentration for
each gene is shown in Table 3.1. The lower the CT value obtained with a particular
concentration of probe, the greater the detection sensitivity. The optimal concentration
for each probe was considered to be 200nM. There was no significant improvement in
detection sensitivity with 300nM of each probe. 25nM and 100nM of each probe
reduced the detection sensitivity significantly in each case (p<0.05).
3.3.2 Range and sensitivity of fluorogenic detection
In preliminary experiments, reverse transcribed mRNA extracted from tissue was used
to obtain a range of CT values (data not shown). This was used to determine the range
of cDNA standard concentrations required to obtain CT values that spanned the range
of predicted CT values that would be obtained from experimental samples. The
amplification plots of three CYP27B1 cDNA samples measured in duplicates, shown
in Figure 3.2, ranged in concentration from 1.2 x104 copies/reaction to 1.2 x1010
59
copies/reaction, which demonstrated a 106-dilution range of detection. The range of
copies examined and the range of CT values obtained is shown in Table 3.2. The
greatest serial dilution performed was a 1.6 x 107-fold dilution of CYP27B1 cDNA.
CT values were detected up to 37.4 + 0.6, which was for an estimated 1.5 x102 copies
of VDR cDNA. No amplification was observed in the no-template controls (NTC)
reactions. The CT was allotted the arbitrary value of >45 when no amplification was
detected in the 45th cycle of the reaction. The most concentrated and most dilute
cDNA sample of each gene under investigation provided CT values, spanning the
range of CT values expected from unknown samples.
3.3.3 Standard curves
Standard curves for each cDNA species are shown in Figure 3.3. The standard curves
contain data from duplicate PCR reactions of each cDNA dilution and from a second
PCR reaction, which was performed approximately one week later. The correlation
coefficient for each cDNA standard curve was 0.99, indicating a high-level of
accuracy in detection throughout the cDNA concentration range. The efficiency of the
amplification was a high in all reactions. This was concluded from the slopes of the
standard curves, which were all within 10% of the theoretical optimum slope of -3.32
(Chapter 3.2.2). The reaction efficiency for CYP24 was 100%, while the efficiency
for CYP27B1, VDR and GAPDH was 96% (p<0.001), 93% (p<0.05), and 90%
(p<0.001), respectively.
3.3.4 Reproducibility of cDNA standard detection
The reproducibility of the fluorogenic probe detection was tested by performing two
separate PCR reactions on different days on serial dilutions of the same cDNA.
Comparisons of the CT values obtained from the two separate PCR reactions on
60
Figure 3.1 Optimisation of the CYP27B1 probe concentration. Amplification plots of
four concentrations of CYP27B1 cDNA, reversed transcribed from rat kidney mRNA.
A no-template control (NTC) was also included and was not amplified in the reaction.
The horizontal line shows the setting of the baseline. The point at which the
amplification plot crosses the base line is the CT value.
0
0.5
1
1.5
2
2.5
3
300nM 200nM 100nM
25nM
25 30 35 40 45
Cycle Number
Rn
NTC
Baseline
0
0.5
1
1.5
2
2.5
3
300nM 200nM 100nM
25nM
25 30 35 40 45
Cycle Number
Rn
NTC
Baseline
Fluo
resc
ence
Inte
nsity
(∆R
n)
61
Table 3.1 Threshold cycle (CT) values for the optimisation of fluorogenic probe
concentrations for mRNA quantification.
Fluorogenic Probe
300nM (CT)
200nM (CT)
100nM (CT)
25nM (CT)
NPC (CT)
CYP27B1 28.5 + 0.07 28.7 + 0.14 32.2 + 0.64* 41.7 + 1.4* >45
CYP24 19.9 + 0.05 19.9 + 0.32 20.9 + 0.18* 28.6 + 0.51* >45
VDR 18.5 + 0.20 18.8 + 0.22 20.3 + 0.27* 38.8 + 0.49* >45
GAPDH 17.2 + 0.12* 15.2 + 0.36 15.7 + 0.29* 36.2 + 0.70* >45
All primers were specific for rat cDNA sequence and the results show amplification
of rat cDNA standards. Values and mean + SD (n = 2). The no probe control (NPC)
was allotted a value of >45 when no amplification was detected before the 45th cycle
of the PCR reaction. ∗ p<0.05 vs. 200nM probe. CT, threshold cycle; CYP27B1, 25-
hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-hydroxylase; VDR,
vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
62
Figure 3.2 Amplification plots of three CYP27B1 cDNA standards. The three
standards represent the range of cDNA copies that can be detected. The amplification
plots of the standards ranged from 1.2 x 104 copies/reaction to 1.2 x 1010
copies/reaction. Duplicate reactions are shown and can appear superimposed. A no-
template control (NTC) was included, which was not amplified in the reaction. The
horizontal line shows the setting of the baseline. The point at which the amplification
plot crosses the base line is the CT value.
Baseline
1.2 x 1010 1 .2 x 10 7 1 .2 x 1 04
NTC
C ycle Thresho ld (C T) L ine
Cycle Number
2.5
2
1.5
1
0.5
04 8 12 16 20 24 28 32 36 40
1.2 x 1010 1 .2 x 10 7 1 .2 x 1 04
NTC
C ycle Thresho ld (C T) L ine
Cycle Number
2.5
2
1.5
1
0.5
04 8 12 16 20 24 28 32 36 40
Fluo
resc
ence
Inte
nsity
(R
n)
63
Table 3.2 Sensitivity of fluorogenic probe for detection
Fluorogenic Probe Range of copies detected Range of CT values detected NTC
(CT) CYP27B1 6.2 x 103 1.0 x 1011 34.2 + 0.01 9.7 + 0.05 >45
CYP24 1.3 x 103 2.7 x 1010 24.1 + 0.05 5.0 + 0.3 >45
VDR 1.5 x 102 1.2 x 106 37.4 + 0.6 23.8 + 0.06 >45
GAPDH 2.8 x 107 5.8 x 1010 20.0 + 0.2 8.0 + 0.06 >45
All primers were specific for rat cDNA sequence and the results show amplification
of rat cDNA standards. The no template control (NTC) was allotted a value of >45
when no amplification was detected in the 45th cycle of the PCR reaction. CT,
threshold cycle; CYP27B1, 25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-
hydroxyvitamin-24-hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-
3-phosphate dehydrogenase.
64
Figure 3.3 Standard curves of CYP27B1 (A), CYP24 (B), VDR (C), and GAPDH (D)
cDNA. cDNA was serially diluted 1:2 before amplification with the appropriate
primers and probe. Each sample was assayed in duplicate and re-assayed one week
later. The standard curve is a product of both assays. The equation for the line-of-best-
fit, y = slope (±S.D.) x + y-intercept (±S.D.) The coefficient of determination (R2) is
shown for each standard curve. *p<0.001 vs. theoretical slope, #p<0.05 vs. theoretical
standard curve slope for maximum amplification efficiency.
R2 = 0.9976
103 104 105 106 107 108 109 10101011 10120
5
10
15
20
25
30
35
40
0
5
10
15
20
25
105 104 105 106 107 109108 1010 1011
20
25
30
35
40
102 103 104 105 106 10710
Cyc
le T
hres
hold
(CT)
y = -1.5823Ln(x) + 46.943R2 = 0.9975
5
10
15
20
25
105 106 107 108 109 1011
cDNA Copy Number
A B
C D
R2 = 0.9976
103 104 105 106 107 108 109 10101011 10120
5
10
15
20
25
30
35
40
0
5
10
15
20
25
105 104 105 106 107 109108 1010 1011
20
25
30
35
40
102 103 104 105 106 10710
Cyc
le T
hres
hold
(CT)
y = -1.5823Ln(x) + 46.943R2 = 0.9975
5
10
15
20
25
105 106 107 108 109 1011
cDNA Copy Number
A B
C D
y = *-3.45 (± 0.04)x + 47.66 (± 0.27)
R2 = 0.99
y = -3.28 (± 0.08)x + 37.97 (± 0.56)
R2 = 0.99
y = #-3.54 (± 0.09)x + 44.82 (± 0.36)
R2 = 0.99
y =* -3.64 (± 0.06)x + 46.94 (± 0.53)
R2 = 0.99
* p < 0.001 p = 0.67 (NS)
# p < 0.05 * p < 0.001
65
serially diluted cDNA for CYP27B1, CYP24, VDR and GAPDH cDNA showed a
high degree of reproducibility when analysed by the linear regression analysis (Figure
3.4). The inter-assay reproducibility was extremely high with a coefficient of variation
(CV) less than 5% for CYP27B1, VDR and GAPDH, whilst CYP24 had a CV of
5.5%. No statistical difference was found between the line-of-best-fit for each cDNA
species tested and the theoretical line-of-unity. The intercept of the line-of-best-fit
was not statistically different from 0 and the slope of the line-of-best-fit was not
statistically different from 1. This confirms that the CT values obtained on different
days of cDNA samples are reproducible between assay runs.
3.3.5 Comparison of copy numbers of mRNA obtained from standard
curves generated in different assays
The estimation of mRNA copy numbers from standard curves generated in separate
PCR amplification reactions was assessed. Kidney and bone total RNA were isolated
from rats that were fed either a 1% or 0.1% calcium combined with either a vitamin
D-replete or vitamin D-deficient semi-synthetic diet (Chapter 2.3.1.2). The total RNA
from each rat tissue was reverse-transcribed to cDNA (Chapter 2.5.4) and real-time
PCR (Chapter 2.6) was used to obtain CT values. Using these CT values, mRNA copy
numbers were estimated from two individual standard curves, which were generated
on different days. Regression analysis between the mRNA copy numbers determined
from each standard curve was performed. The line-of-best-fit determined for each
target species by linear regression analysis are shown in Table 3.3. The equations
shown are for the kidney and bone copy number data separately as well as combined.
If the copy numbers estimated from one standard curve, equalled the copy numbers
estimated from the other standard curve, the line-of-best-fit would be statistically the
same as the line-of-unity. The slope and intercept, however, for each gene of interest
66
examined were statistically different from the slope and intercept of the line-of-unity.
The deviation in the slope of the line-of-best-fit from the slope of the line-of-unity
was greatest for VDR, with a slope of 0.61 ± 0.001 (p<0.0001). When copy numbers
were separated into tissue groups, each linear regression analysis was equivalent to
the combined tissue analysis. A calculation of the average difference in mRNA copy
numbers determined by each standard curve was 20% for CYP27B1, while for
CYP24, VDR and GAPDH there was a 13%, 36% and 20% difference respectively.
3.3.6 Accuracy of the estimation of mRNA levels by reverse-
transcription and real-time PCR amplification
The accuracy of the estimation of mRNA levels by reverse transcription and PCR
amplification, was assessed using rat kidney and bone total RNA. Kidney and bone
total RNA was isolated (Chapter 2.5.3) from 6-month-old rats fed a standard chow
diet (Chapter 2.3.1.1). Purified total RNA was serially diluted, 1:2, starting with a
concentration of 5µg of total RNA for each sample. Each dilution was then reverse-
transcribed to cDNA (Chapter 2.5.4) and target cDNA sequences were amplified by
Real-Time PCR amplification using an appropriate primer and probe set (Chapter
2.6). The equations for the line-of-best-fit, determined by linear regression analysis,
for each mRNA species in kidney and bone are shown in Table 3.4. Linear
amplification was detected over the entire mRNA concentration. The coefficient of
determination for each line-of-best-fit was within 5% of linearity. The degree of
efficiency of the amplification was indicated by the comparison of the slope of the
line-of-best-fit for each reaction series and the theoretical slope of the line if the
reaction was to proceed with 100% efficiency. This theoretical slope for maximum
PCR amplification efficiency is –3.32 (Chapter 3.2.2). When the efficiency of PCR
67
Figure 3.4 Reproducibility of CT values obtained from cDNA samples of CYP27B1
(A), CYP24 (B), VDR (C) and GAPDH (D). The horizontal axis shows the results of
PCR Run 1 and the vertical axis of PCR Run 2. The equation for the line-of-best-fit, y
= slope(±S.D.)x + y-intercept (±S.D.), and the coefficient of determination (R2) are
shown for the regression analyses. All linear regression analyses were not statistically
different form the line-of-unity. CT, Threshold Cycle; CYP27B1, 25-hydroxyvitamin
D-1α-hydroxylase; CYP24, 25-hydroxyvitamin D-24-hydroxylase; VDR, vitamin D
receptor; GAPDH, glyceraldehyde phosphate dehydrogenase.
5
10
15
20
25
30
35
40
5 10 15 20 25 30 35 40
y = 1.01 (± 0.02) x – 0.58 (± 0.37)R2 = 0.99
0
5
10
15
20
25
30
0 5 10 15 20 25 30
y = 0.99 (± 0.02) – 0.07 (± 0.29)R2 = 0.99
20
25
30
35
40
20 25 30 35 40
y = 1.02 (± 0.04)x – 0.76 (± 1.20)R2 = 0.97
Cyc
le th
resh
old
CT
(Run
2)
5
10
15
20
5 10 15 20
y = 0.99 (± 0.02)x – 0.22 (± 0.34)R2 = 0.99
Cycle Threshold CT (Run 1)
A B
C D
5
10
15
20
25
30
35
40
5 10 15 20 25 30 35 40
y = 1.01 (± 0.02) x – 0.58 (± 0.37)R2 = 0.99
0
5
10
15
20
25
30
0 5 10 15 20 25 30
y = 0.99 (± 0.02) – 0.07 (± 0.29)R2 = 0.99
20
25
30
35
40
20 25 30 35 40
y = 1.02 (± 0.04)x – 0.76 (± 1.20)R2 = 0.97
Cyc
le th
resh
old
CT
(Run
2)
5
10
15
20
5 10 15 20
y = 0.99 (± 0.02)x – 0.22 (± 0.34)R2 = 0.99
Cycle Threshold CT (Run 1)
A B
C D
68
Table 3.3 Equation of the line-of-best-fit for mRNA copy number estimations
determined from separate standard curves.
Equations of line-of-best-fit are y = slope (±S.D.)x + y-intercept (±S.D.). All
regression analyses were statistically different from the line-of-unity (p<0.0001).
CYP27B1, 25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-
hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate
dehydrogenase.
Combined Y = 1.29 (± 0.002)x – 1.7 x104 (± 4.6 x104)
Kidney Y = 1.14 (± 0.001)x - 7.5 x104 (± 4.7 x104)
CYP
27B
1
Bone Y = 1.11 (± 0.001)x - 2.0 x104 (± 2.6 x103)
Combined y = 0.82 (± 0.002)x + 3.8 x103 (± 5.9 x102)
Kidney y = 0.82 (± 0.002)x + 4.7 x103 (± 1.2 x103)
CYP
24
Bone y = 0.84 (± 0.001)x + 1.4 x103 (± 1.4 x102)
Combined y = 0.61 (± 0.001)x + 2.4 x105 (± 6.2 x104)
Kidney y = 0.60 (± 0.001)x + 8.1 x105 (± 9.3 x104) VDR
Bone y = 0.64 (± 0.001)x + 2.0 x104 (± 2.2 x103)
Combined y = 0.81 (± 0.0002)x – 7.2 x106 (± 7.9 X105)
Kidney y = 0.81 (± 0.0001)x - 2.3 x107 (± 6.4 X105)
GA
PDH
Bone y = 0.80 (± 0.0003)x - 3.0 x106 (± 2.8 X105)
Equation Tissue Gene
69
Table 3.4. Efficiency of mRNA amplification of kidney and bone samples.
Kidney y = -3.21 (± 0.14)X + 32.7 (± 0.09) R2 = 0.99
CYP
27B1
Bone y = -3.72 (± 0.36)x + 32.6 (± 0.23) R2 = 0.96
Kidney y = -3.23 (± 0.17)x + 25.4 (± 0.07) R2 = 0.99
CYP
24
Bone y = -3.60 (± 0.20)x + 31.5 (± 0.18) R2 = 0.97
Kidney y = -3.56 (± 0.10)x + 21.4 (± 0.05) R2 = 0.95
VDR
Bone y = -3.35 (± 0.32)x + 30.4 (± 0.20) R2 = 0.96
Kidney y = -3.57 (± 0.29)x + 17.9 (± 0.15) R2 = 0.97
GAP
DH
Bone y = -3.34 (± 0.21)x + 21.6 (± 0.14) R2 = 0.98
Equations of line-of-best-fit are y = slope (±S.D.)x + y-intercept (±S.D.). CYP27B1,
25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-hydroxylase;
VDR, vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. All
slopes for the line-of-best-fit are not statistically different from the slope of the
theoretical line for maximum amplification efficiency.
Equation Coefficient of determination
Tissue Gene
70
amplification is reduced, the value for the slope of the line-of-best-fit becomes more
negative than the optimal slope of –3.32. The efficiency of PCR amplification of
reverse-transcribed mRNA was high in all cases. There was no statistical difference
between the slope of the line-of-best-fit and the theoretical slope for maximal
amplification efficiency for any of the mRNA species tested.
3.3.7 Reproducibility of mRNA detection
The reproducibility of the fluorogenic detection system was tested by comparing
results generated in PCR reactions run on different days. Total RNA was isolated
from kidney and bone tissue (Chapter 2.5.3), collected from 9-month-old rats fed a
semi-synthetic diet containing 0.5%, 0.2%, 0.4% or 1% calcium (Chapter 2.3.1.2) for
3 months. Messenger RNA was reverse transcribed for each PCR reaction (Chapter
2.5.4). Real-time PCR analysis was performed on the cDNA using specific probe and
primer sets for each target cDNA sequence (Chapter 2.6). CT values, obtained from
the two separate PCR amplification reactions of CYP27B1, CYP24, VDR and
GAPDH cDNA were compared by linear regression analysis, which is shown in
Figure 3.5. There was a high degree of reproducibility between the CT values obtained
from the two separate PCR reactions. For each cDNA sequence of interest analysed,
the coefficient of determination was within 5% of linearity when kidney and bone
data were combined. The coefficients of variation were less than 3% in the combined
data. The lines-of-best-fit describing CYP27B1, CYP24 and VDR mRNA detection
reproducibility were all statistically the same as the line-of-unity. The slope of the
line-of-best-fit for GAPDH, however, was greater than the slope of the line-of-unity
(p<0.001). The slope of the line-of-best-fit for bone GAPDH CT values remained
statistically different from the slope of the line-of-unity. In the case of kidney
GAPDH, however, no statistical difference was observed between slope of the line-of-
71
Figure 3.5 Reproducibility of fluorogenic detection of CYP27B1 (A), CYP24 (B),
VDR (C) and GAPDH (D) mRNA in total RNA samples. The horizontal axis shows
the results of PCR Run 1 and the vertical axis of PCR Run 2. The equation of the line-
of-best-fit and the coefficient of determination (R2) are shown for the analysis.
Equations of line-of-best-fit are y = slope (± SD)x + y-intercept (± SD). CT, Threshold
Cycle; CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; CYP24, 25-hydroxyvitamin
D-24-hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde phosphate
dehydrogenase.
17
15
13
19
11
171513 19119
9
17
15
13
19
11
171513 19119
9
21
19
17
23
15
25
27
29
211917 2315 25 27 29
21
19
17
23
15
25
27
29
211917 2315 25 27 29
30
28
26
32
24
34
36
302826 3224 34 36
30
28
26
32
24
34
36
302826 3224 34 36
21
19
17
23
15
25
27
29
31
33
35
211917 2315 25 27 29 31 33 35
21
19
17
23
15
25
27
29
31
33
35
211917 2315 25 27 29 31 33 35
A B
C D
y = 0.98 (± 0.02) x – 0.61 (± 0.55)R2 = 0.97
y = 1.05 (± 0.03) – 0.72 (± 0.53)R2 = 0.95
y = 1.00 (± 0.02)x – 0.01 (± 0.38)R2 = 0.98
y = 1.13 (± 0.02)x – 0.58 (± 0.32)R2 = 0.96
Threshold Cycle (Run 1)
Thre
chol
d C
ycle
(Run
2)
17
15
13
19
11
171513 19119
9
17
15
13
19
11
171513 19119
9
21
19
17
23
15
25
27
29
211917 2315 25 27 29
21
19
17
23
15
25
27
29
211917 2315 25 27 29
30
28
26
32
24
34
36
302826 3224 34 36
30
28
26
32
24
34
36
302826 3224 34 36
21
19
17
23
15
25
27
29
31
33
35
211917 2315 25 27 29 31 33 35
21
19
17
23
15
25
27
29
31
33
35
211917 2315 25 27 29 31 33 35
A B
C D
y = 0.98 (± 0.02) x – 0.61 (± 0.55)R2 = 0.97
y = 1.05 (± 0.03) – 0.72 (± 0.53)R2 = 0.95
y = 1.00 (± 0.02)x – 0.01 (± 0.38)R2 = 0.98
y = 1.13 (± 0.02)x – 0.58 (± 0.32)R2 = 0.96
Threshold Cycle (Run 1)
Thre
chol
d C
ycle
(Run
2)
72
Table 3.5. The reproducibility of amplification of reverse-transcribed mRNA samples
assessed by the comparison of the equations of line-of-best-fit and the line-of unity.
Combined y = 0.98 (± 0.02)x + 0.61 (± 0.55) R2 = 0.97
Kidney y = 0.99 (± 0.03) x + 0.35 (± 0.98) R2 = 0.95
CYP
27B1
Bone y = 0.93 (± 0.04)x + 1.85 (± 1.19) R2 = 0.91
Combined y = 1.05 (± 0.03)x – 0.72 (± 0.53) R2 = 0.95
Kidney y = 0.98 (± 0.06)x + 0.46 (± 1.04) R2 = 0.88
CYP
24
Bone y = 0.96 (± 0.06)x + 1.35 (± 1.27) R2 = 0.86
Combined y = 1.00 (± 0.02)x – 0.01 (± 0.38) R2 = 0.98
Kidney y = *0.83 (± 0.06)x + #3.05 (± 1.17) R2 = 0.80 VDR
Bone y = 0.98 (± 0.06)x + 0.57 (± 1.67) R2 = 0.85
Combined y = *1.13 (± 0.02)x– 0.58 (± 0.32) R2 = 0.96
Kidney y = 1.10 (± 0.08)x – 0.18 (± 0.93) R2 = 0.81
GAP
DH
Bone y = *1.13 (± 0.06)x – 0.60 (± 0.85) R2 = 0.89
Equations of line-of-best-fit are y = slope (±S.D.)x + y-intercept (±S.D.). ∗ p<0.05 vs
slope of line-of-unity; # p<0.05 vs intercept of line-of-unity. CYP27B1, 25-
hydroxyvitamin-1α-hydroxylase; CYP24, 25-hydroxyvitamin-24-hydroxylase; VDR,
vitamin D receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Equation Coefficient of Determination Tissue Gene
73
best-fit and that of the line-of-unity. The greatest variation in the coefficient of
determination and slope of line-of-best-fit occurred when only a narrow range of CT
values was detected in the analysis. The use of a limited range of CT values causes an
error in the estimation of the slope of the line-of-best-fit.
3.3.8 Assessment of GAPDH mRNA and total RNA as the referent for
mRNA quantitation
To assess the value of GAPDH as an internal control, CT values for GAPDH were
determined in rat kidney and bone tissue, removed from animals fed a combination of
a 1% or 0.1% calcium and a vitamin D-replete or vitamin D-deficient semi-synthetic
diet (Chapter 2.3.1.2), and are shown in Table 3.6. In the kidney, the levels of
GAPDH mRNA detected in different groups are relatively constant. The similar
expression of GAPDH could, therefore, be used in this tissue. In the bone, however,
the expression of GAPDH mRNA varies between the dietary treatment groups. The
rats fed a 1% calcium diet demonstrated reduction in CT by approximately 1 cycle,
which was independent of vitamin D status. Furthermore, the expression levels of
GAPDH were significantly lower in bone when compared to the levels in kidney. CT
values were 3 to 4 cycles higher in bone, which represents a 5- to 10-fold lower
GAPDH mRNA levels when compared to levels kidney. For these reason, the use of
GAPDH in bone as an referent is inappropriate. The expression levels of CYP27B1,
CYP24 and VDR mRNA when using either GAPDH or total RNA as the referents is
shown in Table 3.7. For the purpose of comparing expression levels of mRNA when
using either total RNA or GAPDH mRNA as the control, the expression levels of
mRNA is expressed as a percentage relative to animals fed a 1% calcium, vitamin D-
replete diet. In the kidney, expression levels of mRNA are comparable when corrected
with either total RNA or GAPDH mRNA. This was an expected outcome considering
74
Table 3.6 GAPDH threshold cycle (CT) values from various rats treatment groups
from kidney and bone.
Vit D (+) / 0.1% Calcium 11.74 + 0.25 15.58 + 0.21
Vit D (+) / 1% Calcium 11.57 + 0.16 14.66 + 0.51
Vit D (-) / 0.1% Calcium 11.74 + 0.09 15.50 + 0.26
Vit D (-) / 1% Calcium 11.78 + 0.15 14.40 + 0.27
Values and mean + SEM (n = 6). CT, threshold cycle; Vit D (+), vitamin D-replete;
Vit D (-), vitamin D-deficient; GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
Rat treatment Kidney (CT) Bone (CT)
75
Table 3.7. Comparison of expression levels when using total RNA or GAPDH as the
referent.
Expression of each mRNA species is expressed as a percentage relative to rats fed 1%
calcium/Vit D (+) diet and s.e.m. Ca, calcium; Vit D (+), vitamin D-replete; Vit D (-),
vitamin D-deficient; CYP27B1, 25-hydroxyvitamin-1α-hydroxylase; CYP24, 25-
hydroxyvitamin-24-hydroxylase; VDR, vitamin D receptor; GAPDH, glyceraldehyde-
3-phosphate dehydrogenase.
/ µg total RNA 100% 172.3 53.1 14736 (s.e.m.) (26.5) (60.5) (16.7) (176.1)
/ GAPDH 100% 195.0 60.9 16322 CYP27B1
(s.e.m.) (23.8) (91.3) (20.7) (3751.2)
/ µg total RNA 100% 58.7 13.5 7.3 (s.e.m.) (6.4) (13.4) (5.1) (4.2)
/ GAPDH 100% 58.4 12.8 7.4 CYP24
(s.e.m.) (10.1) (4.3) (4.8) (3.9)
/ µg total RNA 100% 64.0 72.1 36.3 (s.e.m.) (23.2) (29.8) (17.8) (2.1)
/ GAPDH 100% 56.4 77.7 39.6
KID
NEY
VDR
(s.e.m.) (22.7) (22.8) (22.0) (1.7)
/ µg total RNA 100% 20.1 117.4 18.3 (s.e.m.) (23.3) (3.5) (23.8) (5.6)
/ GAPDH 100% 40.8 130.1 45.7 CYP27B1
(s.e.m.) (15.9) (4.2) (20.0) (9.4)
/ µg total RNA 100% 34.6 133.3 28.3 (s.e.m.) (33.9) (7.3) (34.2) (8.6)
/ GAPDH 100% 93.0 144.5 88.1 CYP24
(s.e.m.) (13.1) (40.0) (11.3) (31.0)
/ µg total RNA 100% 264.1 103.8 467.3 (s.e.m.) (16.8) (114.0) (18.4) (219.6)
/ GAPDH 100% 400.2 99.2 791.4
BO
NE
VDR
(s.e.m.) (37.5) (163.9) (33.5) (390.3)
Gene Internal Control
1% CaVit D (+) (control)
0.1% CaVit D (+)
(% of control)
1% Ca Vit D (-)
(% of control)
0.1% CaVit D (-)
(% of control)
76
that the GAPDH levels are consistent between all animal groups. In the bone,
however, while the trend of relative expression was the same whether using total
RNA or GAPDH mRNA as the referent, the magnitude of target mRNA expression
varied considerably, due to the variation in the GAPDH mRNA levels between
groups. Hence, to compare target mRNA levels between treatment groups as well as
between kidney and bone tissue, total RNA loaded per reaction was considered to be
more appropriate as the referent than GAPDH mRNA.
3.4 DISCUSSION
In this study, we have assessed the use of quantitative real-time RT-PCR in the
determination of CYP27B1, CYP24 and VDR mRNA levels in both rat kidney and
bone tissue, and we have optimised the experimental protocol of this method. This is
the first report to demonstrate a reliable, quantitative, detection of mRNA, extracted
from calcified tissue by real-time RT-PCR. Leutenegger et al (1999) extracted intact
total RNA from bone embedded in hydrophobic acrylic resin and used real-time PCR
to detect mRNA of several cytokines. They only used real-time RT-PCR, however, to
qualitatively analyse the mRNA species. Although a number of reports describe the
quantification of mRNA in various soft tissues (Wang et al 1989; Overbergh et al
1999; Yin et al 2001), there are no reports of the quantitative analysis of mRNA
obtained from calcified tissue, by real-time RT-PCR.
Relatively few studies have assessed the use of real-time RT-PCR in the quantitative
analysis of mRNA levels when compared with the number of studies that have
investigated the use of the technique in the detection of viral infections or allelic
discriminations. To our knowledge, no other studies have examined the regulation of
77
CYP27B1, CYP24 and VDR mRNA expression, using real-time RT-PCR. This
system accurately determines low levels of target mRNA expression and overcomes
the shortfalls of other less sensitive and non-quantitative techniques such as Northern
blot analysis or standard RT-PCR. The generation of standard curves with external
cDNA standards in order to derive copy numbers of target mRNA present in unknown
samples was demonstrated to be a robust, quantitative procedure. The cDNA
standards were also used to estimate the sensitivity of the method. The fluorogenic
probes were able to detect hundreds of copy numbers of target cDNA with high
reproducibility. It is likely that the fluorogenic probes may be sensitive enough to
even detect tens of copies since the highest CT value found at which hundreds of
copies were detected was considerably lower that the 45 cycles of the amplification
run. Additionally, no sign of amplification was detected in the NTC during the 45
cycles of the PCR reaction, which increases the reliability of low copy number
detection. The absence of amplified cDNA in the NTC demonstrated that the primer
and probe combinations did not amplify any potential contaminating genomic DNA
and confirmed that no contaminating material was present in the PCR reaction
mixture.
The sensitivity and efficiency of this system depends on the components present in the
reaction mixture being in excess. By using the linear part of the amplification curve,
rather than the amount of end product detected, to quantify cDNA levels present in a
particular sample, problems with amplification-limiting reagent concentrations is
avoided. Excessive amounts of probe, however, are known to interfere with cDNA
amplification by the forward and reverse primers. The optimised fluorogenic probe
concentration used for our PCR reactions was 200nM for each probe. The Universal
78
Master Mix (PE Applied Biosystems, Foster City, CA), which contains Amplitaq
Gold DNA polymerase (PE Applied Biosystems, Foster City, CA), is pre-optimised
for most fluorogenic probe PCR reactions. Although in some applications the level of
5’ exonuclease activity of Amplitaq Gold may vary, the use of Amplitaq Gold in the
current study does not appear to have compromised the progression of the PCR
reaction.
Linear amplification was detected over a large concentration range. In the case of
CYP27B1 cDNA, linear amplification was detected over a concentration range of 1.6
x 107-fold. The high degree of linearity, suggests that the dilutions performed and the
reaction conditions for each sample where appropriate. The concentrations of the
reaction components, such as the probe, the primers, the nucleotide and the
polymerase enzyme, are not limiting the reaction or the accuracy of CT detection.
The comparable amplification efficiencies found for the cDNA standards and for the
reverse-transcribed mRNA allows for the interpolation of mRNA copy numbers from
the cDNA standard curves. The high amplification efficiency of the reverse-
transcribed mRNA indicates the PCR efficiency is not affected by the use of the
phenol/chloroform method to purify total RNA from both soft kidney and mineralised
bone tissues, or by subsequent reverse-transcription of mRNA. While no direct
measurement can be made to determine the effectiveness of the first-strand synthesis
of cDNA from mRNA, the assumption can be made that the efficiency of the reverse-
transcription reaction is constant for all samples.
79
Duplicates of a PCR reaction of reverse-transcribed mRNA, exhibited a high degree
of reproducibility. No statistical difference could be determined between CT values
obtained from two separate PCR reactions, in any mRNA species except for GAPDH.
The reasons for the reduced reproducibility of the GAPDH amplification reaction are
unclear. They may be due to the small range of GAPDH levels detected, which may
prejudice the line-of-best-fit used to the determine the reproducibility of the GAPDH
mRNA analysis. A high degree of reproducibility was detected between CT values
obtained from two separate amplification reactions of cDNA standards, even at low
cDNA copy numbers. The CT values of the cDNA standards, generated on different
occasions showed a high reproducibility throughout the entire concentration range
tested. Despite this, when the mRNA copy number for a single unknown sample was
derived from each of the two standard curves, there was a significant difference in the
estimated amounts of copy numbers. This shows that even though the two standard
curves demonstrate a high degree of reproducibility in regards to the CT values, a
statistically insignificant shift of the standard curve can cause a substantial difference
in the amount of copy numbers estimated from this curve. Therefore, the
reproducibility of the reaction is limited when a separate standard curve is generated
for each PCR run. It was concluded, that the quantification of all unknown samples
during this project, should be derived from a single standard curve calculated from the
average of the two standard curves obtained through the amplification of a range of
cDNA standards.
The use of an endogenous standard as a means of controlling for experimental
variation is important. GAPDH mRNA could be used as an external referent for
unknown kidney mRNA samples, because consistent levels of GAPDH mRNA
80
expression were detected in all of the kidney samples tested. In the bone, however,
differences in GAPDH mRNA expression levels were detected. The rats fed the 1%
calcium diet, both vitamin D-replete and vitamin D-deplete, demonstrated a reduction
in CT value of approximately 1 cycle. This makes is impossible to compare relative
mRNA expression levels between the different dietary groups in bone tissue. There
have been a number of reports suggesting that GAPDH expression is regulated by a
number of physiological challenges and it is possible that the dietary treatment may
have altered the expression of GAPDH mRNA (Bustin et al 1999; Oliveira et al 1999;
Thellin et al 1999). As well, expression levels of GAPDH were significantly different
between the kidney and bone, with a reduction in CT values found in the kidney of 3
to 4 cycles. This represents a 5- to 10-fold increase of GAPDH mRNA copy number
in the kidney when compared to the bone, which does not allow for a direct
comparison of target message between these two tissues. Because the use of GAPDH
mRNA as a referent was considered inappropriate in the current study, total RNA was
used. Total RNA referent does not correct for the amount of cDNA loaded into each
PCR tube. There was, however, a high degree of reproducibility between the duplicate
reactions and between the two separate PCR runs, which suggested that a loading
control is not essential.
In conclusion, real-time RT-PCR is a rapid, highly reproducible and sensitive system,
which can accurately detect and quantify mRNA expression, even at very low levels.
Quantification based on the CT value, which is obtained from the early, linear stage of
amplification, rather than on the amount of end product detected, prevents the
problems associated with amplification limitation due to depletion of reagent
components, which is likely to occur in the later stages of amplification. The
81
generation of a standard curve, created by the amplification of cDNA standards of
known concentrations, allows for accurate estimation of mRNA copy numbers for a
specific gene. Furthermore, it enables us to compare mRNA expression levels
between different tissues and to compare results obtained from separate PCR runs.
The mRNA extraction and the reverse transcription procedure, prior to the real-time
RT-PCR analysis, do not appear to affect the accuracy and efficiency of the
fluorescence detection. Although the fluorogenic probes, specifically designed for
every target mRNA of interest, are difficult to design and expensive to synthesise,
they offer a high degree of specificity and sensitivity of detection, which gives rise to
a system that is superior over Northern blot analysis and semi-quantitative PCR
reactions.
82
CHAPTER 4: The Effects of Age on the Regulation of
CYP27B1, CYP24 and VDR mRNA Expression
4.1 Introduction Blood calcium levels are one of the most tightly regulated substances in the body. The
central role of the vitamin D endocrine system, along with PTH and calcitonin, is to
regulate blood calcium levels within a narrow range. Synthesis of 1,25D can increase
levels of serum calcium by increasing intestinal calcium absorption and renal calcium
reabsorption. The requirements for calcium, however, vary throughout life. During the
early stage of life when growth is vigorous, calcium requirements are high as the
skeleton accretes large amounts of calcium. During the latter stages of life, bone
growth ceases, and the skeleton in fact can serve as a source of calcium if dietary
calcium levels are inadequate. It is well established that intestinal calcium absorption
decreases with age (Gallagher et al 1979), which contributes to loss of calcium from
the skeleton (Morgan 1972; Nordin 1997). The role of the vitamin D endocrine
system in the adaptation of the body to the various requirements of calcium, however,
is less clear.
The biological activity of vitamin D is determined essentially from three genes, which
are CYP27B1, CYP24 and VDR. The synthesis of vitamin D by CYP27B1 occurs
primarily in the kidney. The catabolic activity of CYP24, however, occurs in the
kidney as well as in non-renal tissues that contain VDR. CYP27B1 and CYP24
enzyme activity are the most tightly regulated steps in vitamin D metabolism and
interact with several physiological factors such as calcium, PTH, calcitonin,
83
phosphate and 1,25D itself (Rost et al 1981; Nesbitt et al 1986; Nesbitt et al 1987;
Frolich et al 1990; Nesbitt and Drezner 1990; Walker et al 1990; Econs et al 1992;
Beckman et al 1995; Brenza et al 1998; Murayama et al 1998; Murayama et al 1999;
Shinki et al 1999; Yoshida et al 1999; Brenza and DeLuca 2000). In the kidney, these
factors usually have an effect on both CYP27B1 and CYP24 activity to modulate
1,25D production. For example, PTH strongly induces CYP27B1 activity and inhibits
CYP24 activity with the purpose of increasing 1,25D production (Matsumoto et al
1985; Shigematsu et al 1986; Shinki et al 1992; Armbrecht et al 1998; Zierold et al
2000). 1,25D, itself, has been shown to suppress CYP27B1 enzyme activity (Booth et
al 1985; Brenza and DeLuca 2000) and strongly induce CYP24 enzyme activity in a
feedback mechanism to limit the further synthesis of 1,25D (Akeno et al 1993;
Armbrecht and Hodam 1994; Itoh et al 1995; Lemay et al 1995; Armbrecht et al
1997(a); Armbrecht et al 1998; Furuichi et al 1998). There is emerging evidence that a
number of non-renal sites express CYP27B1 activity. Several recent studies have
shown that osteoblasts, as well as a variety of bone marrow precursor cells, express
CYP27B1 mRNA (Kreutz et al 1993; Nishimura et al 1994; Ichikawa et al 1995;
Panda et al 2001(a)). Although the precise role of CYP27B1 in these cells remains
unknown, the regulation of the 1α-hydroxylation of vitamin D in a number of non-
renal sites appears to be different from that of the renal 1α-hydroxylation step (Pryke
et al 1990; Reichel et al 1991; Gyetko et al 1993; Bell 1998; Zehnder et al 2001).
There is evidence for an age-related decline in the renal synthesis of 1,25D, which is
associated with reduced serum 1,25D levels and reduced VDR levels in target tissues
(Horst et al 1990; Takamoto et al 1990; Ebeling et al 1992; Johnson et al 1995). The
effect of age, however, on vitamin D activation and vitamin D catabolism, particularly
84
with respect to bone is unknown. To identify the effects of age on the biological
activity of vitamin D in kidney and bone tissue, levels of CYP27B1, CYP24 and VDR
mRNA were measured in these tissues removed from animals ranging in age from 3
weeks to 2 years of age. The animals were fed a standard rat chow for the duration of
the experiment, which contained adequate levels of calcium and vitamin D. The
measurement of several non-fasting serum markers of the vitamin D endocrine system
allows for further analysis of the regulation of kidney and bone CYP27B1, CYP24
and VDR mRNA expression.
4.2 Protocol
4.2.1 Experimental procedure
24 Sprague-Dawley female rats were allocated to 8 different age groups. Animals
were housed as described in Chapter 2.3 and were fed commercial rat chow (Chapter
2.3.1.1) and water ad libitum. Rats were sacrificed at the ages of 3, 6, 9, 12, 15, 26, 52
and 104 weeks of age as described in Chapter 2.5.3.1. Body weight was recorded at
time of death.
4.1.1 Biochemical analysis
Blood samples were collected from non-fasting animals at death as described in
Chapter 2.3.2. Blood serum was analysed for calcium (Chapter 2.4.1), 1,25D (Chapter
2.4.2), 25D (Chapter 2.4.3), PTH (Chapter 2.4.4) and calcitonin (Chapter 2.4.5).
4.1.2 Messenger RNA analyses
Messenger RNA extraction, purification and quantification from rat kidney and bone
tissue are described in Chapter 2.5.3. First strand cDNA synthesis from mRNA is
85
described in Chapter 2.5.4. The reaction temperature, reagent composition and
conditions for real-time RT-PCR are described in Chapter 2.6.2.
4.1.3 Data expression and statistical analyses
The effect of age on biochemical markers, CYP27B1, CYP24 and VDR mRNA were
statistically analysed with one-way analysis of variance (Chapter 2.4.6.2). A Tukey’s
post hoc test (Chapter 2.4.6.4) was used to identify the differences between age
groups. Multiple linear regression analysis was used to determine the relationship
between mRNA levels of a specific target gene and two or more biochemical markers
(Chapter 2.4.6.6) when each of the analyses demonstrated a significant linear
relationship.
4.3 Results
4.3.1 Body weight and serum biochemistry
Body weight and serum levels of 25D, 1,25D, PTH, calcitonin and calcium are shown
in Table 4.1.
4.3.1.1 Serum Calcium
The non-fasting serum calcium levels ranged from 2.6 ± 0.01 mmol/L at 26 weeks of
age to 3.0 ± 0.1 mmol/L at 15 weeks of age. Levels did not significantly vary between
the different age groups. Serum calcium did not correlate with serum PTH, calcitonin
or 1,25D levels.
4.3.1.2 Serum 25D
Serum 25D was higher at 12 and 15 weeks of age when compared to all other ages,
with levels of 276.6 ± 24.7 nmol/L and 316.9 ± 17.7 nmol/L respectively (p<0.0001)
86
despite constant dietary intake of vitamin D. In a multiple linear regression analysis,
CYP27B1 mRNA and CYP24 mRNA levels did not correlate with 25D over the
entire age range. Kidney CYP27B1 mRNA levels were, however, negatively
correlated with serum 25D levels between 3 and 12 weeks of age (R2 = 0.53)
(p<0.05). Furthermore, kidney CYP24 mRNA levels were negatively correlated with
serum 25D levels in animals between 15 and 104 weeks of age (R2 = 0.31) (p<0.05).
4.3.1.3 Serum 1,25D
Serum levels of 1,25D were highest in the 3-week-old rat at 805.1 ± 59.9 pmol/L.
Levels decreased significantly until 12 weeks of age (p<0.0001). 1,25D levels
plateaued at 26 weeks of age. The relationship for age and serum 1,25D had a
logathrithmic correlation with a coefficient of determination of 0.74 (Figure 4.1).
4.3.1.4 Serum PTH
Serum PTH fell from 19.5 ± 0.7 pmol/L at 6 weeks of age to 14.0 ± 1.3 pmol/L at 9
weeks of age and remained at this level at 12 and 15 weeks of age. Serum PTH levels
then rose again at 26, 52 and 104 weeks of age (p<0.05). Serum PTH levels were not
analysed at 3 weeks of age.
4.3.1.5 Serum Calcitonin
Serum calcitonin levels were low from 3 to 12 weeks of age before significantly
increasing at 15, 26 and 104 weeks of age (p<0.01). Calcitonin levels were highest at
104 weeks of age at 18.8 ± 1.5 pmol/L. Serum calcitonin levels were not analysed at
52 weeks of age.
87
Table 4.1 Body weight and serum biochemistry of 25D, 1,25D, PTH, calcitonin and
calcium with respect to age.
3 w 6 w 9 w 12 w 15 w 26 w 52 w 104 w
Body Weight (g)
69.0a ± 1.5
175.0a ± 12.5
238.7a
± 1.5 265.3b
± 6.3 294.7c ± 15.8
336.7 ± 8.8
380.0 ± 5.8
373.3 ± 12.0
25D (nmol/L)
157.9 ± 0.0
161.5 ± 5.5
178.9 ± 15.6
276.6d
± 24.7 316.9e
± 17.7 200.1 ± 8.7
193.7 ± 4.2
158.8 ± 33.0
1,25D (pmol/L)
805.1a ± 59.9
479.9f ± 87.8
421.4g
± 52.3 164.4 ± 21.3
151.9 ± 16.6
73.1 ± 14.4
130.2 ± 49.6
67.6 ± 24.2
PTH (pmol/L) NA 19.6h
± 0.7 14.0i ± 1.3
14.5i ± 2.8
15.7j ± 1.1
23.0k ± 2.2
22.0k ± 3.9
30.9 ± 6.0
Calcitonin (pmol/L)
5.7l (n=1)
5.6l ± 1.0
3.9l ± 0.3
6.5l ± 1.3
12.8m ± 2.1
15.4 ± 4.9
NA 18.8 ± 1.5
Calcium (mmol/L)
2.7 ± 0.1
2.8 ± 0.04
2.7 ± 0.06
2.8 ± 0.1
3.0 ± 0.1
2.6 ± 0.01
2.8 ± 0.1
2.7 ± 0.1
Values are mean ± s.e.m. n = 3. a p<0.0001 v all; b p<0.0001 v all but 15 w; c
p<0.0001 all but 12 & 26 w; d p<0.0001 v all but 15 & 26w; e p<0.0001 v all
but 12w; f p<0.0001 v all but 9w; g p<0.0001 v all but 6w; h p<0.05 v 9, 12 &
104w; i p<0.05 v all but 12 & 15w; j p<0.05 v 26, 52, 104w; k p<0.05 v 104w; l
p<0.01 v 15, 26, 104w; m p<0.01 v 104w. NA, not analysed; 25D, 25-
hydroxyvitamin D3; 1,25D, 1,25-dihydrixyvitamin D3; PTH, parathyroid
hormone; Calcitonin, Calcitonin; calcium, calcium.
88
Figure 4.1 Relationship between rat age (weeks) and serum 1,25D levels (pmol/L).
The coefficient of determination (R2) is shown for the regression analysis.
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
0
200
400
600
800
1000
Seru
m 1
,25D
(nm
ol/L
)
R2 = 0.74
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
0
200
400
600
800
1000
Seru
m 1
,25D
(nm
ol/L
)
R2 = 0.74
89
4.3.2 Gene expression in the kidney
4.3.2.1 CYP27B1 mRNA
Kidney CYP27B1 mRNA levels were highest in the 3-week-old rat at 2.5 x106 ± 2.6
x105 copies/µg of total RNA. This was significantly different from mRNA levels
found at 9 weeks of age and older. There was a reduction in the levels of kidney
CYP27B1 mRNA with age, such that mRNA levels fell to 3.1 x105 ± 1.6 x105
copies/µg of total RNA by 52 weeks of age and 3.1 x105 ± 5.2 x104 at 104 weeks.
These mRNA levels were both statistically different from the levels detected at 3 and
6 weeks of age (p<0.0001). The line-of-best-fit for the fall in mRNA expression with
age has a non-linear coefficient of determination of 0.92 (Figure 4.2). There was no
correlation of kidney CYP27B1 mRNA with serum PTH levels or serum calcium
levels.
4.3.2.2 Relationship between serum 1,25D and kidney CYP27B1 mRNA
Kidney CYP27B1 mRNA levels positively correlated with serum 1,25D levels such
that an increase in CYP27B1 mRNA expression is associated with an increase in
serum 1.25D levels (p<0.001) (Figure 4.3). The coefficient of determination for the
relationship was 0.72.
4.3.2.3 Relationship between serum calcitonin and kidney CYP27B1 mRNA
The negatively correlation between serum calcitonin and kidney CYP27B1 mRNA
levels is shown in Figure 4.4. The non-linear coefficient of determination for the
relationship was 0.49 (p<0.01).
90
Figure 4.2 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA)
with age. Values are mean ± s.e.m. (n = 3). The coefficient of determination (R2) is
shown for the regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase.
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
0
5
15
20
25
30
35
10
R2 = 0.92
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
0
5
15
20
25
30
35
10
R2 = 0.92
CYP
27B
1
91
Figure 4.3 Relationship between serum 1,25D (pmol/L) and kidney CYP27B1 mRNA
levels (copy numbers/µg total RNA). The coefficient of determination (R2) is shown
for the linear regression analysis. 1,25D, 1,25-dihydroxyvitamin D3; CYP27B1, 25-
hydroxyvitamin D-1α-hydroxylase.
CYP27b1 mRNA copy number (x105)/ µg total RNA
10 20 353000
100
200
300
400
500
600
700
800
900
1000
Seru
m 1
,25D
(nm
ol/L
)
R2 = 0.72
15 255
CYP27b1 mRNA copy number (x105)/ µg total RNA
10 20 353000
100
200
300
400
500
600
700
800
900
1000
Seru
m 1
,25D
(nm
ol/L
)
R2 = 0.72
15 255
CYP27B1
92
Figure 4.4 Relationship between serum calcitonin (pmol/L) and kidney CYP27B1
mRNA levels (copy numbers/µg total RNA). The coefficient of determination (R2) is
shown for the linear regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-
hydroxylase.
Calcitonin (pmol/L)
CYP
27b1
mR
NA c
opy
num
ber (
x105 )
/ µg
tota
l RN
A
35R2 = 0.42
0
5
10
15
20
25
30
5 10 20150 25 30
CYP
27B
1
93
4.3.2.4 CYP24 mRNA
The relationship between kidney CYP24 mRNA copy numbers and age is shown in
Figure 4.5. Expression of kidney CYP24 mRNA was lowest at 9 weeks of age at 3.2
x104 ± 9.3 x103 copy numbers/µg total RNA and highest at 104 weeks of age with 1.1
x106 ± 1.1 x105 copy numbers/µg total RNA. The mRNA expression with age
resembles a J-curve. Expression of CYP24 mRNA is high at 3 weeks of age before
falling at 6 and 9 weeks of age. The mRNA levels then increased significantly from
12 to 26 weeks of age and plateaued at 52 weeks of age (p<0.0001). The coefficient of
determination of the logarithmic line-of-best-fit relationship for data between 6 and
104 weeks of age was 0.90 (data not shown).
4.3.2.5 Relationship between serum 1,25D and kidney CYP24 mRNA
Kidney CYP24 mRNA copy numbers were negatively correlated with serum 1,25D in
rats varying in age between 6 and 104 weeks (p<0.05) (Figure 4.6). The coefficient of
determination for the logathrithmic line-of-best-fit was 0.71.
4.3.2.6 Relationship between kidney CYP27B1 mRNA and kidney CYP24
mRNA
Kidney CYP24 mRNA levels were negatively correlated with kidney CYP27B1
mRNA levels in rats varying in age between 3 and 104 weeks of age (p<0.05) (Figure
4.7). The coefficient of determination for the line-of-best-fit was 0.38.
94
Figure 4.5 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) with
age (weeks). Values are mean ± s.e.m. (n = 3). CYP24, 25-hydroxyvitamin D-24-
hydroxylase.
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
24 m
RN
A co
py n
umbe
r (x1
04 )/ µ
g to
tal R
NA
0
2
6
8
10
12
14
4
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
24 m
RN
A co
py n
umbe
r (x1
04 )/ µ
g to
tal R
NA
0
2
6
8
10
12
14
4
95
Figure 4.6 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA). The coefficient of determination (R2) is shown
for the linear regression analysis. 1,25D, 1,25-dihydroxyvitamin D3; CYP24, 25-
hydroxyvitamin D-24-hydroxylase.
CYP24 mRNA copy number (x105)/ µg total RNA
2 4 860 10 12 140
100
200
300
400
500
600
700
Seru
m 1
,25D
(nm
ol/L
)
R2 = 0.71
CYP24 mRNA copy number (x105)/ µg total RNA
2 4 860 10 12 140
100
200
300
400
500
600
700
Seru
m 1
,25D
(nm
ol/L
)
CYP24 mRNA copy number (x105)/ µg total RNA
2 4 860 10 12 140
100
200
300
400
500
600
700
Seru
m 1
,25D
(nm
ol/L
)
R2 = 0.71
96
Figure 4.7 Relationship between kidney CYP27B1 mRNA (copy numbers/µg total
RNA) and kidney CYP24 mRNA levels (copy numbers/µg total RNA). The
coefficient of determination (R2) is shown for the linear regression analysis.
CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; CYP24, 25-hydroxyvitamin D-24-
hydroxylase.
5 10 20150
CYP27b1 mRNA copy number (x105)/ µg total RNA
25 30 35
CYP
24 m
RN
A co
py n
umbe
r (x1
04 )/ µ
g to
tal R
NA
0
2
6
8
10
12
14
4
R2 = 0.38
5 10 20150
CYP27b1 mRNA copy number (x105)/ µg total RNA
25 30 35
CYP
24 m
RN
A co
py n
umbe
r (x1
04 )/ µ
g to
tal R
NA
0
2
6
8
10
12
14
4
R2 = 0.38
CYP27B1
97
4.3.2.7 Relationship between serum calcitonin and kidney CYP24 mRNA
Kidney CYP24 mRNA copy numbers were positively correlated with serum
calcitonin levels in rats varying in age between 3 and 104 weeks of age (p<0.05)
(Figure 4.8). The coefficient of determination for the line-of-best-fit was 0.69. Due to
a lack of serum blood sample, serum calcitonin levels could not be measured in two 3-
week-old rats and all 26-week-old rats.
4.3.2.8 VDR mRNA
The expression of kidney VDR mRNA with age is shown in Figure 4.9, which
resembles a J-curve. Expression of VDR mRNA is high at 3 weeks of age before
falling at 6 and 9 weeks of age. The mRNA levels then significantly increase between
9 and 15 weeks of age and plateau at 26 weeks of age (p<0.0001). The coefficient of
determination of the logarithmic line-of-best-fit relationship for the data between 6
and 104 weeks of age was 0.66 (p<0.01) (data not shown).
4.3.2.9 Relationship between kidney CYP24 mRNA and kidney VDR mRNA
The relationship between kidney VDR and kidney CYP24 copy numbers is shown in
Figure 4.10. The positive correlation between kidney CYP24 and kidney VDR mRNA
expression has a coefficient of determination of 0.60 (p<0.01).
98
Figure 4.8 Relationship between serum calcitonin (pmol/L) and kidney CYP24
mRNA levels (copy numbers/µg total RNA). The coefficient of determination (R2) is
shown for the linear regression analysis. CYP24, 25-hydroxyvitamin D-24-
hydroxylase.
CYP
24 m
RN
A c
opy
num
ber (
x105 )
/ µg
tota
l RN
A
Calcitonin (pmol/L)
R2 = 0.69
5 10 20150 25 30
14
0
2
4
6
8
10
12
99
Figure 4.9 Expression of kidney VDR mRNA (copy numbers/µg total RNA) with age
(weeks). Values are mean ± s.e.m. (n = 3). VDR, vitamin D receptor.
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
VDR
mR
NA
copy
num
ber (
x104 )
/ µg
tota
l RN
A
0
5
15
20
25
10
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
VDR
mR
NA
copy
num
ber (
x104 )
/ µg
tota
l RN
A
0
5
15
20
25
10
100
Figure 4.10 Relationship between kidney CYP24 and kidney VDR mRNA expression
(copy numbers/µg total RNA). The coefficient of determination (R2) is shown for the
linear regression analysis. CYP24, 25-hydroxyvitamin D-24-hydroxylase; VDR,
vitamin D receptor.
CYP24 mRNA copy number (x105)/ µg total RNA
2 4 8600
5
10
15
20
25
10 12 14
VDR
mR
NA
copy
num
ber (
x107 )
/ µg
tota
l RN
A
R2 = 0.60
CYP24 mRNA copy number (x105)/ µg total RNA
2 4 8600
5
10
15
20
25
10 12 14
VDR
mR
NA
copy
num
ber (
x107 )
/ µg
tota
l RN
A
R2 = 0.60
101
4.3.3 Gene Expression in the bone
4.3.3.1 CYP27B1 mRNA
The expression of bone CYP27B1 mRNA with age is shown in Figure 4.11. Bone
CYP27B1 mRNA levels were highest and remained relatively constant in rats
between 3 and 15 weeks, with values ranging from 2.0 x106 ± 3.7 x105 copies/µg of
total RNA to 3.4 x106 ± 6.0 x105 copies/µg of total RNA. Their levels of CYP27B1
mRNA were approximately 3-fold higher than in rats at 26 weeks of age or older. The
mRNA levels in the 12-week-old rat were significantly higher when compared to the
26, 52 and 104 week old rats (p<0.01). The mRNA levels in the 6 and 15-week-old
rats where only higher than those found in the 26-week-old rats (p<0.01). There is no
correlation between bone CYP27B1 mRNA levels and serum 1,25D or kidney
CYP27B1 mRNA levels.
4.3.3.2 Relationship between serum calcium and bone CYP27B1 mRNA
The relationship between serum calcium and bone CYP27B1 mRNA level is shown in
Figure 4.12. There is a positive correlation between serum calcium and bone
CYP27B1 (p<0.05). The coefficient of determination for the relationship is 0.34.
4.3.3.3 Relationship between serum PTH and bone CYP27B1 mRNA
The relationship between serum PTH and bone CYP27B1 mRNA level is shown in
Figure 4.13. The negative correlation between serum PTH and bone CYP27B1
mRNA has a coefficient of determination of 0.49 (p<0.01). In a multiple linear
regression analysis, serum PTH levels and not serum Ca remained a significant
determinant of bone CYP27B1 mRNA expression.
102
Figure 4.11 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) with
age (weeks). Values are mean ± s.e.m. (n = 3). CYP27B1, 25-hydroxyvitamin D-1α-
hydroxylase.
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
0
5
15
20
25
30
35
10
40
45
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
0
5
15
20
25
30
35
10
40
45
CYP
27B
1
103
Figure 4.12 Relationship between serum calcium (mmol/L) and bone CYP27B1
mRNA (copy numbers/µg total RNA). The coefficient of determination (R2) is shown
for the linear regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase.
0
5
10
15
20
25
30
CYP
27b1
mR
NA
copy
num
ber (
x105 )
/ µg
tota
l RNA
35
40
45
50
2.5 2.6 2.82.72.4
Serum Calcium (mmol/L)
2.9 3 3.1 3.2
R2 = 0.34
0
5
10
15
20
25
30
CYP
27b1
mR
NA
copy
num
ber (
x105 )
/ µg
tota
l RNA
35
40
45
50
2.5 2.6 2.82.72.4
Serum Calcium (mmol/L)
2.9 3 3.1 3.2
R2 = 0.34
CYP
27B
1
104
Figure 4.13 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA
(copy numbers/µg total RNA). The coefficient of determination (R2) is shown for the
linear regression analysis. PTH, parathyroid hormone; CYP27B1, 25-hydroxyvitamin
D-1α-hydroxylase.
PTH (pmol/L)
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
R2 = 0.49
0
5
10
15
20
25
30
35
40
45
5 10 20150 25 30 35 40 45
50
CYP
27B
1
105
4.3.3.4 CYP24 mRNA
The expression of bone CYP24 mRNA with age is shown in Figure 4.14. Bone
CYP24 mRNA levels were highest in rats ranging in age between 3 and 15 weeks
with values ranging from 4.7 x104 ± 6.1 x103 to 1.1 x105 ± 2.7 x104 copies/µg of total
RNA. The levels of CYP24 mRNA were over 4-fold higher in the 3- to 15-week-old
rats than in rats at 26 weeks of age or older. The mRNA levels were significantly
higher in the 12-week-old rats when compared to the 26, 52 and 104 week old rats
(p<0.05). There is no correlation between bone CYP24 mRNA levels and serum
1,25D or kidney CYP24 mRNA levels.
4.3.3.5 Relationship between bone CYP27B1 mRNA and bone CYP24 mRNA
The relationship between bone CYP24 mRNA and bone CYP27B1 mRNA copy
numbers is shown in Figure 4.15. Bone CYP27B1 mRNA and bone CYP24 mRNA
levels are positively correlated, with a coefficient of determination of 0.72
(p<0.0001).
4.3.3.6 Relationship between serum PTH and bone CYP24 mRNA
The relationship between bone CYP24 copy numbers and serum PTH levels is shown
in Figure 4.16. Bone CYP24 mRNA levels and serum PTH levels are negatively
correlated, with a coefficient of determination of 0.29 (p<0.05).
106
Figure 4.14 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) with
age (weeks). Values are mean ± s.e.m. (n = 3). CYP24, 25-hydroxyvitamin D-24-
hydroxylase.
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
0
2
6
8
12
14
16
4
18
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
0
2
6
8
12
14
16
4
18
107
Figure 4.15 Relationship between bone CYP27B1 mRNA (copy numbers/µg total
RNA) and bone CYP24 mRNA expression (copy numbers/µg total RNA). The
coefficient of determination (R2) is shown for the linear regression analysis.
CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase. CYP24, 25-hydroxyvitamin D-24-
hydroxylase.
5 10 20150
CYP27b1 mRNA copy number (x105)/ µg total RNA
0
2
4
6
8
10
12
25 30 35
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
14
16
18
40 45 50
R2 = 0.74
5 10 20150
CYP27b1 mRNA copy number (x105)/ µg total RNA
0
2
4
6
8
10
12
25 30 35
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
14
16
18
40 45 50
R2 = 0.74
CYP27B1
108
Figure 4.16 Relationship between serum PTH (pmol/L) levels and bone CYP24
mRNA (copy numbers/µg total RNA). The coefficient of determination (R2) is shown
for the linear regression analysis. PTH, parathyroid hormone; CYP24, 25-
hydroxyvitamin D-24-hydroxylase.
R2 = 0.29
05 10 15 20 25
PTH (pmol/L)
30 35 40 45
2
4
8
6
0
10
12
14
16
18
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
109
4.3.3.7 VDR mRNA
The expression of bone VDR mRNA with age is shown in Figure 4.17. There was a
reduction in the levels of VDR mRNA with age such that VDR levels fell to 6.3 x105
± 2.2 x105 copies/µg of total RNA by 15 weeks of age and remained low until 104
weeks of age (p<0.001). This fall in expression had a coefficient of determination of
0.66.
4.3.3.8 Relationship between serum 1,25D and bone VDR mRNA
The relationship between serum 1,25D and bone VDR mRNA levels is shown in
Figure 4.18. Serum 1,25D levels correlate with bone VDR mRNA levels such that an
increase in expression of VDR mRNA is associated with an increase in serum 1.25D
levels (p<0.01). The coefficient of determination for the relationship was 0.69. In a
multiple linear regression analysis, serum 1,25D and not age determines bone VDR
mRNA levels (p<0.001).
4.4 Discussion
4.4.1 Determinants of serum 1,25D
1,25D is essential for the stimulation of intestinal calcium absorption, which provides
adequate calcium levels for normal bone mineralisation during growth and skeletal
development. As the skeletal growth slows down, less calcium is being deposited in
the bone and therefore the requirement for 1,25D-stimulated intestinal calcium
absorption is reduced. Consequently, the renal synthesis of 1,25D is reduced with age
and this has been reported in both rats (Ishida et al 1987) and humans (Gallagher et al
1979). In the current study, serum 1,25D levels correlate positively with kidney
CYP27B1 mRNA levels and negatively with kidney CYP24 mRNA levels. This
110
Figure 4.17 Expression of bone VDR mRNA (copy numbers/µg total RNA) with age
(weeks). Values are mean ± s.e.m. (n = 3). The coefficient of determination (R2) is
shown for the regression analysis. VDR, vitamin D receptor.
R2 = 0.6578
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
VDR
mR
NA
copy
num
ber (
x107 )
/ µg
tota
l RN
A
0
5
15
20
25
30
35
10
R2 = 0.65
R2 = 0.6578
0 10 20 30 40 50 60 70 80 90 100 110
Age (weeks)
VDR
mR
NA
copy
num
ber (
x107 )
/ µg
tota
l RN
A
0
5
15
20
25
30
35
10
R2 = 0.65
111
Figure 4.18 Relationship between serum 1,25D levels (pmol/L) and bone VDR
mRNA (copy numbers/µg total RNA). The coefficient of determination (R2) is shown
for the regression analysis. 1,25D, 1,25-dihydroxyvitamin D3; VDR, vitamin D
receptor.
5
10
20
15
0
25
30
35
40
45
0200100 300 400 500 600 700 800 900 1000
VDR
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
R2 = 0.60
Serum 1,25D (pmol/L)
112
suggests that the age related decline in serum 1,25D levels is due to a reduction in the
1,25D synthesis by kidney CYP27B1 and an increase in 1,25D catabolism by kidney
CYP24. The decreased availability of circulating 1,25D with age, due to changes in
CYP27B1 and CYP24 mRNA expression, may be important in the development of
intestinal calcium malabsorption, negative calcium balance and the subsequent bone
loss seen in humans (Armbrecht et al 1981; Nordin 1997).
4.4.2 Determinants of serum 25D
Data presented here indicate that serum 25D levels rise to a peak at 12 and 15 weeks
of age before falling again at 26 weeks of age and older. The exact reason for the peak
in serum 25D levels is not known, since the animals were provided with an adequate
and identical intake of dietary vitamin D at all times. It is possible that, since 25D
synthesis in the liver is not tightly regulated (Reinholz and DeLuca 1998), fluctuations
in 25D levels may be due to metabolism into 1,25D or 24,25D. This proposal is
supported by the negative correlation between CYP27B1 mRNA and 25D levels
between 3 and 12 weeks of age (p<0.01) and the positive correlation between CYP24
mRNA and 25D levels between 15 and 104 weeks of age (p<0.001). For this proposal
to be correct, the enzyme activities of CYP27B1 and CYP24 would have to be
modulated by large amounts to effect the large changes in total serum 25D levels of
some 100 to 150nmol/L. Measuring the clearance of 25D from the serum and
appearance of its metabolites at different ages could be done to test this hypothesis.
4.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA
4.4.3.1 Determinants of kidney CYP27B1 mRNA
An age related decline in CYP27B1 mRNA expression has been found in the current
study, which is shown to correlate with a decrease in serum 1,25D levels. This finding
113
is consistent with results from a study by Ishida and co-workers (1987) who showed a
decline in rat kidney CYP27B1 enzyme activity over a two-year period and a
corresponding reduction in serum 1,25D levels. The reduction in kidney CYP27B1
mRNA expression and serum 1,25D levels with age occurs concomitantly with the
decrease in skeletal calcium accretion (O’Loughlin and Morris, 1994) and a reduced
requirement for 1,25D-mediated calcium absorption in the latter stages of skeleton
maturation.
No relationship between serum PTH and kidney CYP27B1 mRNA levels was found
in this study, despite the fact that PTH has been shown to stimulate CYP27B1 gene
transcription (Tanaka et al 1972; Korkor et al 1987) through the cAMP-signalling
pathway (Horiuchi et al 1977; Henry 1985). Garabedian et al (1972) demonstrated,
that parathyroidectomised animals are unable to synthesise 1,25D in the kidney and
that PTH administration to these animals restored the renal production of 1,25D.
Furthermore, St-Arnaud et al (1997) reported a 2-fold increase in CYP27B1 mRNA
expression in the kidney of mice, following the infusion of a pharmacological dose of
PTH for 3 days. The lack of correlation between serum PTH and kidney CYP27B1
mRNA levels may be explained by the measurement of serum PTH levels in non-
fasting animals. The higher serum calcium levels, which occur during non-fasting
periods, may have suppressed the levels of serum PTH and concealed the relationship
between serum PTH and kidney CYP27B1 mRNA expression. Physiologically, PTH
stimulates CYP27B1 mRNA expression, in response to hypocalcemia (Suda et al
1994). The lack of correlation between serum PTH and kidney CYP27B1 mRNA
levels in the current study could therefore indicate PTH regulates CYP27B1 mRNA
expression only during periods of hypocalcaemia The lack of correlation between
serum PTH and kidney CYP27B1 mRNA levels in the current study could therefore
114
indicate PTH regulates CYP27B1 mRNA expression only during periods of
hypocalcaemia. The results from a study performed by Shinki et al (1999) support this
concept where PTH was found to induce CYP27B1 mRNA expression in vitamin D-
deficient hypocalcaemic rats but not in normocalcemic rats.
Another possible explanation for the lack of correlation between serum PTH levels
and kidney CYP27B1 mRNA levels, is provided by a study by Armbrecht and co-
workers (1999), when both young and adult rats were fed a low calcium diet. While a
similar increase in PTH levels was detected in both groups, CYP27B1 mRNA
expression was less responsive to PTH stimulation in the kidneys of adult rats when
compared to those in the young rats. The lack of responsiveness of the adult kidney to
PTH with regards to elevating CYP27B1 mRNA levels is consistent with studies in
humans (Neer et al 1975). Therefore, the increase in serum PTH levels with age could
be a response to the failing ability of PTH to stimulate CYP27B1 mRNA expression
in adulthood.
In the study by Shinki et al (1999) a single pharmacological dose of calcitonin was
given to normocalcemic rats, which unlike PTH, greatly enhanced both the in vivo
conversion of 25D into 1,25D and the CYP27B1 mRNA expression in the kidney.
This calcitonin-mediated stimulation of CYP27B1 has been previously shown by
enzyme activity in rat renal slices and by CYP27B1 promoter activity studies in
kidney cell-lines (Armbrecht et al 1987; Murayama et al 1998; Yoshida et al 1999).
The calcitonin-mediated increase in CYP27B1 mRNA expression, shown by Shinki et
al, was lost when animals were hypocalcaemic. This suggests that normal serum
calcium levels are required for calcitonin to stimulate renal CYP27B1 mRNA
115
expression. The negative correlation between serum calcitonin and CYP27B1 mRNA
levels in the current study, suggests that under vitamin D replete, normocalcemic
conditions, calcitonin may mediate a suppressive rather than stimulatory effect on
renal CYP27B1 mRNA expression. Although, the explanation for the differences in
results between the study of Shinki et al and the current study is unclear, it is possible
that the differences between the pharmacological doses of calcitonin that Shinki and
co-workers used and the physiological levels of calcitonin measured in the current
study is the basis for the discrepancy.
Although calcitonin has been suggested to play a role in the kidney, the most
important function of calcitonin is to lower serum calcium levels by inhibiting bone
resorption. Only in young rats, however, in which bone resorption is relatively high,
does calcitonin administration result in a significant reduction in bone resorption and
a subsequent fall in serum calcium levels (Armbrecht et al 1987; Tsai et al 1991). The
increase in calcitonin levels, starting from 15 weeks of age, may be an indication of
calcitonin insensitivity in adulthood, rather than of a direct involvement of calcitonin
in the regulation of renal CYP27B1 activity. The rise in calcitonin in adulthood might,
therefore, be a consequence of an inability to reduce serum calcium levels by
suppressing bone resorption. Further investigation of bone resorption activity with age
groups is required to substantiate this theory. Although calcitonin plays an important
role in calcium homeostasis, its effect on kidney CYP27B1 mRNA expression
remains unclear.
4.4.3.2 Determinants of kidney CYP24 mRNA
In the current study, CYP24 mRNA expression was positively correlated with age and
negatively correlated with serum 1,25D levels. This finding is consistent with CYP24
116
enzyme activity studies by Ishida and co-workers (1987). They showed a rise in
CYP24 enzyme activity, and a decline in rat kidney CYP27B1 enzyme activity over a
two-year period. The rise in the CYP24-mediated 1,25D breakdown, and the
reduction in the renal 1,25D synthesis reflect the reduced need for 1,25D when the
skeleton matures. The increase in CYP24 mRNA expression coupled to the decrease
in CYP27B1 mRNA expression confirms the reciprocal relationship between the two
enzymes (Boyle et al 1971; Gray et al 1971) and demonstrates the role of the kidney
in regulating levels of circulating 1,25D.
In this study, an age-related rise in serum calcitonin levels is shown, which rapidly
increases from 15 weeks of age. Although some studies in humans suggest that serum
calcitonin levels either remain constant or decrease with age, numerous studies in rats
report an age related increase in serum calcitonin levels (Kalu et al 1983; Lore et al
1984; Tiegs et al 1986; Kalu et al 1988; Lu et al 1998). The rise in serum calcitonin
was positively correlated with kidney CYP24 mRNA levels. This is the first report of
its kind to show a positive correlation between calcitonin and kidney CYP24. As
described earlier, the primary role for calcitonin is to lower serum calcium levels
during periods of hypercalcemia by inhibiting bone resorption. The positive
correlation between serum calcitonin and kidney CYP24 mRNA levels suggests that
calcitonin may also be able to regulate the catabolism of 1,25D, thereby reducing the
1,25D-mediated intestinal calcium absorption and consequently the serum calcium
levels. This is further supported by the fact that there is a negative correlation between
serum calcitonin and kidney CYP27B1 mRNA in this study. Further investigation into
the in vivo effects of calcitonin may reveal an important role for this hormone in
vitamin D metabolism.
117
In this study, kidney CYP24 mRNA levels positively correlated with kidney VDR
mRNA levels. Liganded VDR can directly regulate CYP24 gene expression by
binding to either of two distinct vitamin D response elements (VDRE), which are
located in the promoter region of the CYP24 gene (Ohyama et al 1994; Chen and
DeLuca 1995; Dwivedi et al 2000). A concomitant rise in VDR and CYP24 mRNA
levels has been previously described by Johnson et al (1995). They detected greater
levels of renal VDR and CYP24 mRNA and protein levels in 18-month-old female
Fischer 344 rats when compared to levels found in 6-month-old and younger rats.
Studies conducted under extreme physiological situations support the notion of a
dependency of CYP24 on VDR expression. In patients who suffer from vitamin D-
dependent rickets type II (VDDRII), which is characterised by a defective VDR, have
significantly reduced CYP24 enzyme activity levels (Tiosano et al 1998).
Furthermore, very high 1,25D levels were detected in VDR-knockout mice compared
to levels in wild-type animals, which was associated with undetectable levels of renal
CYP24 mRNA (Takeyama et al 1997).
4.4.3.3 Determinants of kidney VDR mRNA
While numerous in vitro and in vivo studies have shown a 1,25D-directed increase in
VDR mRNA in the kidney (Merke et al 1989; Strom et al 1989; Goff et al 1990;
Reinhardt and Horst 1990; Sandgren and DeLuca 1990; Santiso-Mere et al 1993;
Uhland-Smith and DeLuca 1993), there is no positive correlation detectable between
serum 1,25D and kidney VDR levels in the current study. In fact, there is a tendency
for a negative correlation between serum 1,25D and kidney VDR mRNA levels,
which is similar to the negative correlation found between serum 1,25D and CYP24
mRNA levels. This relationship becomes statistically significant when data from the
118
3-week-old animals are excluded (data not shown). Therefore, it appears that under
normal physiological circumstances, circulating 1,25D is not a direct determinant of
VDR mRNA expression in the kidney. Rather, the apparent dependence of CYP24
activity on VDR mRNA expression suggests that VDR is an indirect determinant of
the serum 1,25D levels via the regulation of CYP24 enzyme activity.
While changes in CYP27B1 and CYP24 mRNA expression result in a concomitant
change in enzyme activity, it is not clear whether the increase in VDR mRNA levels
with age actually results in an increased VDR protein levels. Strom et al (1989)
showed that 1,25D administration to vitamin D-deficient mice increased the VDR
mRNA levels by 10-fold but the total receptor protein levels only by 2-fold, and there
was no change in unoccupied VDR levels. It was suggested that the role of increased
in VDR mRNA levels was to maintain the constant levels of unoccupied receptor.
This concept was supported by Koszewski et al (1990) who could not detect any
difference in unoccupied VDR receptor levels between 1-month and 18-month-old
rats. Furthermore, Wiese et al (1992) found in rat fibroblast and intestinal epithelial
cells that 1,25D treatment did not increase VDR mRNA levels but did increase the
stability of the VDR protein. The study by Wiese et al was confirmed by several other
studies, which showed in intestinal, kidney and bone cells, that the mechanism of the
1,25D-mediated VDR up-regulation was due to an increase in the stability of the
occupied VDR, rather than to an increase in VDR mRNA expression (Costa and
Feldman 1987; Arbour et al 1993; Santiso-Mere et al 1993). It is therefore possible,
that the increase in VDR mRNA levels in adulthood found in the current study does
not reflect an increase in VDR protein levels, but rather reflects a greater turnover of
the less-stable unoccupied VDR, due to lower circulating 1,25D levels. An
119
investigation, however, of the total and unoccupied levels of VDR would be required
to substantiate this concept.
4.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA
4.4.4.1 Determinants of bone CYP27B1
The effects of age on vitamin D metabolism in bone tissue remain largely unknown.
In rats ranging in age from 3 to 15 weeks, the expression of CYP27B1 mRNA in the
bone is 4 to 5-fold higher when compared to the expression found in rats of 26 weeks
of age and older. This is the first report to demonstrate a relationship between bone
CYP27B1 mRNA expression levels and age. The detection of a higher expression of
bone CYP27B1 mRNA during the period of rapid growth, implicates a role for locally
produced 1,25D in bone growth and in the development of mineralised bone. The
possible involvement of local CYP27B1 activity in bone development is supported by
the positive correlation found between serum calcium and bone CYP27B1 mRNA
levels, which suggests that a rise in extracellular calcium may stimulate the expression
of bone CYP27B1 mRNA. Such a relationship between serum calcium and bone
CYP27B1 mRNA levels is possible considering the fact that 1,25D has been shown to
increase intracellular calcium levels and mineralisation of osteoblasts in vitro (Jenis et
al 1993; Shalhoub et al 1998). Bone CYP27B1 mRNA and serum 1,25D levels do not
correlate, which suggests that locally synthesised 1,25D serves an autocrine or
paracrine role and supports the hypothesis that locally produced 1,25D plays a role in
the growth and development of normal mineralised bone. Such a mechanism would
have particular physiological importance and would be worth further investigation.
Serum PTH levels were inversely correlated with bone CYP27B1 mRNA levels. This
suggests that the local production of 1,25D in the bone does not respond to PTH or
120
may even be suppressed by PTH. This is not the first report of a tissue-specific effect
of PTH on the regulation of CYP27B1 in a non-renal tissue, which is different from
that in the kidney. For example, PTH is unable to affect CYP27B1 enzyme activity in
pulmonary alveolar macrophages (Reichel et al 1987(a)). Interestingly, Reichel and
co-workers (1987(d)) also showed that both pulmonary alveolar macrophages and
bone marrow macrophages respond to interferon-γ by up-regulating the production of
1,25D. Hence, it is possible that PTH is also unable to stimulate CYP27B1 activity in
bone marrow macrophages. In the current study, the total RNA extracted from the
femora included the bone marrow. The lack of PTH-mediated stimulation of
CYP27B1 expression in the bone may, therefore, be partly explained by the presence
of bone marrow macrophage and macrophage-like cells in the tissue collected. The
investigation of the regulation of CYP27B1 activity in bone marrow macrophages and
other bone cells by PTH may provide evidence for a differential regulation of
CYP27B1 activity between the kidney and the bone. An examination of the bone cells
that express CYP27B1 mRNA is described in Chapter 6.
4.4.4.2 Determinants of bone CYP24
Of considerable interest is the strong positive correlation found between bone
CYP27B1 mRNA and bone CYP24 mRNA levels throughout the age range
examined. This is the first report of co-expression of the synthetic and catabolic
enzymes in an in vivo system. The co-expression of bone CYP27B1 and CYP24 is
supported by the study of Reichel et al (1987(d)), who showed that the addition of
25D to bone marrow macrophage cells caused an increase in CYP27B1 enzyme
activity and consequent rise in CYP24 enzyme activity. The increase in CYP24
activity was suggested to be due to the increase in intracellular production of 1,25D,
which suggests that CYP24 activity is responsive to locally produced 1,25D.
121
Furthermore, there was no correlation found between bone CYP24 mRNA and serum
1,25D levels, indicating that bone CYP24 mRNA expression is responsive to the
locally produced 1,25D rather than to the circulating 1,25D levels. The implication of
this observation is that the local synthesis of 1,25D in the bone plays a significant role
in autocrine or paracrine signalling and that CYP24 modulates the response to 1,25D
by catabolising 1,25D.
Bone CYP24 mRNA was negatively correlated with serum PTH levels. Although it is
well established that PTH suppresses the kidney CYP24 activity (Henry 1992; Henry
et al 1992; Shinki et al 1992), this is the first study to demonstrate this relationship
between serum PTH and bone CYP24 mRNA. Nishimura et al (1994), however,
showed that in osteoblast like cells, bone CYP24 mRNA expression was unaltered by
administration of PTH. The mechanism by which PTH down-regulates the bone
CYP24 mRNA is unclear. The divergence between results from Nishimura’s study
and the current study may be to be due to a tissue- and/or cell-specific effect of PTH
on CYP24 expression, which has been detected in previous studies. Yang et al, for
example, (1999) showed a cAMP-mediated suppression of CYP24 mRNA in renal
proximal tubule cells and a stimulation in renal distal tubule cells.
4.4.4.3 Determinants of bone VDR
Bone VDR mRNA levels fall with age. The levels are highest at 3 weeks of age and
plateau at 15 weeks of age. This is consistent with Horst et al (1990), who
demonstrated a reduction in unoccupied VDR levels in bones of 18-month-old rats
when compared to VDR levels in 1-month-old rats. When analysed by multiple linear
regression, however, bone VDR mRNA is positively correlated with serum 1,25D
levels and not with age. This is supported by other studies that have shown an
122
increase in VDR levels in osteoblast-like cell lines in response to 1,25D treatment
(Dokoh et al 1984; Pols et al 1988). The suggestion that circulating 1,25D levels
dictating the responsiveness of bone cells to 1,25D, is supported by previous studies
in osteoblast-like cell systems (Dokoh et al 1984; Chen et al 1986(a); Chen et al
1986(b); Staal et al 1997). Chen et al (1986(b)) showed, however, that sensitivity and
magnitude of the responses to 1,25D in cultured osteoblast-like cells, was specifically
dependent on the osteoblast numbers. Dokoh et al (1984) found a correlation between
serum 1,25D levels and the respective number of VDR molecules per cell in a
cultured osteosarcoma cell-line. Thus, the VDR mRNA reduction with age could be a
function either of decreased osteoblast numbers or decreased VDR levels in each bone
cell.
Supporting the suggestion of the relationship between 1,25D-mediated osteoblast
function and VDR levels, is the fact that the number of functional osteoblasts has been
shown to decrease with age (Bouillon et al 1995; Parfitt et al 1997). Therefore, the
reduction of VDR mRNA levels detected in the current study may reflect the reduced
functional capacity of osteoblasts. A relationship between serum 1,25D levels, bone
VDR levels and osteoblastic function may have some important physiological effects
during aging and on the vitamin D endocrine system, and therefore warrants further
investigation. While other bone cells have been shown to express VDR, including
bone marrow-derived monocytes, macrophages and T lymphocytes (Lemire et al
1984; Lemire et al 1985; Clemens et al 1988; Lemire and Archer 1991; Abu-Amer
and Bar-Shavit 1994; Gruber et al 1999), the effects of age on VDR mRNA
expression in these cells is unknown.
123
4.4.5 Comparisons of kidney and bone vitamin D endocrine systems
This study demonstrated that both kidney and bone tissue express mRNA for
CYP27B1, CYP24 and VDR. The regulation of the expression of these genes during
aging is, however, considerably different between the kidney and bone. In the kidney,
the inverse relationship between CYP27B1 and CYP24 mRNA suggests that the
primary role of the kidney is to control the circulating levels of 1,25D. In the bone,
however, the co-expression of CYP27B1 and CYP24 suggests that locally produced
1,25D is involved in autocrine or paracrine signalling. The positive correlation
between bone CYP24 and bone CYP27B1 suggests that, under normal physiological
conditions, it is the locally produced 1,25D that induces CYP24 in the bone, rather
than circulating 1,25D levels. This is, however, is in opposition to the current
paradigm of the vitamin D endocrine system, in which extra-renal CYP24 exclusively
deactivates circulating 1,25D to moderate the 1,25D-mediated action.
The regulation of bone CYP27B1 mRNA expression is considerably different from
that of kidney CYP27B1 mRNA expression. Kidney CYP27B1 mRNA levels were
not correlated with serum PTH levels. Interestingly, however, bone CYP27B1 mRNA
levels were negatively correlated with serum PTH levels. While the lack of correlation
between serum PTH and kidney CYP27B1 mRNA levels may be explained by the
possibility that PTH regulates kidney CYP27B1 mRNA expression only during
periods of hypocalcaemia, the potential for serum PTH-mediated inhibition of
CYP27B1 mRNA expression in the bone is worthy of further investigation.
Furthermore, defining the regulation of bone CYP27B1 mRNA by PTH may help to
124
resolve the different physiological role for 1,25D synthesis between the kidney and
bone.
Although this is the first report of the differential regulation of kidney and bone
vitamin D metabolism, it is not the first report of a difference in regulation of the
vitamin D metabolism between renal and non-renal tissues. For example, CYP27B1
activity in activated macrophages, unlike in kidney cells, is not inhibited by 1,25D or
extracellular calcium. This is suggested to be the basis for the uncontrolled CYP27B1
activity associated with sarcoidosis and other granulomatoses (Barbour et al 1981;
Adams and Hamilton 1984; Adams and Gacad 1985; Reichel et al 1987(a); Reichel et
al 1987(b); Reichel et al 1987(d); Papapoulos et al 1988; Dusso et al 1997). CYP24
mRNA expression has been shown to be regulated differently between the kidney and
intestine. When rats were challenged acutely with 1,25D, following a chronic
exposure to 1,25D, the kidney CYP24 mRNA levels were unaltered, while the
intestinal CYP24 mRNA levels were markedly induced (Demers et al 1997). This was
suggested to be due to the fact that CYP24 has different physiological roles in the
kidney and the intestine. In the intestine, CYP24 was induced to prevent the over-
stimulation of 1,25D-mediated calcium absorption, whereas CYP24 was not induced
in the kidney, possibly because 1,25D does not adversely stimulate 1,25D-mediated
processes in this tissue. Similarly, the differences between kidney and bone CYP24
mRNA expression can be attributed to the role of CYP24 in each tissue.
While during periods of normocalcemia PTH does not appear to regulate kidney
CYP27B1 mRNA expression, calcitonin, on the other hand, is negatively correlated
with kidney CYP27B1 mRNA and positively correlated with CYP24 mRNA levels.
125
This suggests that the role for calcitonin in reducing serum calcium levels may extend
to regulating serum 1,25D levels. While the precise role of calcitonin in regulation of
the renal vitamin D metabolism is unclear, the lack of correlation between calcitonin
and bone CYP27B1 or CYP24 mRNA levels suggests that calcitonin is more likely to
be involved in the regulation of circulating levels of 1,25D, than in the local
production of 1,25D in the bone.
A striking difference between vitamin D metabolism in kidney and bone was found
when studying the expression of VDR mRNA. The expression of VDR mRNA in the
kidney rises with age, whereas bone VDR mRNA levels fall with age. The difference
in VDR mRNA expression between bone and kidney may be due to a difference in the
need for vitamin D-responsiveness in these tissues with age. Assuming for the
moment that an increase in VDR mRNA expression results in an increase in VDR
protein levels, kidney VDR levels then increase in parallel with the age-related
increase in CYP24 levels, which is consistent with previous studies (Johnson et al
1995; Armbrecht et al 1998; Yang et al 2001). In the bone, however, there is no
correlation between CYP24 mRNA and VDR mRNA levels. The reason for this
difference in the association between CYP24 and VDR found between the kidney and
bone is unknown. Bone VDR levels, however, correlate with serum 1,25D levels,
suggesting that the vitamin D-responsiveness of bone tissue is dependent on the
circulating 1,25D levels. Bone CYP24 mRNA, on the other hand, responds to locally
synthesised 1,25D, rather than to circulating 1,25D. The uncoupling of the association
between CYP24 and VDR is therefore likely to be due to the different mechanisms
controlling bone CYP24 and VDR mRNA expression. Given that the VDR is required
for CYP24 expression mRNA in bone, the VDR levels present in the bone cell must
126
be sufficient to induce the CYP24-mediated catabolism of locally produced 1,25D,
and therefore further stimulation of VDR mRNA expression is not required.
4.4.6 Summary
In summary, this study demonstrated that both kidney and bone tissue express mRNA
for CYP27B1, CYP24 and VDR. In the kidney, CYP27B1 and CYP24 primarily
control the circulating levels of 1,25D, which in turn contribute to the stringent
regulation of serum calcium levels. While PTH was not correlated with kidney
CYP27B1, the association found between calcitonin and kidney CYP27B1 and
CYP24 mRNA during normocalcemia points to a new role for calcitonin in the
regulation of circulating 1,25D levels. The coupling of CYP27B1 and CYP24 mRNA
expression in the bone was in contrast with the inverse relationship found in the
kidney. Taken together with the lack of correlation between circulating 1,25D levels
and bone CYP24 mRNA, this suggests that, under normal physiological conditions,
the locally produced 1,25D plays a significant role in autocrine or paracrine signalling
of 1,25D-medaited bone cell events. In contrast, bone VDR mRNA expression is
associated with serum 1,25D and therefore the renal production of 1,25D, suggesting
that the vitamin D-responsiveness of bone is dependant on circulating 1,25D levels,
rather than locally produced 1,25D. However, an investigation into the unoccupied
VDR levels in these bones would be required to confirm the relationship of serum
1,25D levels and vitamin D-responsiveness of the bone. The decline in CYP27B1
expression in bone in adulthood has not been previously described and may be an
important factor in the reduction of bone formation found with age. The positive
correlation between bone CYP27B1 mRNA and serum calcium levels suggests locally
produced 1,25D may be involved in the mineralisation process. However, 1,25D
produced in the bone may also be associated with the differentiation and the
maturation of a number of vitamin D-responsive bone cells.
127
Chapter 5: The Effect of Dietary Calcium and Vitamin
D on CYP27B1, CYP24 and VDR mRNA Expression
5.1 Introduction
The investigation of the in vivo regulation of CYP27B1 and CYP24 activity has
proved difficult due to the tight control of vitamin D activity under normal
physiological conditions. Although a number of non-renal tissues have been shown to
synthesise 1,25D, so far most studies have focussed on the control of the CYP27B1
gene expression in the kidney. It has been known for more than two decades that bone
cells contain CYP27B1 (Howard et al 1981) and CYP24 activity, however, little is
known about the regulation of CYP27B1 mRNA expression and enzyme activity in
the bone and the relationship between CYP27B1 and CYP24 in this tissue.
By varying the content of calcium and vitamin D in the diet, a number of biochemical
and physiological changes are triggered in humans and animals. Intestinal calcium
absorption, renal calcium reabsorption and bone calcium metabolism are all regulated
by several hormones in an effort to maintain normocalcemia during these dietary
challenges. The vitamin D-endocrine system is central to the regulation of serum
calcium levels, which also involves a number of biochemical factors, such as PTH and
calcitonin. In response to hypocalcemia, PTH potently up-regulates kidney CYP27B1
mRNA expression (Booth et al 1985) and down-regulates both kidney CYP24 and
VDR mRNA expression (Matsumoto et al 1985; Shigematsu et al 1986; Reinhardt &
Horst 1990; Shinki et al 1992; Armbrecht et al 1998; Zierold et al 2000). In response
to hypercalcemia, the primary action of calcitonin is to reduce calcium resorption in
128
the bone (Ikegame et al 1996). While the role of calcitonin in regulating vitamin D
metabolism is controversial, there is some evidence, which suggests that this hormone
is involved in the regulation of CYP27B1 activity in the kidney (Shinki et al 1999)
and CYP24 in non-renal tissues (Beckman et al 1994).
Despite the advanced understanding of the regulation of the vitamin D synthesis in the
kidney, the regulation of the activity of the enzymes involved in vitamin D
metabolism in the bone is still unclear. Numerous studies have investigated the
regulation of CYP24 mRNA expression and enzyme activity in bone cell culture
experiments, but little work has been done on the regulation of CYP27B1 mRNA
expression in the bone. This study is the first to describe the regulation of CYP27B1,
CYP24 and VDR by dietary calcium and vitamin D in kidney and bone tissue and
compare the regulation of vitamin D metabolism between these two tissues. The
measurement of several non-fasting serum markers of the vitamin D endocrine system
is helpful in the identification of the regulation of CYP27B1, CYP24 and VDR
mRNA expression in kidney and bone tissue.
5.2 Protocol
5.2.1 Experimental procedure
20 Sprague-Dawley female rats were allocated to either vitamin D-replete or vitamin
D-deplete dietary treatment groups. Vitamin D-deplete animals were bred from
mothers fed a vitamin D-deficient diet and housed in a UV-free environment. The
vitamin D-replete animals were exposed to normal fluorescent tube lighting. All
animals were housed in a 12-hour light/dark cycle (Chapter 2.3). 10 vitamin D-replete
(D(+)) animals were maintained on a standard 1% calcium semisynthetic diet
129
(Chapter 2.3.1.1) and 10 vitamin D-deplete (D(-)) animals were maintained on a 1%
calcium semisynthetic diet deficient in vitamin D (Chapter 2.3.1.1). All animals were
maintained on their assigned diets until 6 months of age. At 6 months of age, 5 rats
from both the D(+) and D(-) groups were transferred to a 0.1% calcium semi-synthetic
diet, containing vitamin D for the D(+) animals and no vitamin D for the D(-) group.
All animals were fed the assigned diets for a further 3 months. A representation of the
4 dietary treatment groups with an abbreviation for each group name is shown in
Table 5.1. All rats were fed water ad libitum through the duration of the experiment.
All animals were sacrificed at 9 months of age as described in Chapter 2.5.3.1.
Table 5.1 Allocation of animals into the dietary treatment groups at 6 months of age.
5.2.2 Biochemical analysis
Blood samples were collected at time of death as described in Chapter 2.3.2. Blood
serum levels of calcium (Chapter 2.4.1), phosphate (Chapter 2.4.1), 1,25D (Chapter
2.4.2), 25D (Chapter 2.4.3), PTH (Chapter 2.4.4) and calcitonin (Chapter 2.4.5) were
determined.
Vitamin D-deficient
Vitamin D-replete
0. 1 % Calcium1 % Calcium
D(+) / LC(n = 5)
D(+) / HC(n = 5)
D(-) / LC(n = 5)
D(-) / HC(n = 5)
Vitamin D-deficient
Vitamin D-replete
0. 1 % Calcium1 % Calcium
D(+) / LC(n = 5)
D(+) / HC(n = 5)
D(-) / LC(n = 5)
D(-) / HC(n = 5)
130
5.2.3 Bone histomorphometry
5.2.3.1 Bone fixation, cutting and resin embedding
Rat femora were removed from animals and defleshed before being placed in neutral
buffered formalin at 4°C for 4 hours. Femora were then cut transversely, using a slow
speed saw (Beuhler, Ltd, Lake Bluff, USA) equipped with a diamond tipped blade
(van Moppes, Gloucester, UK), to expose the epiphyseal and metaphyseal regions.
All embedding protocols were derived from standard laboratory techniques (Moore,
1996). Samples were dehydrated in graded acetone (70%, 95%, 2 x 100%) for 1 hour
each, then transferred into two changes of methylmethacrylate (MMA) and 8% w/v
K-Plast plasticiser (Medim, Giessen, Germany) each for 24 hours. 4mL of the final
embedding mixture containing MMA, 8% w/v plascticiser and 0.9% (w/v) K-Plast
initiator (Medim, Giessen, Germany) was poured into 25mL polypropylene tubes and
the bone samples immersed, cut surface down. The tubes were tightly capped and
transferred to a 37°C water bath for overnight polymerisation. All work was
performed in a fume hood and contact with skin was avoided, with samples
maintained at 4°C prior to polymerisation. The embedded samples were cut from the
tubes using a band saw and fixed to aluminium block holders (Bio-Rad, Sydney,
Australia) with epoxy glue (Selleys, Sydney, Australia).
5.2.3.2 Section Production
Following embedding, the samples were trimmed to expose the sample area by
removing and discarding 10µm sections with a motorised microtome (Jüng K,
Reichert, and Heidelberg, Germany). To expose the maximal epiphyseal and
metaphyseal area, the samples were trimmed to the midline of the femur. The exposed
131
sample area was then moistened with 50% ethanol and three consecutive 5µm
sections were cut and placed onto glass slides. Sections were flattened onto the slides
following immersion in a 30:70 mixture of ethylene glycol mono-ethyl ether (Merck,
Kilsyth, Australia) and 70% ethanol heated to 65-70°C. The section was then covered
with polyethylene plastic and cartridge paper, clamped and annealed to the slide
overnight in a 37°C oven. Prior to staining, MMA was removed by 2 x 5 minute
immersions in 100% acetone. Sections were then dehydrated in ethanol (2 x 100%),
cleared in xylene (2 x 100%) and mounted in xylene-based moutant Eukill (Kinder
GmbH and co., Freiburg, Germany).
5.2.3.3 Modified von Kossa method for identification of calcified tissue
Procedure for modified von Kossa staining was derived from previously published
protocol (Page 1977). Sections previously stored in tap water were washed twice with
distilled water and transferred to an aqueous solution of 0.1% silver nitrate and
exposed to UV light for 45 minutes. Sections were then washed in distilled water and
transferred to an aqueous solution of 2.5% sodium thiosulphate for 5 minutes.
Sections were rinsed in distilled water before mounting.
5.2.3.4 Von Kossa method for sites of calcium deposition with haematoxylin and eosin counterstain
Procedure for haematoxylin and eosin counterstaining was derived from a previously
published protocol (Page 1977). Following the final distilled water wash of the von
Kossa staining protocol (Chapter 5.2.3.3), sections were stained in Lillie Mayer’s
alum haematoxylin (Page 1977) for 10 minutes and washed in tap water for 1 minute.
The next step involved a combination differentiation in acid alcohol solution and
blueing in a saturated aqueous solution of lithium carbonate. The appropriate end-
point for this component was blue nuclei and basophilic cytoplasm over a colourless
132
background. Sections were then rinsed in running tap water for 30 seconds and
stained with a 1% aqueous eosin solution for 3 minutes. The appropriate end-point of
this component was pink osteoid, and strong staining of acidophilic cytoplasm, while
retaining cytoplasmic texture.
5.2.4 Messenger RNA analyses
Messenger RNA extraction, purification and quantification from rat kidney and bone
tissue are described in Chapter 2.5.3. First Strand cDNA synthesis from mRNA is
described in Chapter 2.5.4. The reaction temperature, reagent composition and
conditions for real-time RT-PCR are described in Chapter 2.6.2. Messenger RNA
analysis by ribonuclease protection assay is described in Chapter 2.7.
5.2.5 Data expression and statistical analysis
Two-way analysis of variance was performed on biochemical markers (Chapter
2.4.7.3). The effect of dietary treatment on CYP27B1, CYP24 and VDR mRNA
expression was determined using two-way analysis of variance (Chapter 2.4.7.3). The
data were further analysed using Tukey’s post hoc test (Chapter 2.4.7.4). Multi-linear
regression analysis was used to determine the relationship between mRNA levels of
target genes and between biochemical markers and mRNA levels (Chapter 2.4.7.5).
5.3 Results
5.3.1 Serum biochemistry
Serum levels of 25D, 1,25D, PTH, calcitonin, calcium and phosphate are shown in
Table 5.2. Data from only four animals from the D(+)/LC group can be presented
since one rat died of natural causes before the completion of the experiment.
133
5.3.1.1 Serum 25D
Serum 25D levels in the D(-) animals were approximately 14 nmol/L. These levels of
serum 25D are markedly reduced when compared to serum 25D levels in the D(+)
animals (p<0.001). A reduction in 25D levels was found in the D(+)/HC animals
when compared to levels in the D(+)/LC group (p<0.05).
5.3.1.2 Serum 1,25D
The serum 1,25D levels in the D(-)/LC animals were 33.8 ± 0.3 pmol/L, which was
higher than levels found in the D(-)/HC animals (p<0.05) but markedly reduced when
compared to levels in the D(+)/LC animals (p<0.05). The D(+)/LC animals showed
elevated 1,25D levels of 405 ± 50.2 pmol/L when compared to serum levels found in
the D(+)/HC group (p<0.05).
5.3.1.3 Serum calcium
The D(-)/LC animals were hypocalcaemic, and were significantly reduced when
compared to levels in the D(-)/HC animals and the D(+)/LC animals (p<0.05). The
serum calcium levels found in D(+)/LC animals, were significantly lower than those
found in D(+)/HC animals (p<0.05). Serum calcium levels were inversely correlated
with serum PTH levels (p<0.01). The coefficient of determination of this non-linear
relationship was 0.75. A positive correlation was found between serum calcium and
serum calcitonin levels (p<0.01). The coefficient of determination of this non-linear
relationship was 0.59.
5.3.1.4 Serum phosphate
Serum phosphate levels were significantly reduced in the D(-)/LC animals when
compared to the levels found in D(-)/HC animals and the D(+)/LC animals (p<0.05).
134
Both the D(-)/HC animals and the D(+)/LC animals showed elevated serum phosphate
levels when compared to the levels found in the D(+)/HC animals (p<0.05).
5.3.1.5 Serum PTH
The D(-)/LC animals showed markedly elevated PTH levels at 167.0 ± 28.8 pmol/L,
which were significantly higher than the levels found in the D(-)/HC animals and the
D(+)/LC animals (p<0.05). Both the D(-)/HC animals and the D(+)/LC animals
showed elevated serum PTH levels when compared to the levels found in the
D(+)/HC animals (p<0.05).
5.3.1.6 Serum calcitonin
The serum calcitonin levels were suppressed in the D(-) animals when compared to
the levels in the D(+) animal (p<0.01). The D(-)/LC animals had lower levels of
calcitonin when compared to the D(-)/HC animals (p<0.05). The D(+)/LC animals
also showed a significant reduction in the levels of serum calcitonin when compared
to the levels in the D(+)/HC animals (p<0.05).
135
Table 5.2 Serum biochemistry of 25D, 1,25D, calcium, phosphate, PTH and calcitonin
in animals from each dietary treatment group.
D(-) / LC D(-) / HC D(+) / LC D(+) / HC
25D (nmol/L) 14.0 ± 1.5* 14.3 ± 1.7† 134.3 ± 3.1 96.9 ± 7.2*
1,25D (pmol/L) 33.8 ± 0.3* 13.2 ± 2.9#† 405.8 ± 50.2 19.6 ± 3.9*
Calcium (mmol/L) 1.99 ± 0.12* 2.32 ± 0.03#† 2.48 ± 0.02 2.69 ± 0.05*
Phosphate (mmol/L) 1.14 ± 0.05* 1.62 ± 0.17#† 2.10 ± 0.2 0.97 ± 0.12*
PTH (pmol/L) 167.0 ± 28.8* 32.2 ± 3.1#† 23.5 ± 2.9 2.07 ± 0.7*
Calcitonin (pmol/L) 1.48 ± 0.23* 2.35 ± 0.71# 11.7 ± 4.7 87.9 ± 9.1*
Values are mean ± s.e.m. n = 5 except for vitamin D-replete/0.1% calcium where n
=4. *p<0.05 v D(+)/LC; # p<0.05 v D(-)/LC; † p<0.05 v 1% D(+)/HC. D(-)/LC,
vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium;
D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete fed 1%
calcium; 25D, 25-hydroxyvitamin D; 1,25D, 1,25-dihydrixyvitamin D3; PTH,
parathyroid hormone.
136
Figure 5.1 Relationship between serum calcium (mmol/L) and serum PTH levels
(pmol/L). The coefficient of determination (R2) is shown for the line-of-best-fit. PTH,
parathyroid hormone.
R2 = 0.75
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
Seru
m P
TH (p
mol
/L)
150
100
50
0
200
250
137
Figure 5.2 Relationship between serum calcium (mmol/L) and serum calcitonin levels
(pmol/L). The coefficient of determination (R2) is shown for the line-of-best-fit.
R2 = 0.59
Seru
m C
alci
toni
n (p
mol
/L) 120
100
80
60
40
20
140
0
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
R2 = 0.59
Seru
m C
alci
toni
n (p
mol
/L) 120
100
80
60
40
20
140
0
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
138
5.3.2 Bone histomorphometry
Rat femora bone sections, which are stained for mineral content, and representative of
each of the dietary treatment groups, is shown in Figure 5.3 (A). Of particular interest
were the femora removed from the D(-)/LC animals. These animals showed numerous
thin trabeculae in the metaphysis of the femur as well as a reduction of bone mineral
content in the epiphysis when compared to the D(-)/HC animals. These animals also
showed higher levels of osteoid adjacent to the thin trabeculae (Figure 5.3 (B)). When
animals were fed the 1% calcium diet, the D(-)/HC animals maintained a normal bone
mineral content and showed a reduction in osteoid content, despite the vitamin D-
depletion.
5.3.2.1 Relationship between serum calcium and BV/TV in the D(-) animals
The relationship between serum calcium levels and bone mineral volume in the
epiphyseal region (BV/TV) is shown in Figure 5.4. A strong positive correlation was
found between serum calcium levels and BV/TV in the epiphysis from the D(-)
animals (p<0.001). The coefficient of determination for the relationship was 0.82. No
such relationship was detected in the D(+) animals or when the data from all groups
were combined for analysis.
139
Figure 5.3 Representative bone histology from each rat treatment group. A: Sections
were stained for bone mineral by a modified von Kossa silver technique. B: Sections
were stained for bone cells by a Hemotoxin and Eosin technique.
D(+)/HC
D(+)/LC D(-)/LC
D(-)/HC
A B
D(+)/HCD(+)/HC
D(+)/LCD(+)/LC D(-)/LCD(-)/LC
D(-)/HCD(-)/HC
A B
140
Figure 5.4 Relationship between serum calcium levels (pmol/L) and BV/TV (%) in
the epiphysis of the D(-) animals. The coefficient of determination (R2) is shown for
the line-of-best-fit. BV/TV, bone volume/total volume; D(-), vitamin D-deplete.
Serum Calcium (mmol/L)
2.12.01.91.7 2.3 2.51.8 2.2 2.4
50
45
35
30
25
20
BV
/ TV
(%) 40
R2 = 0.82
Serum Calcium (mmol/L)
2.12.01.91.7 2.3 2.51.8 2.2 2.4
50
45
35
30
25
20
BV
/ TV
(%) 40
R2 = 0.82
141
5.3.3 Gene expression in the kidney
5.3.3.1 CYP27B1 mRNA
The effect of dietary calcium and vitamin D content on CYP27B1 mRNA copy
number in the kidney, are shown in Figure 5.5. In the kidney, CYP27B1 mRNA level
were markedly increased in the D(-)/LC animals and were 277-fold higher than those
found in the D(-)/HC animals (p<0.0001). The high expression of CYP27B1 mRNA
in the D(-)/LC animals, was confirmed by ribonuclease protection assay (Figure 5.26).
The CYP27B1 mRNA levels in the D(-)/HC animals, were not statistically different
from those found in the D(+)/HC animals. Although CYP27B1 mRNA levels were
lower in the D(+)/HC animals when compared to the levels in the D(+)/LC, this
difference did not achieve statistical significance. In the D(+) animals, there was a
positive trend between kidney CYP27B1 mRNA and serum 1,25D levels, which did
not reach statistical significance (p=0.07). CYP27B1 mRNA levels were not
associated with serum levels of calcium, phosphate, calcitonin or 1,25D in all animals.
5.3.3.2 Relationship between serum PTH and kidney CYP27B1 mRNA
levels
Serum PTH levels were positively correlated with kidney CYP27B1 mRNA copy
numbers (p<0.0001) (Figure 5.6). The coefficient of determination for this
relationship was 0.78. The marked elevated serum PTH levels in the D(-)/LC animals
corresponded to a markedly increased CYP27B1 mRNA. When the regression
analysis excluded these hypocalcaemic animals, no relationship was found between
serum PTH and CYP27B1 mRNA levels in the kidney.
142
Figure 5.5 Expression of kidney CYP27B1 mRNA (copy numbers/µg total RNA) in
each dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where
n = 4). *p<0.05 v 1% D(-)/HC & D(+)/LC. D(+)/LC, vitamin D-replete fed 0.1%
calcium; D(+)/HC, vitamin D-replete fed 1% calcium; D(-)/LC, vitamin D-deplete fed
0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP27B1, 25-
hydroxyvitamin D-1α-hydroxylase.
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
5
10
600
800
1000
Dietary Treatment Group
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
2.5
7.5
12.5
700
900*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
5
10
600
800
1000
Dietary Treatment Group
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
05 )/ µ
g to
tal R
NA
2.5
7.5
12.5
700
900*
CYP
27B
1
143
Figure 5.6 Relationship between serum PTH (pmol/L) and CYP27B1 mRNA levels
(copy numbers/µg total RNA) in the kidney. The coefficient of determination (R2) is
shown for the line-of-best-fit. PTH, parathyroid hormone; CYP27B1, 25-
hydroxyvitamin D-1α-hydroxylase.
R2 = 0.78
Serum PTH (pmol/L)
150100500 200 250
2
4
8
6
0
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
07 )/ µ
g to
tal R
NA
10
12
14
18
R2 = 0.78
Serum PTH (pmol/L)
150100500 200 250
2
4
8
6
0
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
07 )/ µ
g to
tal R
NA
10
12
14
18
CYP
27B
1
144
5.3.3.3 CYP24 mRNA
The effects of dietary calcium and vitamin D content on CYP24 mRNA copy number
are shown in Figure 5.7. CYP24 mRNA levels in the D(-) animals were markedly
reduced when compared to the D(+) animals (p<0.001). The CYP24 mRNA levels in
the D(-)/LC animals were comparable to the D(-)/HC animals and were 8-fold lower
than levels in the (D+)/LC animals. The highest levels of CYP24 mRNA were
recorded in the D(+)/HC animals at 5.9 x105 ± 3.7 x104 copy numbers/µg total RNA,
which were 1.5-fold higher than levels in the D(+)/LC animals (p<0.01).
5.3.3.4 Relationship between serum 25D and kidney CYP24 mRNA levels
A negative correlation was found between serum 25D and CYP24 mRNA levels in
the kidney of D(+) animals (p<0.05) (Figure 5.8). The coefficient of determination of
this relationship was 0.64.
5.3.3.5 Relationship between serum 1,25D and kidney CYP24 mRNA levels
A negative correlation was found between serum 1,25D and CYP24 mRNA levels in
the kidneys of D(+) animals (p<0.05) (Figure 5.9). The coefficient of determination
for this relationship was 0.56. A negative correlation was also found between serum
1,25D and CYP24 mRNA levels in the kidneys of D(-) animals (p<0.05) (Figure
5.10). The coefficient of determination for this relationship was 0.45. No such
relationship was detected, however, when the data from all groups were combined for
analysis.
145
Figure 5.7 Expression of kidney CYP24 mRNA (copy numbers/µg total RNA) in each
dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where n =
4). *p<0.05 v D(+)/LC; # p<0.001 v D(+)/HC. D(+)/LC, vitamin D-replete fed 0.1%
calcium; D(+)/HC, vitamin D-replete fed 1% calcium; D(-)/LC, vitamin D-deplete fed
0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP24, 25-
hydroxyvitamin D-24-hydroxylase.
0
1
2
3
4
5
6
7
CYP
24 m
RN
A co
py n
umbe
r (x1
05 )/ µ
g to
tal R
NA
Dietary Treatment Group
#
*
*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
1
2
3
4
5
6
7
CYP
24 m
RN
A co
py n
umbe
r (x1
05 )/ µ
g to
tal R
NA
Dietary Treatment Group
#
*
*
0
1
2
3
4
5
6
7
CYP
24 m
RN
A co
py n
umbe
r (x1
05 )/ µ
g to
tal R
NA
Dietary Treatment Group
#
*
*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC
146
Figure 5.8 Relationship between serum 25D (nmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(+) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. 25D, 25-hydroxyvitamin D3;
CYP24, 25-hydroxyvitamin D-24-hydroxylase; D(+), vitamin-replete.
R2 = 0.64
Seru
m 2
5D (n
mol
/L) 120
100
80
60
40
20
01 2 430
CYP24 mRNA copy number (x105)/ µg total RNA
5 6 7 8
140
160
147
Figure 5.9 Relationship between serum 1,25D (pmol/L) and kidney CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(+) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. 1,25D, 1,25-dihydroxyvitamin D3;
CYP24, 25-hydroxyvitamin D-24-hydroxylase; D(+), vitamin-replete.
0
0
0
0
0
0
0
R2 = 0.56
Seru
m 1
,25D
(pm
ol/L
)
600
500
400
300
200
100
01 2 430
CYP24 mRNA copy number (x105)/ µg total RNA
5 6 7 80
0
0
0
0
0
0
R2 = 0.56
Seru
m 1
,25D
(pm
ol/L
)
600
500
400
300
200
100
01 2 430
CYP24 mRNA copy number (x105)/ µg total RNA
5 6 7 8
148
Figure 5.10 Relationship between serum 1,25D (pmol/L) and kidneys CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(-) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. 1,25D, 1,25-dihydroxyvitamin D3;
CYP24, 25-hydroxyvitamin D-24-hydroxylase; D(-), vitamin D-deplete.
R2 = 0.47
Seru
m 1
,25D
(pm
ol/L
)
30
25
20
15
10
5
02 4 860
CYP24 mRNA copy number (x105)/ µg total RNA
10 12 14 16 18
35
R2 = 0.47
Seru
m 1
,25D
(pm
ol/L
)
30
25
20
15
10
5
02 4 860
CYP24 mRNA copy number (x105)/ µg total RNA
10 12 14 16 18
35
149
5.3.3.6 Relationship between serum calcium and kidney CYP24 mRNA levels
A positive correlation was found between serum calcium and CYP24 mRNA levels in
the kidney (p<0.0001) (Figure 5.11). The coefficient of determination for this
relationship was 0.63.
5.3.3.7 Relationship between serum PTH and kidney CYP24 mRNA levels
A negative correlation was found between serum PTH and CYP24 mRNA levels in
the kidney (p<0.01) (Figure 5.12). The coefficient of determination for this
relationship was 0.55.
5.3.3.8 Relationship between serum calcitonin and kidney CYP24 mRNA
A positive correlation was found between serum calcitonin and CYP24 mRNA levels
in the kidney (p<0.0001) (Figure 5.13). The strong logarithmic relationship had a
coefficient of determination of 0.81. In a multiple linear regression, which included
serum calcitonin, calcium and PTH levels, calcitonin was the only significant
determinant of CYP24 mRNA expression levels (p<0.01) (Table 5.3).
5.3.3.9 Kidney VDR mRNA
The effects of dietary calcium and vitamin D content on the expression of VDR
mRNA in the kidney are shown in Figure 5.14. While there was a an increase in VDR
mRNA expression in the 1% calcium fed D(+) and D(-) animals, this rise did not
achieve statistical significance.
150
Figure 5.11 Relationship between serum calcium (mmol/L) and CYP24 mRNA levels
(copy numbers/µg total RNA) in the kidney. The coefficient of determination (R2) is
shown for the line-of-best-fit. CYP24, 25-hydroxyvitamin D-24-hydroxylase.
R2 = 0.63
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
CYP
24 m
RN
A co
py n
umbe
r (x1
05 )/ µ
g to
tal R
NA
1
2
4
3
0
5
6
7
8R2 = 0.63
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
CYP
24 m
RN
A co
py n
umbe
r (x1
05 )/ µ
g to
tal R
NA
1
2
4
3
0
5
6
7
8
151
Figure 5.12 Relationship between serum PTH (pmol/L) and CYP24 mRNA levels
(copy numbers/µg total RNA) in the kidney. The coefficient of determination (R2) is
shown for the line-of-best-fit. PTH, parathyroid hormone; CYP24, 25-hydroxyvitamin
D-24-hydroxylase.
R2 = 0.55
Serum PTH (pmol/L)
150100500 200 250
12
10
8
6
4
2
0
CYP
24 m
RN
A c
opy
num
ber (
x105 )
/ µg
tota
l RN
A
R2 = 0.55
Serum PTH (pmol/L)
150100500 200 250
12
10
8
6
4
2
0
CYP
24 m
RN
A c
opy
num
ber (
x105 )
/ µg
tota
l RN
A
152
Figure 5.13 Relationship between serum calcitonin (pmol/L) and CYP24 mRNA
levels (copy numbers/µg total RNA) in the kidney. The coefficient of determination
(R2) is shown for the line-of-best-fit. CYP24, 25-hydroxyvitamin D-24-hydroxylase.
R2 = 0.81
Serum Calcitonin (pmol/L)
12010080604020 1400
1
2
4
3
0
CYP2
4 m
RN
A c
opy
num
ber (
x105 )
/ µg
tota
l RN
A
5
6
7
8
R2 = 0.81
Serum Calcitonin (pmol/L)
12010080604020 1400
1
2
4
3
0
CYP2
4 m
RN
A c
opy
num
ber (
x105 )
/ µg
tota
l RN
A
5
6
7
8
153
Table 5.3 Single and multiple linear regression equations for serum calcium, serum
PTH and serum calcitonin as determinants of kidney CYP24 mRNA levels.
Independent Variable Equation R2 P value
Serum Calcium CYP24 = 6.55x105 Calcium - 1.29 x106 0.57 2.0x10-4
Serum PTH CYP24 = -241.45 PTH + 3.89x105 0.39 4.2x10-3
Serum Calcitonin CYP24 = 5.28x103 Calcitonin + 1.23 x105 0.68 1.2x10-5
Serum Calcium CYP24 = + 2.37x105 Calcium NS
+ Serum PTH - 47.5 PTH NS
+ Serum Calcitonin + 3.75x103 Calcitonin - 3.71x105 0.002
Multiple R2 = 0.88
CYP24, 25-hydroxyvitamin D-24-hydroxylase; PTH, parathyroid hormone. (n = 19)
154
Figure 5.14 Expression of kidney VDR mRNA (copy numbers/µg total RNA) in each
dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where n =
4). D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete fed 1%
calcium; D(-)/LC, vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-deplete
fed 1% calcium; VDR, vitamin D receptor.
0
1
2
3
4
5
6
VDR
mR
NA
copy
num
ber (
x107 )
/ µg
tota
l RN
A
Dietary Treatment Group
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
1
2
3
4
5
6
VDR
mR
NA
copy
num
ber (
x107 )
/ µg
tota
l RN
A
Dietary Treatment Group
D(+) / LC D(+) / HC D(-) / LC D(-) / HC
155
5.3.4 Gene expression in the bone
5.3.4.1 CYP27B1 mRNA
The effects of dietary calcium and vitamin D content on the expression of CYP27B1
mRNA in bone are shown in Figure 5.15. The CYP27B1 mRNA levels in bone were
highest in the 1% calcium fed D(+) and D(-) animals. Levels in these groups were
approximately 4-fold higher than those found in the 0.1% calcium fed D(+) and D(-)
animals (p<0.05). The CYP27B1 mRNA levels in the bone for each of the dietary
treatment groups were confirmed qualitatively by ribonuclease protection assay
(Figure 5.26).
5.3.4.2 Relationship between serum calcitonin and bone CYP27B1 mRNA
levels in D(+) animals
A positive relationship was detected between serum calcitonin and bone CYP27B1
mRNA levels in the D(+) animals (p<0.05) (Figure 5.16). The coefficient of
determination for the relationship was 0.65. No such relationship was detected in the
D(-) animals or when the data from all groups were combined for analysis.
5.3.4.3 Relationship between serum PTH and bone CYP27B1 mRNA levels
in D(-) animals
A negative relationship was found between serum PTH and bone CYP27B1 mRNA
levels in the D(-) animals (p<0.05) (Figure 5.17). The coefficient of determination for
the relationship was 0.76. No such relationship was detected in the D(+) animals. A
negative correlation was, however, detected when data from all four dietary treatment
groups were included in the analysis. The coefficient of determination for this
relationship was 0.28 (p<0.05) (data not shown).
156
Figure 5.15 Expression of bone CYP27B1 mRNA (copy numbers/µg total RNA) in
each dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where
n = 4). *p<0.05 v D(+)/LC; # p<0.01 v D(-)/LC. D(+)/LC, vitamin D-replete fed 0.1%
calcium; D(+)/HC, vitamin D-replete fed 1% calcium; D(-)/LC, vitamin D-deplete fed
0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP27B1, 25-
hydroxyvitamin D-1α-hydroxylase.
0
1
2
3
4
5
6
7
CYP
27b1
mR
NA
copy
num
ber (
x106 )
/ µg
tota
l RN
A
Dietary Treatment Group
#
*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
1
2
3
4
5
6
7
CYP
27b1
mR
NA
copy
num
ber (
x106 )
/ µg
tota
l RN
A
Dietary Treatment Group
#
*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC
CYP
27B
1
157
Figure 5.16 Relationship between serum calcitonin (pmol/L) and bone CYP27B1
mRNA levels (copy numbers/µg total RNA) in the D(+) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. CYP27B1, 25-hydroxyvitamin D-
1α-hydroxylase; D(+), vitamin D-replete.
Serum Calcitonin (pmol/L)
12010080604020 1400
R2 = 0.65
1
2
4
3
0
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
06 )/ µ
g to
tal R
NA
5
6
7
8
Serum Calcitonin (pmol/L)
12010080604020 1400
R2 = 0.65
1
2
4
3
0
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
06 )/ µ
g to
tal R
NA
5
6
7
8
CYP
27B
1
158
Figure 5.17 Relationship between serum PTH (pmol/L) and bone CYP27B1 mRNA
levels (copy numbers/µg total RNA) in the D(-) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. PTH, parathyroid hormone;
CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; D(-), vitamin D-deplete.
1
2
4
3
0
CYP
27b1
mR
NA
copy
num
ber (
x106 )
/ µg
tota
l RN
A
5
6
7
8
9
Serum PTH (pmol/L)
150100500 200 250
R2 = 0.76
1
2
4
3
0
CYP
27b1
mR
NA
copy
num
ber (
x106 )
/ µg
tota
l RN
A
5
6
7
8
9
Serum PTH (pmol/L)
150100500 200 250
R2 = 0.76
CYP
27B
1
159
5.3.4.4 Relationship between serum calcium and bone CYP27B1 mRNA levels in D(-) animals
A positive logarithmic relationship was detected between serum calcium and bone
CYP27B1 mRNA levels in D(-) animals (p<0.05) (Figure 5.17). The coefficient of
determination for the relationship was 0.69. No such relationship was detected in the
D(+) animals or when the data from all groups were combined for analysis.
5.3.4.5 Relationship between BV/TV and bone CYP27B1 mRNA in D(-) animals
A positive correlation was found between bone mineral volume (BV/TV) and bone
CYP27B1 mRNA levels in the epiphysis of the D(-) animals groups (p<0.01) (Figure
5.18). The coefficient of determination for the relationship was 0.63. No such
relationship was detected in the D(+) animals or when the data from all groups were
combined for analysis. In a multiple linear regression, which included serum calcium,
PTH, and bone CYP27B1 mRNA levels, only serum calcium was found to be a
significant determinant of epiphyseal BV/TV in the D(-) animals (p<0.01) (Table 5.4).
160
Figure 5.18 Relationship between serum calcium (mmol/L) and bone CYP27B1
mRNA levels (copy numbers/µg total RNA) in the D(-) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. CYP27B1, 25-hydroxyvitamin D-
1α-hydroxylase; D(-), vitamin D-deplete.
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5
1
2
4
3
0
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
06 )/ µ
g to
tal R
NA
5
6
7
8
9
R2 = 0.69
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5
1
2
4
3
0
CYP
27b1
mR
NA
cop
y nu
mbe
r (x1
06 )/ µ
g to
tal R
NA
5
6
7
8
9
R2 = 0.69
CYP
27B
1
161
Figure 5.19 Relationship between bone CYP27B1 mRNA levels (copy numbers/µg
total RNA) and BV/TV (%) in the epiphysis of the D(-) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. BV/TV, bone volume/total
volume; D(-), vitamin D-deplete.
50
45
35
30
25
20
BV
/ TV
(%) 40
1 2 430
CYP27b1 Copy Number (x106)/ µg Total RNA
5 6 7 8 9
R2 = 0.63
50
45
35
30
25
20
BV
/ TV
(%) 40
1 2 430
CYP27b1 Copy Number (x106)/ µg Total RNA
5 6 7 8 9
R2 = 0.63
CYP27B1
162
Table 5.4 Single and multiple linear regression equations for serum calcium, serum
PTH and bone CYP27B1 mRNA levels as determinants of epiphyseal BV/TV in the
D(-) animals.
Independent Variable Equation R2 P value
serum Calcium BV/TV = 31.2 Calcium - 33.5 x106 0.74 0.0013
serum PTH BV/TV = -0.08 PTH - 41.0 0.45 0.034
bone CYP27B1 BV/TV = 2.1x10-7 bone CYP27B1 + 28.2 0.46 0.032
serum Calcium BV/TV = + 28.3 Calcium 0.002
+ serum PTH - 0.03 PTH NS
+ bone CYP27B1 - 3.3x10-7 bone CYP27B1 - 23.4 NS
Multiple R2 = 0.78
CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; PTH, parathyroid hormone;
BV/TV, bone mineral volume. (n = 10)
163
5.3.4.6 Bone CYP24 mRNA
The effects of dietary calcium and vitamin D content on the expression of CYP24
mRNA in bone are shown in Figure 5.20. CYP24 mRNA copy number levels were
highest in the 1% calcium fed D(+) and D(-) animals. The CYP24 mRNA levels in the
D(-)/LC animals were 4-fold lower than levels in the D(-)/HC animals (p<0.05) and
were comparable to levels in the D(+)/LC animals. The CYP24 mRNA levels in
D(+)/LC animals were 3-fold higher than levels in the D(+)/HC animals (p<0.05). No
effect of vitamin D status on CYP24 mRNA levels was detected in the bone.
5.3.4.7 Relationship between bone CYP27B1 and bone CYP24 mRNA
levels
A positive linear relationship was detected between CYP27B1 and CYP24 mRNA
levels in the bone (p<0.0001) (Figure 5.21). The coefficient of determination for the
relationship was 0.85.
5.3.4.8 Relationship between serum PTH and bone CYP24 mRNA
A negative correlation was detected between serum PTH and bone CYP24 mRNA
levels in the D(-) animals (p<0.01) (Figure 5.22). The coefficient of determination for
the relationship was 0.78. No such relationship was detected in the D(+) animals or
when the data from all groups were combined for analysis.
5.3.4.9 Bone VDR mRNA
VDR mRNA levels were increased in the 0.1% calcium fed D(+) and D(-) animals,
however these differences did not achieve statistical significance between the VDR
mRNA levels found in the different dietary treatment groups (Figure 5.23).
164
Figure 5.20 Expression of bone CYP24 mRNA (copy numbers/µg total RNA) in each
dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where n =
4). * p<0.05 v D(+)/LC; # p<0.05 v D(-)/LC. D(+)/LC, vitamin D-replete fed 0.1%
calcium; D(+)/HC, vitamin D-replete fed 1% calcium; D(-)/LC, vitamin D-deplete fed
0.1% calcium; D(-)/HC, vitamin D-deplete fed 1% calcium; CYP24, 25-
hydroxyvitamin D-24-hydroxylase.
0
2
4
6
8
10
12
14
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
16
18
Dietary Treatment Group
#
*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
2
4
6
8
10
12
14
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
16
18
Dietary Treatment Group
#
*
D(+) / LC D(+) / HC D(-) / LC D(-) / HC
165
Figure 5.21 Relationship between bone CYP27B1 mRNA (copy numbers/µg total
RNA) and bone CYP24 mRNA (copy numbers/µg total RNA). The coefficient of
determination (R2) is shown for the line-of-best-fit. CYP27B1, 25-hydroxyvitamin D-
1α-hydroxylase; CYP24, 25-hydroxyvitamin D-24-hydroxylase.
R2 = 0.8525
20
15
10
5
0
CYP
24 m
RN
A co
py n
umbe
r (x1
04 )/ µ
g to
tal R
NA
1 2 430
CYP27b1 mRNA copy number (x106)/ µg total RNA
5 6 7 8 9
R2 = 0.8525
20
15
10
5
0
CYP
24 m
RN
A co
py n
umbe
r (x1
04 )/ µ
g to
tal R
NA
1 2 430
CYP27b1 mRNA copy number (x106)/ µg total RNA
5 6 7 8 9
CYP27B1
166
Figure 5.22 Relationship between serum PTH (pmol/L) and bone CYP24 mRNA
levels (copy numbers/µg total RNA) in the D(-) animals. The coefficient of
determination (R2) is shown for the line-of-best-fit. PTH, parathyroid hormone;
CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; D(-), vitamin D-deplete.
Serum PTH (pmol/L)
150100500 200 250
25
20
15
10
5
0
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
R2 = 0.78
Serum PTH (pmol/L)
150100500 200 250
25
20
15
10
5
0
CYP
24 m
RN
A c
opy
num
ber (
x104 )
/ µg
tota
l RN
A
R2 = 0.78
167
Figure 5.23 Expression of bone VDR mRNA (copy numbers/µg total RNA) in each
dietary treatment group. Values are mean ± s.e.m. (n = 5, except D(+)/LC where n =
4). D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete fed 1%
calcium; D(-)/LC, vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-deplete
fed 1% calcium; VDR, vitamin D receptor.
0
5
5
5
5
6
6
6
6
VDR
mR
NA
copy
num
ber (
x105 )
/ µg
tota
l RN
A
0
2
4
6
8
10
12
14
16
Dietary Treatment Group
D(+) / LC D(+) / HC D(-) / LC D(-) / HC0
5
5
5
5
6
6
6
6
VDR
mR
NA
copy
num
ber (
x105 )
/ µg
tota
l RN
A
0
2
4
6
8
10
12
14
16
Dietary Treatment Group
D(+) / LC D(+) / HC D(-) / LC D(-) / HC
168
5.3.4.10 Relationship between serum calcium and bone VDR mRNA levels
A negative relationship was found between serum calcium and bone VDR mRNA
levels when data from all treatment groups were combined (p<0.05) (Figure 5.24).
The coefficient of determination for the relationship is 0.28. This negative correlation
was also detected in the D(-) animals alone (p<0.05), which had a coefficient of
determination of 0.45 (data not shown). No such relationship was detected in the D(+)
animals alone. Thus the levels of VDR mRNA in the bone are increased in
hypocalcemic animals.
5.3.4.11 Relationship between serum PTH and bone VDR mRNA levels
A positive relationship was found between serum PTH levels and bone VDR mRNA
levels in the D(+) animals (Figure 5.25). The coefficient of determination for the
relationship was 0.56. No such relationship was detected in the D(-) animals or when
the data from all groups were combined for analysis.
5.3.5 Assessment of CYP27B1 mRNA levels in kidney and bone by
ribonuclease protection assay
The semi-quantitative analysis of CYP27B1 mRNA levels by ribonuclease protection
assay is shown in Figure 5.26. CYP27B1 and GAPDH mRNA were detected in both
kidney and bone total RNA, isolated from animals from each of the dietary treatment
groups (n = 3). In the kidney, CYP27B1 mRNA levels were highest in the D(-)/LC
animals. In the bone, CYP27B1 mRNA expression appeared higher in the D(+) and
D(-) animals fed the 1% calcium diets when compared to the D(+) and D(-) animals
fed the 0.1% calcium diets.
169
Figure 5.24 Relationship between serum calcium (mmol/L) and VDR mRNA levels
(copy numbers/µg total RNA) in the bone. The coefficient of determination (R2) is
shown for the line-of-best-fit. VDR, vitamin D receptor.
R2 = 0.37
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
VDR
mR
Na
copy
num
ber (
x106 )
/ µg
tota
l RN
A
1
2
4
3
0
5
6
R2 = 0.37
Serum Calcium (mmol/L)
2.11.91.71.5 2.3 2.5 2.7 2.9
VDR
mR
Na
copy
num
ber (
x106 )
/ µg
tota
l RN
A
1
2
4
3
0
5
6
170
Figure 5.25 Relationship between serum PTH (pmol/L) and bone VDR mRNA levels
(copy numbers/µg total RNA) in the D(+) animals. The coefficient of determination
(R2) is shown for the line-of-best-fit. VDR, vitamin D receptor; D(+), vitamin D-
replete.
Serum PTH (pmol/L)
151050 20 25 30 35
5
10
20
15
0
VDR
mR
NA
copy
num
ber (
x106 )
/ µg
tota
l RN
A
25
30
35
R2 = 0.56
Serum PTH (pmol/L)
151050 20 25 30 35
5
10
20
15
0
VDR
mR
NA
copy
num
ber (
x106 )
/ µg
tota
l RN
A
25
30
35
R2 = 0.56
171
Figure 5.26 Ribonuclea se protection assay for CYP27B1 mRNA detected in total
RNA isolated from kidney (A) and bone (B) tissue from each dietary treatment group
(n = 3). D(+)/LC, vitamin D-replete fed 0.1% calcium; D(+)/HC, vitamin D-replete
fed 1% calcium; D(-)/LC, vitamin D-deplete fed 0.1% calcium; D(-)/HC, vitamin D-
deplete fed 1% calcium; CYP27B1, 25-hydroxyvitamin D-1α-hydroxylase; GAPDH,
glyceraldehyde-3-phosphate dehydrogenase.
CYP27b1
GAPDH
D(+)/LC D(+)/HC D(-)/LC D(-)/HC
CYP27b1
GAPDH
D(+)/LC D(+)/HC D(-)/LC D(-)/HC
A
B
CYP27b1
GAPDH
D(+)/LC D(+)/HC D(-)/LC D(-)/HC
CYP27b1
GAPDH
D(+)/LC D(+)/HC D(-)/LC D(-)/HC
A
B
CYP27B1
CYP27B1
172
5.4 Discussion
5.4.1 Determinants of serum calcium levels
The negative correlation between serum calcium and serum PTH levels is consistent
with the physiological role of PTH to maintain of circulating serum calcium levels. In
response to hypocalcaemia, the parathyroid glands react rapidly to secrete PTH. PTH
then initiates a sequence of events, which involve 1,25D synthesis and 1,25D-
stimulated intestinal calcium absorption to normalise calcium concentrations in the
circulation.
Converse to the negative relationship between serum calcium and serum PTH levels,
serum calcium levels were positively correlated with serum calcitonin levels. In
response to hypercalcaemia, calcitonin is secreted from parafollicular cells of the
thyroid gland to lower serum calcium. The primary action of calcitonin is to inhibit
skeletal calcium resorption by suppressing osteoclastic activity, reducing of calcium
mobilisation into to the circulation and ultimately reduces the levels of serum calcium.
In a multiple linear regression analysis, both serum PTH and serum calcitonin
hormones contribute to the regulation of serum calcium levels, suggesting that there is
a complex regulatory mechanism of serum calcium levels, which involves PTH and
calcitonin during periods of hypocalcemia and hypercalcemia.
5.4.2 Determinants of serum 1,25D levels
The synthesis of 1,25D and catabolism of 25D and 1,25D in the kidney determines the
concentration of 1,25D in the circulation (Armbrecht & Boltz 1991; Armbrecht et al
1997(a); Eto et al 1998; Zehnder et al 1999). In the D(-) animals, the marked
reduction in 25D levels, from the vitamin D-deficient diet and housing in a UV-free
173
environment, was the primary reason for the reduced serum 1,25D levels. The
negative correlation between kidney CYP24 mRNA and serum 1,25D levels in the
D(-) animals, however, suggests that serum 1,25D levels are modulated by CYP24,
even when the vitamin D levels are depleted. Furthermore, a negative correlation
between serum 1,25D and kidney CYP24 mRNA was detected in D(+) animals. These
data are consistent with a model that when dietary calcium levels are high, obviating
the requirement for 1,25D-mediated intestinal calcium absorption, 1,25D levels are
reduced as a result of increased gene expression of kidney CYP24, which also has the
effect of reducing serum 25D levels.
While no statistically positive relationship was detected between kidney CYP27B1
mRNA and serum 1,25D levels, it is possible that modulation of the expression of
renal CYP27B1 mRNA in the D(+) animals plays a role in determining serum 1,25D
levels. In the D(+)/LC animals, CYP27B1 mRNA levels were slightly increased,
although not significantly (p= 0.07), when compared to the levels detected in the
D(+)/HC animals. This increase was associated with a marked increase in serum
1,25D levels. In a multiple linear regression analysis including both kidney CYP27B1
mRNA and kidney CYP24 mRNA levels, accounted for a greater proportion of the
variation in the serum 1,25D levels, than when the analysis was restricted to CYP24
mRNA levels alone. These data suggest that the regulation of both kidney CYP24 and
kidney CYP27B1 contribute to the regulation of serum 1,25D levels. CYP24
expression, however, appears to be a more important factor when dietary calcium
levels are varied between 0.1% and 1%, as studied in this experiment.
174
5.4.3 Renal expression of CYP27B1, CYP24 and VDR mRNA
5.4.3.1 Determinants of CYP27B1 mRNA levels
The biosynthesis of 1,25D by the renal CYP27B1 enzyme is required for the
stimulation of intestinal calcium absorption and renal calcium reabsorption.
Reflecting this role for 1,25D, the activity of CYP27B1 is tightly regulated by a
number of factors including calcium, phosphate, PTH, calcitonin and 1,25D itself. In a
multiple linear regression, however, which included all these factors, only PTH was
found to be a significant determinant of CYP27B1 mRNA levels in the kidney,
particularly as a result of the high PTH levels, which occurred in the hypocalcemic
D(−)/LC animals. These studies did not find that a significant relationship between
PTH and kidney CYP27B1 mRNA levels in animals that were normocalcemic.
Numerous studies have shown, both in in vitro and in vivo experiments, that PTH is a
most potent stimulator of renal CYP27B1 mRNA expression and enzyme activity
especially when pharmacological levels of PTH are used (Frolich et al 1990; Welsh et
al 1991; Brenza et al 1998; Murayama et al 1998; Murayama et al 1999; Yang et al
1999; Brenza and DeLuca 2000). It would appear, however, that the variation in
serum PTH levels between 2 and 30 pmol/L is not associated with significant
stimulation of kidney CYP27B1 mRNA in normocalcemic animals.
While it has been shown that exogenous administration of 1,25D to animals can
inhibit the in vivo expression of kidney CYP27B1 mRNA (Brenza and DeLuca 2000),
these data suggest that, under normal physiological circumstances, 1,25D is not a
major determinant of CYP27B1 mRNA expression in the kidney. Kidney CYP27B1
mRNA expression was not induced in D(-)/HC animals, despite a marked reduction in
serum 1,25D levels. This finding is in contrast with the study of Fox et al (1991) who
175
showed that renal cortical slices taken from vitamin D-deficient animals fed a 2%
calcium diet, showed a 17-fold increased CYP27B1 activity when compared with
activity detected in renal cortical slices taken from normal animals fed 0.8% calcium.
They concluded that absence of 1,25D-mediated enzyme inhibition is a strong
stimulus of CYP27B1 activity, which is independent of the effects of PTH, calcium
and phosphate. The discrepancy between the result reported here and those of Fox et
al are unclear. It is possible, however, that in the Fox et al study, an increase in 1,25D
levels detected in renal cortical slices of vitamin D-deficient animals fed 2% calcium,
may not be due to increased CYP27B1 activity, but instead to a reduced clearance of
1,25D as a result of decreased CYP24 activity.
The suppression of the CYP27B1 mRNA expression in the D(+)/HC animals by the
1% calcium diet, despite vitamin D-depletion, is consistent with previous studies,
using parathyroidectomised, PTH-replete rats. In these animals, it has been shown that
elevated calcium levels are able to directly inhibit circulating levels of 1,25D
(Matsumoto et al 1987; Weisinger et al 1989). Bland et al (1999) was also able to
show that in human proximal tubule cell line, HKC-8, a treatment with a medium
containing a high calcium level significantly inhibited 1,25D production. In this study,
calcium was suggested to directly affect CYP27B1 activity, through the calcium-
sensing receptor (CaR), which is present in all segments of the nephron. While no
correlation was found between serum calcium and kidney CYP27B1 mRNA levels in
the current study, it is possible that the normal serum calcium levels in the D(-)/HC
animals was able to directly inhibit CYP27B1 mRNA expression in the kidney.
176
5.4.3.2 Determinants of CYP24 mRNA levels
The catabolic enzyme CYP24 has been shown to be induced by 1,25D and suppressed
in the absence of 1,25D (Tanaka and DeLuca 1974; Tanaka et al 1975; Tanaka et al
1977; Kumar et al 1978). The negative correlations found between CYP24 mRNA
levels in the kidney and serum 1,25D levels indicate, however, that the expression of
CYP24 mRNA and therefore enzyme activity is a major determinant of serum 1,25D
levels. The expression of CYP24 mRNA is consistent with the biological role of
CYP24 in the deactivation of 1,25D and in the limitation of the biological effect of
1,25D. The positive correlation between serum calcium and the expression of CYP24
mRNA in the kidney suggest that a high calcium diet, which reduces the requirement
for 1,25D-mediated intestinal calcium, causes an increase in CYP24 activity to reduce
serum 1,25D levels.
The positive correlation between serum calcium and kidney CYP24 mRNA levels is
consistent with findings from Spanos et al (1981). They showed a significant
stimulation of CYP24 activity in isolated chick renal tubules, incubated in the
presence of a high calcium concentration. Previous studies have shown a direct
regulation of the renal vitamin D metabolism by calcium. This was, however,
suggested to be due to a calcium-mediated increase in CYP27B1 activity (Matsumoto
et al 1987; Weisinger et al 1989; Bland et al 1999). The positive correlation between
serum calcium and kidney CYP24 mRNA levels suggests that if calcium is directly
involved in the renal vitamin D metabolism, it acts through stimulation of vitamin D
breakdown, rather than of vitamin D synthesis.
177
The negative correlation between serum PTH and CYP24 mRNA levels is consistent
with findings from several researchers, which have shown that PTH suppresses
CYP24 activity (Tanaka et al 1975; Shigematsu et al 1986; Henry 1992; Henry et al
1992; Shinki et al 1992; Armbrecht et al 1998). The PTH-mediated suppression of the
CYP24 mRNA expression in the kidney occurs via the cAMP signal transduction
pathway (Shigematsu et al 1986; Shinki et al 1992; Zierold et al 2000). The precise
mechanism by which PTH down-regulates the CYP24 mRNA, however, remains
unclear. This is partly due to the tissue- and cell-specific effect of PTH on CYP24
mRNA expression. For example, while a PTH-mediated suppression of CYP24
transcription has been found in renal proximal tubule cells, the addition of 1,25D and
cAMP together in renal distal tubule cells acts synergistically to induced CYP24
mRNA expression (Yang et al 1999).
Of considerable interest is the strong positive relationship between serum calcitonin
and CYP24 mRNA levels. In a multiple linear regression including levels of serum
calcitonin, calcium and PTH, only calcitonin significantly contributed to the
regulation of CYP24 mRNA expression, which is consistent with the positive
relationship between CYP24 expression and serum calcitonin levels described in
Chapter 4. This, to our knowledge, is the first published report of the regulation of
kidney CYP24 mRNA by serum calcitonin. Recently, in vitro studies have shown that
calcitonin up-regulates CYP24 promoter activity in the human kidney cell line, AOK-
B50 (unpublished data, Gao and May). Thus, in addition to inhibiting bone resorption,
calcitonin may reduce the levels of serum calcium by reducing circulating 1,25D
levels, through the renal catabolism of 1,25D by CYP24. Further investigation of the
178
effects of calcitonin on kidney CYP24 mRNA expression would be required to
substantiate this theory.
5.4.3.3 Determinants of VDR mRNA levels
Although the expression of VDR mRNA appears to be regulated by dietary calcium
and vitamin D, no statistically significant relationship between these factors and the
expression levels of VDR mRNA could be detected in this study. Previous studies
have, however, shown regulation in VDR mRNA expression by 1,25D and calcium.
Zineb et al (1998) showed a reduction in rat kidney VDR mRNA during vitamin D-
deficiency. Goff et al (1990) showed a decrease in kidney VDR protein levels of 35%
in rats fed a 0.02% calcium diet when compared to protein levels from animals fed a
calcium-replete diet, even though serum 1,25D levels were increased in the calcium
restricted animals. These studies are consistent with the current study in that the
lowest expression level of VDR mRNA in the kidney was found in the D(-)/LC
animals. The reasons for the reduction in VDR mRNA levels, associated with low
levels of dietary calcium are unclear. Recently, however, Beckman and DeLuca
(2002) found that the down regulation of VDR protein levels in the kidney during
hypocalcemia blocks the 1,25D-mediated suppression of CYP27B1 gene expression,
and therefore allows for unabated renal production of 1,25D. Further investigation of
the regulation of VDR mRNA expression by dietary calcium and vitamin D, is needed
to understand the complex mechanisms that regulate of VDR mRNA expression in the
kidney.
179
5.4.4 Bone expression of CYP27B1, CYP24 and VDR mRNA
5.4.4.1 Determinants of CYP27B1 mRNA levels
This is the first report that describes the in vivo regulation of CYP27B1 mRNA
expression by dietary calcium in the bone. While, bone CYP27B1 mRNA levels were
4-fold higher in 1% calcium fed animals when compared to the levels in the 0.1%
calcium fed animals, the mechanisms that regulate CYP27B1 mRNA in the bone
appear to be more complex than simply the effect of dietary calcium load. The change
in dietary calcium and vitamin D levels between the animal treatment groups have
profound effects on the concentrations of serum calcium, 1,25D, PTH and calcitonin,
and it appears that these factors interact to regulate the expression of bone CYP27B1
mRNA.
In the D(-) animals, a negative correlation was detected between serum PTH and bone
CYP27B1 mRNA levels, which is suggestive of an inhibitory role of PTH in the
regulation of bone CYP27B1 mRNA expression. This is in direct contrast with the
well-described, potent stimulatory effect of PTH on kidney CYP27B1 transcriptional
activity (Henry et al 1974; Henry 1982; Brenza et al 1998; Murayama et al 1998).
Although the down-regulation of the CYP27B1 mRNA expression in bone by PTH
has not been described before, PTH has been shown not to have an effect on the
expression of CYP27B1 mRNA in non-renal tissues (Reichel et al 1987(a)) as is
discussed in detail in Chapter 4. CYP27B1 mRNA expression in bone cells could be,
in a similar way, unresponsive to PTH.
In addition to the association with PTH, bone CYP27B1 mRNA levels were positively
correlated with serum calcium levels in the D(-) animals. The suggestion that the
180
circulating serum calcium levels could directly stimulate CYP27B1 mRNA
expression in the bone is possible since the CaR has been shown to be expressed on a
number of bone cell types including, bone marrow precursor cells, progenitor cells,
osteoblasts and pre-osteoblast cells (House et al 1997; Yamaguchi et al 1998(a);
Yamaguchi et al 1998(b); Yamaguchi et al 1998(c); Yamaguchi et al 1998(d);
Yamaguchi et al 2001). While the direct effect of calcium on the expression of
CYP27B1 mRNA expression in the kidney has previously been shown (Matsumoto et
al 1987; Weisinger et al 1989; Bland et al 1999), an effect of calcium on the
expression of bone CYP27B1 mRNA has not yet been reported. Further investigation
in the effects of serum calcium, as well as PTH, on a number of bone cell types would
be valuable to delineate the relative importance of these two factors in the regulation
of the expression of CYP27B1 mRNA in the bone during vitamin D-depletion. While
there was no correlation between serum calcium and PTH in the D(+) animals, the
relative importance of these factors during vitamin D-repletion cannot be discounted.
It is likely that any association between serum calcium and CYP27B1 in the bone, for
example, would be masked by the tight regulation of serum calcium levels.
In the D(+) animals, a positive correlation was found between the serum calcitonin
and CYP27B1 mRNA in the bone. While a calcitonin-mediated stimulation of
CYP27B1 mRNA expression in the bone has not been previously reported, the
hormone has been shown to stimulate CYP27B1 mRNA expression in the kidney
(Murayama et al 1998; Murayama et al 1999; Shinki et al 1999; Yoshida et al 1999).
Interestingly, Shinki et al (1999) showed a calcitonin-mediated regulation of the
expression of CYP27B1 mRNA in the kidney, which occurred only during
normocalcemia. This is consistent with the finding that the positive correlation
181
between the serum calcitonin levels and bone CYP27B1 mRNA levels was only
detectable in normocalcemic animals. The well-established role for calcitonin in the
bone is to act via the calcitonin receptor (CTR) in osteoclasts to inhibit bone
resorption activity. For calcitonin to have an effect on CYP27B1 mRNA expression in
the bone, it may therefore occur through the osteoclasts (Sexton et al 1999; Pondel
2000), as no other bone cells have been found to express the CTR. Such a link
between calcitonin, osteoclasts and CYP27B1 mRNA expression requires further
investigation.
While no clear correlation was detected between serum 1,25D and bone CYP27B1
mRNA levels, the role of serum 1,25D in the regulation of CYP27B1 mRNA
expression in the bone cannot be discounted. When serum 1,25D levels were high in
D(+)/LC animals, bone CYP27B1 mRNA expression was low and, conversely, when
serum 1,25D levels were low in D(+)/HC animals, bone CYP27B1 mRNA expression
was high. A 1,25D-mediated inhibition of bone CYP27B1 mRNA expression is
feasible, since 1,25D has been shown to down-regulate the expression and activity of
kidney CYP27B1 mRNA in process that is not fully understood (Rosenthal et al 1980;
Tanaka & DeLuca 1984; Takeyama et al 1997; Brenza & DeLuca 2000). Brenza and
DeLuca (2000) believe that the down regulation of CYP27B1 mRNA expression is
indirect, since they could not demonstrate a 1,25D-mediated suppression of CYP27B1
promoter activity in AOK-B50 kidney cells, but did show a 1,25D-mediated
suppression of kidney CYP27B1 mRNA in vivo. A more direct effect of 1,25D on
CYP27B1 mRNA expression, however, has been proposed by Takeyama and
colleagues (1997) and Kato (2000), who have identified a putative negative vitamin D
response element (nVDRE) on the promoter of the human CYP27B1 gene. While the
182
down-regulation of CYP27B1 transcriptional activity by 1,25D requires the VDR, the
exact mechanism by which 1,25D interacts with the nVDRE is yet to determined.
The expression of CYP27B1 mRNA in the bone is likely to be controlled by more
than one physiological factor. The findings from the current study suggest that the
control of the expression of CYP27B1 mRNA in bone during vitamin D-repletion is
different from that during vitamin D-depletion. When the D(+) animals were fed the
1% calcium diet, the expression of CYP27B1 mRNA in the bone is increased. The
increase in the expression of CYP27B1 mRNA in the bone is either due to a
calcitonin-mediated stimulation of the CYP27B1 mRNA expression or an absence of
the 1,25D-mediated suppression of CYP27B1 mRNA expression. Whatever the direct
mechanism of control may involve, the suggestion is that when the serum levels of
1,25D are low, due to the reduced requirement for 1,25D-mediated calcium
absorption, the production of 1,25D in the bone is up-regulated to compensate for the
fall in circulating 1,25D levels. During vitamin D-depletion, however, the expression
of CYP27B1 mRNA is increased when serum calcium levels are increased as a result
of the 1% calcium diet. This increase in the expression of CYP27B1 mRNA in the
bone is either due to a calcium-mediated stimulation of the CYP27B1 mRNA
expression, or to a previously undescribed PTH-mediated inhibition of the CYP27B1
mRNA expression. When the findings from the D(+) and D(-) animals are taken
together, it appears that an increase in CYP27B1-mediated 1,25D synthesis in the
bone takes place when serum 1,25D levels are low, providing that serum calcium
levels are normal. The local production of 1,25D in the bone may occur so that
processes in the bone, which require calcium can function normally, such as during
bone cell mineralisation.
183
There is evidence that supports the suggestion that 1,25D synthesised in the bone is
involved in the mineralisation process. In the D(-) animals, a positive relationship was
detected between the expression of CYP27B1 mRNA in the bone and the bone
mineral volume (BV/TV) in the epiphyseal region of the femur. This association was
the result of the positive correlation of CYP27B1 mRNA expression with both
trabecular number and trabecular thickness in this region (data not shown). This
suggests that if locally produced 1,25D is involved in increasing the net bone
formation during systemic vitamin D-depletion, it does so by increasing the thickness
and the number of trabeculae. In addition, despite the absence of the renal supply of
1,25D, the high expression of CYP27B1 mRNA in the D(-)/HC was associated with a
reduction in osteoid levels when compared to levels in the D(-)/LC animals,
suggesting further that locally produced 1,25D may promote bone mineralisation.
This finding is consistent with the positive correlation between bone CYP27B1
mRNA and serum calcium levels found in Chapter 4. Although this hypothesis seems
possible, a degree of caution should be taken, since serum calcium was found in a
multiple linear regression to be a significant determinant of BV/TV in the epiphysis.
Serum calcium has been found to directly stimulate bone mineralisation in
chondrogenic cells and increase the expression of several markers of cell
differentiation (Chang et al 2002). Serum calcium also affects the levels of serum
PTH levels, which has its own biological effect on bone mineralisation (Rader et al
1979; McSheehy & Chambers 1986; Toromanoff et al 1997; Swarthout et al 2002).
Nonetheless, a physiological mechanism, involving locally produced 1,25D, is
plausible and has significant implications in our understanding of the regulation of
bone mineralisation, particularly during vitamin D-depletion.
184
5.4.4.2 Determinants of CYP24 mRNA levels
Dietary calcium levels regulate the expression of CYP24 mRNA in the bone. The
expression of CYP24 mRNA is highest in the animals fed the 1% calcium diet,
irrespective of the vitamin D-load in their diet. A strong positive relationship was
detected between CYP27B1 and CYP24 mRNA levels in the bone, suggesting that the
locally produced 1,25D is the major determinant of the expression of CYP24 mRNA
in the bone. Consistent with these findings, Reichel et al (1987(d)) showed an increase
in the enzyme activity of both CYP27B1 and CYP24 in response to the addition of
25D to bone marrow macrophage cells. The increase in CYP24 activity occurred after
the rise in CYP27B1 activity, suggesting that CYP24 serves to catabolise the locally
produced 1,25D. Furthermore, 1,25D administration to rats was shown to increase the
expression of CYP24 mRNA in osteoblasts and cause a 4-fold increase in the enzyme
activity of CYP24 in isolated rat calvaria (Nishimura et al 1994). The fact that no
correlation was found between bone CYP24 mRNA and serum 1,25D levels in the
current study, further suggests that the CYP24 present in the bone responds to levels
of locally produced 1,25D rather than to the circulating levels of 1,25D.
The CYP24 mRNA levels in the bone were found to be negatively correlated with the
serum PTH levels in the D(-) animals. This is in contrast to stimulatory effect of PTH
on the expression of CYP24 mRNA shown in rat osteoblasts. Armbrecht and co-
workers (1994, 1996, 1998) showed that the 1,25D-mediated stimulation of the
expression of CYP24 mRNA in the osteoblast-like cells was synergistically increased
by the administration of PTH. The synergistic effect of PTH on CYP24 in osteoblasts
was, however, shown only in the presence of 1,25D. This point may explain the
difference in the findings of Armbrecht et al and that of the current study, since the
185
negatively correlation between PTH and CYP24 was only detected in the D(-) animals
when circulating 1,25D levels are low. Further study is, however, required to
elucidate the exact role of PTH in the regulation of the expression of CYP24 mRNA
in the bone.
5.4.4.3 Determinants of VDR mRNA levels
No statistically significant effect between dietary calcium and vitamin D levels and
the levels of VDR mRNA in the bone could be detected in any of the four treatment
groups. Thus, the regulation of the expression of VDR mRNA in bone remains
unclear. In the vitamin D-replete animals, the serum PTH levels were positively
correlated with the levels of VDR mRNA in the bone. A PTH-mediated stimulation of
the expression of VDR mRNA has been shown in several cell culture studies. The
expression of VDR mRNA was shown to be up-regulated by PTH, via cAMP, in both
growth plate chondrocytes and UMR-106 cells (van Leeuwen et al 1992; Klaus et al
1994; Krishnan et al 1995). There is no clear explanation for the lack of correlation
between serum PTH and bone VDR mRNA in the D(-) animals. This may be due to
the hypocalcemia in the D(-) animals fed 0.1% calcium diet. A negative correlation
was detected between serum calcium levels and expression levels of VDR mRNA in
the bone. It may be possible that calcium, together with PTH, can regulate the
expression of VDR mRNA in the bone and ultimately the vitamin D-responsiveness
of bone cells to 1,25D.
5.4.5 Comparisons of the kidney and bone vitamin D endocrine
systems
This study clearly demonstrated that the expression pattern of CYP27B1, CYP24 and
VDR mRNA was different in the bone from the pattern detected in the kidney. The
186
difference in the expression pattern of CYP27B1 mRNA between the kidney and bone
has been previously shown. Panda et al (2001(a)) showed, by qualitative assessment
of PCR products, that the expression of CYP27B1 mRNA was higher in bone of
foetal rats than in bone of adult rats. In contrast, they also showed that the expression
of CYP27B1 mRNA was higher in the kidney from adult rats than in the kidney from
foetal rats. This study is the first to quantify the differences in the regulation of the
expression of CYP27B1 mRNA found between kidney and bone tissue.
A partial explanation for the differences in the regulation of CYP27B1 mRNA
expression detected between the kidney and bone may come from the difference in
signalling pathways that are involved in the regulation of CYP27B1 mRNA
expression by different physiological factors. PTH predominantly stimulates the
expression of kidney CYP27B1 and the synthesis of 1,25D through a cAMP/protein
kinase A (PKA)-dependent pathway (Murayama et al 1999). PTH can, however, also
activate the protein kinase C (PKC) pathway (Janulis et al 1992) and activation of this
pathway has been shown to result in inhibition of the renal synthesis of 1,25D (Henry
1986; Henry and Luntao 1989; Mandla et al 1990; Welsh et al 1991). The PTH-
mediated PKA-signalling pathway predominates over the PKC-signalling pathway in
the kidney, which results in CYP27B1 mRNA expression and 1,25D synthesis
(Janulis et al 1992; Swarthout et al 2002). It is possible that in bone tissue, the PTH-
mediated PKC pathway is dominant over the PKA pathway, PKA pathway non-
responsiveness of CYP27B1 to the PKA pathway.
In the kidney, CYP27B1 and CYP24 mRNA expression are reciprocally regulated to
modulate the circulating levels of 1,25D. In the bone, CYP27B1 and CYP24 mRNA
187
levels were increased when circulating levels of 1,25D were low, provided that levels
of serum calcium were normal. In the kidney, a slight increase in the expression of
CYP27B1 mRNA and more pronounced decrease in CYP24 mRNA expression that
was detected in the D(+)/LC animals resulted in a marked increase in the levels of
serum 1,25D. In the bone, however, a reduction in the expression of CYP27B1
mRNA was detected in the D(+)/LC animals. The negative correlation detected
between the serum levels of 1,25D and the expression of CYP27B1 mRNA in the
bone suggests that the activation of CYP27B1 mRNA expression in the bone is only
required when the circulating levels of 1,25D are low. The expression of CYP24
mRNA in the bone, however, appears to be unresponsive to changes in circulating
levels of 1,25D. The coupling of the expression of CYP27B1 and CYP24 mRNA in
the bone suggests that the primary role of CYP24 in the bone is to catabolise the
locally produced 1,25D. This also suggests that the 1,25D synthesised in the bone is
more important for the continuation of 1,25D-dependant processes in the bone, than
the 1,25D that is produced in the kidney.
In the D(-)/LC animals, the kidney is unable to synthesise sufficient 1,25D to restore
circulating levels of calcium, due to the low levels of the substrate, 25D. This need for
the kidney to up-regulate the synthesis of 1,25D was reflected in the drastic increase
in kidney CYP27B1 mRNA levels and in the marked reduction in CYP24 mRNA. In
the D(+)/HC animals, however, the expression levels of kidney CYP27B1 were
reduced to levels comparable with the D(+) animals, presumably because the dietary
calcium levels were sufficient to maintain eucalcemia without the need for 1,25D-
mediated calcium absorption. The pattern of expression of CYP27B1 mRNA in the
bone in the D(-) animals was opposite to that in the kidney. The low expression of
188
CYP27B1 mRNA detected in the bones of the D(-)/LC animals may be due directly to
the hypocalcemia that was found in these animals. Supporting this hypothesis is the
positive correlation found between serum calcium and the levels of CYP27B1 mRNA
in the bone of the D(-) animals, suggesting that calcium may be able to directly
stimulate the synthesis of 1,25D in the bone. Interestingly, the expression of CYP24
mRNA and the expression of CYP27B1 mRNA were also coupled in the bones of the
D(-) animals, suggesting that even under these conditions, locally produced 1,25D is
sufficient to maintain the 1,25D-mediated processes in the bone, despite the low
circulating levels of 25D and 1,25D found in these animals. The apparent
unresponsiveness of CYP27B1 in the bone to vitamin D-depletion, under the
condition that circulating calcium levels are normal, may explain why, during vitamin
D deficiency, the intake of a high calcium diet alone is able to maintain a normal
mineralised skeleton (Pettifor et al 1984; Clark et al 1987; Schaafsma et al 1987).
5.4.6 Summary
This study is the first to demonstrate the difference in regulation of CYP27B1, CYP24
and VDR mRNA expression by calcium and vitamin D, between kidney and the bone.
The difference in the regulation of the expression of these genes can be explained, in
part, by the difference in the associations between these genes and the biochemical
factors that regulate their expression between the two tissues. For example, PTH
potently stimulates the expression of CYP27B1 mRNA in the kidney, but it
apparently is not involved in the transcriptional activation of CYP27B1 in the bone.
The reasons for the tissue-specific effects of PTH and other factors on the expression
of CYP27B1, CYP24 and VDR mRNA are not clear. They may, however, be due to
the different signal transduction pathways that are activated in kidney and bone cells.
189
While the different mechanisms that control gene expression of CYP27B1, CYP24
and VDR are unknown in the kidney and bone, the differences in the regulation of the
these genes are likely to reflect the different physiological roles of vitamin D in these
tissues. In the kidney, the reciprocal regulation of CYP27B1 and CYP24 mRNA
expression ensures that appropriate 1,25D is supplied for 1,25D-mediated intestinal
calcium absorption and other calcium homeostatic mechanisms. In the bone, however,
the strong coupling of CYP27B1 and CYP24 mRNA expression suggest that locally
produced 1,25D acts in an autocrine or paracrine manner for the initiation of 1,25D-
dependant processes. While the role for the kidney supplying 1,25D to the bone for
these processes remains probable, it appears that the role for 1,25D synthesis in the
bone is to compensate for when the kidney production of 1,25D is reduced. Having
said this, the coupling of the expression of CYP27B1 and CYP24 mRNA in the bone
clearly shows the production of 1,25D in the bone is primary determinant of CYP24
activity. This suggests that the autocrine or paracrine function of 1,25D is significant
and must be regulated over the circulating levels of 1,25D by its catabolism. When the
renal production of 1,25D was low, the positive correlation between CYP27B1
mRNA and serum calcium levels, which was also associated with bone volume in the
epiphysis and reduction of osteoid in the metaphysis, suggests that an increase of
locally produced 1,25D may be involved in promoting bone mineralisation. This
possibility has important consequence for the role of 1,25D in the bone and our
understanding of process of mineralisation during vitamin D-depletion.
190
Chapter 6: Identification of the bone cell types with
the capacity to metabolise vitamin D
6.1 Introduction
CYP27B1 enzyme activity was first identified in bone cells over 20 years ago. Turner
and co-workers (1980) detected that cultured bone cells from rat calvariae were able
to synthesise 1,25D from 25D. They also showed that, when these cells were
incubated with 1,25D, the activity of CYP24 in these cells was markedly induced.
Reichel and co-workers (1987) identified CYP27B1 and CYP24 enzyme activity in
bone marrow macrophage cell cultures. They showed that the induction of the 1,25D
production in these cells was followed by a subsequent induction of the activity of
CYP24 in the same cells. No further research was reported on the expression of
CYP27B1 in bone cells until 1999 when the Panda and co-workers detected
CYP27B1 mRNA expression in femoral sections of foetal mice. In this study
CYP27B1 mRNA was identified in chondrocytes of the growth plate and in
osteoblasts associated with trabeculae. Little further research has been conducted,
however, on the identification of the specific bone cell types that express CYP27B1
and the relationship between the expression of CYP27B1, CYP24 and VDR mRNA in
bone cells.
The experiments in this study were based on the hypothesis that CYP27B1, CYP24
and VDR mRNA was expressed in osteoblasts and in a number of cells from the bone
marrow. The present study investigated the expression of CYP27B1, CYP24 and
VDR mRNA in specific regions of the rat femora, with the aim to identify the specific
191
zones of the femur that have the ability to metabolise vitamin D. In situ hybridisation
was used to identify the specific cell types in the rat femur that are able to synthesise
1,25D. To investigate the in vitro expression of CYP27B1, CYP24 and VDR mRNA,
two rat clonal osteosarcoma cell lines, UMR 106-06 and UMR 201-10B, as well as
primary rat bone cell cultures were used. The UMR cell lines, which are similar in
function to osteoblasts, have been "arrested" at a particular stage of differentiation and
have been characterised in terms of their expression of genes that are involved in the
regulation of osteoblastic function (Forrest et al 1985; Zhou et al 1991; Choong et al
1993). Although UMR 106 cells are not fully differentiated, they can be induced to
mineralise in vitro (Stanford et al 1995). The less mature UMR 201 cells are
preosteoblastic cells and cannot be induced to mineralise in vitro (Zhou et al 1991).
The investigation of the expression of CYP27B1, CYP24 and VDR mRNA in these
cells will be helpful in determining the role for these genes in the regulation of
osteoblastic function.
6.2 Protocol
6.2.1 Experimental Procedures
Sprague-Dawley female rats (n = 4) were housed as described in Chapter 2.3 and
were fed commercial rat chow (Chapter 2.3.1.1). Animals were sacrificed at 6 months
of age as described in Chapter 2.5.3.1. Rat femora were removed, snap frozen in
liquid nitrogen and stored at -70°C until ready for mRNA extraction. One femur from
each animal was divided into the bone marrow, cortical bone and femoral head. The
distal femoral head, containing the epiphysis, growth plate and metaphysis, was
collected from each femur. The bone marrow was collected by flushing out the
diaphysis with PBS using a 20-gauge needle and syringe. The cortical bone was taken
192
from the diaphysis and was coarsely crushed and washed in PBS to remove any
remaining bone marrow.
6.2.2 Cell culture
Primary osteoblast cells, UMR 201-10B and UMR 106-06 cell lines were obtained
from Dr D Findlay, Department of Orthopaedics, Royal Adelaide Hospital, Adelaide.
Primary osteoblast cells were grown from rat trabecular bone as described previously
(Gronthos et al 1997). Briefly, specimens of trabecular bone were dissected into small
pieces and washed extensively in PBS. The fragments were seeded as explants into
75cm2 culture dishes (Corning, Costar Corp., Cambridge, MA) and cultured in Eagle's
minimal essential medium (ICN Biomedicals, Aurora, OH), containing 10% heat-
inactivated foetal calf serum (Trace Biosciences, Ltd., Noble Park, Vic, Australia) and
L-ascorbic acid-2-phosphate (NovaChem, Victoria, Australia). The UMR-201-10B
and UMR 106-06 cell lines were grown in culture as described previously (Zhou et al
1991; Celic et al 1998). Briefly, these cell lines were maintained in Dulbeccos
minimal essential media (DMEM) supplemented with 10% foetal calf serum (FCS).
The growth media for UMR 201-10B also contained 200µg/ml of the antibiotic G418,
except when cells were prepared for experiments. All cell cultures were grown at
37°C in a humidified 5% CO2 atmosphere.
6.2.3 Messenger RNA analyses
Messenger RNA extraction, purification and quantification from bone tissue are
described in Chapter 2.5.3. The method of mRNA extraction, purification and
quantification from harvested cell lines was the same as described for tissue samples.
First Strand cDNA synthesis from mRNA is described in Chapter 2.5.4. The reaction
temperature, reagent composition and conditions for real-time RT-PCR are described
193
in Chapter 2.6.2. The copy numbers of mRNA for CYP27B1, CYP24 and VDR in the
cell lines were expressed relative to the levels of GAPDH mRNA in each cell line.
6.2.4 Insitu hybridisation
One rat femur from each animal was prepared for in situ hybridisation. In situ
hybridisation analysis, performed for CYP27B1 mRNA on rat femoral bone sections,
is described in Chapter 2.8.
6.2.5 Data expression and statistical analyses
One-way analysis of variance (Chapter 2.4.6.1) was performed to compare the levels
of CYP27B1, CYP24 and VDR mRNA between the three bone fractions as well as
between the three individual cell lines. The data were further analysed using Tukey’s
post hoc test (Chapter 2.4.6.3). Linear regression analysis (Chapter 2.4.6.4) was used
to compare the levels of CYP27B1 and CYP24 mRNA detected in the three bone
factions.
6.3 Results
6.3.1 Expression of CYP27B1 mRNA in specific bone regions
The expression of CYP27B1 mRNA in the bone marrow, femoral head and cortical
bone fractions of the rat femur is shown in Figure 6.1. Expression of CYP27B1
mRNA was detected in all fractions of the rat femur. In the femoral head, however,
the levels of mRNA expression was more than 2-fold higher than the levels found in
the bone marrow and cortical bone (p<0.01).
194
Figure 6.1 The expression of CYP27B1 mRNA levels (copy number/µg total RNA) in
rat bone marrow, femoral head and cortical bone. Values are mean ± sem. n = 4. * p <
0.01 vs. bone marrow and cortical bone fractions. CYP27B1, 25-hydroxyvitamin D-
1α-hydroxylase.
BoneMarrow
FemoralHead
CorticalBone
2 x104
4 x105
6 x105
0
CYP
27b1
Cop
y N
umbe
r/ µ
g to
tal R
NA
1.2 x106
1.0 x106
8 x105
1.4 x106
*
BoneMarrow
FemoralHead
CorticalBone
2 x104
4 x105
6 x105
0
CYP
27b1
Cop
y N
umbe
r/ µ
g to
tal R
NA
1.2 x106
1.0 x106
8 x105
1.4 x106
*
2 x105
CYP
27B
1
195
6.3.2 Expression of CYP24 mRNA in specific bone regions
The expression of CYP24 mRNA in the bone marrow, femoral head and cortical bone
fractions of the rat femur is shown in Figure 6.2. CYP24 mRNA was detected in all
fractions of the rat femur. In the femoral head, however, the levels of mRNA
expression was 26-fold higher than the levels found in the bone marrow and more
than 260-fold higher than the levels of expression found in the cortical bone
(p<0.001). The levels of CYP24 mRNA expression in the bone marrow was
significantly higher than that in the cortical bone (p<0.001).
6.3.3 Relationship between CYP27B1 and CYP24 mRNA expression
A positive relationship was detected between CYP27B1 and CYP24 mRNA levels in
the bone (p<0.01) (Figure 6.3). The coefficient of determination for the relationship
was 0.81. This relationship between CY27b1 and CYP24 mRNA was, however,
found only to occur in the femoral head.
6.3.4 Expression of VDR mRNA in the separate bone fractions
The expression of VDR mRNA in the bone marrow, femoral head and cortical bone
fractions of the rat femur is shown in Figure 6.4. VDR mRNA was detected in all
fractions of the rat femur. In the cortical bone, however, the levels of mRNA
expression was approximately 20-fold lower than the levels of expression found in
both the bone marrow and the femoral head (p<0.01). The expression levels of VDR
mRNA levels in both the bone marrow and the femoral head were comparable at
approximately 1.2 x105 (± 2.5 x104) copies/µg of total RNA.
196
Figure 6.2 The expression of CYP24 mRNA levels (copy number/µg total RNA) in
the rat bone marrow, femoral head and cortical bone. Values are mean ± sem. n = 4. *
p <0.001 vs. bone marrow and cortical bone fractions. CYP24, 25-hydroxyvitamin D-
24-hydroxylase.
BoneMarrow
FemoralHead
CorticalBone
CYP
24 C
opy
Num
ber
/ µg
tota
l RN
A
1.25 x104
2.5 x104
3.75 x104
0
1.2 x106
1.0 x106
5 x104
1.4 x106 *
1.6 x106
BoneMarrow
FemoralHead
CorticalBone
CYP
24 C
opy
Num
ber
/ µg
tota
l RN
A
1.25 x104
2.5 x104
3.75 x104
0
1.2 x106
1.0 x106
5 x104
1.4 x106 *
1.6 x106
197
Figure 6.3 The relationship between the expression of CYP27B1 and of CYP24
mRNA levels (copy numbers/µg total RNA) in the bone marrow (○), the femoral head
(◊) and in the cortical bone (×) fractions. The coefficient of determination (R2) is
shown for the linear regression analysis. CYP27B1, 25-hydroxyvitamin D-1α-
hydroxylase. CYP24, 25-hydroxyvitamin D-24-hydroxylase.
2
4
6
0
8
10
16
12
14
18C
YP24
Cop
y N
umbe
r (X
105 )
/ µg
tota
l RN
A
2 4 60 8 10 12 14
CYP27b1 Copy Number (x 105)/ µg total RNA
R2 = 0.81
2
4
6
0
8
10
16
12
14
18C
YP24
Cop
y N
umbe
r (X
105 )
/ µg
tota
l RN
A
2 4 60 8 10 12 14
CYP27b1 Copy Number (x 105)/ µg total RNA
R2 = 0.81
CYP27B1
198
Figure 6.4 The expression of VDR mRNA levels (copy number/µg total RNA in the
rat bone marrow, femoral head and cortical bone. Values are mean ± sem. n = 4. * p <
0.05 vs. bone marrow and femoral head fractions. VDR, vitamin D receptor.
BoneMarrow
FemoralHead
CorticalBone
VDR
Cop
y Nu
mbe
r/ µ
g to
tal R
NA
2 x104
4 x104
6 x104
0
8 x104
1.0 x105
1.6 x105
1.2 x105
1.4 x105
*
BoneMarrow
FemoralHead
CorticalBone
VDR
Cop
y Nu
mbe
r/ µ
g to
tal R
NA
2 x104
4 x104
6 x104
0
8 x104
1.0 x105
1.6 x105
1.2 x105
1.4 x105
*
199
6.3.5 Expression of CYP27B1 mRNA in bone cells
The expression of CYP27B1 mRNA in primary bone cell cultures, UMR 201 and
UMR 106 cells is shown in Figure 6.5. CYP27B1 mRNA was detected in all of the
cell lines tested. The highest level of CYP27B1 mRNA expression was detected in
UMR 106 cells, and was approximately 4-fold higher than the levels of expression
detected in the primary bone cells and in UMR 201 cells (p<0.05).
6.3.6 Expression of CYP24 mRNA in bone cells
The expression of CYP24 mRNA in primary bone cell cultures, UMR 201 and UMR
106 cells is shown in Figure 6.6. CYP24 mRNA was detected in all of the cell lines
tested. In the UMR 201 cells, the levels of mRNA expression was approximately 77-
fold higher than the level of expression detected in the primary bone cells and
approximately 130-fold higher than that found in the UMR 106 cells (p<0.001).
6.3.7 Expression of VDR mRNA in bone cells
The expression of VDR mRNA in primary bone cell cultures, UMR 201 and UMR
106 cells is shown in Figure 6.7. VDR mRNA was detected in all fractions of the rat
femur. In the UMR 201 cells, the levels of mRNA expression was approximately 10-
fold lower than the level detected in the primary bone cells (p<0.05). The level in the
UMR 106 cells was highest, and was approximately 7-fold higher than the level of
mRNA expression detected in the primary bone cells.
200
Figure 6.5 The expression of CYP27B1 mRNA levels (copy number/GAPDH copy
number) in primary bone cells, UMR 201, and UMR 106 cells. Values are mean ±
sem. n = 3. * p<0.01 vs Primary bone cells, # p<0.01 vs UMR 201 cells. CYP27B1,
25-hydroxyvitamin D-1α-hydroxylase.
Primarybone cells
UMR 201 UMR 106
CYP
27b1
mR
NA
cop
y nu
mbe
r / G
APD
H m
RN
A
1 x 10-3
0
2 x 10-3
3 x 10-3
4 x 10-3
5 x 10-3
6 x 10-3
7 x 10-3
* #
*
CYP
27B
1
201
Figure 6.6 The expression of CYP24 mRNA levels (copy number/GAPDH copy
number) in primary bone cells, UMR 201, and UMR 106 cells. Values are mean ±
sem. n = 3. * p<0.01 vs Primary bone cells, # p<0.01 vs UMR 201 cells. CYP24, 25-
hydroxyvitamin D-24-hydroxylase.
Primarybone cells
UMR 201 UMR 106
CYP
24 m
RN
A c
opy
num
ber
/ GA
PDH
mR
NA
5 x10-5
1 x 10-4
0
2 x 10-4
1.5 x 10-4
2.5 x 10-4
3 x 10-4
3.5 x 10-4
4 x 10-4
4.5 x 10-4
#
*
202
Figure 6.7 The expression of VDR mRNA levels (copy number/GAPDH copy
number) in primary bone cells, UMR 201, and UMR 106 cells. Values are mean ±
sem. n = 3. * p<0.01 vs Primary bone cells, # p<0.01 vs UMR 201 cells. CYP27B1,
25-hydroxyvitamin D-1α-hydroxylase.
Primarybone cells
UMR 201 UMR 106
VDR
mR
NA
cop
y nu
mbe
r / G
APD
H m
RNA
1 x 10-2
0
2 x 10-2
3 x 10-2
4 x 10-2
5 x 10-2
* #
*
203
6.3.8 Detection of CYP27B1 mRNA by in situ hybridisation
The detection of CYP27B1 mRNA in femoral bone sections by in situ hybridisation
showed a wide spread expression of CYP27B1 mRNA expression in the
haematopoietic cells of the bone marrow (Figure 6.8). No CYP27B1 mRNA was
detected in other bone marrow cells such as megakaryocytes and adipose cells.
Although no CYP27B1 mRNA was detected in osteoblasts, very few osteoblasts were
found in these sections. CYP27B1-positive cells of a normoblast nature were
identified adjacent to the trabeculae (Figure 6.9). The osteocytes of the lacuna did not
express CYP27B1 mRNA.
6.4 Discussion
6.4.1 Expression of CYP27B1, CYP24 and VDR mRNA in specific bone
regions
6.4.1.1 CYP27B1 mRNA
CYP27B1 mRNA was detected in all specific fractions of bone collected from the
femur. The highest expression of CYP27B1 mRNA was detected in the femoral head
and was more than 2-fold higher than the expression levels detected in the cortical
bone and in the bone marrow. The high expression of CYP27B1 mRNA in this region
is consistent with the study of Panda and co-workers (2001(a)), who identified
CYP27B1 mRNA in the chondrocytes of the growth plate and in osteoblasts
associated with metaphyseal trabeculae. Since the femoral head region studied here
contains the epiphysis, the growth
204
Figure 6.8 The expression of CYP27B1 mRNA in rat bone marrow. Tissue sections
were hybridised with a digoxigenin-labelled rat CYP27B1 anti-sense riboprobe. (A)
The purple stain indicates the expression of CYP27B1 mRNA. (B) No reaction was
detected in the control section, which was hybridised with a digoxigenin-labelled rat
CYP27B1 sense riboprobe.
A BA B
205
Figure 6.9 The detection of CYP27B1 mRNA in the rat femur. Tissue sections were
hybridised with a digoxigenin-labelled rat CYP27B1 anti-sense riboprobe. (A) The
purple stain indicates the expression of CYP27B1 mRNA. Depicted in these slides are
haematopoietic cells (1), megakaryocytes (2), trabecula bone (3), osteocytes (4) and
adipose cells (5). (B) No reaction was detected in the control section, which was
hybridised with a digoxigenin-labelled rat CYP27B1 sense riboprobe.
A B
1
1
2
2
3 3
4
5
5
A B
1
1
2
2
3 3
4
5
5
206
plate, trabeculae and bone marrow from the metaphyseal region, CYP27B1 mRNA
expression could be expressed in a number of cells types in each of these sites. The
high expression of CYP27B1 in the femoral head suggests that 1,25D-mediated
autocrine or paracrine signalling pathways may be involved in the skeletal growth and
maturation.
Although the cortical bone is an area of low cellular activity, the level of CYP27B1
mRNA expression in this region was comparable with the level of expression that was
detected in the bone marrow. The significance of the expression of CYP27B1 mRNA
in the cortical bone is presently unclear. Bone marrow macrophages are known to
have CYP27B1 activity (Reichel et al 1987) and 1,25D has been shown to be involved
in a number of processes in the bone-marrow, such as macrophage differentiation and
activity (Clohisy et al 1987; Abu-Amer and Bar-Shavit 1993; Rickard et al 1995) and
in the immune response (Gray and Cohen 1985; Abu-Amer and Bar-Shavit 1994).
6.4.1.2 CYP24 mRNA
Although CYP24 mRNA was detected in all three regions examined, the highest level
of CYP24 mRNA expression was found in the femoral head. This is consistent with
reports of CYP24 mRNA and enzyme activity in osteoblasts (Turner et al 1980;
Makin et al 1989). Although bone marrow macrophages have been shown to have
CYP24 activity (Reichel et al 1987), in the current study the levels of expression of
CYP24 in the bone marrow is significantly lower than the levels of expression
detected in the femoral head. The level of expression of CYP24 mRNA in the bone
marrow, however, was significantly higher than the level of expression found in the
cortical bone. The low level of CYP24 mRNA expression in the cortical bone is likely
207
to be the result of the low cellular activity of the terminally differentiated, highly
compacted and mineralised cells.
Of considerable interest is the co-expression of CYP27B1 and CYP24 mRNA in the
femoral head, which is consistent with the findings presented in Chapters 4 and 5.
Although this relationship could not be detected in the bone marrow, the coupling of
bone CYP27B1 and CYP24 has been shown in bone marrow macrophage cells
(Reichel et al 1987). The activity of CYP24 was shown to be increased in bone
marrow macrophages in response to the intracellular production of 1,25D. The
coupling of CYP27B1 and CYP24 mRNA expression suggests that the activity of the
locally produced 1,25D, is modulated by the catabolic activity of CYP24 in the
femoral head.
6.4.1.3 VDR mRNA
Although VDR mRNA was detected in all three faction of the bone examined, the
expression levels of VDR mRNA were significantly higher in the bone marrow and
femoral head when compared to the levels detected in the cortical bone. The detection
of VDR mRNA in the bone marrow and in the femoral head, like the presence of
CYP24 mRNA, reflects the high cellular activity of cells in these regions. VDR has
been identified in a number of bone cell types. Immunohistochemistry analysis on
both rat and human bone, have shown that VDR protein is present in high amounts in
osteoblasts (Clemens et al 1988; Langub et al 2000). A number of studies have shown
that osteoblast-like cell lines also express the VDR (Mahonen and Maenpaa 1994;
Ohtera et al 2001). The presence of VDR in osteoblasts is necessary for a number of
1,25D-mediated processes, such as the regulation of osteoblastic-specific genes,
208
including osteocalcin and osteopontin (Kraichely and MacDonald 1998; Martinez et
al 2001).
The detection of VDR mRNA in the bone marrow is consistent with previous studies
that have identified VDR in a number of bone cell types. Clemens et al (1988) and
Gruber et al (1999) identified the VDR in a variety of different bone marrow cells,
including monocytes-macrophages and T and B-lymphocytes. Cells from the
osteoblastic cell lineage, primary stromal cells and more differentiated fibroblasts
were also shown to express the VDR. The interactions between these VDR-positive
cells and 1,25D are numerous and are only recently starting to be resolved. Abu-Amer
and Bar-Shavit (1994) showed, for example, that the interaction between 1,25D and
mature monocytes and macrophages enhances their immune function and improves
host defence by promoting macrophage survival and differentiation. In lymphocytes,
however, 1,25D acts in an immunoinhibitory agent by decreasing both the
proliferation rate and the activity of T- and B-lymphocytes (Lemire et al 1984; Lemire
et al 1985; Lemire and Archer 1991).
6.4.2 Expression of CYP27B1, CYP24 and VDR mRNA in bone cells
6.4.2.1 CYP27B1 mRNA
The highest expression of CYP27B1 mRNA was found in the UMR 106 cells when
compared to the UMR 201 cells and primary bone cells. This suggests that the UMR
106 cells, which can mature and mineralise in vitro, have an increased capacity to
synthesise 1,25D. UMR 106 cells have been shown to contain PTH, calcitonin, and
calcium receptors, which all respond to their respective ligands by stimulating the
cAMP-dependent protein kinase pathway (Yamaguchi et al 1998(b)). Since PTH,
calcitonin and calcium have all been shown to stimulate the transcriptional activity of
209
CYP27B1 in kidney cell lines (Brenza and DeLuca 2000), it is possible that one or
more of these factors may mediated the expression of CYP27B1 mRNA in the UMR
106 cells via a cAMP-mediated signalling process.
The UMR 201 cells, which are phenotypically an immature preosteoblast and are
unable to mineralise in vitro, expresses CYP27B1 mRNA at a level, which is
approximately 4-fold lower than the level of expression detected in the UMR 106
cells. It is possible that the levels of maturation of the osteoblast affect the level of
expression of CYP27B1 mRNA. This concept is supported by the finding that the
level of CYP27B1 mRNA expression in immature, primary osteoblasts, which is
comparable with the level of expression detected in UMR 201 cells. These findings,
taken together with the fact that 1,25D stimulates the influx of calcium into the
osteoblast (Meszaros and Farach-Carson 1997; Nakagawa et al 1999), suggests that
the level of CYP27B1 mRNA expression in the bone cell may be associated with the
ability of these cells to mineralise.
6.4.2.2 CYP24 mRNA
The level of expression of CYP24 mRNA in UMR 201 cells was markedly higher
than the level of expression found in UMR 106 and primary bone cells. This is
consistent with the report by Nishimura and co-workers (1994), that the 1,25D-
mediated induction of CYP24 mRNA expression was more rapid and much greater in
an immature osteoblast-like cell-line, C-26, compared with a more mature osteoblast-
like cell-line, C-11. This is in contrast with the level of expression of CYP27B1
mRNA detected in the UMR 201 and UMR 106 cells. Armbrecht and co-workers
(1994, 1998) have previously reported the low level of expression of CYP24 mRNA
210
in UMR 106 cells. They found that the low basal expression of CYP24 mRNA was
markedly increased when exogenous 1,25D and PTH was added to medium.
One of the functions of CYP24 in bone is the inactivation of 1,25D, thereby
preventing the elevation of intracellular 1,25D levels that could adversely affect
mineralisation. St-Arnaud and co-workers (2000) recently identified markedly
elevated 1,25D levels and impaired bone formation at specific sites in mice with the
CYP24 gene knocked out. The high CYP24 mRNA expression in immature UMR 201
cells may, therefore, prevent the 1,25D-mediated differentiation and mineralisation in
these cells. The lower level of expression of CYP24 mRNA in UMR 106 cells may
reflect the need for these cells to mature and to mineralise. The level of expression of
CYP24 mRNA in primary osteoblast cells, is comparable to the level of expression
detected in UMR 106 cells, therefore suggests that these cells, like UMR 106 cells,
are able to mature and to mineralise.
6.4.2.3 VDR mRNA
The level of VDR mRNA expression in UMR 106 cells was significantly higher
than the levels detected in UMR 201 or primary osteoblast cells. This clearly
shows that UMR 106 cells are responsive to 1,25D-mediated gene
transcription, which is consistent with previous studies that have shown the
presence of VDR in osteoblast-like cells is required for 1,25D-mediated
processes (Dokoh et al 1984; Chen et al 1986(a); Chen et al 1986(b); Stein et
al 1990; Staal et al 1997). Dokoh et al (1984) detected in a series of rat
osteogenic sarcoma (ROS) cell lines that the high level of VDR protein in a
particular cell was associated with the strong osteoblastic nature of this cell.
They also found a strong correlation between the concentration of 1,25D in
211
the medium and the number of VDR molecules per ROS cell. Since the UMR
106 and UMR 201 cells were maintained in the same medium, it may be
possible that the high levels of VDR mRNA in UMR 106 cells is due to the
increase in the synthesis of 1,25D by CYP27B1 in these cells. Further
examination, however, into the relationship between the VDR mRNA levels
and the amount of 1,25D produced in UMR 106 cells, is required to
substantiate this theory.
The level of VDR mRNA levels in the UMR 201 cells was low compared to the levels
detected in UMR 106 and primary bone cells, suggesting that this cell-line may be
unable to respond to 1,25D. This is, to our knowledge, the first report of the
expression of VDR mRNA in UMR 201 cells. The lack of ability for UMR 201 cells
to mineralise in vitro may be explained, in part, by the inability of these cells to
respond to 1,25D due to their low expression of VDR mRNA.
Although, the level of expression of VDR mRNA in UMR 201 cells is low, the level
of CYP24 mRNA expression detected in the same cells was markedly high. This
finding is in contrast with a number of studies that have demonstrated that the VDR is
required for the 1,25D mediated stimulation of CYP24 mRNA expression in the
kidney and in other cell types (Pols et al 1991; Staal et al 1997). This is not, however,
the first study to detect this disassociation between VDR and CYP24 mRNA in
immature osteoblasts. Nishimura and co-workers (1994) found by using three
different osteoblastic cell lines (C-26, C-20, and C-11), which varied in level of
maturity, that the expression of VDR mRNA was lowest and the expression of CYP24
mRNA was highest in the most immature osteoblastic cell line (C-26). This suggests
212
that, unlike in the kidney, in the bone the level of expression of CYP24 cannot be not
be explained simply by the level of the expression of VDR mRNA.
It is important to note that the level of VDR mRNA expression in UMR 201 cells is
not a direct measure of the level of VDR protein in these cell. Previous studies have
reported a lack of association between the levels of VDR mRNA and the VDR protein
levels (Strom et al 1989; Wiese et al 1992). Wiese et al (1992), for example, showed
that the treatment of rat fibroblasts with 1,25D did not increase the levels of VDR
mRNA, but did increase the stability of the VDR protein. It was suggested that an
increase in the level of VDR mRNA is only required to maintain a constant level of
unoccupied receptor. It is therefore possible, that the low level of VDR mRNA in
UMR 201 cells is not indicative of a low level of VDR protein. An investigation into
the regulation of the expression of VDR mRNA and the amount of total and
unoccupied VDR is required to determine the ability of UMR 201 cells to respond to
1,25D and to study the relationship between the levels of CYP24 activity and VDR
content in these cells.
6.4.3 Insitu identification of CYP27B1 mRNA in rat femora
A number of bone cells in the rat femur were shown to express CYP27B1 mRNA by
using in situ hybridisation. The majority of the CYP27B1-positive cells that were
identified were of haematopoietic lineage found throughout the bone marrow (Figure
6.8). This is the first report of CYP27B1 mRNA expression in these largely
undifferentiated, normoblast-like cells. The homogeneity of the haematopoietic cells
made it difficult to determine the exact cells that express CYP27B1 mRNA. Although
CYP27B1 mRNA has previously been identified in bone marrow macrophages
(Reichel et al 1987), in the current study no CYP27B1 mRNA could be detected in
213
macrophages. The absence of CYP27B1 mRNA expression was also found in other
differentiated cells, such as megakaryocytes. In the current study, the expression of
CYP27B1 mRNA was not detected on osteoblasts. Since osteoblasts can be found on
only 2 to 4% of the total trabecula bone surface (A Moore, unpublished data), it is
likely that we were unable to detect osteoblasts expressing CYP27B1 mRNA due to
the absence of these cells in the sections we examined. While we were not able to
positively identify osteoblasts in our sections, Panda and co-workers (1999), were
able to detect CYP27B1 mRNA in osteoblasts of foetal mice femora. The absence of
CYP27B1 mRNA detection in osteoblasts of the adult rat femur may, therefore, be
due to the inability to detect the lower expression of CYP27B1 mRNA in these cells
when compared to the high expression of CYP27B1 mRNA in osteoblasts of the
foetal mice bones.
6.4.4 Summary
The study of the expression of CYP27B1 and CYP24 mRNA in different regions of
the rat femur and in specific osteoblast-like cells, has shown that a number of cells in
the bone are able to synthesise and catabolise 1,25D. The high level of expression of
CYP27B1 in the femoral head is consistent with the high cellular activity in this area.
Although bone cells have been shown to produce 1,25D, the exact role of this locally
produced 1,25D remains unclear. Of particular interest are the results obtained from
mature UMR 106 cells. The levels of CYP27B1 mRNA were higher and the levels of
CYP24 mRNA were lower in UMR 106 cells than the mRNA levels found in UMR
201 cells. In addition, the level of expression of VDR mRNA was significantly higher
in these cells than in any other cell type examined. Taken together, these findings
suggest that more mature osteoblast have the ability to both produce 1,25D and to
respond to 1,25D. Since 1,25D has been shown to promote the mineralisation of
214
mature osteoblasts in vitro, it is possible that the 1,25D produced in these osteoblasts
is involved in the mineralisation process. The UMR 201 cells, which have been
arrested in a preosteoblatsic stage of development, express CYP24 mRNA at a high
level, even though the level of VDR mRNA expression is very low. The ability of
these cells to catabolise 1,25D suggests that, during the early development of the
osteoclast, it is necessary to limit the activity of 1,25D, so that the immature
osteoblast can proliferate without the 1,25D-mediated stimulation of the
mineralisation processes.
This study has demonstrated for the first time, the expression of CYP27B1 mRNA in
normoblastic, haematopoietic cell types. Although the role of CYP27B1 in these non-
differentiated cells of the bone marrow is presently unclear, this finding is consistent
with the detection CYP27B1 mRNA in the bone marrow of the femur. The possibility
that 1,25D-mediated processes such as macrophage differentiation and immune
responses are dependent on 1,25D produced in haematopoietic cells would require
further investigation.
215
CHAPTER 7: Summary and Conclusions
7.1 Summary
This thesis investigated the regulation of the expression of CYP27B1, CYP24 and
VDR mRNA, both in the bone and in the kidney. The broad aim was to determine
whether the regulation of the vitamin D metabolism in the bone is independent from
that in the kidney. The quantitative real-time RT-PCR was used to detect low levels of
mRNA, overcoming the limitations of other methods, such as Northern blot analysis.
This technique was able to accurately quantify the copy numbers mRNA in a highly
reproducible and sensitive manner. The measurement of the absolute quantities of
CYP27B1, CYP24 and VDR mRNA in both the kidney and in bone was used to
determine the effects of age, dietary calcium and vitamin D status on the metabolism
of vitamin D in these tissues. The data derived from the studies on age and dietary
manipulations have enable the development of an number of models for the regulation
of gene expression for CYP27B1 and CYP24.
The first hypothesis investigated the expression of CYP27B1, CYP24 and VDR
mRNA with age. This study clearly demonstrated that the expression levels of these
three genes in the bone were significantly different from the levels found in the
kidney. While in the kidney an age-related decrease in the expression of CYP27B1
mRNA and an increase in the expression of CYP24 mRNA was detected, in the bone
the expression of both CYP27B1 and CYP24 mRNA was high throughout the period
of rapid growth and development. The age-related decrease in the renal CYP27B1
mRNA and the increase in the renal CYP24 mRNA expression resulted in a decline in
serum 1,25D levels with age. The positive correlation found between the CYP27B1
216
mRNA expression in the bone and the circulating levels of calcium, suggests that the
1,25D that is produced in the bone, particularly during the period of bone growth, may
be involved in bone mineralisation. The coupling of CYP27B1 and CYP24 mRNA
expression in the bone implies that the breakdown of locally produced 1,25D in the
bone is necessary to modulate the biological activity of this 1,25D in the bone.
The second hypothesis related to the effect of the concentration of dietary calcium on
the expression of CYP27B1, CYP24 and VDR mRNA in the kidney and bone. This
study demonstrated that the expression of these genes is regulated in such ways that
appropriate blood levels of 1,25D are produced for calcium absorption in the intestine.
In animals fed a low calcium diet, intestinal calcium absorption was stimulated by the
rise in circulating levels of 1,25D, which occurred as a result of increase renal
CYP27B1 mRNA and decreased renal CYP24 mRNA expression (Figure 8.1). The
animals fed a high calcium diet abrogated the need for active intestinal calcium
absorption and consequently the synthesis of renal 1,25D by CYP27B1 was reduced
and the breakdown of 1,25D and 25D by kidney CYP24 was increased (Figure 8.2).
In the bone, the expression of CY27b1 and CYP24 mRNA were strikingly different to
that in the kidney. In animals fed a low calcium diet, the expression of CYP27B1 and
CYP24 mRNA in the bone were both reduced.
In contrast, the expression of CYP27B1 and CYP24 mRNA in the bone was increased
as a result of the consumption of a high calcium diet. The difference in the regulation
of CYP27B1 and CYP24 mRNA between the kidney and bone may be explained in
217
Figure 7.1 Diagram representing the proposed effects of the vitamin D-replete/low
calcium (D(+)/LC) diet on the expression of CYP27B1 and CYP24 in the kidney and
bone. In response to the low calcium diet, serum PTH increases the CYP27B1 mRNA
expression and suppresses CYP24 mRNA expression in the kidney. The rise in
CYP27B1 activity increases in the production of 1,25D, which in turn is able to
stimulate 1,25D-mediated intestinal calcium absorption. In the bone, CYP27B1
mRNA expression is not stimulated by PTH and may be suppressed by the increase in
serum 1,25D levels. Bone CYP24 mRNA levels correspond to the low expression
levels of CYP27B1 mRNA in the bone and do not respond to the rise in circulating
levels of 1,25D. 1,25D-mediated bone mineralisation is normal due to the production
of 1,25D in the kidney.
BONE
1,25D↓
Ca++b 25D↑
CYP27b1↑
CYP24↓
KIDNEY
CYP24↓
PTH↑
CIRCULATION
CYP27b1↓
1,25D↑
DIET: Vitamin D-Replete + Low Calcium
1,24,25D 1,24,25D
25D↑CYP24↓
24,25D
Calcitonin↓
VDR +1
Intestinal Caabsorption
1,25D↑
Normal BoneMineralisation
218
Figure 7.2 Diagram representing the proposed effects of the vitamin D-replete/high
calcium (D(+)/HC) diet on the expression of CYP27B1 and CYP24 in the kidney and
bone. In response to the high calcium diet, the low serum PTH levels result in low
expression of CYP27B1 mRNA in the kidney. The rise in serum calcium levels also
directly suppresses the expression of CYP27B1 in the kidney and, along with high
serum calcitonin levels, stimulates the expression of CYP24 in the kidney, ultimately
reducing the production of 1,25D in the kidney. Serum calcium and calcitonin also
stimulates the expression of CYP27B1 in the bone. The rise in bone CYP27B1
activity increases in the production of 1,25D in the bone and consequently the levels
of CYP24 activity. 1,25D-mediated bone mineralisation is normal due to the
production of 1,25D in the bone.
1,25D↑
Ca++↑ 25D↑
CYP27b1↓
CYP24↑ CYP24↑
PTH↓ CYP27b1↑
1,25D↓
DIET: Vitamin D-Replete + High Calcium
1,24,25D 1,24,25D
25D↑
VDR +1
Normal BoneMineralisation
CYP24↑
24,25D
Intestinal Caabsorption
Calcitonin↑↑
1,25D↓
BONEKIDNEY CIRCULATION
219
part, by the supply of 1,25D to the bone. In the animals fed the low calcium diet, the
high circulating levels of 1,25D may be sufficient for the supply of 1,25D to the bone
for 1,25D-mediated bone processes, which reduced the need for locally produced
1,25D (Figure 8.1). In the animals fed the high calcium diet, the low circulating 1,25D
levels may cause the increase in CYP27B1 mRNA expression in the bone and the
local production of 1,25D (Figure 8.2). The positive correlation between serum
calcitonin levels and the expression of CYP27B1 mRNA in the bone suggests that the
calcitonin may be involved in the production of 1,25D in the bone. It is possible,
therefore, that an increase in 1,25D production in the bone, either by the absence of
inhibition by circulating 1,25D levels or by calcitonin-mediated stimulation, may
ensure that the 1,25D-mediated bone mineralisation continues normally in the event
of a reduction in circulating 1,25D levels.
The third and fourth hypotheses are related to the effect of vitamin D-depletion and
the combined effect of dietary calcium concentration and vitamin D-status, on the
expression of CYP27B1, CYP24 and VDR mRNA in the kidney and in the bone. The
depletion of vitamin D abolished the expression of CYP24 mRNA in the kidney,
which was independent of the concentration of calcium in the diet. The CYP27B1
mRNA expression in the kidney of the vitamin D-depleted animals was, however,
dependent on the amount of calcium that was added to this diet.
When the vitamin D-deplete animals were fed a low calcium diet, the expression of
CYP27B1 mRNA in the kidney was markedly induced by the elevated serum PTH
levels, which occurred as a result of the pronounced hypocalcemia (Figure 8.3).
Despite the drive towards increased 1,25D production, the circulating levels of serum
220
1,25D were low due to the depletion of 25D levels. When the vitamin D-deplete
animals were fed a high calcium diet, the requirement for the 1,25D-mediated
intestinal calcium absorption was reduced and, therefore, the emphasis on the renal
synthesis of 1,25D was also reduced (Figure 8.4).
Unlike in the kidney, the expression of CYP27B1 mRNA in the bone was low in the
vitamin D-deplete animals fed the low calcium diet. While serum PTH potently up-
regulated the expression of renal CYP27B1 mRNA of these animals, it appears that
the expression of CYP27B1 mRNA in the bone is not stimulated by serum PTH
(Figure 8.3). In the vitamin D-deplete animals that were fed the high calcium diet, the
expression of CYP27B1 in the bone was high. The increased levels of serum calcium
in these animals were correlated with the increased expression of CYP27B1 mRNA in
the bone (Figure 8.4), suggesting that when serum calcium levels are normal, the
production of 1,25D in the bone is also increased. The positive association between
CYP27B1 mRNA expression in the bone and BV/TV in the epiphysis of the vitamin
D-deplete animals suggests that as serum calcium levels increase with the
consumption of a high calcium diet, the production of 1,25D in the bone may occur to
mediate the bone mineralisation. Along with finding that CYP27B1 mRNA
expression in the bone in the vitamin D-replete animals fed the high calcium diet,
1,25D production in the bone may ensure that bone mineralisation proceeds when the
supply of renal 1,25D is insufficient, provided that the supply of calcium is adequate.
The difference in the coordinated regulation of the expression of CYP27B1 and
CYP24 mRNA found between the kidney and the bone is likely to reflect the different
roles of the 1,25D produced in these tissues. In the kidney, the reciprocal regulation of
221
Figure 7.3 Diagram representing the proposed effects of the vitamin D-deplete/low
calcium (D(-)/LC) diet on the expression of CYP27B1 and CYP24 in the kidney and
bone. In response to the vitamin D-depletion and low calcium diet, serum PTH levels
are markedly induced, which results in high CYP27B1 mRNA expression in the
kidney. Despite the high CYP27B1 activity, the production of 1,25D is low due to the
depleted 25D levels and 1,25D-mediated intestinal calcium absorption is unable to
occur. In the bone, CYP27B1 mRNA expression appears to be inhibited by serum
PTH and may also be suppressed due to low serum levels of calcium and calcitonin.
Bone CYP24 mRNA levels correspond to the low production of 1,25D in the bone.
1,25D-mediated bone mineralisation is abnormal due to the lack of 1,25D production
in either the kidney or the bone.
1,25D↓
Ca++↓↓ 25D↓
CYP27b1↑↑
CYP24↓ CYP24↓
PTH↑↑ CYP27b1↓
1,25D↓
DIET: Vitamin D-Deplete + Low Calcium
1,24,25D 1,24,25D
25D↓
VDR +1
Abnormal BoneMineralisation
CYP24↓
24,25D
Intestinal Caabsorption
Calcitonin↓
1,25D↓
BONEKIDNEY CIRCULATION
222
Figure 7.4 Diagram representing the proposed effects of the vitamin D-deplete/high
calcium (D(-)/HC) diet on the expression of CYP27B1 and CYP24 in the kidney and
bone. In response to the vitamin D-depletion and high calcium diet, the low serum
PTH levels result in low expression of CYP27B1 mRNA in the kidney. Serum
calcium levels also directly suppresses the expression of CYP27B1 in the kidney. The
expression of CYP2 4 in the kidney is, however, low due to the low serum levels of
25D and 1,25D. Serum calcium and calcitonin stimulates the expression of CYP27B1
in the bone. The rise in bone CYP27B1 activity increases in the production of 1,25D
in the bone and consequently the levels of CYP24 activity. 1,25D-mediated bone
mineralisation is normal due to the production of 1,25D in the bone.
1,25D↓
Ca++b 25D↓
CYP27b1↓
CYP24↓ CYP24↑
PTH↓ CYP27b1↑
1,25D↓↓
DIET: Vitamin D-Deplete + High Calcium
1,24,25D 1,24,25D
25D↓
VDR +1
Normal BoneMineralisation
CYP24↓
24,25D
Intestinal Caabsorption
Calcitonin↑
1,25D↓↓
BONEKIDNEY CIRCULATION
223
the expression of CYP27B1 and CYP24 mRNA ensures that appropriate amounts of
1,25D are supplied to the circulation to mediate intestinal calcium absorption and
other processes involved in calcium homeostasis. In the kidney, the expression of
CYP27B1 mRNA is stimulated by PTH during hypocalcemia and the expression of
CYP24 mRNA may be stimulated by serum calcitonin during normocalcemia. In the
bone, however, the strong coupling of the expression of CYP27B1 and CYP24
mRNA found in studies investigating the effects of age, dietary calcium and vitamin
D status, suggests that the locally produced 1,25D acts in an autocrine or paracrine
manner to initiate 1,25D-mediated processes. It is possible that the production of
1,25D in the bone may be the primary source of 1,25D required for local processes.
This is supported by the finding that, in the bone, CYP24 mRNA expression is
primarily concerned with the catabolism of locally produced 1,25D, rather than with
the catabolism of the circulating 1,25D. Such a proposal would, however, require
further investigation. The mechanism that would allow CYP24 in the bone to
catabolise the locally produced 1,25D, rather than the circulating 1,25D, is likely to
involve other biological factors that regulate the expression of CYP24 in this tissue.
The absence of the PTH-mediated down-regulation of the expression of CYP24
mRNA, found in young, developing animals and in vitamin D-deplete animals fed a
high calcium diet, may stimulate the expression of CYP24 mRNA in the bone and
allow for the specific catabolism of locally produced 1,25D.
7.2 Limitations
The design of the experiments in this thesis was such that it is difficult to conclusively
demonstrate that the regulation of the transcriptional activity of CYP271b, CYP24 or
VDR was due solely to one or more factors. The associations between specific gene
expression and factors known to be involved in vitamin D metabolism and calcium
224
homeostasis generates hypotheses to the regulation of vitamin D metabolism. Further
studies, however, investigating the specific regulation of CYP27B1 in the bone would
be required to substantiate these hypotheses.
The hypotheses generated in this thesis are largely based on the assumption that the
measurement of absolute levels mRNA extracted from tissue are representative of the
protein levels and activity. The strong associations between both the expression of
CYP27B1, CYP24 mRNA in the kidney and serum 1,25D levels found in this thesis
suggests the measurement of these mRNA species are a reasonable estimate of the
activity of their respective enzymes. It is less clear, however, whether the levels of
CYP27B1 and CYP24 in the bone directly relate to the activity of these enzymes and
the production of 1,25D in the bone. Furthermore, previous studies have shown that
VDR mRNA levels do not necessarily directly relate to the protein levels of VDR.
Future experiments may incorporate the measurement of protein levels of CYP27B1,
CYP24 and VDR by western blot analysis to ascertain the relationship between
mRNA expression of the genes investigated in this thesis and the protein levels and
activity. Alternatively, it is possible to conduct enzyme activity assays, which would
be able to determine the activity of CYP27B1 and CYP24 enzymes under different
physiological conditions. Immunohistochemistry could also be used to identify VDR
protein in the kidney and bone.
The identification of the specific bone cell types that express CYP27B1 mRNA was
limited by the sensitivity of method. CYP27B1 mRNA is lowly expressed and it is
possible that the particular method of in situ hybridisation that we employed was
unable to detect all the cell types that expressed this gene. Besides this, the bone
225
marrow cells that were found to contain CYP27B1 mRNA could not be precisely
identified due to their undifferentiated nature. In the mouse and human, it is possible
to select and purify specific cell types from the bone marrow, which would have
allowed us to clearly identify the cell types that express CYP27B1 mRNA. The
available antibodies required to select the cell types were, however, too few in the rat
to warrant this course of action.
7.3 Future Directions
The distinct regulation of CYP27B1 and CYP24 mRNA in the bone, which appears to
be associated with process of bone mineralisation, is one of the most important
observations made in this thesis. To further investigate this possibility, the infusion of
25D directly into one femur of vitamin D-deplete animals would allow us to compare
the femur given adequate 25D levels and the other femur, which is in a 25D-deplete
environment within the same animal. The expression of CYP27B1 mRNA and the
histological examination of these bones would then be able to give a clear link
between the production of 1,25D in the bone and measurements of bone
mineralisation.
A transgenic mouse, which expresses the luciferase reporter gene under the control of
1.5kb promoter of the CYP27B1 gene, has recently been developed in our laboratory.
In future, specific truncations and deletions in the promoter of the CYP27B1 gene
could be used in a similar transgenic animal model to identify whether specific factors
such as serum calcium, calcitonin and PTH are directly involved in the expression of
the CYP27B1 gene in the bone.
226
Bibliography
Abe E, Miyaura C, Sakagami H, Takeda M, Konno K, Yamazaki T, Yoshiki S, Suda
T. 1981. Differentiation of mouse myeloid leukemia cells induced by 1 alpha,25-
dihydroxyvitamin D3. Proc Natl Acad Sci USA 78(8): 4990-4.
Abu-Amer Y and Bar-Shavit Z. 1993. Impaired bone marrow-derived macrophage
differentiation in vitamin D deficiency. Cell Immunol 151(2): 356-68.
Abu-Amer Y and Bar-Shavit Z. 1994. Regulation of TNF-alpha release from bone
marrow-derived macrophages by vitamin D. J Cell Biochem 55(4): 435-44.
Abou-Samra AB, Juppner H, Kong XF, Schipani E, Iida-Klein A, Karga H, Urena P,
Gardella TF, Potts JT Jr, Kronenberg HM 1994. Structure, function, and expression of
the receptor for parathyroid hormone and parathyroid hormone-related peptide. Adv
Nephrol Necker Hosp(23): 247-64.
Adams JS, Beeker TG, Hongo T, Clemens TL. 1990. Constitutive expression of a
vitamin D 1-hydroxylase in a myelomonocytic cell line: a model for studying 1,25-
dihydroxyvitamin D production in vitro. J Bone Miner Res 5(12): 1265-9.
Adams DO and Hamilton TA. 1984. The cell biology of macrophage activation. Annu
Rev Immunol 2: 283-318.
227
Adams JS and Gacad MA. 1985. Characterization of 1 alpha-hydroxylation of vitamin
D3 sterols by cultured alveolar macrophages from patients with sarcoidosis. J Exp
Med 161(4): 755-65.
Akeno N, Saikatsu S and Horiuchi N. 1993. Increase of renal 25-hydroxyvitamin D3-
24-hydroxylase activity and its messenger ribonucleic acid level in 1 alpha-
hydroxyvitamin D3-administered rats: possibility of the presence of two forms of 24-
hydroxylase. J Nutr Sci Vitaminol (Tokyo) 39(2): 89-100.
Amling M, Priemel M, Holzmann T, Chapin K, Rueger JM, Baron R and Demay MB.
1999. Rescue of the skeletal phenotype of vitamin D receptor-ablated mice in the
setting of normal mineral ion homeostasis: formal histomorphometric and
biomechanical analyses. Endocrinology 140(11): 4982-7.
Andersson S, Davis DL, Dahlback H, Jornvall H, Russell DW. 1989. Cloning,
structure, and expression of the mitochondrial cytochrome P-450 sterol 26-
hydroxylase, a bile acid biosynthetic enzyme. J Biol Chem 264(14): 8222-9.
Arbour NC, Prahl JM and DeLuca HF. 1993. Stabilization of the vitamin D receptor
in rat osteosarcoma cells through the action of 1,25-dihydroxyvitamin D3. Mol
Endocrinol 7(10): 1307-12.
Armbrecht HJ and Boltz MA. 1991. Expression of 25-hydroxyvitamin D 24-
hydroxylase cytochrome P450 in kidney and intestine. Effect of 1,25-
dihydroxyvitamin D and age. FEBS Lett 292(1-2): 17-20.
228
Armbrecht HJ, Boltz M, Strong R, Richardson A, Bruns ME and Christakos S. 1989.
Expression of calbindin-D decreases with age in intestine and kidney. Endocrinology
125(6): 2950-6.
Armbrecht HJ, Chen ML, Hodam TL and Boltz MA. 1997(a). Induction of 24-
hydroxylase cytochrome P450 mRNA by 1,25-dihydroxyvitamin D and phorbol esters
in normal rat kidney (NRK-52E) cells. J Endocrinol 153(2): 199-205.
Armbrecht HJ and Hodam TL. 1994. Parathyroid hormone and 1,25-
dihydroxyvitamin D synergistically induce the 1,25-dihydroxyvitamin D-24-
hydroxylase in rat UMR-106 osteoblast- like cells. Biochem Biophys Res Commun
205(1): 674-9.
Armbrecht HJ, Hodam TL, Boltz MA and Kumar VB. 1999. Capacity of a low
calcium diet to induce the renal vitamin D 1a-hydroxylase is decreased in adult rats.
Biochem Biophys Res Commun 255(3): 731-4.
Armbrecht HJ, Hodam TL, Boltz MA, Partridge NC, Brown AJ and Kumar VB. 1998.
Induction of the vitamin D 24-hydroxylase (CYP24) by 1,25-dihydroxyvitamin D3 is
regulated by parathyroid hormone in UMR106 osteoblastic cells. Endocrinology
139(8): 3375-81.
Armbrecht HJ, Wongsurawat VJ, Hodam TL and Wongsurawat N. 1997(b). Insulin
markedly potentiates the capacity of parathyroid hormone to increase expression of
229
25-hydroxyvitamin D3-24-hydroxylase in rat osteoblastic cells in the presence of
1,25-dihydroxyvitamin D3. FEBS Lett 393(1): 77-80.
Armbrecht HJ, Wongsurawat N and Paschal RE. 1987. Effect of age on renal
responsiveness to parathyroid hormone and calcitonin in rats. J Endocrinol 114(2):
173-8.
Armbrecht HJ, Zenser TV and Davis BB. 1981. Conversion of 25-hydroxyvitamin D3
to 1,25-dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 in renal slices from the
rat. Endocrinology 109(1): 218-22.
Baker AR, McDonnell DP, Hughes M, Crisp TM, Mangelsdorf DJ, Haussler MR,
Pike JW, Shine J and O'Malley BW. 1988. Cloning and expression of full-length
cDNA encoding human vitamin D receptor. Proc Natl Acad Sci USA 85(10): 3294-8.
Bar A, Shani M, Fullmer CS, Brindak ME, Striem S. 1990. Modulation of chick
intestinal and renal calbindin gene expression by dietary vitamin D3, 1,25-
dihydroxyvitamin D3, calcium and phosphorus. Mol Cell Endocrinol 72(1): 23-31.
Barbour GL, Coburn JW, Slatopolsky E, Norman AW and Horst RL. 1981.
Hypercalcemia in an anephric patient with sarcoidosis: evidence for extrarenal
generation of 1,25-dihydroxyvitamin D. N Engl J Med 305(8): 440-3.
230
Beckman MJ, Goff JP, Reinhardt TA, Beitz DC and Horst RL. 1994. In vivo
regulation of rat intestinal 24-hydroxylase: potential new role of calcitonin.
Endocrinology 135(5): 1951-5.
Beckman MJ, Johnson JA, Goff JP, Reinhardt TA, Beitz DC and Horst RL. 1997. The
role of dietary calcium in the physiology of vitamin D toxicity: excess dietary vitamin
D3 blunts parathyroid hormone induction of kidney 1-hydroxylase. 574.1905 A67
319(2): 535-9.
Beckman MJ and DeLuca HF. 2002. Regulation of renal vitamin D receptor is an
important determinant of 1alpha,25-dihydroxyvitamin D(3) levels in vivo. Arch
Biochem Biophys 401(1): 44-52.
Bell NH. 1998. Renal and nonrenal 25-hydroxyvitamin D-1alpha-hydroxylases and
their clinical significance. J Bone Miner Res 13(3): 350-3.
Bhattacharyya MH and DeLuca HF. 1974. Subcellular location of rat liver calciferol-
25-hydroxylase. Arch Biochem Biophys 160(1): 58-62.
Bland R, Walker EA, Hughes SV, Stewart PM and Hewison M. 1999. Constitutive
expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in a transformed human
proximal tubule cell line: evidence for direct regulation of vitamin D metabolism by
calcium. Endocrinology 140(5): 2027-34.
231
Blunt JW, Tanaka Y, DeLuca HF. 1968. Biological activity of 25-
hydroxycholecalciferol, a metabolite of vitamin D3. Proc Natl Acad Sci USA 61(4):
1503-6.
Booth BE, Tsai HC, Morris RC Jr. 1977. Parathyroidectomy reduces 25-
hydroxyvitamin D3-1 alpha-hydroxylase activity in the hypocalcemic vitamin D-
deficient chick. J Clin Invest 60(6): 1314-20.
Booth BE, Tsai HC and Morris RC Jr. 1985. Vitamin D status regulates 25-
hydroxyvitamin D3-1 alpha-hydroxylase and its responsiveness to parathyroid
hormone in the chick. J Clin Invest 75(1): 155-61.
Bouillon R, Bex M, Van Herck E, Laureys J, Dooms L, Lesaffre E and Ravussin E.
1995. Influence of age, sex, and insulin on osteoblast function: osteoblast dysfunction
in diabetes mellitus. J Clin Endocrinol Metab 80(4): 1194-202.
Boyle IT, Gray RW and DeLuca HF. 1971. Regulation by calcium of in vivo
synthesis of 1,25-dihydroxycholecalciferol and 21,25-dihydroxycholecalciferol. Proc
Natl Acad Sci USA 68(9): 2131-4.
Brenza HL and DeLuca HF. 2000. Regulation of 25-hydroxyvitamin D3 1alpha-
hydroxylase gene expression by parathyroid hormone and 1,25-dihydroxyvitamin D3.
Arch Biochem Biophys 381(1): 143-52.
232
Brenza HL, Kimmel-Jehan C, Jehan F, Shinki T, Wakino S, Anazawa H, Suda T and
DeLuca HF. 1998. Parathyroid hormone activation of the 25-hydroxyvitamin D3-
1alpha- hydroxylase gene promoter. Proc Natl Acad Sci USA 95(4): 1387-91.
Brown EM and Hebert SC. 1997. Calcium-receptor-regulated parathyroid and renal
function. Bone 20(4): 303-9.
Burmester JK, Maeda N and DeLuca HF. 1988(a). Isolation and expression of rat
1,25-dihydroxyvitamin D3 receptor cDNA. Proc Natl Acad Sci USA 85(4): 1005-9.
Burmester JK, Wiese RJ, Maeda N and DeLuca HF. 1988(b). Structure and regulation
of the rat 1,25-dihydroxyvitamin D3 receptor. Proc Natl Acad Sci USA 85(24): 9499-
502.
Bustin SA, Gyselman VG, Williams NS and Dorudi S. 1999. Detection of
cytokeratins 19/20 and guanylyl cyclase C in peripheral blood of colorectal cancer
patients. Br J Cancer 79(11-12): 1813-20.
Cali JJ, Russell DW. 1991. Characterization of human sterol 27-hydroxylase. A
mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile
acid biosynthesis. J Biol Chem 266(12): 7774-8.
Cantley LK, Russell J, Lettieri D and Sherwood LM. 1985. 1,25-Dihydroxyvitamin
D3 suppresses parathyroid hormone secretion from bovine parathyroid cells in tissue
233
culture. Endocrinology 117(5): 2114-9.
Celic S, Katayama Y, Chilco PJ, Martin TJ and Findlay DM. 1998. Type I collagen
influence on gene expression in UMR106-06 osteoblast-like cells is inhibited by
genistein. J Endocrinol 158(3): 377-88.
Chakravarti D, LaMorte VJ, Nelson MC, Nakajima T, Schulman IG, Juguilon H,
Montminy M and Evans RM. 1996. Role of CBP/P300 in nuclear receptor signalling.
Nature 383(6595): 99-103.
Chan YL, McKay C, Dye E and Slatopolsky E. 1986. The effect of 1,25
dihydroxycholecalciferol on parathyroid hormone secretion by monolayer cultures of
bovine parathyroid cells. Calcif Tissue Int 38(1): 27-32.
Chang W, Tu C, Pratt S, Chen TH and Shoback D. 2002. Extracellular Ca2+-Sensing
Receptors Modulate Matrix Production and Mineralization in Chondrogenic
RCJ3.1C5.18 Cells. Endocrinology 143(4): 1467-74.
Chapuy MC, Arlot ME, Duboeuf F, Brun J, Crouzet B, Arnaud S, Delmas PD,
Meunier PJ. 1992. Vitamin D3 and calcium to prevent hip fractures in the elderly
women. N Engl J Med 327(23): 1637-42.
Chen KS and DeLuca HF. 1995. Cloning of the human 1 alpha,25-dihydroxyvitamin
D-3 24-hydroxylase gene promoter and identification of two vitamin D-responsive
elements. Biochim Biophys Acta 1263(1): 1-9.
234
Chen ML, Boltz MA, Armbrecht HJ. 1993. Effects of 1,25-dihydroxyvitamin D3 and
phorbol ester on 25-hydroxyvitamin D3 24-hydroxylase cytochrome P450 messenger
ribonucleic acid levels in primary cultures of rat renal cells. Endocrinology 132(4):
1782-8.
Chen TL, Hauschka PV and Feldman D. 1986(a). Dexamethasone increases 1,25-
dihydroxyvitamin D3 receptor levels and augments bioresponses in rat osteoblast-like
cells. Endocrinology 118(3): 1119-26.
Chen TL, Li JM, Ye TV, Cone CM and Feldman D. 1986(b). Hormonal responses to
1,25-dihydroxyvitamin D3 in cultured mouse osteoblast-like cells--modulation by
changes in receptor level. J Cell Physiol 126(1): 21-8.
Chomczynski P and Sacchi N. 1987. Single-step method of RNA isolation by acid
guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162(1): 156-9.
Choong PF, Martin TJ and Ng KW. 1993. Effects of ascorbic acid, calcitriol, and
retinoic acid on the differentiation of preosteoblasts. J Orthop Res 11(5): 638-47.
Clark SA, Boass A and Toverud SU. 1987. Effects of high dietary contents of calcium
and phosphorus on mineral metabolism and growth of vitamin D-deficient suckling
and weaned rats. Bone Miner 2(4): 257-70.
235
Clemens TL, Garrett KP, Zhou XY, Pike JW, Haussler MR and Dempster DW. 1988.
Immunocytochemical localization of the 1,25-dihydroxyvitamin D3 receptor in target
cells. Endocrinology 122(4): 1224-30.
Clohisy DR, Bar-Shavit Z, Chappel JC and Teitelbaum SL. 1987. 1,25-
Dihydroxyvitamin D3 modulates bone marrow macrophage precursor proliferation
and differentiation. Up-regulation of the mannose receptor. Journal of Biological
Chemistry 262(33): 15922-9.
Cooke NE, Haddad JG. 1989. Vitamin D binding protein (Gc-globulin). Endocr Rev 10(3): 294-307.
Cooke NE, McLeod JF, Wang XK, Ray K. 1991. Vitamin D binding protein: genomic
structure, functional domains, and mRNA expression in tissues. J Steroid Biochem
Mol Biol 40(4-6): 787-93.
Costa EM and Feldman D. 1987. Modulation of 1,25-dihydroxyvitamin D3 receptor
binding and action by sodium butyrate in cultured pig kidney cells (LLC-PK1). J
Bone Miner Res 2(2): 151-9.
Darwish HM and DeLuca HF. 1996. Analysis of binding of the 1,25-
dihydroxyvitamin D3 receptor to positive and negative vitamin D response elements.
Arch Biochem Biophys 334(2): 223-34.
236
Davey RA, Hahn CN, May BK and Morris HA. 2000. Osteoblast gene expression in
rat long bones: effects of ovariectomy and dihydrotestosterone on mRNA levels.
Calcif Tissue Int 67(1): 75-9.
DeLuca HF. 1988. The vitamin D story: a collaborative effort of basic science and
clinical medicine. Faseb J 2(3): 224-36.
Demers C, Lemay J, Hendy GN and Gascon-Barre M. 1997. Comparative in vivo
expression of the calcitriol-24-hydroxylase gene in kidney and intestine. J Mol
Endocrinol 18(1): 37-48.
Dokoh S, Donaldson CA and Haussler MR. 1984. Influence of 1,25-dihydroxyvitamin
D3 on cultured osteogenic sarcoma cells: correlation with the 1,25-dihydroxyvitamin
D3 receptor. Cancer Res 44(5): 2103-9.
Dusso AS, Kamimura S, Gallieni M, Zhong M, Negrea L, Shapiro S and Slatopolsky
E. 1997. gamma-Interferon-induced resistance to 1,25-(Oh)2 D3 in human monocytes
and macrophages: a mechanism for the hypercalcemia of various granulomatoses. J
Clin Endocrinol Metab 82(7): 2222-32.
Dwivedi PP, Omdahl JL, Kola I, Hume DA and May BK. 2000. Regulation of rat
cytochrome P450C24 (CYP24) gene expression. Evidence for functional cooperation
of Ras-activated Ets transcription factors with the vitamin D receptor in 1,25-
dihydroxyvitamin D(3)-mediated induction. J Biol Chem 275(1): 47-55.
237
Ebeling PR, Sandgren ME, DiMagno EP, Lane AW, DeLuca HF and Riggs BL. 1992.
Evidence of an age-related decrease in intestinal responsiveness to vitamin D:
relationship between serum 1,25-dihydroxyvitamin D3 and intestinal vitamin D
receptor concentrations in normal women. J Clin Endocrinol Metab 75(1): 176-82.
Econs MJ, Lobaugh B and Drezner MK. 1992. Normal calcitonin stimulation of
serum calcitriol in patients with X- linked hypophosphatemic rickets. J Clin
Endocrinol Metab 75(2): 408-11.
Eriksen EF, Steiniche T, Mosekilde L, Melsen F. 1989. Histomorphometric analysis
of bone in metabolic bone disease. Endocrinol Metab Clin North Am 18(4): 919-54.
Eto TA, Nakamura Y, Taniguchi T, Miyamoto K, Nagatomo J, Maeda Y, Higashi S,
Okuda K and Setoguchi T. 1998. Assay of 25-hydroxyvitamin D3 1 alpha-
hydroxylase in rat kidney mitochondria. Anal Biochem 258(1): 53-8.
Forrest SM, Ng KW, Findlay DM, Michelangeli VP, Livesey SA, Partridge NC, Zajac
JD and Martin TJ. 1985. Characterization of an osteoblast-like clonal cell line, which
responds to both parathyroid hormone and calcitonin. Calcif Tissue Int 37(1): 51-6.
Fort P, Marty L, Piechaczyk M, el Sabrouty S, Dani C, Jeanteur P and Blanchard JM.
1985. Various rat adult tissues express only one major mRNA species from the
glyceraldehyde-3-phosphate-dehydrogenase multigenic family. Nucleic Acids Res
13(5): 1431-42.
238
Fox J, Kollenkirchen U and Walters MR. 1991. Deficiency of vitamin D metabolites
directly stimulates renal 25- hydroxyvitamin D3-1-hydroxylase activity in rats.
Metabolism 40(4): 438-41.
Fraser DR and Kodicek E. 1973. Regulation of 25-hydroxycholecalciferol-1-
hydroxylase activity in kidney by parathyroid hormone. Nat New Biol 241(110): 163-
6.
Friedman PA, Gesek FA. 1993. Vitamin D3 accelerates PTH-dependent calcium
transport in distal convoluted tubule cells. Am J Physiol 265(2 Pt 2): F300-8.
Frolich A, Nielsen BF and Transbol I. 1990. Respective roles of 25 hydroxy-vitamin
D, PTH, phosphate and renal function for the 1-alpha-hydroxylase activity in primary
hyperparathyroidism. Miner Electrolyte Metab 16(4): 210-5.
Fu GK, Lin D, Zhang MY, Bikle DD, Shackleton CH, Miller WL and Portale AA,
1997(a). Cloning of human 25-hydroxyvitamin D-1 alpha-hydroxylase and mutations
causing vitamin D-dependent rickets type 1. Mol Endocrinol 11(13): 1961-70.
Fu GK, Portale AA, Miller WL. 1997(b). Complete structure of the human gene for
the vitamin D 1alpha-hydroxylase, P450c1alpha. DNA Cell Biol 16(12): 1499-507
Furuichi T, Kawata S, Asoh Y, Kumaki K and Ohyama Y. 1998. Differential time
course of induction of 1alpha,25-dihydroxyvitamin D3- 24-hydroxylase mRNA
expression in rats by 1alpha,25-dihydroxyvitamin D3 and its analogs. Life Sci 62(5):
453-9.
239
Galante L, Colston KW, MacAuley SJ, MacIntyre I. 1972. Effect of calcitonin on
vitamin D metabolism. Nature 238(5362): 271-3.
Gallagher JC, Riggs BL. 1990. Action of 1,25-dihydroxyvitamin D3 on calcium
balance and bone turnover and its effect on vertebral fracture rate. Metabolism 39(4
Suppl 1): 30-4.
Gallagher JC and Riggs BL. 1978. Current concepts in nutrition. Nutrition and bone
disease. N Engl J Med 298(4): 193-5.
Gallagher JC, Riggs B, Eisman J, Hamstra A, Arnaud SB, DeLuca HF. 1979.
Intestinal calcium absorption and serum vitamin D metabolites in normal subjects and
osteoporotic patients: effect of age and dietary calcium. J Clin Invest 64(3): 729-36.
Gao XH, Dwivedi PP, Choe S, Alba F, Morris HA, Omdahl JL, May BK. 2002. Basal
and parathyroid hormone induced expression of the human 25-hydroxyvitamin D
1alpha-hydroxylase gene promoter in kidney AOK-B50 cells: role of Sp1, Ets and
CCAAT box protein binding sites. Int J Biochem Cell Biol 34(8): 921-30.
Garabedian M, Holick MF, Deluca HF and Boyle IT. 1972. Control of 25-
hydroxycholecalciferol metabolism by parathyroid glands. Proc Natl Acad Sci USA
69(7): 1673-6.
240
Garrett JE, Tamir H, Kifor O, Simin RT, Rogers KV, Mithal A, Gagel RF and Brown
EM. 1995. Calcitonin-secreting cells of the thyroid express an extracellular calcium
receptor gene. Endocrinology 136(11): 5202-11.
Glass CK, Rose DW, Rosenfeld MG. 1997. Nuclear receptor coactivators. Curr Opin
Cell Biol 9(2): 222-32.
Goff JP, Reinhardt TA, Beckman MJ and Horst RL. 1990. Contrasting effects of
exogenous 1,25-dihydroxyvitamin D [1,25-(OH)2D] versus endogenous 1,25-
(OH)2D, induced by dietary calcium restriction, on vitamin D receptors.
Endocrinology 126(2): 1031-5.
Gray TK and Cohen MS. 1985. Vitamin D, phagocyte differentiation and immune
function. Surv Immunol Res 4(3): 200-12.
Gray R, Boyle I and DeLuca HF. 1971. Vitamin D metabolism: the role of kidney
tissue. Science 172(989): 1232-4.
Gronthos S, Stewart K, Graves SE, Hay S and Simmons PJ. 1997. Integrin expression
and function on human osteoblast-like cells. J Bone Miner Res 12(8): 1189-97.
Gruber R, Czerwenka K, Wolf F, Ho GM, Willheim M and Peterlik M. 1999.
Expression of the vitamin D receptor, of estrogen and thyroid hormone receptor
alpha- and beta-isoforms, and of the androgen receptor in cultures of native mouse
bone marrow and of stromal/osteoblastic cells. Bone 24(5): 465-73.
241
Gyetko MR, Hsu CH, Wilkinson CC, Patel S and Young E. 1993. Monocyte 1 alpha-
hydroxylase regulation: induction by inflammatory cytokines and suppression by
dexamethasone and uremia toxin. J Leukoc Biol 54(1): 17-22.
Habel B and Glaser R. 1998. Human osteoblast-like cells respond not only to the
extracellular calcium concentration but also to its changing rate. Eur Biophys J 27(4):
411-6.
Hahn CN, Kerry DM, Omdahl JL and May BK. 1994. Identification of a vitamin D
responsive element in the promoter of the rat cytochrome P450(24) gene. Nucleic
Acids Res 22(12): 2410-6.
Henry HL. 1982. The role of parathyroid hormone in the regulation of the metabolism
of 25-hydroxyvitamin D3. Miner Electrolyte Metab 8(3-4): 179-87.
Henry HL. 1985. Parathyroid hormone modulation of 25-hydroxyvitamin D3
metabolism by cultured chick kidney cells is mimicked and enhanced by forskolin.
Endocrinology 116(2): 503-10.
Henry H L. 1986. Influence of a tumor promoting phorbol ester on the metabolism of
25-hydroxyvitamin D3. Biochem Biophys Res Commun 139(2): 495-500.
Henry HL. 1992. Vitamin D hydroxylases. J Cell Biochem 49(1): 4-9.
242
Henry HL, Dutta C, Cunningham N, Blanchard R, Penny R, Tang C, Marchetto G and
Chou SY. 1992. The cellular and molecular regulation of 1,25(OH)2D3 production. J
Steroid Biochem Mol Biol 41(3-8): 401-7.
Henry HL and Luntao EM. 1989. Interactions between intracellular signals involved
in the regulation of 25-hydroxyvitamin D3 metabolism. Endocrinology 124(5): 2228-
34.
Henry HL, Midgett RJ and Norman AW. 1974. Regulation of 25-hydroxyvitamin D3-
1-hydroxylase in vivo. J Biol Chem 249(23): 7584-92.
Higuchi R, Fockler C, Dollinger G and Watson R. 1993. Kinetic PCR analysis: real-
time monitoring of DNA amplification reactions. Biotechnology (N Y) 11(9): 1026-
30.
Holland PM, Abramson RD, Watson R and Gelfand DH. 1991. Detection of specific
polymerase chain reaction product by utilizing the 5'----3' exonuclease activity of
Thermus aquaticus DNA polymerase. Proc Natl Acad Sci USA 88(16): 7276-80.
Hollis BW, Pittard WB 3rd, Reinhardt TA. 1986. Relationships among vitamin D, 25-
hydroxyvitamin D, and vitamin D-binding protein concentrations in the plasma and
milk of human subjects. J Clin Endocrinol Metab 62(1): 41-4.
Horiuchi N, Suda T, Takahashi H, Shimazawa E and Ogata E. 1977. In vivo evidence
for the intermediary role of 3',5'-cyclic AMP in parathyroid hormone-induced
243
stimulation of 1alpha,25-dihydroxyvitamin D3 synthesis in rats. Endocrinology
101(3): 969-74.
Horst RL, Goff JP and Reinhardt TA. 1990. Advancing age results in reduction of
intestinal and bone 1,25-dihydroxyvitamin D receptor. Endocrinology 126(2): 1053-7.
House MG, Kohlmeier L, Chattopadhyay N, Kifor O, Yamaguchi T, Leboff MS,
Glowacki J and Brown EM. 1997. Expression of an extracellular calcium-sensing
receptor in human and mouse bone marrow cells. J Bone Miner Res 12(12): 1959-70.
Howard GA, Turner RT, Sherrard DJ and Baylink DJ. 1981. Human bone cells in
culture metabolize 25-hydroxyvitamin D3 to 1,25-dihydroxyvitamin D3 and 24,25-
dihydroxyvitamin D3. J Biol Chem 256(15): 7738-40.
Ichikawa F, Sato K, Nanjo M, Nishii Y, Shinki T, Takahashi N and Suda T. 1995.
Mouse primary osteoblasts express vitamin D3 25-hydroxylase mRNA and convert 1
alpha-hydroxyvitamin D3 into 1 alpha,25-dihydroxyvitamin D3. Bone 16(1): 129-35.
Ikegame M, Rakopoulos M, Martin TJ, Moseley JM and Findlay DM. 1996. Effects
of continuous calcitonin treatment on osteoclast-like cell development and calcitonin
receptor expression in mouse bone marrow cultures. J Bone Miner Res 11(4): 456-65.
Ishida M, Bulos B, Takamoto S and Sacktor B. 1987. Hydroxylation of 25-
hydroxyvitamin D3 by renal mitochondria from rats of different ages. Endocrinology
121(2): 443-8.
244
Itoh S, Yoshimura T, Iemura O, Yamada E, Tsujikawa K, Kohama Y and Mimura T.
1995. Molecular cloning of 25-hydroxyvitamin D-3 24-hydroxylase (Cyp-24) from
mouse kidney: its inducibility by vitamin D-3. Biochim Biophys Acta 1264(1): 26-8.
Janulis M, Tembe V and Favus MJ. 1992. Role of protein kinase C in parathyroid
hormone stimulation of renal 1,25-dihydroxyvitamin D3 secretion. J Clin Invest
90(6): 2278-83.
Jenis LG, Lian JB, Stein GS and Baran DT. 1993. 1 alpha,25-dihydroxyvitamin D3-
induced changes in intracellular pH in osteoblast-like cells modulate gene expression.
J Cell Biochem 53(3): 234-9.
Johnson JA, Beckman MJ, Pansini-Porta A, Christakos S, Bruns ME, Beitz DC, Horst
RL and Reinhardt TA. 1995. Age and gender effects on 1,25-dihydroxyvitamin D3-
regulated gene expression. Exp Gerontol 30(6): 631-43.
Jones G, Strugnell SA and DeLuca HF. 1998. Current understanding of the molecular
actions of vitamin D. Physiol Rev 78(4): 1193-231.
Kalu DN, Cockerham R, Yu BP and Roos BA. 1983. Lifelong dietary modulation of
calcitonin levels in rats. Endocrinology 113(6): 2010-6.
245
Kalu DN, Herbert DC, Hardin RR, Yu BP, Kaplan G and Jacobs JW. 1988.
Mechanism of dietary modulation of calcitonin levels in Fischer rats. J Gerontol
43(5): B125-31.
Kamei Y, Kawada T, Fukuwatari T, Ono T, Kato S and Sugimoto E. 1995. Cloning
and sequencing of the gene encoding the mouse vitamin D receptor. Gene 152(2):
281-2.
Kawashima H, Torikai S, Kurokawa K. 1981. Calcitonin selectively stimulates 25-
hydroxyvitamin D3-1 alpha-hydroxylase in proximal straight tubule of rat kidney.
Nature 291(5813): 327-9.
Kerry DM, Dwivedi PP, Hahn CN, Morris HA, Omdahl JL and May BK. 1996.
Transcriptional synergism between vitamin D-responsive elements in the rat 25-
hydroxyvitamin D3 24-hydroxylase (CYP24) promoter. J Biol Chem 271(47): 29715-
21.
Klaus G, von Eichel B, May T, Hugel U, Mayer H, Ritz E and Mehls O. 1994.
Synergistic effects of parathyroid hormone and 1,25-dihydroxyvitamin D3 on
proliferation and vitamin D receptor expression of rat growth cartilage cells.
Endocrinology 135(4): 1307-15.
Knutson JC, DeLuca HF. 1974. 25-Hydroxyvitamin D3-24-hydroxylase. Subcellular
location and properties. Biochemistry 13(7): 1543-8.
246
Korkor AB, Gray RW, Henry HL, Kleinman JG, Blumenthal SS and Garancis JC.
1987. Evidence that stimulation of 1,25(OH)2D3 production in primary cultures of
mouse kidney cells by cyclic AMP requires new protein synthesis. J Bone Miner Res
2(6): 517-24.
Koszewski NJ, Reinhardt TA, Beitz DC and Horst RL. 1990. Developmental changes
in rat kidney 1,25-dihydroxyvitamin D receptor. Biochem Biophys Res Commun
170(1): 65-72.
Kraichely DM and MacDonald PN. 1998. Transcriptional activation through the
vitamin D receptor in osteoblasts. Front Biosci 3: D821-33.
Kreutz M, Andreesen R, Krause SW, Szabo A, Ritz E and Reichel H. 1993. 1,25-
dihydroxyvitamin D3 production and vitamin D3 receptor expression are
developmentally regulated during differentiation of human monocytes into
macrophages. Blood 82(4): 1300-7.
Krishnan AV, Cramer SD, Bringhurst FR and Feldman D. 1997. Regulation of 1,25-
dihydroxyvitamin D3 receptors by parathyroid hormone in osteoblastic cells: role of
second messenger pathways. Endocrinology 136(2): 705-12.
Kumar R. 1984. Metabolism of 1,25-dihydroxyvitamin D3. Physiol Rev 64(2): 478-
504.
247
Kumar R, Schnoes HK and DeLuca HF. 1978. Rat intestinal 25-hydroxyvitamin D3-
and 1alpha,25-dihydroxyvitamin D3- 24-hydroxylase. J Biol Chem 253(11): 3804-9.
Langdahl BL, Mortensen L, Vesterby A, Eriksen EF, Charles P. 1996. Bone
histomorphometry in hypoparathyroid patients treated with vitamin D. Bone 18(2):
103-8.
Langub MC, Reinhardt TA, Horst RL, Malluche HH and Koszewski NJ. 2000.
Characterization of vitamin D receptor immunoreactivity in human bone cells. Bone
27(3): 383-7.
Lee LG, Connell CR and Bloch W. 1993. Allelic discrimination by nick-translation
PCR with fluorogenic probes. Nucleic Acids Res 21(16): 3761-6.
Lemay J, Demers C, Hendy GN, Delvin EE and Gascon-Barre M. 1995. Expression
of the 1,25-dihydroxyvitamin D3-24-hydroxylase gene in rat intestine: response to
calcium, vitamin D3 and calcitriol administration in vivo. J Bone Miner Res 10(8):
1148-57.
Lemire JM, Adams JS, Kermani-Arab V, Bakke AC, Sakai R and Jordan SC. 1985.
1,25-Dihydroxyvitamin D3 suppresses human T helper/inducer lymphocyte activity in
vitro. J Immunol 134(5): 3032-5.
248
Lemire JM, Adams JS, Sakai R and Jordan SC. 1984. 1 alpha,25-dihydroxyvitamin
D3 suppresses proliferation and immunoglobulin production by normal human
peripheral blood mononuclear cells. J Clin Invest 74(2): 657-61.
Lemire JM and Archer DC. 1991. 1,25-dihydroxyvitamin D3 prevents the in vivo
induction of murine experimental autoimmune encephalomyelitis. J Clin Invest 87(3):
1103-7.
Leutenegger CM, von Rechenberg B, Huder JB, Zlinsky K, Mislin C, Akens MK,
Auer J and Lutz H. 1999. Quantitative real-time PCR for equine cytokine mRNA in
nondecalcified bone tissue embedded in methyl methacrylate. Calcif Tissue Int 65(5):
378-83.
Li YC, Amling M, Pirro AE, Priemel M, Meuse J, Baron R, Delling G and Demay
MB. 1998(a). Normalization of mineral ion homeostasis by dietary means prevents
hyperparathyroidism, rickets, and osteomalacia, but not alopecia in vitamin D
receptor-ablated mice. Endocrinology 139(10): 4391-6.
Li YC, Bolt MJ, Cao LP and Sitrin MD. 2001. Effects of vitamin D receptor
inactivation on the expression of calbindins and calcium metabolism. Am J Physiol
Endocrinol Metab 281(3): E558-64.
Li YC, Pirro AE and Demay MB. 1998(b). Analysis of vitamin D-dependent calcium-
binding protein messenger ribonucleic acid expression in mice lacking the vitamin D
receptor. Endocrinology 139(3): 847-51.
249
Lidor C, Sagiv P, Amdur B, Gepstein R, Otremski I, Hallel T and Edelstein S. 1993.
Decrease in bone levels of 1,25-dihydroxyvitamin D in women with subcapital
fracture of the femur. Calcif Tissue Int 52(2): 146-8.
Liu SM, Koszewski N, Lupez M, Malluche HH, Olivera A and Russell J. 1996.
Characterization of a response element in the 5'-flanking region of the avian (chicken)
PTH gene that mediates negative regulation of gene transcription by 1,25-
dihydroxyvitamin D3 and binds the vitamin D3 receptor. Mol Endocrinol 10(2): 206-
15.
Lo YM, Tein MS, Lau TK, Haines CJ, Leung TN, Poon PM, Wainscoat JS, Johnson
PJ, Chang AM and Hjelm NM. 1998. Quantitative analysis of fetal DNA in maternal
plasma and serum: implications for noninvasive prenatal diagnosis. Am J Hum Genet
62(4): 768-75.
Lobaugh B, Garner SC, Lovdal JA, Boass A, Toverud SU. 1993. Parathyroidectomy
abolishes the increase of renal 25-hydroxyvitamin D-1 alpha-hydroxylase in lactating
rats. Am J Physiol 264(6 Pt 1): E981-5.
Lockey C, Otto E and Long Z. 1998. Real-time fluorescence detection of a single
DNA molecule. Biotechniques 24(5): 744-6.
Lore F, Galli M, Franci B and Martorelli MT. 1984. Calcitonin levels in normal
subjects according to age and sex. Biomed Pharmacother 38(5): 261-3.
250
Lorenc R, Tanaka Y, DeLuca HF, Jones G. 1977. Lack of effect of calcitonin on the
regulation of vitamin D metabolism in the rat. Endocrinology 100(2): 468-72.
Lu CC, Tsai SC, Wang SW, Huang WJ and Wang PS. 1998. Age-related differences
in the secretion of calcitonin in female rats. Am J Physiol 275(5 Pt 1): E735-9.
Mahonen A and Maenpaa PH. 1994. Steroid hormone modulation of vitamin D
receptor levels in human MG-63 osteosarcoma cells. Biochem Biophys Res Commun
205(2): 1179-86.
Makin G, Lohnes D, Byford V, Ray R and Jones G. 1989. Target cell metabolism of
1,25-dihydroxyvitamin D3 to calcitroic acid. Evidence for a pathway in kidney and
bone involving 24-oxidation. Biochem J 262(1): 173-80.
Mandel ML, Moorthy B and Ghazarian JG. 1990. Reciprocal post-translational
regulation of renal 1 alpha- and 24-hydroxylases of 25-hydroxyvitamin D3 by
phosphorylation of ferredoxin. mRNA-directed cell-free synthesis and
immunoisolation of ferredoxin. Biochem J 266(2): 385-92.
Mandla S, Boneh A and Tenenhouse HS. 1990. Evidence for protein kinase C
involvement in the regulation of renal 25-hydroxyvitamin D3-24-hydroxylase.
Endocrinology 127(6): 2639-47.
251
Mandla S and Tenenhouse HS. 1992. Inhibition of 25-hydroxyvitamin D3-24-
hydroxylase by forskolin: evidence for a 3',5'-cyclic adenosine monophosphate-
independent mechanism. Endocrinology 130(4): 2145-51.
Martin TJ. 1999. Calcitonin, an update. Bone 24(5 Suppl): 63S-65S.
Martinez P, Moreno I, De Miguel F, Vila V, Esbrit P and Martinez ME. 2001.
Changes in osteocalcin response to 1,25-dihydroxyvitamin D(3) stimulation and basal
vitamin D receptor expression in human osteoblastic cells according to donor age and
skeletal origin. Bone 29(1): 35-41.
Masuda S, Strugnell S, Calverley MJ, Makin HL, Kremer R and Jones G. 1994. In
vitro metabolism of the anti-psoriatic vitamin D analog, calcipotriol, in two cultured
human keratinocyte models. J Biol Chem 269(7): 4794-803.
Matkovits T and Christakos S. 1995. Variable in vivo regulation of rat vitamin D-
dependent genes (osteopontin, Ca,Mg-adenosine triphosphatase, and 25-
hydroxyvitamin D3 24-hydroxylase): implications for differing mechanisms of
regulation and involvement of multiple factors. Endocrinology 136(9): 3971-82.
Matsumoto T, Igarashi C, Takeuchi Y, Harada S, Kikuchi T, Yamato H and Ogata E.
1991. Stimulation by 1,25-dihydroxyvitamin D3 of in vitro mineralization induced by
osteoblast-like MC3T3-E1 cells. Bone 12(1): 27-32.
252
Matsumoto T, Ikeda K, Morita K, Fukumoto S, Takahashi H and Ogata E. 1987.
Blood Ca2+ modulates responsiveness of renal 25(OH)D3-1 alpha- hydroxylase to
PTH in rats. Am J Physiol 253(5 Pt 1): E503-7.
Matsumoto T, Kawanobe Y and Ogata E. 1985. Regulation of 24,25-
dihydroxyvitamin D-3 production by 1,25-dihydroxyvitamin D-3 and synthetic human
parathyroid hormone fragment 1-34 in a cloned monkey kidney cell line (JTC-12).
Biochim Biophys Acta 845(3): 358-65.
McDonnell DP, Mangelsdorf DJ, Pike JW, Haussler MR and O'Malley BW. 1987.
Molecular cloning of complementary DNA encoding the avian receptor for vitamin D.
Science 235(4793): 1214-7.
McSheehy PM and Chambers TJ. 1986. Osteoblast-like cells in the presence of
parathyroid hormone release soluble factor that stimulates osteoclastic bone
resorption. Endocrinology 119(4): 1654-9.
Merke J, Nawrot M, Hugel U, Szabo A and Ritz E. 1989. Evidence for in vivo
upregulation of 1,25(OH)2 vitamin D3 receptor in human monocytes. Calcif Tissue
Int 45(4): 255-6.
Meszaros JG and Farach-Carson MC. 1997. Assay of direct effect of 1,25-
dihydroxyvitamin D3 on calcium ion influx into cultured osteoblasts. Methods
Enzymol 282: 236-43.
253
Miyamoto Y, Shinki T, Yamamoto K, Ohyama Y, Iwasaki H, Hosotani R, Kasama T,
Takayama H, Yamada S and Suda T. 1997. 1alpha,25-dihydroxyvitamin D3-24-
hydroxylase (CYP24) hydroxylates the carbon at the end of the side chain (C-26) of
the C-24-fluorinated analog of 1alpha,25-dihydroxyvitamin D3. J Biol Chem 272(22):
14115-9.
Monkawa T, Yoshida T, Wakino S, Shinki T, Anazawa H, Deluca HF, Suda T,
Hayashi M and Saruta T. 1997. Molecular cloning of cDNA and genomic DNA for
human 25-hydroxyvitamin D3 1 alpha-hydroxylase. Biochem Biophys Res Commun
239(2): 527-33.
Moorehead WR and Biggs HG. 1974. 2-Amino-2-methyl-1-propanol as the alkalizing
agent in an improved continuous-flow cresolphthalein complexone procedure for
calcium in serum. Clin Chem 20(11): 1458-60.
Morgan DB. 1972. Calcium and phosphate metabolism and the bone. Prog Surg 10:
24-75.
Murayama A, Takeyama K, Kitanaka S, Kodera Y, Hosoya T and Kato S. 1998. The
promoter of the human 25-hydroxyvitamin D3 1 alpha-hydroxylase gene confers
positive and negative responsiveness to PTH, calcitonin, and 1 alpha, 25(OH)2D3.
Biochem Biophys Res Commun 249(1): 11-6.
Murayama A, Takeyama K, Kitanaka S, Kodera Y, Kawaguchi Y, Hosoya T and Kato
S. 1999. Positive and negative regulations of the renal 25-hydroxyvitamin D3 1alpha-
254
hydroxylase gene by parathyroid hormone, calcitonin, and 1alpha, 25(OH)2D3 in
intact animals. Endocrinology 140(5): 2224-31.
Murayama A, Kim M, Unno K, Takeyama K and Kato S. 2001. A novel mechanism
of the vitamin Ddependant transcriptional repression through the human 25-
hydroxyvitamin D3-1α-hydroxylase nVDRE. J Bone Miner Res 16:S229
Nakagawa K, Tsugawa N, Okamoto T, Kishi T, Ono T, Kubodera N and Okano T.
1999. Rapid control of transmembrane calcium influx by 1alpha,25-dihydroxyvitamin
D3 and its analogues in rat osteoblast-like cells. Biol Pharm Bull 22(10): 1058-63.
Neer RM, Holick MF, DeLuca HF and Potts JT Jr. 1975. Effects of 1alpha-hydroxy-
vitamin D3 and 1,25-dihydroxy-vitamin D3 on calcium and phosphorus metabolism
in hypoparathyroidism. Metabolism 24(12): 1403-13.
Nesbitt T and Drezner MK. 1990. Abnormal parathyroid hormone-related peptide
stimulation of renal 25- hydroxyvitamin D-1-hydroxylase in Hyp mice: evidence for a
generalized defect of enzyme activity in the proximal convoluted tubule.
Endocrinology 127(2): 843-8.
Nesbitt T, Drezner MK and Lobaugh B. 1986. Abnormal parathyroid hormone
stimulation of 25-hydroxyvitamin D-1 alpha- hydroxylase activity in the
hypophosphatemic mouse. Evidence for a generalized defect of vitamin D
metabolism. J Clin Invest 77(1): 181-7.
255
Nesbitt T, Lobaugh B and Drezner MK. 1987. Calcitonin stimulation of renal 25-
hydroxyvitamin D-1 alpha-hydroxylase activity in hypophosphatemic mice. Evidence
that the regulation of calcitriol production is not universally abnormal in X-linked
hypophosphatemia. J Clin Invest 79(1): 15-9.
Nishimura A, Shinki T, Jin CH, Ohyama Y, Noshiro M, Okuda K and Suda T. 1994.
Regulation of messenger ribonucleic acid expression of 1 alpha,25- dihydroxyvitamin
D3-24-hydroxylase in rat osteoblasts. Endocrinology 134(4): 1794-9.
Nordin BE. 1997. Calcium and osteoporosis. Nutrition 13(7-8): 664-86.
Nordin BE and Morris HA. 1992. Osteoporosis and vitamin D. J Cell Biochem 49(1):
19-25.
Nordin BE, Need AG, Steurer T, Morris HA, Chatterton BE and Horowitz M. 1998.
Nutrition, osteoporosis, and aging. Ann N Y Acad Sci 854: 336-51.
Ohtera K, Ishii S and Matsuyama T. 2001. Influence of the vitamin D receptor alleles
on human osteoblast-like cells. J Bone Joint Surg Br 83(1): 134-8.
Ohyama Y, Noshiro M, Eggertsen G, Gotoh O, Kato Y, Bjorkhem I and Okuda K.
1993. Structural characterization of the gene encoding rat 25-hydroxyvitamin D3 24-
hydroxylase. Biochemistry 32(1): 76-82.
256
Ohyama Y, Noshiro M and Okuda K. 1991(a). Cloning and expression of cDNA
encoding 25-hydroxyvitamin D3 24- hydroxylase. FEBS Lett 278(2): 195-8.
Ohyama Y and Okuda K. 1991(b). Isolation and characterization of a cytochrome P-
450 from rat kidney mitochondria that catalyzes the 24-hydroxylation of 25-
hydroxyvitamin D3. J Biol Chem 266(14): 8690-5.
Ohyama Y, Ozono K, Uchida M, Shinki T, Kato S, Suda T, Yamamoto O, Noshiro M
and Kato Y. 1994. Identification of a vitamin D-responsive element in the 5'-flanking
region of the rat 25-hydroxyvitamin D3 24-hydroxylase gene. J Biol Chem 269(14):
10545-50.
Okuda K, Usui E and Ohyama Y. 1995. Recent progress in enzymology and
molecular biology of enzymes involved in vitamin D metabolism. J Lipid Res 36(8):
1641-52.
Oliveira JG, Prados RZ, Guedes AC, Ferreira PC and Kroon EG. 1999. The
housekeeping gene glyceraldehyde-3-phosphate dehydrogenase is inappropriate as
internal control in comparative studies between skin tissue and cultured skin
fibroblasts using Northern blot analysis. Arch Dermatol Res 291(12): 659-61.
O'Loughlin PD and Morris HA. 1994. Oophorectomy in young rats impairs calcium
balance by increasing intestinal calcium secretion. J Nutr 124(5): 726-31.
257
Orlando C, Pinzani P and Pazzagli M. 1998. Developments in quantitative PCR. Clin
Chem Lab Med 36(5): 255-69.
Overbergh L, Valckx D, Waer M and Mathieu C. 1999. Quantification of murine
cytokine mRNAs using real time quantitative reverse transcriptase PCR. Cytokine
11(4): 305-12.
Page K. 1977. Bone and preparation of bone sections. In: Bancroft J.D, Stevens, A.
(eds) Theory and Practise of Histological Techniques. 1st edition, Churchill
Livingstone, London, pp 223-48.
Panda DK, Al Kawas S, Seldin MF, Hendy GN and Goltzman D. 2001(a). 25-
hydroxyvitamin D 1alpha-hydroxylase: structure of the mouse gene, chromosomal
assignment, and developmental expression. J Bone Miner Res 16(1): 46-56.
Panda DK, Miao D, Tremblay ML, Sirois J, Farookhi R, Hendy GN and Goltzman D.
2001(b). Targeted ablation of the 25-hydroxyvitamin D 1alpha -hydroxylase enzyme:
evidence for skeletal, reproductive, and immune dysfunction. Proc Natl Acad Sci
USA 98(13): 7498-503.
Papapoulos SE, van der Berg H, Frolich M and Valentijn RM. 1988. Circulating 1,25-
dihydroxycholecalciferol after intravenous injections of 1 alpha-
hydroxycholecalciferol in patients on regular haemodialysis. Nephrol Dial Transplant
3(5): 647-50.
258
Papapoulos SE, Clemens TL, Fraher LJ, Lewin IG, Sandler LM and O'Riordan JL.
1979. 1, 25-dihydroxycholecalciferol in the pathogenesis of the hypercalcaemia of
sarcoidosis. Lancet 1(8117): 627-30.
Parfitt AM, Han ZH, Palnitkar S, Rao DS, Shih MS and Nelson D. 1997. Effects of
ethnicity and age or menopause on osteoblast function, bone mineralization, and
osteoid accumulation in iliac bone. J Bone Miner Res 12(11): 1864-73.
Pettifor JM, Marie PJ, Sly MR, du Bruyn, DB, Ross F, Isdale JM, de Klerk WA and
van der Walt WH. 1984. The effect of differing dietary calcium and phosphorus
contents on mineral metabolism and bone histomorphometry in young vitamin D-
replete baboons. Calcif Tissue Int 36(6): 668-76.
Pikuleva IA, Bjorkhem I and Waterman MR. 1997. Expression, purification, and
enzymatic properties of recombinant human cytochrome P450c27 (CYP27). Arch
Biochem Biophys 343(1): 123-30.
Pols HA, Birkenhager JC, Schilte JP and Visser TJ. 1988. Evidence that the self-
induced metabolism of 1,25-dihydroxyvitamin D-3 limits the homologous up-
regulation of its receptor in rat osteosarcoma cells. Biochim Biophys Acta 970(2):
122-9.
Pols HA, Birkenhager JC, Schilte JP, Bos MP and van Leeuwen JP. 1991. The effects
of MC903 on 1,25-(OH)2D3 receptor binding, 24-hydroxylase activity and in vitro
bone resorption. Bone Miner 14(2): 103-11.
259
Pondel M. 2000. Calcitonin and calcitonin receptors: bone and beyond. Int J Exp
Pathol 81(6): 405-22.
Portale AA and Miller WL. 2000. Human 25-hydroxyvitamin D-1alpha-hydroxylase:
cloning, mutations, and gene expression. Pediatr Nephrol 14(7): 620-5.
Pryke AM, Duggan C, White CP, Posen S and Mason RS. 1990. Tumor necrosis
factor-alpha induces vitamin D-1-hydroxylase activity in normal human alveolar
macrophages. J Cell Physiol 142(3): 652-6.
Puzas JE, Turner RT, Howard GA, Brand JS, Baylink DJ. 1987. Synthesis of 1,25-
dihydroxycholecalciferol and 24,25-dihydroxycholecalciferol by calvarial cells.
Characterization of the enzyme systems. Biochem J 245(2): 333-8.
Rader JI, Howard GA, Feist E, Turner RT and Baylink DJ. 1979. Bone mineralization
and metabolism of 3H-25-hydroxyvitamin D3 in thyroparathyroidectomized rats
treated with parathyroid extract. Calcif Tissue Int 29(1): 21-6.
Rasmussen H, Wong M, Bikle D and Goodman DB. 1972. Hormonal control of the
renal conversion of 25-hydroxycholecalciferol to 1,25-dihydroxycholecalciferol. J
Clin Invest 51(9): 2502-4.
260
Reddy GS, Tserng KY. 1989. Calcitroic acid, end product of renal metabolism of
1,25- dihydroxyvitamin D3 through C-24 oxidation pathway. Biochemistry 28(4):
1763-9.
Reichel H, Bishop JE, Koeffler HP and Norman AW. 1991. Evidence for 1,25-
dihydroxyvitamin D3 production by cultured porcine alveolar macrophages. Mol Cell
Endocrinol 75(2): 163-7.
Reichel H, Koeffler HP, Barbers R and Norman AW. 1987(a). Regulation of 1,25-
dihydroxyvitamin D3 production by cultured alveolar macrophages from normal
human donors and from patients with pulmonary sarcoidosis. J Clin Endocrinol Metab
65(6): 1201-9.
Reichel H, Koeffler HP, Bishop JE and Norman AW. 1987(b). 25-Hydroxyvitamin
D3 metabolism by lipopolysaccharide-stimulated normal human macrophages. J Clin
Endocrinol Metab 64(1): 1-9.
Reichel H, Koeffler HP and Norman AW. 1987(c). 25-Hydroxyvitamin D3
metabolism by human T-lymphotropic virus- transformed lymphocytes. J Clin
Endocrinol Metab 65(3): 519-26.
Reichel H, Koeffler HP and Norman AW. 1987(d). Synthesis in vitro of 1,25-
dihydroxyvitamin D3 and 24,25-dihydroxyvitamin D3 by interferon-gamma-
stimulated normal human bone marrow and alveolar macrophages. J Biol Chem
262(23): 10931-7.
261
Reinhardt TA and Horst RL. 1990. Parathyroid hormone down-regulates 1,25-
dihydroxyvitamin D receptors (VDR) and VDR messenger ribonucleic acid in vitro
and blocks homologous up-regulation of VDR in vivo. Endocrinology 127(2): 942-8.
Reinhardt TA, Horst RL. 1989. Self-induction of 1,25-dihydroxyvitamin D3
metabolism limits receptor occupancy and target tissue responsiveness. J Biol Chem
264(27): 15917-21.
Reinholz GG and DeLuca HF. 1998. Inhibition of 25-hydroxyvitamin D3 production
by 1, 25-dihydroxyvitamin D3 in rats. Arch Biochem Biophys 355(1): 77-83.
Rickard DJ, Kazhdan I and Leboy PS. 1995. Importance of 1,25-dihydroxyvitamin D3
and the nonadherent cells of marrow for osteoblast differentiation from rat marrow
stromal cells. Bone 16(6): 671-8.
Rosenthal AM, Jones G, Kooh SW and Fraser D. 1980. 25-hydroxyvitamin D3
metabolism by isolated perfused rat kidney. Am J Physiol 239(1): E12-20.
Rost CR, Bikle DD and Kaplan RA. 1981. In vitro stimulation of 25-
hydroxycholecalciferol 1 alpha-hydroxylation by parathyroid hormone in chick
kidney slices: evidence for a role for adenosine 3',5'-monophosphate. Endocrinology
108(3): 1002-6.
262
Roy S, Martel J and Tenenhouse HS. 1995. Comparative effects of 1,25-
dihydroxyvitamin D3 and EB 1089 on mouse renal and intestinal 25-hydroxyvitamin
D3-24-hydroxylase. J Bone Miner Res 10(12): 1951-9.
Sagiv P, Lidor C, Hallel T and Edelstein S. 1992. Decrease in bone level of 1,25-
dihydroxyvitamin D in women over 45 years old. Calcif Tissue Int 51(1): 24-6.
Sambrook J, Fritsch EF, Maniatis J. 1989. Molecular cloning, a laboratory manual. 2nd
ed. Cold Springs Harbour Laboratory Press, USA. Pp 141, 7.22, 7.8.
Sandgren ME and DeLuca HF. 1990. Serum calcium and vitamin D regulate 1,25-
dihydroxyvitamin D3 receptor concentration in rat kidney in vivo. Proc Natl Acad Sci
USA 87(11): 4312-4.
Santiso-Mere D, Sone T, Hilliard GM, Pike JW and McDonnell DP. 1993. Positive
regulation of the vitamin D receptor by its cognate ligand in heterologous expression
systems. Mol Endocrinol 7(7): 833-9.
Schaafsma G, Visser WJ, Dekker PR and Van Schaik M. 1987. Effect of dietary
calcium supplementation with lactose on bone in vitamin D-deficient rats. Bone 8(6):
357-62.
Sexton PM, Findlay DM and Martin TJ. 1999. Calcitonin. Curr Med Chem 6(11):
1067-93.
263
Shalhoub V, Aslam F, Breen E, van Wijnen A, Bortell R, Stein GS, Stein JL and Lian
JB. 1998. Multiple levels of steroid hormone-dependent control of osteocalcin during
osteoblast differentiation: glucocorticoid regulation of basal and vitamin D stimulated
gene expression. J Cell Biochem 69(2): 154-68.
Shigematsu T, Horiuchi N, Ogura Y, Miyahara T and Suda T. 1986. Human
parathyroid hormone inhibits renal 24-hydroxylase activity of 25- hydroxyvitamin D3
by a mechanism involving adenosine 3',5'- monophosphate in rats. Endocrinology
118(4): 1583-9.
Shinki T.1998. Cloning and expression of 25-hydroxyvitamin D3-1 alpha-
hydroxylase gene. Nippon Rinsho 56(6): 1440-6.
Shinki T, Jin CH, Nishimura A, Nagai Y, Ohyama Y, Noshiro M, Okuda K and Suda
T. 1992. Parathyroid hormone inhibits 25-hydroxyvitamin D3-24-hydroxylase mRNA
expression stimulated by 1 alpha,25-dihydroxyvitamin D3 in rat kidney but not in
intestine. J Biol Chem 267(19): 13757-62.
Shinki T, Shimada H, Wakino S, Anazawa H, Hayashi M, Saruta T, DeLuca HF and
Suda T. 1997. Cloning and expression of rat 25-hydroxyvitamin D3-1alpha-
hydroxylase cDNA. Proc Natl Acad Sci USA 94(24): 12920-5.
Shinki, T, Ueno, Y, DeLuca, H. F. and Suda, T. 1999. Calcitonin is a major regulator
for the expression of renal 25-hydroxyvitamin D3-1alpha-hydroxylase gene in
normocalcemic rats. Proc Natl Acad Sci USA 96(14): 8253-8.
264
Spanos E, Freake H, MacAuley SJ and MacIntyre I. 1981. Regulation of vitamin D
metabolism by calcium and phosphate ions in isolated renal tubules. Biochem J
196(1): 187-93.
Staal A, van den Bemd GJ, Birkenhager JC, Pols HA and van Leeuwen JP. 1997.
Consequences of vitamin D receptor regulation for the 1,25- dihydroxyvitamin D3-
induced 24-hydroxylase activity in osteoblast-like cells: initiation of the C24-
oxidation pathway. Bone 20(3): 237-43.
Stanford CM, Jacobson PA, Eanes ED, Lembke LA and Midura RJ. 1995. Rapidly
forming apatitic mineral in an osteoblastic cell line (UMR 106-01 BSP). J Biol Chem
270(16): 9420-8.
St-Arnaud R, Arabian A, Travers R, Barletta F, Raval-Pandya M, Chapin K,
Depovere J, Mathieu C, Christakos S, Demay MB, Glorieux FH. 2000. Deficient
mineralization of intramembranous bone in vitamin D-24-hydroxylase-ablated mice is
due to elevated 1,25-dihydroxyvitamin D and not to the absence of 24,25-
dihydroxyvitamin D. Endocrinology 141(7): 2658-66.
St-Arnuad R, Messerlian S, Moir JM, Omdahl JL and Glorieux FH. 1997. The 25-
hydroxyvitamin D 1-alpha-hydroxylase gene maps to the pseudovitamin D-deficiency
rickets (PDDR) disease locus. J Bone Miner Res 12(10): 1552-9.
265
Strom M, Sandgren ME, Brown TA and DeLuca HF. 1989. 1,25-Dihydroxyvitamin
D3 up-regulates the 1,25-dihydroxyvitamin D3 receptor in vivo. Proc Natl Acad Sci
USA 86(24): 9770-3.
Suda T, Shinki T and Kurokawa K. 1994. The mechanisms of regulation of vitamin D
metabolism in the kidney. Curr Opin Nephrol Hypertens 3(1): 59-64.
Suda T, Udagawa N, Nakamura I, Miyaura C and Takahashi N. 1995. Modulation of
osteoclast differentiation by local factors. Bone 17(2 Suppl): 87S-91S.
Swarthout JT, D'Alonzo RC, Selvamurugan N and Partridge NC. 2002. Parathyroid
hormone-dependent signalling pathways regulating genes in bone cells. Gene 282(1-
2): 1-17.
Szabo A, Merke J, Beier E, Mall G and Ritz E. 1989. 1,25(OH)2 vitamin D3 inhibits
parathyroid cell proliferation in experimental uremia. Kidney Int 35(4): 1049-56.
Takamoto S, Seino Y, Sacktor B and Liang CT. 1990. Effect of age on duodenal 1,25-
dihydroxyvitamin D-3 receptors in Wistar rats. Biochim Biophys Acta 1034(1): 22-8.
Takeda S, Yoshizawa T, Nagai Y, Yamato H, Fukumoto S, Sekine K, Kato S,
Matsumoto T and Fujita T. 1999. Stimulation of osteoclast formation by 1,25-
dihydroxyvitamin D requires its binding to vitamin D receptor (VDR) in osteoblastic
cells: studies using VDR knockout mice. Endocrinology 140(2): 1005-8.
266
Takeda T, Arakawa M, Kuwano R. 1994. Organization and expression of the mouse
spot35/calbindin-D28k gene: identification of the vitamin D-responsive promoter
region. Biochem Biophys Res Commun 204(2): 889-97.
Takeyama K, Kitanaka S, Sato T, Kobori M, Yanagisawa J and Kato S. 1997. 25-
Hydroxyvitamin D3 1alpha-hydroxylase and vitamin D synthesis. Science 277(5333):
1827-30.
Tanaka H, Abe E, Miyaura C, Kuribayashi T, Konno K, Nishii Y, Suda T. 1982. 1
alpha,25-Dihydroxycholecalciferol and a human myeloid leukaemia cell line (HL-60).
Biochem J 204(3): 713-19.
Tanaka Y, Castillo L and DeLuca HF. 1977. The 24-hydroxylation of 1,25-
dihydroxyvitamin D3. J Biol Chem 252(4): 1421-4.
Tanaka Y, Chen TC and Deluca HF. 1972. Dependence of 25-hydroxycholecalciferol-
1-hydroxylase regulation on RNA and protein synthesis. Arch Biochem Biophys
152(1): 291-8.
Tanaka Y and DeLuca HF. 1974. Stimulation of 24,25-dihydroxyvitamin D3
production by 1,25- dihydroxyvitamin D3. Science 183(130): 1198-200.
Tanaka Y and DeLuca HF. 1984. Rat renal 25-hydroxyvitamin D3 1- and 24-
hydroxylases: their in vivo regulation. Am J Physiol 246(2 Pt 1): E168-73.
267
Tanaka Y, Lorenc RS and DeLuca HF. 1975. The role of 1,25-dihydroxyvitamin D3
and parathyroid hormone in the regulation of chick renal 25-hydroxyvitamin D3-24-
hydroxylase. Arch Biochem Biophys 171(2): 521-6.
Thakker RV, Fraher LJ, Adami S and Karmali R. 1986. Circulating concentrations of
1,25-dihydroxyvitamin D3 in patients with primary hyperparathyroidism. Bone Miner
1(2): 137-44.
Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G, Grisar T, Igout
A and Heinen E. 1999. Housekeeping genes as internal standards: use and limits. J
Biotechnol 75(2-3): 291-5.
Tiegs RD, Body JJ, Barta JM and Heath H 3rd. 1986. Secretion and metabolism of
monomeric human calcitonin: effects of age, sex, and thyroid damage. J Bone Miner
Res 1(4): 339-49.
Tiosano D, Weisman Y and Hochberg Z. 1998. The role of the vitamin D receptor in
regulating vitamin D metabolism: a study of vitamin D-dependent rickets, type II. J
Clin Endocrinol Metab 86(5): 1908-12.
Tomon M, Tenenhouse HS, Jones G. 1990(a). 1,25-Dihydroxyvitamin D3-inducible
catabolism of vitamin D metabolites in mouse intestine. Am J Physiol 258(4 Pt 1):
G557-63.
268
Tomon M, Tenenhouse HS, Jones G. 1990(b). Expression of 25-hydroxyvitamin D3-
24-hydroxylase activity in Caco-2 cells. An in vitro model of intestinal vitamin D
catabolism. Endocrinology 126(6): 2868-75.
Toromanoff A, Ammann P, Mosekilde L, Thomsen JS and Riond JL. 1997.
Parathyroid hormone increases bone formation and improves mineral balance in
vitamin D-deficient female rats. Endocrinology 138(6): 2449-57.
Tsai CL, Wong TY, Tsai SC, Lau CP, Chen YZ, Hwang GS and Wang PS. 1991.
Age-related differences in the hypocalcemic effect of calcitonin and calcium excretion
in female rats. Chin J Physiol 34(4): 455-62.
Tso JY, Sun XH, Kao TH, Reece KS and Wu R. 1985. Isolation and characterization
of rat and human glyceraldehyde-3-phosphate dehydrogenase cDNAs: genomic
complexity and molecular evolution of the gene. Nucleic Acids Res 13(7): 2485-502.
Tucker G 3rd, Gagnon RE, Haussler MR. 1973. Vitamin D 3 -25-hydroxylase: tissue
occurrence and apparent lack of regulation. Arch Biochem Biophys 155(1): 47-57.
Turner RT, Puzas JE, Forte MD, Lester GE, Gray TK, Howard GA and Baylink DJ.
1980. In vitro synthesis of 1 alpha,25-dihydroxycholecalciferol and 24,25-
dihydroxycholecalciferol by isolated calvarial cells. Proc Natl Acad Sci USA 77(10):
5720-4.
269
Uhland-Smith A and DeLuca HF. 1993. The necessity for calcium for increased renal
vitamin D receptor in response to 1,25-dihydroxyvitamin D. Biochim Biophys Acta
1176(3): 321-6.
Van Cromphaut SJ, Dewerchin M, Hoenderop JG, Stockmans I, Van Herck E, Kato S,
Bindels RJ, Collen D, Carmeliet P, Bouillon R and Carmeliet G. 2001. Duodenal
calcium absorption in vitamin D receptor-knockout mice: functional and molecular
aspects. Proc Natl Acad Sci USA 98(23): 13324-9.
van Leeuwen JP, Birkenhager JC, Vink-van Wijngaarden T, van den Bemd GJ and
Pols HA. 1992. Regulation of 1,25-dihydroxyvitamin D3 receptor gene expression by
parathyroid hormone and cAMP-agonists. Biochem Biophys Res Commun 185(3):
881-6.
Varghese S, Lee S, Huang YC, Christakos S. 1988. Analysis of rat vitamin D-
dependent calbindin-D28k gene expression. J Biol Chem 263(20): 9776-84.
Walker AT, Stewart AF, Korn EA, Shiratori T, Mitnick MA and Carpenter TO. 1990.
Effect of parathyroid hormone-like peptides on 25-hydroxyvitamin D-1 alpha-
hydroxylase activity in rodents. Am J Physiol 258(2 Pt 1): E297-303.
Wang AM, Doyle MV and Mark DF. 1989. Quantitation of mRNA by the polymerase
chain reaction. Proc Natl Acad Sci USA 86(24): 9717-21.
270
Wasserman RH, Fullmer CS. 1995. Vitamin D and intestinal calcium transport: facts,
speculations and hypotheses. J Nutr 125(7 Suppl): 1971S-1979S.
Weinstein RS, Underwood JL, Hutson MS and DeLuca HF. 1984. Bone
histomorphometry in vitamin D-deficient rats infused with calcium and phosphorus.
Am J Physiol 246(6 Pt 1): E499-505.
Weisinger JR, Favus MJ, Langman CB and Bushinsky DA. 1989. Regulation of 1,25-
dihydroxyvitamin D3 by calcium in the parathyroidectomized, parathyroid hormone-
replete rat. J Bone Miner Res 4(6): 929-35.
Welsh J, Weaver V and Simboli-Campbell M. 1991. Regulation of renal 25(OH)D3 1
alpha-hydroxylase: signal transduction pathways. Biochem Cell Biol 69(12): 768-70.
Wiese RJ, Uhland-Smith A, Ross TK, Prahl JM and DeLuca HF. 1992. Up-regulation
of the vitamin D receptor in response to 1,25-dihydroxyvitamin D3 results from
ligand-induced stabilization. J Biol Chem 267(28): 20082-6.
Yamaguchi T, Chattopadhyay N, Kifor O and Brown EM. 1998(a). Extracellular
calcium (Ca2+(o))-sensing receptor in a murine bone marrow-derived stromal cell
line (ST2): potential mediator of the actions of Ca2+(o) on the function of ST2 cells.
Endocrinology 139(8): 3561-8.
Yamaguchi T, Chattopadhyay N, Kifor O, Butters RR Jr, Sugimoto T and Brown EM.
1998(b). Mouse osteoblastic cell line (MC3T3-E1) expresses extracellular calcium
271
(Ca2+o)-sensing receptor and its agonists stimulate chemotaxis and proliferation of
MC3T3-E1 cells. J Bone Miner Res 13(10): 1530-8.
Yamaguchi T, Chattopadhyay N, Kifor O, Ye C, Vassilev PM, Sanders JL and Brown
EM. 2001. Expression of extracellular calcium-sensing receptor in human osteoblastic
MG-63 cell line. Am J Physiol Cell Physiol 280(2): C382-93.
Yamaguchi T, Kifor O, Chattopadhyay N, Bai M and Brown EM. 1998(c).
Extracellular calcium (Ca2+o)-sensing receptor in a mouse monocyte-macrophage
cell line (J774): potential mediator of the actions of Ca2+o on the function of J774
cells. J Bone Miner Res 13(9): 1390-7.
Yamaguchi T, Olozak I, Chattopadhyay N, Butters RR, Kifor O, Scadden DT and
Brown EM. 1998(d). Expression of extracellular calcium (Ca2+o)-sensing receptor in
human peripheral blood monocytes. Biochem Biophys Res Commun 246(2): 501-6.
Yamamoto M, Kawanobe Y, Takahashi H, Shimazawa E, Kimura S and Ogata E.
1984. Vitamin D deficiency and renal calcium transport in the rat. J Clin Invest 74(2):
507-13.
Yang W, Friedman PA, Kumar R, Omdahl JL, May BK, Siu-Caldera ML, Reddy GS
and Christakos S. 1999. Expression of 25(OH)D3 24-hydroxylase in distal nephron:
coordinate regulation by 1,25(OH)2D3 and cAMP or PTH. Am J Physiol 276(4 Pt 1):
E793-805.
272
Yin JL, Shackel NA, Zekry A, McGuinness PH, Richards C, Putten KV, McCaughan
GW, Eris JM and Bishop GA. 2001. Real-time reverse transcriptase-polymerase chain
reaction (RT-PCR) for measurement of cytokine and growth factor mRNA expression
with fluorogenic probes or SYBR Green I. Immunol Cell Biol 79(3): 213-21.
Yoshida N, Yoshida T, Nakamura A, Monkawa T, Hayashi M and Saruta T. 1999.
Calcitonin induces 25-hydroxyvitamin D3 1alpha-hydroxylase mRNA expression via
protein kinase C pathway in LLC-PK1 cells. J Am Soc Nephrol 10(12): 2474-9.
Zehnder D, Bland R, Walker EA, Bradwell AR, Howie AJ, Hewison M and Stewart
PM. 1999. Expression of 25-hydroxyvitamin D3-1alpha-hydroxylase in the human
kidney. J Am Soc Nephrol 10(12): 2465-73.
Zehnder D, Bland R, Williams MC, McNinch RW, Howie AJ, Stewart PM and
Hewison M. 2001. Extrarenal expression of 25-hydroxyvitamin d(3)-1 alpha-
hydroxylase. J Clin Endocrinol Metab 86(2): 888-94.
Zehnder D and Hewison M. 1999. The renal function of 25-hydroxyvitamin D3-
1alpha-hydroxylase. Mol Cell Endocrinol 151(1-2): 213-20.
Zhou A, Elgort MG and Allegretto EA. 1997. Retinoid X receptor (RXR) ligands
activate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR
heterodimer binding to two vitamin D- responsive elements and elicit additive effects
with 1,25- dihydroxyvitamin D3. J Biol Chem 272(30): 19027-34.
273
Zhou H, Hammonds RG Jr, Findlay DM, Fuller PJ, Martin TJ and Ng KW. 1991.
Retinoic acid modulation of mRNA levels in malignant, nontransformed, and
immortalized osteoblasts. J Bone Miner Res 6(7): 767-77.
Zierold C, Darwish HM and DeLuca HF. 1995. Two vitamin D response elements
function in the rat 1,25- dihydroxyvitamin D 24-hydroxylase promoter. J Biol Chem
270(4): 1675-8.
Zierold C, Reinholz GG, Mings JA, Prahl JM and DeLuca HF. 2000. Regulation of
the procine 1,25-dihydroxyvitamin D3-24-hydroxylase (CYP24) by 1,25-
dihydroxyvitamin D3 and parathyroid hormone in AOK-B50 cells. Arch Biochem
Biophys 381(2): 323-7.
Zineb R, Zhor B, Odile W and Marthe RR. 1998. Distinct, tissue-specific regulation
of vitamin D receptor in the intestine, kidney, and skin by dietary calcium and vitamin
D. Endocrinology 139(4): 1844-52.
Zou A, Elgort MG and Allegretto EA. 1997. Retinoid X receptor (RXR) ligands
activate the human 25-hydroxyvitamin D3-24-hydroxylase promoter via RXR
heterodimer binding to two vitamin D- responsive elements and elicit additive effects
with 1,25- dihydroxyvitamin D3. J Biol Chem 272(30): 19027-34.