Genotyping TP1-Venus JDW 6/14 MGI: Reference: Visualization of spatiotemporal activation of Notch signaling: live monitoring and significance in neural development. Kohyama J, Tokunaga A, Fujita Y, Miyoshi H, Nagai T, Miyawaki A, Nakao K, Matsuzaki Y, Okano H. Dev. Bio., 2005.* Note: TP1-venus transgenic mice. Notch reporter mice, in which venus expression was induced upon activation of Notch signaling via RBP-jk-binding sequence. 12 tandem RBP-J binding site, rBG minimum promoter. Green Fluorescent Protein, F46L (Jellyfish). Venus and dVenus cDNA inserts (Nagai et al., 2002; Nagai et al., unpublished results) were substituted with pEGFP-1 and pEGFP-N1 (Clontech Laboratories) to generate pVenus- 1/pdVenus-1 and pVenus/dVenus-N1, respectively. TP-1-Venus/dVenus and rBG- Venus/dVenus were generated by inserting the promoter region of TP-1 luciferase ( Kato et al., 1997) and the minimal promoter region of TP-1 luciferase into pVenus/dVenus-1. Developed by Yumiko Sago Primers (from Riken BRC): JDW 168 (TP1-E1b Fwd):5’ GGCAGATCACTTCAGCTTCTGC (in E1b, ~100 bp from ATG) JDW 169 (Venus Rev):5’ CGTTCTTCTGCTTGTCGGCGG (481 bp into venus) Transgene=~600 bp Reaction Conditions: Reaction Conditions: 10x CL buffer (Qiagen) 2.5µl Q solution (QIagen) 2.5µl dNTPs (10mM each stock) 0.5µl JDW 168 (20mM stock) 0.5µl JDW 169 (20mM stock) 0.5µl genomic DNA 1.0µl Taq (Qiagen) 0.25µl H2O 17.25µl PCR Program: 95 o C – 2 minutes 95 o C – 30 seconds 60 o C – 30 seconds X 35 Cycles 72 o C – 45 seconds 72 o C – 2 minutes 16 o C – forever *Note: The MTA states: The following terms and conditions will be requested by the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Development, 138, 55-64 (2011). Dev Biol., 286, 311-325 (2005). In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The RECIPIENT agrees to use this BIOLOGICAL RESOURCE as a collaboration with the DEPOSITOR / DEVELOPER. The RECIPIENT shall obtain a prior written consent on use of it from the DEPOSITOR.

Tp1-Venus GenotypingTP-1-Venus/dVenus and rBG-Venus/dVenus were generated by inserting the promoter region of TP-1 luciferase ( Kato et al., 1997) and the minimal promoter region of

Download PDF Report

Upload
others
View
1
Download
0

Embed Size (px)

Citation preview

Page 1: Tp1-Venus GenotypingTP-1-Venus/dVenus and rBG-Venus/dVenus were generated by inserting the promoter region of TP-1 luciferase ( Kato et al., 1997) and the minimal promoter region of

Genotyping TP1-Venus JDW 6/14 MGI: Reference: Visualization of spatiotemporal activation of Notch signaling: live monitoring and significance in neural development. Kohyama J, Tokunaga A, Fujita Y, Miyoshi H, Nagai T, Miyawaki A, Nakao K, Matsuzaki Y, Okano H. Dev. Bio., 2005.* Note: TP1-venus transgenic mice. Notch reporter mice, in which venus expression was induced upon activation of Notch signaling via RBP-jk-binding sequence. 12 tandem RBP-J binding site, rBG minimum promoter. Green Fluorescent Protein, F46L (Jellyfish). Venus and dVenus cDNA inserts (Nagai et al., 2002; Nagai et al., unpublished results) were substituted with pEGFP-1 and pEGFP-N1 (Clontech Laboratories) to generate pVenus-1/pdVenus-1 and pVenus/dVenus-N1, respectively. TP-1-Venus/dVenus and rBG-Venus/dVenus were generated by inserting the promoter region of TP-1 luciferase ( Kato et al., 1997) and the minimal promoter region of TP-1 luciferase into pVenus/dVenus-1. Developed by Yumiko Sago Primers (from Riken BRC): JDW 168 (TP1-E1b Fwd):5’ GGCAGATCACTTCAGCTTCTGC (in E1b, ~100 bp from ATG) JDW 169 (Venus Rev):5’ CGTTCTTCTGCTTGTCGGCGG (481 bp into venus) Transgene=~600 bp Reaction Conditions: Reaction Conditions: 10x CL buffer (Qiagen) 2.5µl Q solution (QIagen) 2.5µl dNTPs (10mM each stock) 0.5µl JDW 168 (20mM stock) 0.5µl JDW 169 (20mM stock) 0.5µl genomic DNA 1.0µl Taq (Qiagen) 0.25µl H2O 17.25µl PCR Program: 95oC – 2 minutes 95oC – 30 seconds 60oC – 30 seconds X 35 Cycles 72oC – 45 seconds 72oC – 2 minutes 16oC – forever *Note: The MTA states: The following terms and conditions will be requested by the DEPOSITOR. In publishing the research results obtained by use of the BIOLOGICAL RESOURCE, a citation of the following literature(s) designated by the DEPOSITOR is requested. Development, 138, 55-64 (2011). Dev Biol., 286, 311-325 (2005). In publishing the research results to be obtained by use of the BIOLOGICAL RESOURCE, an acknowledgment to the DEPOSITOR is requested. The RECIPIENT agrees to use this BIOLOGICAL RESOURCE as a collaboration with the DEPOSITOR / DEVELOPER. The RECIPIENT shall obtain a prior written consent on use of it from the DEPOSITOR.