43
Pyrosequencing Alix Groom

Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

  • Upload
    others

  • View
    3

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing

Alix Groom

Page 2: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

• high-throughput CpG methylation analysis platform

• real-time, sequence-based detection and quantification

• % methylation at multiple adjacent CpG sites

• 80-100 bases sequenced per assay • 2ug DNA analyse 3 assays/regions of interest • 24 or 96 samples/assays run at a time

Pyrosequencing

Page 3: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

DNA extraction

Bisulphite modification

PCR Single strand template generation

Pyrosequencing

Workflow

Page 4: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

GGTCAGTGAC/mCG

GGTUAGTGAU/mCG

C mC

U mC

Bisulphite conversion

GGTTAGTGAT/CG

U

T

mC

C

PCR amplification

Pyrosequencing analysis

G T T C A G T G A T C A G l l l l l l l l l l l l l

C mC

Bisulphite modification

Page 5: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

R I I I I I I

Target sequence

I I I I I I F

primer annealing

I I I I I I I I I I I I

extension

copies of target sequence

Polymerase chain reaction

Page 6: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Biotin labelled PCR product

Anneal sequencing primer

Release single stranded DNA

Denature PCR product

Single strand generation

Capture PCR product with streptavidin beads

Page 7: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing chemistry

T A G T A G G

A T C A T

3’

3’ 5’

5’

Polymerase Polymerase

DNA(n) + dNTP DNA(n+1) + PPi

Sulfurylase

APS + PPi ATP

Luciferase

ATP Light

Light

Time

Apyrase dNTP dNDP + dNMP + phosphate

Apyrase ATP ADP + AMP + phosphate

G T A G G -

G T A G G

Nucleotide sequence

Nucleotide added

DNA polymerase ATP sulfurylase

Luciferase Apyrase

APS Luciferin

Page 8: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Bisulphite modification

PCR Single strand template generation

Pyrosequencing

Day 1

Day 2

Day 2

DNA-reagent incubation 3hrs

sample preparation 15min-1hr

column purification 30min-1hr

PCR set up 30min-1hr

PCR cycles 1.5hr

agarose gel 1hr

sample prep 30min-1hr

Pyrosequencing run 10min-1.5hr

Day 3 Day 3

Pyrosequencing timeline

Page 9: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing applications

• Gene specific methylation analysis identified target loci through gene expression studies literature search methylation arrays etc

• Global methylation analysis methylation of repetitive elements LUMA

Page 10: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Case study

Illumina 27K/450K top hit

Pyrosequencing VeraCode Sequenom

verify

Check no SNPs in probe which DNA strand CpG site is measured

Page 11: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Case study identify if CpG in promoter region

identify CGI within/ adjacent to promoter

capture sequence 4000bp flanking

CGI

identify TFBM that contain CpG

select CpG of interest

Page 12: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

identify CGI within/ adjacent to promoter

capture sequence 4000bp flanking

CGI

identify TFBM that contain CpG

select CpG of interest

• genomatix Gene2Promoter software

Case study promoter region

Page 13: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

identify CGI within/ adjacent to promoter

capture sequence 4000bp flanking

CGI

identify TFBM that contain CpG

select CpG of interest

• genomatix Gene2Promoter software

Case study promoter region

Page 14: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

identify CGI within/ adjacent to promoter

capture sequence 4000bp flanking

CGI

identify TFBM that contain CpG

select CpG of interest

• genomatix Gene2Promoter software

Case study promoter region

Page 15: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

identify CGI within/ adjacent to promoter

capture sequence 4000bp flanking

CGI

identify TFBM that contain CpG

select CpG of interest

• genomatix Gene2Promoter software

Case studypromoter region

Page 16: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics • CpG Island explorer

Case studyCpG Island

Page 17: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studyCpG Island

Page 18: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studyCpG Island

Page 19: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studyCpG Island

Page 20: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studyCpG Island

Page 21: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

• CGI Chr10:48 827 593-48 828 126 • 4000bp downstream 48 823 593 • 4000bp upstream 48 832 126

Case studysequence capture

Page 22: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Chr10: 48823593 - 48832126

Case studysequence capture

Page 23: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studysequence capture

Page 24: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studysequence capture

Page 25: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studysequence capture

Page 26: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

CpG Shelf CpG Shore CpG Island

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

• UCSC Genome Bioinformatics http://genome.ucsc.edu/

Case studysequence capture

Page 27: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case studytranscription factor binding

HNF1 GATA

TTGTACTAACGATATGCCATGCTA TTGTACTAACGATATGCCATGCTA

HNF1 GATA

module

• UCSC TFBS single binding factor information • JASPAR http://jaspar.cgb.ki.se • TRANSFAC http://www.gene-regulation.com/pub/databases.html TRANSCompel • Genomatix ModelInspector

• TFBM defined 2+ TFBS in defined order and orientation

Page 28: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case studytranscription factor binding module

Genomatix

http://www.genomatix.de/

Page 29: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case studytranscription factor binding module

Genomatix

http://www.genomatix.de/

Page 30: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case studytranscription factor binding module

Genomatix

http://www.genomatix.de/

Page 31: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case studytranscription factor binding module

Genomatix

http://www.genomatix.de/

Page 32: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case studytranscription factor binding module

Page 33: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

identify if CpG in promoter region

capture sequence 4000bp flanking

CGI

select CpG of interest

identify CGI within/ adjacent to promoter

identify TFBM that contain CpG

Case study

• If analysing specific CpG can capture adjacent CpGs • Do you want to analyse CGI

CpG Shore CpG Shelf CpG Open Sea

Page 34: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Case studyPSQ design software

• Paste in bisulphite modified sequence of interest flanked by ~300bp • Select target CpG • Maximum amplicon length ~600bp

Page 35: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

• Ensure primers do not cover SNPs or CpGs

Case studyPSQ design software

forward primer

sequencing primer

reverse primer

Page 36: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Case studyPyroMark CpG assays

• 84, 000+ predesigned assays 30,000+ human assays 30,000+ mouse assays 24,000+ rat assays http://www.qiagen.com/products/pyromarkcpgassays.aspx

Page 37: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

• Level of methylation, accuracy within ~ 5% exclude assays with <5% or >95% methylation • No preferential amplification of unmethylated or methylated DNA White HE, Clinical Chemistry 52:6 1005-1013, 2006

• Bisulphite conversion is completed

Pyrosequencing “checks”

Page 38: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing run

• Run time dependent on sequence length, 10min-1.5hr

Page 39: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing analysis

Page 40: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing analysis

• Samples run in duplicate are within 5% • 0% and 100% controls are comparable between plates • inter/intraplate replicates are comparable • negative DNA control no signal

Page 41: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencingsummary

• high-throughput CpG methylation analysis platform

• real-time, sequence-based detection and quantification

• % methylation at multiple adjacent CpG sites

• genotyping

Page 42: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

References

• Helen E. White, Clinical Chemistry 52:6 1005–1013 (2006) Quantitative Analysis of SRNPN Gene Methylation by Pyrosequencing as a Diagnostic Test for Prader–Willi Syndrome and Angelman Syndrome • http://www.pyrosequencing.com/ • http://www.qiagen.com/products/bytechnology/pyrosequencing • UCSC Genome Bioinformatics http://genome.ucsc.edu/ • Genomatix http://www.genomatix.de/

Page 43: Pyrosequencing - University of Bristol · identify if CpG in promoter region identify CGI within/ adjacent to promoter capture sequence 4000bp flanking CGI identify TFBM that contain

Pyrosequencing

Alix Groom