Upload
others
View
1
Download
0
Embed Size (px)
Citation preview
University of Khartoum
Graduate College
Medical & Health Studies Board
Evaluation and Development of Simplified and Rapid Molecular Tests
for Diagnosis and Species Identification of the Genus Leishmania
By
Alfarazdeg Ageed Saad MBBS (U of K) 2004.
MSc in Biochemistry (U of K 2006)
A thesis submitted for the fulfillment of the requirements of the degree of PhD In Biochemistry (Molecular Parasitology), October 2010
Supervisor
Prof. Sayda H. El-Safi MBBS, MSc, DTM &H, PhD. London
Professor of Immunology, Faculty of Medicine, U. of K.
Co-Supervisor
Dr. Ahmed Mohamedain Eltom
MBBS, MSc. &, Ph.D. Khartoum Associate Professor of Biochemistry
Faculty of Medicine, U. of K.
External Co-Supervisor
Gert Van der Auwera, MSc in Biochemistry, PhD in Molecular Biology,
Antwerp University Institute of Tropical Medicine
Department of Parasitology, Antwerp, Belgium
I
Table of contents
Page
Dedication………………………………………………………………………….............I
Acknowledgements……………………………………………………………….............II
Abbreviations…………………………………………………………………….............IV
English abstract…………………………………………………………………………...V
Arabic abstract…………………………………………………………………............VIII
Table of contents………………………………………………………………………….X
List of tables…………………………………………………………………………....XIV
List of figures…………………………………………………………………………...XV
List of publications…………………………………………………………….............XVI
CHAPTER 1.INTRODUCTION AND LITERATURE REVIEW…………..….(1-14)
1.1 LEISHMANIASIS OVERVIEW.……….…………………………………….............1
1.2 LEISHMANIASIS IN SUDAN…….…………………………………………………3
1.3 DIAGNOSIS OF LEISHMANIASIS……............……………………………………4
1.3.1 MICROSCOPY AND CULTURE ..………………………………………..............4
1.3.2. SEROLOGICAL TECHNIQUES …………………………………………............5
1.3.2.1 THE DIRECT AGGLUTINATION TEST (DAT)..................................................5
1.3.3. MOLECULAR DIAGNOSIS………………..……………………………..............5
1.3.3.1 PCR-OC……...........................................................................................................7
1.3.3.2 NASBA...........…………………………………………………………………….7
1.4. IDENTIFICATION OF THE SPECIES OF LEISHMANIA ………………………..7
1.4.1 SOUTHERN BLOTTING USING DNA PROBES.………………………..………7
1.4.2 PCR-BASED TECHNIQUES FOR IDENTIFICATION………. ………………….8
1.4.3 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP)……………9
1.5. MOLECULAR TECHNIQUES AND TAXONOMY ………………………...........10
1.6. NEW DEVELOPMENTS IN THE GENOME OF LEISHMANIA …………...........10
1.6.1. GENOME SEQUENCING PROJECT …………………………………………...10
1.6.2 MICROARRAYS …………………………...……………………………………11
1.7 RATIONALE …………………………………………………….............................13
1.8 OBJECTIVES……………………………. ………………………………………....14
II
CHAPTER 2. MATERIALS AND METHODS…………………………………(15-35)
2.1 CHARACTERIZATION OF SUDANESE ISOLATES OF LEISHMANIA……….. 15
2.1.1 STUDY DESIGN ............................................…………………………………....15
2.1.2 STUDY AREA.................... ……………………………………………………....15
2.1.3 STUDY SUBJECTS ……………………………………………………………....15
2.1.4 SAMPLE SIZE …………………………………………..……………………......15
2.1.5 RESEARCH ETHICS ………………….……………………………………….....15
2.1.6 STUDY DESCRIPTION AND PROTOCOLS ………………………...…………15
2.1.6.1: THE FIELD WORK …………………………………………………………....15
2.1.6.1.1 PARASITOLOGICAL TECHNIQUES ………………………………………15
2.1.6.2 MOLECULAR CHARACTERIZATION OF SUDANESE ISOLATES..……...16
2.1.6.2.1 DNA EXTRACTION OF PARASITES PELLETS …………………………..17
2.1.6.2.2 TYPING OF SUDANESE LEISHMANIA ISOLATES BY SEQUENCING ITS1
REGIONS …………………………………………………………………………….…17
2.1.6.2.3 LEISMANIA CYSTEINE PROTEINASE B SPECIES-SPECIFIC PCRs……. 18
2.2. MULTICENTER RING TRIAL …………………..……………………………......19
2.2.1 PARTICIPATING LABORATORIES ……………………………………………19
2.2.2 SPECIMEN PREPARATION …………………………………………………….19
2.2.3 TRANSPORTATION AND STORAGE OF SPECIMENS………………………19
2.2.4 EXTRACTION OF NUCLEIC ACIDS ………………………….…………….….20
2.2.5 STUDY PROTOCOL……………………………………………………………...20
2.2.5.1 PCR-OC AND NASBA –OC………………………………………..…………..20
2.2.6 STATISTICAL ANALYSIS………...…………………………………………….20
2.3. LABORATORY EVALUATION (PHASE II STUDY) OF PCR-OC AND NASBA-
OC USING SUDANESE SAMPLES …………………………………………………...22
2.3.1 STUDY DESIGN AND SAMPLE SIZE …………………..……………………...22
2.3.2 PARTICIPANTS.………………………………………………………………….22
2.3.3 CLINICAL SCREENING …….…………………………………………………..22
2.3.4 PARASITOLOGICAL DIAGNOSIS …………………………………………….22
2.3.5. COLLECTION OF SAMPLES …………………………………………………..22
2.3.5.1 SAMPLE FOR NUCLEIC ACID…………………………………………….....22
III
2.3.5.2. SAMPLE FOR DAT …………………………………………………………...23
2.3.6. THE DIRECT AGGLUTINATION TEST (DAT)……………………………….23
2.3.7 PARTICIPANT CLASSIFICATION AND REFERENCE TESTS……...………..23
2.3.8 PCR-OC AND NASBA-OC TESTS …………………………...............................24
2.3.9 DATA ANALYSIS………………………………………………………..............24
2.4. LABORATORY EVALUATION OF PCR-OC AND NASBA-OC TESTS ON
KENYAN SAMPLES ……………………………………………………………..…….25
2.4.1 DATA ANALYSIS..…………………………………………………………….....25
2.5. IDENTIFICATION OF OLD WORLD LEISHMANIA SPECIES BY SPECIFIC
PCR AMPLIFICATION OF RDNA ITS1.……………………………………….….….26
2.5.1 DNA SAMPLES …………………………………………………………….…….26
2.5.2 PRIMERS AND INTERNAL CONTROLS ……………………………………....26
2.5.3 SPECIES-SPECIFIC PCRs………………………………………………………..27
2.5.4 OPTIMIZATION AND EVALUATION...………………………………………..27
2.5.5 VALIDATION AND IMPLEMENTATION……………………………………...27
2.5.6 CLINICAL SAMPLES (PHASE I STUDY)...………………………………….....28
2.5.7 DETERMINATION OF THE CAUSATIVE LEISHMANIA SPECIES ON
SUDANESE SAMPLES FROM CONFIRMED AND SUSPECTED VISCERAL
LEISHMANIASIS (VL) PATIENTS (PHASE II STUDY):………...…………………..28
CHAPTER 3. RESULTS………………………………………………….……....(36-51)
3.1. TYPING OF LEISHMANIA STRAINS ………...…………………………………..36
3.2. MULTICENTER RING TRIAL ………...………………………………………….41
3.3. LABORATORY EVALUATION (PHASE II STUDY) OF PCR-OC AND NASBA-
OC USING SUDANESE SAMPLES:…………….....…………………………………..44
3.3.1 PARTICIPANTS…………………….………...…………………………………..44
3.3.2 SENSITIVITY AND SPECIFICITY OF THE LEISHMANIA OLIGOC-TEST
AND NASBA-OC…………………………………...…………………………………..44
3.3.2.1 CONFIRMED VL, CL AND PKDL PATIENTS……………………………….44
3.3.2.2 SUSPECTED VL AND CL PATIENTS ……….……………………………….44
3.4. LABORATORY EVALUATION OF PCR-OC AND NASBA-OC TESTS ON
KENYAN SAMPLES:………………………………….……………………………….46
IV
3.4.1 PARTICIPANTS………………………………….……………………………….46
3.4.2 SENSITIVITY OF THE LEISHMANIA OLIGOC-TEST AND NASBA-OC..….46
3.4.3 SPECIFICITY OF THE LEISHMANIA OLIGOC-TEST AND NASBA-OC…....46
3.4.4 TEST AGREEMENT…………..…………...…….……………………………….46
3.5 IDENTIFICATION OF OLD WORLD LEISHMANIA SPECIES BY SPECIFIC
PCR AMPLIFICATION OF RDNA ITS1………………...…………………………….47
3.5.1 SEQUENCES…………………………….……….……………………………….47
3.5.2 OPTIMIZATION AND EVALUATION..……….………………………………..47
2.5.3 VALIDATION ……………………………..….…………………………………..27
3.5.4 IMPLEMENTATION………………………….………………………………......47
3.5.5 CLINICAL SAMPLE ANALYSIS (PHASEI)...….……………………………….48
3.5.6 SENSITIVITY OF THE L. DONOVANI COMPLEX ASSAY -SPECIFIC PCR...48
3.5.6.1 SUSPECTED VL…………………………….....….…………………………….48
3.5.6.2 CONFIRMED VL……………...…………….....….…………………………….48
CHAPTER 4.DISCUSSION, CONCLUSION AND RECOMMENDATIONS (52-94)
4.1 DISCUSSION....……………………………………………………………………..52
4.1.1 CHARACTERIZATION OF SUDANESE ISOLATES OF LEISHMANIA………52
4.1.2 MULTICENTER RING TRIAL …………………………………………..………53
4.1.3 LABORATORY EVALUATION (PHASE II STUDY) OF PCR-OC AND
NASBA-OC USING SUDANESE SAMPLES …………………………………………55
4.1.4 LABORATORY EVALUATION OF PCR-OC AND NASBA-OC TESTS ON
KENYAN SAMPLES…………………………………………………………... ………58
4.1.5 IDENTIFICATION OF OLD WORLD LEISHMANIA SPECIES BY SPECIFIC
PCR AMPLIFICATION OF rDNA ITS1……………………………....................……..60
4.2 CONCLUSION………………………………………………………………………63
4.3 RECOMMENDATIONS ……………………………………………………………64
REFERENCES .....………………………………………………………………...(65-74)
APPENDICES .....………………………………………………………………............75
V
DEDICATION
This thesis is dedicated to:
My parents, brothers and sisters
Who have given me the opportunity of an education from
The best institutions and support throughout my life.
Who dealt with all of my absence from many family occasions
With a smile
My sister Manal:
Who offered me unconditional love and support
Throughout her life until her death.
.
VI
ACKNOWLEDGEMENTS I am heartily thankful to my supervisor, Professor Sayda H.Elsafi, whose encouragement,
guidance and support from the initial to the final level of the thesis enabled me to develop
an understanding of the subject.
My sincere thanks to my co-supervisor Dr. Ahmed M. Eltom Associate Professor of
Biochemistry, Faculty of Medicine University of Khartoum for his great help and
support.
I would like to express the deepest appreciation to my co-supervisor Dr. Gert Van der
Auwera, Institute of Tropical Medicine in Belgium, His sound advice and careful
guidance was invaluable.
It is an honor for me to express the deepest thanks to Professor Mustafa I. Elbashir, who
has the attitude and the substance of a genius: he continually and convincingly conveyed
a spirit of adventure in regard to research, and an excitement in regard to teaching.
I am particularly grateful to Dr. Khalid.H, Assistant Professor of Biochemistry and the
Head Department for his great help and support.
From the formative stages of this thesis, to the final draft, I owe an immense debt of
gratitude to our group of leishmania research: Awad Hammad, Nuha Galal, Ahmed
Mustafa, Osman Salih, Al-Taib Musa, Faiz Omer and Ahmed Abd.Wahid. Without their
persistent help this dissertation would not have been possible.
I would like to express my special thanks to TRYLEIDIAG Project committee (P.
Büscher, J.-C. Dujardin, T. Laurent, Stijn Deborggraeve and Gerard J. Schoone), for their
great help and valuable advices.
It gives me great pleasure in acknowledging the support and help of my best friends
(Adil, Al-Taib, Mohammed, Naji, Hussein, A.Gasim, Liena, Ishraga,Fatima, Ikhlas,
Selma and Azza) who have always helped me and believed that I could do it.
I am indebted to many of my colleagues to support me in department of biochemistry and
in faculty of medicine.
I would also like to thank those patients and endemic healthy control who agreed to
participate in this study, without their time and cooperation, this study would not have
been possible.
VII
For their efforts and assistance, a special thanks as well to the Director of Soba
University Hospital and his staff.
I would like to express my gratitude to the authorities at Gedarif Ministory of Health with
especial thank to Hamad Alneel Al-Taib.
Lastly, I offer my regards and blessings to all of those who supported me in any respect
during the completion of the study.
This study was financed by the commission of the European Community’s Sixth
Framework Programme, priority INCO-DEV, project TRYLEIDIAG, contract
015379
VIII
Abbreviations
ACC Accordance
CL Cutaneous leishmaniasis
cDNA Complementary DNA
Chr Chromosome
CI Confidence interval
CON Concordance
DAT Direct agglutination test
DAT-FD DAT-freeze Dried
DCL Diffuse cutaneous leishmaniasis
DNA Deoxyribonucleic acid
DR Democratic Republic
EBI European Bioinformatics Institute
EDTA Ethylene diamine tetra acetic acid
EDTA TE Tris-EDTA
ELISA Enzyme-linked immunosorbent assay
ESTs Expressed sequence tags
FRET Fluorescence resonance energy transfer
HIV Human immunodeficiency virus
IDRI Infectious disease research institute
IFAT Indirect fluorescent antibody test
IRT Intergenic region typing
ITMA Institute of Tropical Medicine Antwerp
ITS Internal transcribed spacers
kDNA Kinetoplast maxicircle genes DNA
KEMRI Kenya Medical Research Institute
IX
LAMP Loop-mediated isothermal amplification
LGN Leishmania Genome Network
LSU Large subunit
MCL Mucocutaneous leishmaniasis
MST Montenegro skin test
NASBA Nucleic acid based sequence amplification
NASBA-OC NASBA- oligochromatography
PBS Phosphate-buffered saline
PCR Polymerase chain reaction
PCR-OC PCR- oligochromatography
PFG Pulsed field gel
PKDL Post kalazar leishmaniasis
RAPD Random amplified polymorphic DNA
RFLP Restriction fragment length polymorphism
RNA Ribonucleic acid
rRNA Ribosomal RNA
SDS Sodium dodecyl sulfate
SSCP Single strand conformation polymorphism
SSU Small subunit
TDR Tropical Disease Research
UNDP United Nation Development Programme
UV Ultra violet
VL Visceral leishmaniasis
WHO World Health Organization
2D PAGE 2 dimintional polyacrylamide gel electrophoreses
X
ABSTRACT Background: Recent innovations in molecular diagnosis such as nucleic acid sequence-based amplification (NASBA) and polymerase chain reaction (PCR) products have opened perspectives for robust and rapid point-of-care molecular tests as a real alternative for parasitological and serological diagnosis in leishmaniasis together with the potential of differentiating species and subspecies in one test. The objectives of this study are to determine the leishmania species of isolates from eastern Sudan, to evaluate the repeatability and reproducibility of NASBA and PCR followed with oligochromatography (OC) for the detection of Leishmania in a ring trial multicenter study and to evaluate the performance of both tests in phase II study using clinical leishmaniasis samples from Sudan and Kenya as well as to develop ribosomal DNA internal transcribed spacer 1(rDNA-ITS1) species-specific PCRs that discriminate between old world leishmania species. Methods: The rDNA-ITS1 and Leishmania Cysteine proteinase B species-specific PCRs were used for typing of 22 leishmania isolates .In addition 34 samples were tested blindly by both NASBA-OC and PCR-OC in the ring trial and a laboratory based evaluation of both tests was also performed using Sudanese (247) and Kenyan(182) leishmaniasis samples.Furthermore,four species-specific (PCRs) amplifying ITS1 were developed to discriminate L. aethiopica, L. tropica, L. major, and the L. donovani complex; these PCRs use the same cycling conditions, and include an internal amplification control. Principal Findings: All the leishmania isolates belong to donovani sub-species within the donovani complex. NASBA-OC and PCR-OC tests showed high repeatability and reproducibility in the ring trial study. In phase II study using Sudanese samples, the PCR-OC (OligoC-TesT) as well as the NASBA-OC showed a sensitivity of 96.8% (95% CI: 83.8%–99.4%) on lymph node aspirates and of 96.2% (95% CI: 89.4%–98.7%) on blood from the confirmed VL cases. The sensitivity on bone marrow was 96.9% (95% CI: 89.3%–99.1%) and 95.3% (95% CI: 87.1%–98.4%) for the OligoC-TesT and NASBA-OC, respectively. All confirmed CL and PKDL cases were positive with both tests. The specificity on the healthy endemic controls was 90% (95% CI: 78.6%–95.7%) for the OligoC-TesT and 100% (95% CI: 92.9%–100.0%) for the NASBA-OC test. On the suspected VL cases, we observed a positive OligoC-TesT and NASBA-OC result in 37.1% (95% CI: 23.2%–53.7%) and 34.3% (95% CI: 20.8%–50.9%) on lymph, in 72.7% (95% CI: 55.8%–84.9%) and 63.6% (95% CI: 46.6%–77.8%) on bone marrow and in 76.9% (95% CI: 49.7%–91.8%) and 69.2% (95% CI: 42.4%–87.3%) on blood. Seven out of 8 CL suspected cases were positive with both tests. The specificity on the healthy endemic controls was 90% (95% CI: 78.6%–95.7%) for the OligoC-TesT and 100% (95% CI: 92.9%–100.0%) for the NASBA-OC test. On Kenyan samples, the Leishmania OligoC-TesT showed a sensitivity of 96.4% (95% [CI]: 90–98.8%) and a specificity of 88.8% (95% CI: 81–93.6%), while the sensitivity and specificity of the NASBA-OC were 79.8% (95% CI: 67–87%) and 100% (95% CI: 96.3–100%), respectively. The species specific PCRs can amplify up to 0.1 pg of Leishmania DNA, while being 100% specific for species identification on an extensive panel of geographically representative strains
XI
and isolates; they could also be used for leishmania species identification in clinical specimens. Conclusions: The entire 22 leishmania isolates lie within the donovani complex in the rDNA-ITS1 phylogeny with almost identical sequence, and they are all of L.donovani sub-species. NASBA-OC and PCR-OC showed high sensitivity on lymph, blood and tissue scrapings for diagnosis of VL, CL and PKDL in Sudan and Kenya, but the specificity for clinical VL was significantly higher with NASBA-OC. The ITS1 species specific PCRs presents the first step towards a standardized typing assay for Old World Leishmania species. Recommendations: Further characterization with ITS1 of leishmania isolates from different parts of the Sudan is needed in order to have a comprehensive picture of the distribution of the species causing leishmaniasis in Sudan, The Leishmania OligoC-TesT and NASBA-OC can be used as powerful diagnostic tests in disease surveillance programmes and in monitoring intervention studies. Phase 11 evaluation of the rDNA species specific PCR using an extended set of clinical samples from leishmaniasis patients with different clinical presentation is recommended.
XII
صلالمستخ
:الخلفيةفتحت افاق للفحوصات الجزيئية (PCR)و(NASBA)التطور الحديث في التشخيص الجزيئي كاستخدام نواتج
كبدائل حقيقية للفحص المجهري والمناعي لتشخيص داء الليشمانيا مع إمكانية التفريق بين األنواع واألنواع .الفرعية لليشمانيا في فحص واحد
:االهداف-PCR و NASBA-OCنواع الليشمانيا المأخوذة من شرق السودان وتقييم تكرار واستنساخ نتائج تحديد أ
OCللكشف عن الليشمانيا في دراسة متعددة المراكز)ring trial ( وتقييم اداء الفحصين في المرحلة الثانية منريبوسوم الحمض النووي الدراسة باستخدام عينات من مرضى الليشمانيا من السودان وكينيا وتطوير اختبار
التي تفرق بين انواع PCRلألنواع المعينة من الليشمانيا باستخدام فحوصات ال (rDNA-ITS1)الجزيئي .الليشمانيا المستوطنة في العالم القديم
: منهجية البحث لألنواع المعينة من الليشمانيا بفحوصات ال Cysteine proteinase B) (و (rDNA-ITS1)استخدمت
PCR عينة فحصت علي نحو اعمي بفحص 34 باالضافة الى. طفيل ليشمانيا22لتصنيف NASBA-OC عينة 247وتم تقييم اداء الفحصين اعتمادا علي الفحص المجهري باستخدام ring trial ) (في PCR-OCو
النواع معينة PCR ت المن كينيا وعالوة علي ذلك تم اختراع فحوصا182من مرضى الليشمانيا من السودان و )aethiopica, tropica, major. donovani (للتفريق بين انواع الليشمانياITS1 من الليشمانيا تضاعف ال
.هذه االختبارات تعمل في نفس الظروف وتحتوي علي ضابط داخلي للتضاعف :النتائج
أثبتا NASBA-OCوPCR-OCو فحصي ) donovani(كل طفيليات الليشمانيا تنتمي لتحت نوع مجموعة وأداء الفحصين في المرحلة الثانية لعينات مرضى ) ring trial(نسبة عالية من التكرار واألستنساخ في دراسة
لليشمانيامن السودان أعطت حساسية متساوية لعينات العقد الليمفاوية مقدارها 96.8% (95% CI: 83.8%–99.4%) 96.2ولعينات الدم الوريدي مقدارها% (95% CI: 89.4%–98.7%)
كانت لمرضى الليشمانيا الحشوية وحساسية الفحصين على عينات نخاع العظم96.9% (95% CI: 89.3%–99.1%) 95.3 و% (95% CI: 87.1%–98.4%) على التوالي لنفس
في الحاالت . ات المؤكدة لليشمانيا الجلدية والليشمانيا الجلدية بعد الحشوية كانت ايجابية في الفحصيالعين.المرضى :and 34.3% (95% CI (CI: 23.2%–53.7% %95) %37.1المشتبهة لوحظ ايجابية نتائج الفحصين في
and 63.6% (95% (CI: 55.8%–84.9% %95) %72.7من الغدد الليمفاوية و في (50.9%–20.8%CI: 46.6%–77.8%) 76.9من نخاع العظم و في% (95% CI: 49.7%–91.8%) and 69.2% (95%
CI: 42.4%–87.3%) من حاالت الليشمانيا الجلدية الشتبهة كانت ايجابية في 8من 7. من الدم الوريدي PCR-OC96.4% (95% [CI]: 90–98.8%)في عينات كينيا كانت حساسية الفحص باستخدام .الفحصين
بينما كانت حساسية و (CI: 81–93.6% %95) %88.8لمرضى الليشمانيا الحشوية و خصوصية الفحص (CI: 96.3–100% %95) %100و 79.8% (95% CI: 67–87%) (NASBA-OC)خصوصية فحص
ض النووى لألنواع المعينة من الليشمانيا لها المقدرة على مضاعفة الحم (PCR)إختبارات .على التوالي في مجموعة جغرافية واسعة %100بيكو غرام بينما كانت خصوصية الفحص لمعرفة النوع 0.1 الجزيئي إلى
النطاق تمثل سالالت متنوعة من الليشمانيا و يمكن استخدامها لمعرفة االنواع من العينات السريرية :استنتاجات
و كلها (r DNA-ITS1)في شجرة لتصنيف ) (donovaniكل طفيليات الليشمانيا تقع في غضون مجموعة ال نالفحصا اظهر. (donovani)نوع تحتمتطابقة التسلسل في وحدات الحمض النووي الجزئيي و كلها تتبع ل
حساسية عالية في عينات الغدد الليمفاوية و الدم و بقايا االنسجة لتشخيص الليشمانيا الحشوية و الجلدية و الجلدية
XIII
كانت خصوصية الفحص لعينات مرضى الليشمانيا الحشوية مرتفعة بشكل . ي السودان و كينيابعد الحشوية ف .(NASBA-OC)ملحوظ في فحص الخطوة االولى باتجاه التصنيف الموحد النواع (ITS1-PCR)واع المعينة من فحوصات نتمثل اختبارات األ
م القديملالليشمانيا بالعا :التوصيات
السودان ووصفهم ب فياعداد اكثر من طفيليات الليشمانيا من مناطق مختلفة هنالك حوجة للحصول على(ITS1) بروتوكول لكي نحصل على صورة اكثر شموال النتشار االنواع المسببة لمرض الليشمانيا في السودان.
. يمكن استخدام الفحصين كادوات تشخصية قوية في برامج المسح و دراسات رصد التدخليمكن ان تستخدم على نطاق واسع في العينات السريرية من فحص rDNA-PCRالمعينة لل فحص االنواع
.الليشمانيا باختالف االعراض حتى تسهم في اخذ العالج الكافي و المتابعة لمرضى الليشمانيا في العالم القديم
XIV
List of tables
1. Table 2.5.1 Origin of strains used for evaluation and validation................................29
2. Table 2.5.2: Overview of species-specific PCRs.....………………………………...30
3. Table 2.5.3: The clinical details of the Sudanese VL suspected samples...………...31
4. Table 2.5.4: The clinical details of the Sudanese VL confirmed samples…........31-32
5. Table 3.1.1 The clinical details of the studied Leishmania isolates…...…………….36
6. Table 3.1.2 Leishmania typing results ….…………………………………………..40
7. Table 3.2.1 Results of Try and Leish PCR-OC tests on the specimen sets in the seven
laboratories participating in the study .………………………………………………41
8. Table 3.2.2 Results of Try and Leish NASBA-OC tests on the specimen sets in the
seven laboratories participating in the study…...…………………………………….42
9. Table 3.2.3 Overview of accordance and concordance of the Trypanzoon and
Leishmania OligoC-TesT on DNA and blood specimens analyzed during the ring trial
…………………………………………………………………………………..……43
10. Table 3.3.1 Diagnostic accuracy of leishmania OligoC-Test and NASBA-OC on
confirmed and suspected leishmaniasis cases and on healthy endemic controls from
Sudan ..………………….............................................................................................45
11. Table 3.3.2 Agreement between the Leishmania OligoC-TesT and NASBA-OC on
blood, lymph, bone marrow and lesion scraping specimens...………………………45
12. Table 3.4.1 Diagnostic accuracy of leishmania OligoC-Test and NASBA-OC on
confirmed VL cases and healthy endemic controls from Baringo district, Kenya…. 46
13. Table 3.5.1: Overview of blinded panel validation result ..…………………………49
XV
List of figures
1. Figure (2.1.1): rDNA ITS1 sequencing ……………………………………...…18
2. Figure (2.5.1): Position of the species specific PCR relative to the first
nucleotide of the 18S rDNA gene in chromosome 27 of L. major strain Friedlin
………………………………………………………………..…………………..33
3. Figure (2.5.2): Overview of the 4 cloned PCR products used as internal controls
…………………………………………………………………………………....34
4. Figure (2.5.3): Agarose gel image of the Leishmania species-specific PCR
products (L), and the same products with internal control amplicon
(IC)……………………………………………………………………………….35
5. Figure(3.1.1): ITS1 PCR reactions for sequencing (PCR 10F-
14R)……………………………………………………………………...……….37
6. Figure (3.1.2): rDNA ITS1 clustering (Sudanese strains with bold)………..…..38
7. Figure (3.1.3): Cysteine proteinase B species-specific PCR…………………...39
8. Figure (3.5.2): Results from 4 species-specific PCRs on clinical samples ……..50
9. Figure (3.5.2): L. donovani complex -specific PCR on VL suspected samples...50
10. Figure (3.5.3): L. donovani complex -specific PCR on VL confirmed
samples……………………………………………………………..…………….51
XVI
List of publications
1. Alfarazdeg A. Saad, Nuha G. Ahmed, Osman S. Osman, Ahmed Almustafa
Al-Basheer, Awad Hamad, Stijn Deborggraeve, Philippe Bu¨scher3, Gerard J.
Schoone, Henk D. Schallig, Thierry Laurent, Ahmed Haleem, Omran F.
Osman, Ahmed Mohamedain Eltom, Mustafa I. Elbashir, Sayda El-Safi.
Diagnostic Accuracy of the Leishmania OligoC-TesT and NASBA-
Oligochromatography for Diagnosis of Leishmaniasis in Sudan. Plos
Neglected Tropical Diseases. August 2010, Vol 4, Issue 8
2. S. Ogado Ceasar Odiwuor, A. Ageed Saad, S. De Doncker, I. Maes, T.
Laurent, S, El Safi, M. Mbuchi, P. Büscher, J.-C. Dujardin & G. Van der
Auwera. Universal PCR assays for the differential detection of all Old World
Leishmania species. Eur J Clin Microbiol Infect Dis. DOI 10.1007/s10096-
010-1071-3. Received: 16 April 2010 / Accepted: 19 September 2010.
3. Claire M Mugasa, Thierry Laurent, Gerard J Schoone, Frank L Basiye,
Alfarazdeg A Saad, Sayda el Safi, Piet A Kager & Henk DFH Schallig. Simplified molecular detection of Leishmania parasites in various clinical
samples from patients with leishmaniasis. Parasites & Vectors 2010, 3:13
4. Claire M. Mugasa, Stijn Deborggraeve, Gerard J. Schoone, Thierry Laurent,
Mariska M. Leeflang, Rosine A. Ekangu, Sayda El Safi, Al-farazdag A.
Saad, Frank, L. Basiye, Simone De Doncker, George W. Lubega, Piet A.
Kager, Philippe Buscher & Henk D. F. H. Schallig. Accordance and
concordance of PCR and NASBA followed by oligochromatography for the
XVII
molecular diagnosis of Trypanosoma brucei and Leishmania. Trop Med Int
Health doi:10.1111/j.1365-3156.2010.02547. 2010 Jul;15(7):800-5.
5. Frank L. Basiye, Margaret Mbuchi, Charles Magiri, George Kirigi, Stijn
Deborggraeve, Gerard J. Schoone, Alfarazdeg A. Saad, Sayda El-Safi, Enock
Matovu & Monique K. Wasunna. Sensitivity and specificity of the
Leishmania OligoC-TesT and NASBA-oligochromatography for diagnosis of
visceral leishmaniasis in Kenya Trop Med Int Health Trop Med Int Health.
2010 Jul; 15(7):806-10.
1
1. Introduction & Literature review 1.1.Leishmaniasis Overview:
The trypanosomatid parasite of the genus leishmania is the etiological agent of a
variety of disease manifestations, collectively known as Leishmaniasis. Leishmaniasis is
prevalent in 66 nations throughout the tropical and sub-tropical regions of Africa, Asia,
the Mediterranean and Southern Europe (old world) and in 22 countries in South and
Central America (new world) [1]. Despite enormous efforts, it has proved difficult to
predict the exact scale of the impact of leishmaniasis on public health, since many cases
go unreported or misdiagnosed. It is estimated that approximately 12 million people are
currently infected and a further 367 million are at risk of acquiring leishmaniasis in 88
countries, 72 of which are developing countries and 13 of them are among the least
developed in the world [2]
The leishmaniasis can be classified into 4 main clinical forms:
1. Visceral leishmaniasis (VL) - the most serious form is fatal if left untreated (e.g. Kala
azar due to L. donovani s.l.). More than 90% of visceral leishmaniasis cases occur in
Bangladesh, Brazil, India and Sudan.
2. Cutaneous leishmaniasis (CL) - the most common form, causes 1-200 simple skin
lesions which self-heal within a few months but which leave unsightly scars. (E.g.
Baghdad ulcer, Delhi boil or Bouton d’Orient, due to infection with L. major in Africa
and Asia). More than 90% of cutaneous leishmaniasis cases occur in Iran, Afghanistan,
Syria, and Saudi Arabia, Brazil and Peru. Most cases of CL heal without treatment,
leaving the person immune to further infection. In many parts of South-west Asia,
infections were deliberately encouraged on the buttocks of babies in order to immunize
them (avoiding disfiguring scars on the face or elsewhere).
3. Mucocutaneous leishmaniasis (MCL), due to L. braziliensis infection in the New
World, begins with skin ulcers which spread, causing dreadful and massive tissue
destruction, especially of the nose and mouth.
4. Diffuse cutaneous leishmaniasis (DCL) due to L.aethiopica in old world and
L.mexicana in new world, produces disseminated and chronic skin lesions resembling
those of leprotamous leprosy. It is difficult to treat [2, 3].
The parasitic protozoa of the genus Leishmania is mainly transmitted to humans by sand
flies. Over 20 species and subspecies infect humans. Humans are infected via the bite of
sand flies (subfamily phlebotominae) - tiny sand-colored blood-feeding flies that breed
2
in forest areas, caves, or the burrows of small rodents. Wild and domesticated animals
and humans themselves can act as a reservoir of infection. Rarely, leishmaniasis is
spread from a pregnant woman to her baby. Leishmaniasis also can be spread by blood
transfusions or contaminated needles [4]. Most forms of leishmaniasis are originally
infections of small mammals (‘reservoir hosts’), which play a major role in the
epidemiology of the disease. Old World forms of Leishmania are transmitted by sand
flies of the genus Phlebotomus, while New World forms mainly by flies of the genus
Lutzomyia. Sand flies become infected by ingesting blood from infected reservoir hosts
or from infected people [5, 6].
The diagnosis of leishmaniasis is conventionally confirmed by demonstration of
parasites although some forms of leishmaniasis are extremely difficult to diagnose by
parasitology [7]. Parasitological diagnostic methods include: Microscopic examination,
culture and inoculation of aspirates into animals. It is the method of choice and it
depends on local resources. Other approaches include serodiagnosis which is based on
detection of circulating antibody [8]. It is highly sensitive for diagnosing VL and useful
for diagnosing MCL disease but less useful for diagnosing other forms of CL. Usually it
is a support to a parasitological diagnosis but sometimes it is appropriate for use under
field conditions. The techniques include: Aldehyde (formal gel), direct agglutination
test (DAT), enzyme-linked immunosorbent assay (ELISA), Indirect fluorescent
antibody test (IFAT) and recombinant antigens. Other laboratory investigations include
the polymerase chain reaction (PCR)[9,10]: It is a sensitive and specific technique for
detecting and identifying specific leishmania DNA sequences but it requires advanced
laboratory facilities and technical expertise so it is not suitable for field conditions.
Leishmania species identification is important and techniques to identify leishmania
species include: parasite biology, isoenzyme analysis, monoclonal antibodies, PCR,
DNA or RNA hybridization to specific probes and analysis of kinetoplast maxicircle
genes (kDNA) [5, 11, 12].
Control measures that involve human cases include early: detection which can be active
or passive. Vector and reservoir host control measures are expensive, requiring good
infrastructure and maintenance – often giving results which are short-lived. Vector
control, based on spraying with residual insecticides, can be effective where
transmission occurs in and around the home. Where transmission occurs away from
home, individuals should use some form of protection, such as insect repellent or
insecticide [13, 14]. The leishmaniases, as a complex of diseases, are as yet impossible
3
to control with a single approach or tool (a vaccine may prove a cost-effective
exception). Control depends on early case detection and drug treatment where the
reservoir is infected human. Recently, resistance to drugs has been reported, requiring
the use of more toxic drugs, such as amphotericin B. Most available drugs are costly,
require long treatment regimes and are becoming more and more ineffective,
necessitating the discovery of new drugs [14, 15].
1.2 LEISHMANIASIS IN SUDAN:
VL (kala-azar) has been among the most important health problems in Sudan,
particularly in the main endemic area in the eastern and central regions since the early
1900s [16, 17]. Several major epidemics have occurred; the most recent was in Western
Upper Nile province in southern Sudan, detected in 1988-claiming over 100,000 lives
[18]. The disease has spread to other areas that were previously not known to be
endemic for VL. A major upsurge in the number of cases was noted in the endemic area
of eastern Sudan. These events triggered renewed interest in the disease [19].
Phlebotomus orientalis was confirmed as the vector by various epidemiological and
entomological studies in several parts of the country, typically associated with Acacia
seyal and Balanites aegyptiaca vegetation [20, 21]. Twelve Leishmania isolates from
VL patients in eastern Sudan were characterized using isoenzyme analysis, Southern
blotting and polymerase chain reaction (PCR) ‘fingerprinting’. Isoenzyme analysis
revealed the presence of 3 zymodemes: (MON-18, MON-30 and MON-82),
corresponding to Leishmania donovani sensu stricto, L. infantum and L. archibaldi (still
of uncertain taxonomic status), respectively. Southern blotting and PCR ‘fingerprinting’
revealed identical patterns for all 3 zymodemes, which were indistinguishable from
those of L. donovani s.s. [22]. Transmission indicates a human reservoir and
anthroponotic transmission [23]. PKDL was much more common than expected (56%
of patients with VL developed PKDL), but other post-VL manifestations were also
found affecting the eyes (uveitis, conjunctivitis, blepharitis), nasal and/or oral mucosa
[19]. Leishmania major, zymodeme LON-1 is responsible for CL in Sudan [24]. The
disease is endemic in many parts of the country; major epidemics occurred in northern
Sudan, in Shendi- Atbara area in 1976 [25] and in Tuti island at the junction of the
White and Blue Nile rivers in Khartoum state [26]. The vector is Phlebotomus papatasi
and the animal reservoir is probably the Nile rat Arvicanthis niloticus [21, 27], the
vectors being domestic and peridomestic in the villages [28]. Patients usually present
with papules, nodules, or nodulo-ulcerative lesions, mainly on the exposed parts of the
4
skin [29]. In 20% of cases the parasite disseminates through the lymphatics, producing
sporotrichoid-like lesions [30]. The diagnosis is confirmed by the demonstration of
parasites in slit smears in 50-70% of cases and in histological sections in 70% [31, 32].
With primers specific for L. major, the polymerase chain reaction is positive in 86% of
cases [33]. Since CL is a self-limiting disease, treatment is confined to patients with
severe disease [29].
Sudanese MCL is a chronic infection of the upper respiratory tract and/or oral mucosa
caused mainly by Leishmania donovani [34]. The disease occurs in areas of the country
endemic for visceral leishmaniasis, particularly among Masalit and other closely related
tribes in western Sudan [35]. The condition may present in most cases as a primary
mucosal disease though it may develop during or after an attack of visceral
leishmaniasis [36]. In contrast to South American MCL, mucosal leishmaniasis in
Sudan is not preceded or accompanied by a cutaneous lesion. Parasites are scanty.
Diagnosis is established by demonstration of parasites in smears or biopsies, by culture
or animal inoculation, or with the aid of the polymerase chain reaction. Most patients
give positive results in the direct agglutination test and leishmanin skin test. Patients
respond well to treatment with pentavalent antimony compounds [37].
1.3. DIAGNOSIS OF LEISHMANIASIS:
The broad clinical spectrum of the leishmaniasis makes the diagnosis of present and
past cases difficult. However, differential diagnosis is important because diseases of
other aetiologies with a clinical spectrum similar to that of the leishmaniasis (e.g.,
leprosy, skin cancers, and tuberculosis for CL and malaria and schistosomiasis for VL)
are often present in areas of endemicity. Moreover, the severity of the clinical disease
severity varies according to the infecting Leishmania species, and there is growing
evidence that the therapeutic response is species and, perhaps, even strain specific.
1.3.1. MICROSCOPY AND CULTURE:
Parasitological diagnosis remains the gold standard in leishmaniasis diagnosis because
of its high specificity. This is typically undertaken by microscopic examination of
Giemsa-stained lesion biopsy smears (CL) or lymph node, bone marrow, and spleen
aspirates (VL). Occasionally, histopathological examination of fixed lesion biopsies or
culture of biopsy triturates and aspirates is also performed. Microscopy is probably still
the standard diagnostic approach at tertiary, secondary, or even primary health levels in
areas of endemicity, because more sophisticated techniques are currently expensive and
rarely available. Importantly, the sensitivity of microscopy and culture tends to be low
5
and can be highly variable, depending on the number and dispersion of parasites in
biopsy samples, the sampling procedure, and most of all the technical skills of the
personnel [7].
1.3.2. SEROLOGICAL TECHNIQUES:
Several serological approaches are commonly used in VL diagnosis. In particular,
freeze-dried antigen-based direct agglutination tests and commercially available
immunochromatographic dipstick tests have increasingly become reference tests in
operational settings since they have high sensitivity and specificity, are easy to use, and
require minimal technological expertise or laboratory setup [8]. Serological tests are
rarely used in CL diagnosis because sensitivity can be variable and because the number
of circulating antibodies against CL-causing parasites tends to be low (e.g., if previous
chemotherapy has been administered). The specificity can also be variable, especially in
areas where cross-reacting parasites (e.g., Trypanosoma cruzi) are prevalent. The
Montenegro skin test (MST) is occasionally used in CL diagnosis (e.g., in
epidemiological surveys and vaccine studies) because of its simple use and because of
its high sensitivity and specificity [38]. The MST has major drawbacks which include
that it requires culture facilities to produce the MST antigen, that different antigen
preparations impact test sensitivity, and that the test does not distinguish between past
and present infections. The MST is not used for VL diagnosis, since patients only
develop strong Leishmania-specific cell-mediated immunity when cured [39].
1.3.2.1 THE DIRECT AGGLUTINATION TEST (DAT):
The DAT is a semi-quantitative test that uses microtitre plates in which increasing
dilutions of patient’s serum or blood are mixed with stained killed L. donovani
promastigotes [40]. Agglutination is visible after 18 hours with the naked eye if specific
antibodies are present. The storage of the antigen at 2–8°C once it has been dissolved
and the prolonged incubation time are other drawbacks. Freeze-dried antigen is more
robust than liquid antigen [41]. Through the way of improving DAT, DAT-Mod
presented with adequate reproducibility between the three batches, resulting in variation
coefficients from 0 to 5.8% [42]. A cut-off titer of higher serum dilutions generally
yields higher specificities [43]. Using a cut-off titer of 1:100, [42] there were only four
false-negative and three false positive results, which indicates a high sensitivity (93.4%)
and specificity (96.9%). These rates are comparable [44] when the industrialized kit
(DAT-FD) using the same cut-off titer (1:100) was used.
1.3.3. MOLECULAR DIAGNOSIS:
6
Although different molecular methods have successively been evaluated for
leishmaniasis diagnosis (e.g., pulsed-field gel electrophoresis and multilocus enzyme
electrophoresis), PCR-based assays currently constitute the main molecular diagnostic
approach of researchers and health professionals. Several distinct PCR formats are
available that may broadly be classified into “mid-tech,” “high-tech,” and “low-tech”
approaches. Mid-tech approaches are probably the most widely used, and comprise
conventional PCR assays, in which PCR amplicons are resolved by electrophoresis
(eventually after cleavage with restriction enzymes, i.e., PCR and restriction fragment
length polymorphism analysis [PCR-RFLP]) and visualized after ethidium bromide
staining [45]. These assays are performed with several pieces of laboratory equipment
(e.g., a thermocycler, a power supply, an electrophoresis tank, a UV transilluminator,
and a camera) available in any standard molecular laboratory and are generally time-
consuming (which may considerably alter the cost of analysis, depending on the
personnel costs). High-tech approaches are methods in which PCR products are
analyzed during their amplification (so-called real-time PCR) after staining with SYBR-
green I dye or hybridization with fluorogenic probes (e.g., TaqMan or fluorescence
resonance energy transfer [FRET]) [46]. In this case, assays are performed with a single
all-in setup, and the detection of fluorescence is done within a closed tube, decreasing
the risk of laboratory contamination by amplicons. Applications are rapid and of high
throughput, but equipment are comparatively expensive and working costs remaining
high. Low-tech approaches refer to simplified PCR methods for use in laboratory
settings with minimal equipment [47]. Simplification can potentially be done at the two
main steps of the PCR protocol: target amplification and detection of the PCR products.
Loop-mediated isothermal amplification (LAMP) represents a promising avenue for
both steps: it requires only a simple water bath for amplification, and detection can be
done visually by using SYBR-green I dye, which turns green in the presence of
amplified products and remains orange in its absence [48]. The method was claimed to
be 100 times more sensitive than conventional PCR in the detection of Trypanosoma
brucei [49]. Simplification of detection has been attempted by PCR-enzyme-linked
immunosorbent assay (ELISA), a "reverse hybridization" method based on the capture
of PCR amplicons by specific probes immobilized in ELISA microtiter wells and
colorimetric visualization. High sensitivity was observed in blood samples from HIV-
negative VL patients [50]. However, in PCR-ELISA, detection is still dependent on
sophisticated equipment (i.e., an ELISA plate reader).
7
1.3.3.1 PCR-OC
More recent methods, such as oligochromatography-PCR (OC-PCR), represent a more
promising alternative. This method requires a PCR cycler and a water bath, and PCR
products are visualized in 5 minutes on a dipstick through hybridization with a gold-
conjugated probe; an additional advantage is that internal PCR controls can be placed
onto the dipstick. Phase I evaluation of a first OC-PCR prototype for the diagnosis of
sleeping sickness and leishmaniasis revealed 100% sensitivity and specificity [51, 52].
1.3.3.2 NASBA
Is the most sensitive technique that allows detection and quantification of micro-
organisms [53, 54]. It is based on the isothermal amplification of RNA and detection of
up to 48 samples can be performed in approximately 90 minutes. In NASBA-OC the
amplification products are detected by a simple and rapid dipstick method based on
oligochromatography. This assay showed high sensitivity and specificity for
Leishmania detection during the phase I evaluations [55].
1.4. IDENTIFICATION OF THE SPECIES OF LEISHMANIA:
Leishmania transmission cycle and epidemiology depend on the particular infecting
(sub) species. Therefore, exact identification of the parasite species causing the disease
is essential in order to design the correct control strategy and to make decisions
regarding treatment strategies. Leishmania parasites (old world) have been divided into
different species primarily on the basis of clinical, biological, geographical and
epidemiological criteria [56]. During the past two decades, intrinsic characteristics, such
as biochemical and molecular data, have been used for the classification of Leishmania
isolates. At present, isoenzyme analysis by electrophoresis is widely used for the
identification of Leishmania (sub) species and up to now it still represents the reference
technique for Leishmania identification [57]. The parasites can be identified by their
enzymes electrophoretic mobilities and be grouped in taxonomic units termed
zymodemes. However, isoenzyme analysis has many drawbacks, it is time consuming
and laborious, requires culturing and obtaining the profile of 10–20 different enzymes.
Molecular methods, such as Southern hybridization and PCR-based methods have
become available; those are less laborious and more powerful to study variability
between Leishmania species [58].
1.4.1 SOUTHERN BLOTTING USING DNA PROBES:
One of the first molecular characterization methods in use was Southern blotting using
DNA probes. This method is tedious as it requires cultivation of promastigotes, DNA
8
extraction, gel electrophoresis, Southern blotting and hybridization [59]. DNA probes
for identifying Leishmania spp. generally target (kDNA); because the kDNA minicircle
molecules are present at 10 000 copies and have a variable region that differs from
minicircle classes in the same network [60]. kDNA minicircle sequence probes have
been developed for L .major [61], dermatropic and viscerotropic strains of L. infantum
[62] and L. aethiopica [63]. Recently, a new minicircle class exclusive to Leishmania
(Viannia) guyanensis was identified [64]. This allowed the development of a specific
probe, which hybridized strongly only to L. (V.) guyanensis kDNA after medium
stringency washing. Probes derived from different sequences of the nuclear DNA have
also been described. A cDNA probe containing multiple copies of a 60-bp repetitive
degenerate sequence isolated from L. donovani specifically hybridized only with
isolates of the L. donovani complex [59, 65, 66] described two probes which could be
used for the differentiation of Leishmania species. One probe, pDK10, can be used to
distinguish the Old World CL causing species from L. donovani complex and the other,
pDK20, to differentiate between all Old World Leishmania species.
1.4.2 PCR-BASED TECHNIQUES FOR IDENTIFICATION:
Many PCR-based techniques have been developed for the identification of Leishmania
species. Species specific primers: the specificity of any given PCR assay can be adapted
to specific needs by targeting conserved or variable regions in parasite DNA. In this
way it is possible to characterize Leishmania to the level of the genus complex, species
or even the individual isolate. For example, PCR amplification of mini-exon gene
repeating units showed size and sequence variation amongst many Leishmania species
[67], especially in the non-transcribed spacer region, which is distinct in length and in
sequence among different Leishmania species [68]. Random amplified polymorphic
DNA (RAPD) uses a single primer of arbitrary sequence at a low annealing temperature
to produce a PCR fingerprint-banding pattern after gel electrophoresis. This method
does not depend upon previous knowledge or availability of the nucleotide sequence of
the target nor does it require DNA hybridization [69]. However, the RAPD method has
one major drawback: it can only be used on cultured parasites free of contaminating
host DNA, which would mask the signal from the parasite DNA [70]. A correlation
between RAPD pattern and isoenzyme analysis results was observed among different
Leishmania isolates using six different arbitrary primers [71]. Four different, closely
related Leishmania spp. from the Viannia group were used to evaluate 28 different
RAPD primers. Thirteen of these primers yielded reproducible multiple banding
9
patterns of taxonomic value [70]. Amplification of genomic DNA with primers
annealing to mini- and microsatellite DNA sequences yielded distinctive and
reproducible sets of amplified DNA fragments for all Leishmania isolates tested. The
number and size of amplification products were found to be characteristic for a given
species. By comparing PCR patterns of unidentified Leishmania isolates with those
obtained from reference strains it is possible to identify these isolates at the species
level [72].
1.4.3 RESTRICTION FRAGMENT LENGTH POLYMORPHISM (RFLP):
With RFLP a PCR amplicon is digested with a set of different restriction enzymes and
resulting fragments are separated according to molecular size using gel electrophoresis.
For example, by digesting the amplified small subunit ribosomal RNA PCR product
with the restriction enzyme RsaI, it is possible to distinguish L. donovani from L.
tropica and L. major [73]. The GP63 locus has been successfully used for the genetic
characterization of a large number of natural isolates belonging to four species of the
subgenus Viannia, namely L. (V.) braziliensis, L. (V.) peruviana, L. (V.) guyanensis and
L. (V.) lainsoni [74, 75] has exploited the variability of the transcribed non-coding
regions between the small and large subunit rRNA genes to examine relationships in the
Viannia subgenus. In a method termed intergenic region typing (IRT), PCR
amplification products were obtained for the rapidly evolving 1–1.2-kb internal
transcribed spacers (ITS) between the small subunit (SSU) and large subunit (LSU)
rRNAs, from 50 parasites isolated from different hosts and geographical areas.
Amplified DNAs were cut with different restriction enzymes, and fragment patterns
compared after acrylamide gel electrophoresis. High levels of intra- and interspecific
variation were observed, and quantitative similarity comparisons were used to associate
different lineages. A complex evolutionary tree was obtained. Some species formed
tight clusters (L. equatorensis, L. panamensis, L. guyanensis, L. shawi), while L.
braziliensis was highly polymorphic and L. naiffi showed intraspecific distances
comparable to the largest obtained within all Viannia. L. colombiensis, L. equatorensis
and L. lainsoni clearly represent distinct lineages. Good agreement was obtained with
molecular trees based upon isoenzyme or mini-exon repeat sequence comparisons.
Single strand conformation polymorphism (SSCP) analysis is based on the differences
in the secondary structure of single-strand DNA molecules differing in a single
nucleotide, which also is frequently reflected in an alteration of their electrophoretic
mobility in nondenaturing gel electrophoresis. SSCP analysis was able to detect genetic
10
diversity at the level of a single nucleotide in a set of Sudanese L. donovani isolates
[76] and in 29 L. tropica strains [77].
1.5. MOLECULAR TECHNIQUES AND TAXONOMY:
Molecular techniques have provided new or improved views with regard to a number of
taxonomic matters: So far no differences were found between L. infantum and L.
chagasi, supporting the idea that L. chagasi and L. infantum are identical and that this
species was introduced in the New World in the recent past, may be as part of the
Spanish and Portuguese conquest of Latin America [78]. In another matter, the question
whether Leishmania is a sexually or asexually reproducing organism, the current
consensus seems to be that Leishmania has a basically clonal population structure with
occasional bouts of genetic exchange or hybridization [79]. RFLP data suggest that the
Old World Leishmaniasis comprise a monophyletic lineage, with species associated
with cutaneous disease exhibiting the greatest level of divergence [80]. However, a
number of taxonomic questions with regard to Leishmania remain open to debate. These
are related to the Viannia subgenus and the taxonomic status of a number of New World
complexes and have partly been addressed by [81].
1.6. NEW DEVELOPMENTS IN THE GENOME OF LEISHMANIA:
1.6.1. GENOME SEQUENCING PROJECT:
The Leishmania genome is a relatively small eukaryotic genome with an estimated size
of 33.6 Mbp with a karyotype of 36 chromosomes, ranging in size from 0.3 to 2.5 Mbp
[82]. In imitation of other genome sequencing projects, the Leishmania Genome
Network (LGN) was established in Rio de Janeiro (Brazil) in 1994 and aimed at the
genomic sequencing of the reference strain Leishmania major Friedlin [83]. The LGN is
chaired by Professor J. M. Blackwell (Cambridge, UK) and 10 laboratories from seven
countries are working for this project. The LGN is a programme supported by the
UNDP/WORLD BANK/WHO – TDR and its website www.ebi.ac.uk/
parasites/leish.html is an important source for Leishmania sequence information,
general information on parasites and their genomes and allows access to valuable
bioinformatic tools via its links. The aim of the LGN was to obtain a detailed high
resolution map of the reference strain L. major Friedlin (MHOM/IL/81/Friedlin). This
has been achieved by the application of a number of complementary approaches: the
determination of a pulsed field gel (PFG). Chromosomal ‘karyotype’, shuttle cosmid
clone fingerprinting to generate overlapping contigs, sequencing and mapping of
expressed sequence tags (ESTs) to PFG separated chromosomes and the generation of
11
DNA sequence from entire chromosomes. Sequencing of the whole genome is in
progress. A first-generation cosmid contig map of L. major Friedlin genome has been
constructed and sequencing of the genome is well under way with chromosome 1
(Chr1) and Chr2 completed and Chr4 virtually complete [84]. Furthermore, active
sequencing of Chr19, 23 and 35 is underway (LGN web site 2001). More than 600
completely sequenced genes have been identified, an estimated 8% of the genome of
approximately 8600 genes of Leishmania. Up to date, a large portion of the newly
identified genes (> 60%) remains unclassified, with 40% of these being potentially
Leishmania specific. Chr1, the smallest chromosome of L. major Friedlin, consists of
three homologues which differ in size by approximately 29 kb. The complete sequence
of Chr1 predicts that this chromosome has 79 protein coding sequences. The first 29 of
these genes are encoded in tandem on one strand of DNA, and the remaining 50 genes
are encoded on the other [85]. No RNA polymerase promoters, centromeric sequences
or origins of DNA replication have been identified in the DNA sequence. Statistical
analysis of Chr1 showed that the divergent junction region between the two
polycistronic gene clusters may be a candidate for an origin of DNA replication [86].
In the coming years, the LGN will shift into the next phase: functional genomics and
proteomics. This emerging area of research in the ‘post-genomic era’ deals with the
global analysis of gene expression using a battery of techniques to resolve (by 2D
PAGE), identify (by peptide sequencing, mass spectrometry, immunoblotting,…etc.),
quantify and characterize proteins, as well as to store and interlink protein and DNA
sequence and mapping information from the genome projects. This will aid
identification of the molecular determinants of virulence in Leishmania and new
strategies that can be exploited in the search for new therapies and vaccines.
1.6.2 MICROARRAYS:
The biological functions of only a fraction of the genes that are identified in genome
projects are known. Traditional molecular biological methods work on one gene-one
experiment basis and because of the limited throughput of such methods, the whole
picture of gene function is difficult to obtain. In contrast, the recently developed
microarray technology, in which DNA molecules representing many genes are placed in
thousands of discrete spots on a microscope slide, allows scientists to look at many
genes at once and to determine which ones are expressed in a particular cell type. Total
mRNA from cells in two different conditions is extracted and labelled with two
different fluorescent labels: for example, a green dye for cells at condition 1 (e.g. the
12
Leishmania promastigote stage) and a red dye for cells at condition 2 (amastigote
stage). Both extracts are washed over the microarray. Labelled gene products from the
extracts hybridize to their complementary sequences in the spots because of base
pairing. The fluorescent dyes enable measuring the amount of sample. If the RNA from
the promastigote is in abundance, the spot will be green, if the RNA from the
amastigote, it will be red. If both are equal, the spot will be yellow, while if neither is
present the spot will appear black. Thus, from the fluorescence intensities and colours
for each spot, the relative translation levels of the genes in both samples can be
estimated. More background information on DNA array technology can be found in
[87], including several references to relevant websites. It is expected that the application
of microarray technology in combination with the Leishmania genome project will
allow the identification of many new drug and vaccine targets. Recently, Professor J.M.
Blackwell reported at the Fourth TDR/IDRI meeting on second generation vaccines
against leishmaniasis on the use of microarrays to identify potential new vaccine targets.
DNA microarrays were used to simultaneously monitor the expression profiles for 2183
unique Leishmania genes as the parasite undergoes developmental transition from the
logarithmic promastigote to the metacyclic form and in the host derived amastigote
form. From this analysis, more than 100 previously unknown genes were identified that
are up-regulated in expression in amastigotes. These are now being tested as new
vaccine candidates; some cocktails of them appear to be effective as DNA vaccines in
mice.
13
1.7 RATIONALE:
There is a need of sensitive molecular techniques for diagnosis of leishmaniasis. This is
because serological tests show poor performances in HIV-co-infected patients as well as
in clinical forms characterised by a Th1 answer, like cutaneous and mucocutaneous
leishmaniasis. In these cases, first line diagnosis consists in parasitological detection.
However, since parasitaemia can be extremely low and parasite detection tests can only
be performed by trained personnel, quite a number of actually infected persons will
remain untreated and will constitute a non-controlled human reservoir.
There is need to develop tests that can be used to accurately distinguish different
Leishmania species. This is because species identification is important for clinical and
treatment purposes, epidemiological studies and disease control (anthroponoses versus
zoonoses). In the clinical context, it is necessary to distinguish different species of
Leishmania because they lead to different diseases (visceral leishmaniasis versus
cutaneous leishmaniasis). Some species are also linked to more severe secondary
pathology, such as post-kala-azar dermal leishmaniasis (PKDL) for L. donovani.
L. major infection is self-curing. In addition, the response to treatment and drug
resistance can also be species specific. For instance, L. tropica is poorly responsive to
antimony. Epidemiologically, several species are often prevalent in the same country,
but there are few or outdated distribution maps. Leishmania species repartition can
change and should be monitored by passive diagnosis and determination of species for
each patient. L. infantum is a zoonotically transmitted disease for which dog is the most
important reservoir and host, while L. donovani is thought to be transmitted
anthropozoonotically, which has important implications for prevention and control
programmes.
14
1.8 OBJECTIVES:
1) To characterize Sudanese isolates of Leishmania by sequencing ITS1 regions.
2) To evaluate the repeatability and reproducibility of NASBA-OC and PCR-OC
for the diagnosis of VL in a multicenter ring trial.
3) To validate the PCR-OC and NASBA-OC for VL in a Phase 11 study in Sudan
4) To evaluate the performance of the PCR-OC and NASBA-OC for VL on
Kenyan samples:
5) To develop standard operating procedure (SOP) for Leishmania ITS1 species
specific PCR that distinguishes between old world species.
15
2. Materials and Methods
This study is composed of five components: the first one was characterization of
Sudanese isolates of leishmania, the second one was multicenter ring trial, the third one
was phase II evaluation study on PCR-OC and NASBA-OC on Sudanese samples, the
fourth one was phase II evaluation study on PCR-OC and NASBA-OC on Kenyan
samples and the fifth one was Identification of Old World Leishmania species by
specific PCR.
2.1 CHARACTERIZATION OF SUDANESE ISOLATES OF LEISHMANIA:-
2.1.1 STUDY DESIGN:
This is a cross sectional study for typification of Sudanese isolates of Leishmania.
2.1.2 STUDY AREA:
The study was conducted between January 2007 and January 2008 in villages in Atbara
River Area, Gedarif state-Eastern Sudan, a recognized endemic area for VL in the
country [88].
2.1.3 STUDY SUBJECTS:
The study subjects included VL suspects (fever for more than 2 weeks and
splenomegally and / or lymphadenopathy) and PKDL cases (nodular, ulcerative or
noduloulcerative lesions) as described by Zijlstra and El-Hassan [19]
2.1.4 SAMPLE SIZE:
A total of 22 Leishmania isolates were included in the study: 20 isolates from VL
clinical cases and 2 from PKDL cases.
2.1.5 RESEARCH ETHICS:
Informed consent was obtained from all patients to participate in this study. Ethical
clearance for the study was obtained from the National Ethics Committee of the Federal
Ministry of Health in Sudan and of the University of Antwerp in Belgium.
2.1.6 STUDY DESCRIPTION AND PROTOCOLS:
2.1.6.1: THE FIELD WORK:
The field work involved the selection of VL and PKDL cases as described previously
and the primary isolation of leishmania.
2.1.6.1.1: PARASITOLOGICAL TECHNIQUES:
Direct microscopy:
16
Slit smears (PKDL) or needle aspirations (VL) were done on suspect cases and part of
the material were smeared on a clean glass slide, fixed in methanol and stained with
Giemsa′s stain for the detection of amastigotes.
Lymph node aspiration:
An enlarged lymph nodes in case of VL suspect were selected (the inguinal nodes are
the most convenient), after cleaning the skin the needle (without the syringe) was
inserted, rotated gently and part of the fluid was expelled on a clean glass slide
Bone marrow aspiration:
The superior posterior iliac crest was mostly selected for bone marrow aspiration and
part of marrow was pushed on a clean glass slide
Skin slit smear:
The affected site, e.g. a papule or nodule, was cleaned and pressed firmly between
thumb and finger to avoid contamination with blood. The surface of the lesion was cut
with a surgical blade which was then turned through 90” and material is collected by
Scraping and part of them applied to a slide
Invitro culture of leishmania parasite:-
The remaining of the materials described above was inoculated in use of Tobie blood
agar media (Tobie EJ, 1949). The cultures were incubated at 26 oC and transported in
this temperature to the central lab in Soba University hospital and checked for after 4-14
days for the presence of promastigotes. Locke solution, usually in the amount of 0.5 –2
ml, was used as overlay fluid to support the growth of the parasites in the Tobie culture
medium. Antibiotics were added to the Locke solution to reduce the risk of
contamination of the medium by the other unwanted micro-organisms. Penicillin and
Gentamicin were used for the primary isolation and Penicillin and Streptomycin for
maintenance. The parasites were checked twice per week for viability and density and a
copy of those strains were taken to the Institute of Tropical Medicine (Antwerp).
2.1.6.2: MOLECULAR CHARACTERIZATION OF SUDANESE ISOLATES:-
This work was carried out at the Institute of Tropical Medicine, Antwerp. The work
involved subculture of the isolates in Tobies medium with Locks solution as an overlay;
the cultures were maintained until the density of the promastigotes reached about
106/ml. Then part of the parasites were cryopreserved by adding them to a mixture of
30% glycerol and PBS in a ratio of 3:1 to make stabilates which were kept in liquid
nitrogen or in -70 oC. The rest of the lock solution were filtered and washed with PBS
and centrifuged to get the parasite pellet.
17
2.1.6.2.1 DNA EXTRACTION OF PARASITES PELLETS:
The DNA extraction was carried out using QIAamp Mini Kit; Germany (catn°51304).
The parasites pellets were resuspended in PBS to a final volume of 200 µl. Then 20 µl
QIAGEN Protease or Proteinase K were added. 200 µl AL (lysis buffer) was added to
the sample and mixed well, incubated at 56°C for 10 min (to reach a maximum DNA),
centrifuged in 1.5 ml microcentrifuge tube. And 200 µl ethanol (96–100%) was added
to the sample, and mixed again and briefly centrifuged. The mixture was carefully
applied to the QIAamp Spin Column (in a 2 ml collection tube) and centrifuged at 6000
x g (8000 rpm) for 1 min and the QIAamp Spin Column placed in a clean 2 ml
collection tube, and the tube containing the filtrate was discarded. Then 500 µl of the
AW1 buffer was added and centrifuged at 6000 x g (8000 rpm) for 1 min and the
QIAamp Spin Column placed in a clean 2 ml collection tube, and the tube containing
the filtrate was discarded. This was followed by the addition of 500 µl of the AW2
buffer and centrifugation at 20,000 x g; (14,000 rpm) for 3 min. Then the QIAamp Spin
Column was placed in a clean 1.5 ml microcentrifuge tube and the collection tube
containing the filtrate was discarded then 200 µl Buffer AE or distilled water was added
and incubated at room temperature (15–25°C) for 5 min, and centrifuged at 6000 x g
(8000 rpm) for 1min.
2.1.6.2.2 TYPING OF SUDANESE LEISHMANIA ISOLATES BY SEQUENCING
ITS1 REGIONS:
The internal transcribed spacer 1 of the ribosomal DNA repeat unit (rDNA-ITS1)
as shown in Fig 2.1 was amplified with primers (rDNA-10F and rDNA-14R)
(5’ CAATACAGGTGATCGGACAGG 3’) and (5’ CACGGGGATGACACAATAGAG 3’).
The primers concentration was 0.5 µM and they were ordered from Sigma-Aldrich
(Bornem, Belgium). The total reaction volume was 50 µl of 1x PCR buffer (Qiagen,
Venlo, The Netherlands), including 1mM of MgCl2 buffer (Qiagen, Venlo, The
Netherlands), 200 µM of each dNTPs from Eurogentec (Seraing, Belgium) and 1 unit
HotStarTaq Plus DNA polymerase (Qiagen, Venlo, The Netherlands) was used to give
0.02 u/ul concentration in the final PCR mix, 1 ul of extracted DNA from promastigote
cultures added to the mix. The PCR mix was supplemented in a 200µl tube or plate.
Cycling conditions for PCR were : 5 min at 95°C; followed by 40 cycles of 30 sec
94°C, 30 sec 60°C, and 45 sec 72°C; and finally 5 min at 72°C. The PCR was
performed in an Eppendorf EP Gradient S (Eppendorf, Wesseling-Berzdorf, Germany)
thermocycler. 5 µl of the products were analyzed on a 2% agarose gel stained with
18
ethidium bromide, and scored positive when an amplicon of the expected size was
observed (500bp). The remaining PCR products (45 µl) were sent to Antwerp
University centre for automated sequencing. The results of sequencing are analyzed by
Invitrogen (Vector NTI) program and compared to reference ITS1 sequence, the
determined rDNA-ITS1 sequences were submitted to the EBI sequence data base.
Further more to differentiate between L.donovani and L.infantum within the L.donovani
complex the following PCR protocols were used:-
2.1.6.2.3 LEISMANIA CYSTEINE PROTEINASE B SPECIES-SPECIFIC PCRs:
These PCR assays [89] were used to differentiate between Leishmania donovani and
Leishmania infantum species of the L.donovani complex that had been confirmed by
ITS1 sequencing PCR protocol. They were performed in 30 ul containing 1.5 U
HotStarPlusTaq DNA polymerase (Qiagen, Venlo, The Netherlands) and the
accompanying 1x HotStarPlusTaq buffer (including 1.5 mM MgCl2); 0.2 mM of each
dNTP; 0.33 uM of each primer:
cpbF2.1(5’GCGGCGTGATGACCAGC3’)cpbDo2.1(5’CAATAACCAGCCATTCGTT
TTTA3’) for donovani species and infcpbE (5’ TCTTACCAGAGCGGAGTGCTACT
3’) cpb inf2.1 (5’ ATAACCAGCCATTCGGTTTTG 3’) for infantum species; and for
each PCR mix 1 ul of extracted DNA from promastigote cultures was added.
Cycling was done as follows: initial denaturation for 5 min at 95°C; 40 cycles
consisting of 30 sec 95°C, 15 sec 59°C, 15 sec 72°C; and finally an extra elongation
step of 5 min 72°C.
Fig. 2.1.1 rDNA ITS1 sequencing
5.8S rDNA (2348 - 2630)
2100 2200 2300 2400 2500 2600 2700
SSU rDNA (1 – 2203)
600 700 800 900
L. major rDNA
Sequencing
ITS1
ζSSU (18S) β5,8S α γ δ ε εrDNA
28S rDNA equivalent
19
2.2. MULTICENTER RING TRIAL:
This is the second component of the study which was carried out at the Department of
Biochemistry, Faculty of Medicine and Soba University Hospital. It was a quality
assurance, proficiency testing of the collaborating laboratories (see 2.2.1). The study
involved the evaluation of repeatability and reproducibility of nucleic acid sequence-
based amplification with oligochromatography (NASBA-OC) and polymerase chain
reaction with oligochromatography (PCR-OC) for the detection of Leishmania or
Trypanosoma brucei.
2.2.1 PARTICIPATING LABORATORIES:
The ring trial was performed by trained persons in seven independent laboratories in six
countries: Makerere University in Uganda, Institut National de Recherche Biome´dicale
in Democratic Republic (DR) of the Congo, Kenya Medical Research Institute in
Kenya, University of Khartoum in Sudan, The Koninklijk Instituut voor de Tropen
Biomedical Research in The Netherlands, Coris BioConcept and the Institute of
Tropical Medicine both in Belgium. The laboratories in Europe evaluated all four tests;
the laboratories in Uganda and DRC evaluated the Tryp- PCR-OC and Tryp-NASBA-
OC and the laboratories in Kenya and Sudan tested the Leish-PCR-OC and Leish-
NASBA-OC. All participants were trained in test execution during a one-week
workshop held at Makerere University (Kampala, Uganda).
2.2.2 SPECIMEN PREPARATION:
In-vitro cultured Trypanosoma brucei gambiense (LiTat 1.3) and Leishmania donovani
(MHOM⁄SD ⁄ 68 ⁄ S1) parasites were suspended in phosphate-buffered saline (PBS) at a
concentration of 106 parasites per ml PBS. This suspension was used to prepare two
different sets of specimens. The first set of specimens comprised serially diluted
parasites in Tris-EDTA (TE) buffer containing 20 µg ⁄ ml calf thymus DNA to prevent
degradation of the target DNA (dilution buffer) at concentrations of 100 000, 10 000,
1000, 100, 10 and 0 parasites per ml. The second set comprised human blood from a
healthy volunteer spiked with 1000, 100, 10 and 0 T. brucei gambiense or Leishmania
parasites per ml of blood. All blood specimens were prepared in triplicate. Four blood
specimens from non-endemic healthy volunteers were further included in the study as
negative controls.
2.2.3 TRANSPORTATION AND STORAGE OF SPECIMENS
All specimens were prepared by a single individual in a central laboratory (The
Koninklijk Instituut voor de Tropen Biomedical Research in The Netherlands), as
20
cooled transport to several participants could not be guaranteed, the blood specimens
were stabilized on silica before shipment. This was carried out by performing the first
step in the nucleic acid extraction protocol [90]. In brief, 200 µl of each specimen was
mixed with 1.2 ml of L6 lysis buffer (50 mM Tris–HCl, 5M GuSCN 20 mM EDTA,
0.1% Triton X100) and subsequently 40 µl of silica suspension was added and mixed
for a further 5 min. The samples were centrifuged and the supernatant discarded,
leaving behind a pellet of silica with bound nucleic acids. The specimen sets were
shipped on dry ice to the various participating laboratories. All samples were coded and
tested blindly by a trained person in each of the seven laboratories.
2.2.4 EXTRACTION OF NUCLEIC ACIDS
The silica pellet was washed twice with 1 ml of L2 wash buffer (5 M GuSCN, 100 mM
Tris–HCl [pH 6.4] supplied by the central laboratory to trial participants), twice with 1
ml of 70% ethanol, and once with 1 ml of acetone. The pellet was dried at 56 °C for 5
min after which the nucleic acids were eluted in 50 µl TE buffer during 5-min
incubation at 56 °C. The eluted nucleic acids were stored at -20 °C until amplification.
2.2.5 STUDY PROTOCOL
The Trypanosoma specimen set was analyzed with the Tryp-NASBA-OC and Tryps-
PCR-OC; while the Leishmania specimen set was analyzed with the Leish-NASBA-OC
and Leish-PCR-OC. With the specimen set and necessary test reagents, the participating
laboratories also received a test report sheet, questionnaire and standard operating
procedures for nucleic acid extraction as described by Boom et al. [90], and the PCR-
OC and NASBA-OC execution protocols as described by Deborggraeve et al. [51, 52]
and Mugasa et al. [55, 91]. The laboratories further purified the nucleic acids from the
blood specimens and analyzed the blood specimens once and the nucleic acid dilutions
in PBS thrice.
2.2.5.1 PCR-OC AND NASBA –OC
All specimens were tested blindly and test results were reported to the central laboratory
for statistical analysis.
2.2.6 STATISTICAL ANALYSIS
Accordance (ACC), defined as the average chance of finding the same result for two
identical specimens analyzed in the same laboratory, and concordance (CON), defined
as the average chance of finding the same result for two identical specimens analyzed in
different laboratories, of Tryp-PCR-OC, Tryp-NASBA-OC, Leish-PCR-OC and Leish-
21
NASBA-OC were estimated in a random framework by the formulae described by van
der Voet and van der Raamsdon [92]:
ACCr = (1⁄L) ∑i (p0,i 2+p1,i 2) and CONr = P0 2+P1 2, in which p0, i 2and p1,i 2 were
defined as the squared proportion of Tryp-PCR-OC, Tryp-NASBA-OC, Leish-PCR-OC
and Leish-NASBA-OC negative and positive results, respectively, for each analysis i
and where P0 2 and P1 2 were defined by the equations P0 2 = (1⁄L) ∑i = 1 p0,i and P1 2
= (1⁄L) ∑i = 1 p1,i with L the number of laboratories in the trial. Around the ACC and
CON estimates, 95% confidence intervals (CI) were quantified by bootstrapping [93].
22
2.3. LABORATORY EVALUATION (PHASE II STUDY) OF PCR-OC AND
NASBA-OC USING SUDANESE SAMPLES:
2.3.1 STUDY DESIGN AND SAMPLE SIZE:
This is prospective study to evaluate PCR-OC and NASBA-OC tests on 90 confirmed
and 90 suspected VL cases, 7 confirmed and 8 suspected CL cases, 2 confirmed PKDL
cases and 50 healthy endemic controls.
2.3.2 PARTICIPANTS
VL suspects, PKDL suspects and endemic healthy controls were recruited in Gedarif
State and CL in Khartoum State between October 2008 and January 2009. VL and
PKDL suspects were recruited in the health centers of villages within the endemic areas
while the endemic healthy controls were volunteers from the same villages but not
visiting the health centers. CL suspects were recruited at the Dermatology Hospital in
Khartoum. Confirmed leishmaniasis cases were given appropriate treatment in the same
health center or hospital as they were diagnosed. A participant was included in the study
if 2 years or older and written consent was obtained from the individual or his/her
guardian. Specimen collection was performed by the Faculty of Medicine of Khartoum
University. Ethical clearance for the study was obtained from the ethical committees of
the Federal Ministry of Health Committee in Sudan and the University of Antwerp in
Belgium.
2.3.3 CLINICAL SCREENING:
The criteria for clinical selection of VL suspect was based on the presence of fever for
two weeks or more, splenomegaly and /or lymphadenopathy and exclusion of Malaria,
Typhoid and Tuberculosis. The criteria for clinical selection of PKDL and CL suspect
was based on the presence of papular, nodular or ulcerative lesions on exposed areas of
the skin . The demographic and clinical information was recorded in standard form.
2.3.4 PARASITOLOGICAL DIAGNOSIS:
The same procedure as described in 2.1.6.1.1
2.3.5. COLLECTION OF SAMPLES:
2.3.5.1 SAMPLE FOR NUCLEIC ACID
Two hundred µl anti-coagulated blood (confirmed and suspected VL cases and healthy
endemic controls), and/or lymph node, and/or bone marrow aspirate (confirmed and
suspected VL cases) or lesion or nodule scrapings (confirmed and suspected CL and
PKDL cases) was mixed with 200 µl of L3 buffer (the trade name AngeroNATM, from
Mallinckrodt Baker (USA)) This buffer allows specimen storage without loss of DNA
23
and RNA quality. (Specimens were shipped at 4°C from the collection site to the central
laboratory at Soba University Hospital laboratory, Khartoum University and stored at
4°C for a maximum of two weeks.
2.3.5.2. SAMPLE FOR DAT:
From each healthy endemic control, (5ml) of venous blood sample was collected in
EDTA container. (2ml) .Serum was transferred to (5ml) eppendorf tube and were
shipped at -70°C (liquid nitrogen) from the field collection site to the central laboratory
at Soba University Hospital, Khartoum University and stored at -20 oC for DAT.
2.3.6. THE DIRECT AGGLUTINATION TEST (DAT):
The DAT was performed essentially as described by Harith et al [94]. The wells of the
V-shaped micro-titre plates were filled with the serum dilution fluid. First well (of a
row): 100 µl dilution fluid and all other wells (of a row): 50 µl dilution fluid then1 µl
serum was added to the first well of a row (the first dilution is 1:100), the serum was
diluted by using a multi-channel pipette and Well 12 was used as a negative control well
then the plate was covered and incubated overnight, finally the titer was defined as the
highest dilution at which agglutination was still visible. In comparison to the blue dots
present in the negative control wells, this agglutination shows as blue mats, enlarged
blue dots with frayed edges, or enlarged blue dots
2.3.7 Participant classification and reference tests
A participant was classified as (i) confirmed VL case if there was clinical suspicion for
VL, DAT on serum was positive (titer ≥ 1:3200) and parasites were observed in lymph
or bone marrow aspirates by microscopic analysis; (ii) suspected VL case with positive
DAT if there was clinical suspicion for VL, DAT on serum was positive, no parasites
were observed in lymph or bone marrow aspirates and no previous history of VL was
reported; (iii) suspected VL case with negative DAT if there was clinical suspicion for
VL, DAT on serum was negative, no parasites were observed in lymph or bone marrow
aspirates and no previous history of VL was reported; (iv) endemic healthy control if
there was no clinical suspicion for VL, no previous history of VL and DAT on serum
was negative; (v) confirmed CL or PDKL case if there was clinical suspicion for CL or
PKDL and parasites were observed in lesion or nodule scrapings by microscopic
analysis; and (vi) suspected CL case if there was clinical suspicion for CL and no
parasites were observed in lesion or nodule scrapings. Clinical suspicion for VL was
defined as a history of fever for two weeks or more and splenomegaly or
lymphadenopathy and for CL and PKDL the presence of skin lesions or nodules. The
24
reference tests were performed by experienced laboratory technicians immediately after
specimen taking at the collection sites as described in the WHO manual on visceral
leishmaniasis [95].
2.3.8 PCR-OC AND NASBA-OC TESTS:
This work was done at the Department of Biochemistry, Faculty of Medicine and Soba
University Hospital. Nucleic acids of the specimens were extracted according to the
method described by Boom et al. [90]. Elution was done in 50 µl of pure water or Tris-
EDTA (TE) buffer and stored at -20°C until analysis. The extracts were tested with the
Leishmania OligoC-TesT and NASBA-OC between October 2008 and February 2009
as described by Deborggraeve et al. [52] and Mugasa et al. [55]. In brief, with the
OligoC-TesT DNA of the parasite is amplified by PCR and subsequently 40 µl of
denatured PCR product is mixed with 40 µl of migration buffer preheated at 55°C for at
least 20 minutes followed by dipping the Oligo-strip into the solution. The NASBA-OC
amplifies an RNA sequence of the parasite by NASBA reaction after which 4 µl of the
amplified product is mixed with 76 µl of migration buffer preheated at 55°C and the
Oligo-strip is dipped into the solution. Test results are read after 10 minutes for both
tests. Training on PCR-OC and NASBA – OC had been received during a one-week
workshop held in June 2007 at Makerere University, Kampala, Uganda. No external
quality control confirming the reference test or index test results could be performed
during the study.
2.3.9 Data analysis
The sensitivity and specificity of the Leishmania OligoC-TesT and NASBA-OC were
calculated from data entered into contingency tables. Differences in sensitivity and
specificity between the two tests and differences in test results of specimen types were
estimated by the Mc Nemar test. Concordances between the two tests were determined
using the kappa index. All calculations were estimated at a 95% confidence interval
(95% CI).
25
2.4. LABORATORY EVALUATION OF PCR-OC AND NASBA-OC TESTS ON
KENYAN SAMPLES:
Sample collection and Nucleic acid extraction was performed at KEMRI in Kenya
within 2 weeks of arrival of the specimen from the collection site. The extracts were
analyzed with the PCR- OC and NASBA -OC between October 2008 and February
2009 at Soba University hospital, Khartoum University in the frame of a collaborative
consortium.
All the samples were tested with the Leishmania OligoC-TesT and NASBA-OC as
described by Deborggraeve et al. [52] and Mugasa et al. [55]. Test kits were provided
by Coris BioConcept (Gembloux, Belgium). In brief, the Leishmania OligoC-TesT
amplifies a short sequence of the Leishmania 18S ribosomal DNA by PCR, and the
NASBA-OC amplifies a part of the 18S ribosomal RNA by NASBA. For both assays,
the amplification products are mixed with migration buffer preheated to 55 °C after
which the dipstick is dipped into the solution. Migration is performed at 55 °C, and test
results are read after 10 min. The two tests contain internal controls to validate the
migration as well as the amplification reaction.
2.4.1 DATA ANALYSIS
The sensitivity and specificity of the Leishmania OligoC-TesT and NASBA-OC were
calculated from data entered into contingency tables. Differences in sensitivity and
specificity between the two tests were estimated by the McNemar test. Concordances
between the two tests were determined using the kappa index. All calculations were
estimated at a 95% confidence interval (95% CI).
26
2.5. IDENTIFICATION OF OLD WORLD LEISHMANIA SPECIES BY
SPECIFIC PCR AMPLIFICATION OF RDNA ITS1:
2.5.1 DNA SAMPLES:
DNAs from reference strains and isolates were obtained from cultured parasites, and
were either grown and extracted at the Institute of Tropical Medicine Antwerp (ITMA,
Antwerp, Belgium), or kindly donated by several institutes acknowledged at the end of
this manuscript. Concentration of the parasite DNA was measured using the Nanodrop
ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, Delaware, USA).
Isolates were characterized by rDNA-ITS1 sequencing, or a discriminative PCR
targeting cysteine proteinase B [89]. For sequencing, PCR amplicons (Fig. 2.5.1) were
generated with primers rDNA-10F (5’ CAATACAGGTGATCGGACAGG 3’) and
rDNA-14R (5’ CACGGGGATGACACAATAGAG 3’), and this was followed by direct
sequencing without cloning. Table 2.5.1 lists the origin of all samples used during the
evaluation and validation steps, and the accession numbers of the determined rDNA-
ITS1 sequences. The definitions of L. infantum and L. donovani are as in [96].
2.5.2 PRIMERS AND INTERNAL CONTROLS:
Species-specific PCR primers were designed on the basis of an alignment of rDNA-
ITS1 sequences newly determined (Table 2.5.1) and downloaded from the EBI
sequence data base (www.ebi.ac.uk). Several primer combinations per species were
tested, and a final set (Fig. 2.5.1, Table 2.5.2) was selected for extensive optimization,
evaluation, and validation experiments. For each of the 4 species-specific PCRs,
internal positive control templates were developed (Figs. 2.5.2, 2.5.3). These internal
controls are added to the respective PCRs, and upon successful amplification they show
a product of about 100 bp longer than the Leishmania species-specific amplicon. Such
internal control allows to check for correct PCR mix set-up, and sample inhibition. To
obtain these internal controls, phage lambda DNA fragments were amplified with
composite cloning primer pairs, each consisting of a 3’ lambda-specific segment with a
Leishmania species-specific 5’ extension matching the PCR primers in (Table 2.5.2)
The amplified phage lambda sequences were selected to have a base composition
comparable to the respective Leishmania targets. The phage lambda amplicons, flanked
by the Leishmania primer annealing sites, were cloned in vector pCR4-TOPO using a
27
TOPO TA cloning kit (Invitrogen, Carlsbad, CA, USA), and verified by sequencing
(Fig. 2.5.2).
2.5.3 SPECIES-SPECIFIC PCRs
Five PCRs were used in this study, which are listed in (Table 2.5.2) and depicted
schematically in (Fig. 2.5.1) The total reaction volume was 25 µl of 1x Coralload PCR
buffer (Qiagen, Venlo, The Netherlands), including 0.1 mg/ml acetylated BSA
(Promega, Madison, WI, USA), 200 µM of each dNTP supplemented with 400 µM of
dUTP, in a 200µl tube or plate. Other components are listed in their respective
concentration in Table 2.5.2, and HotStarTaq Plus DNA polymerase (Qiagen) was used
in each case. PCR LT2 was not used in the evaluation and validation experiments.
Primers were ordered from Sigma-Aldrich (Bornem, Belgium), dNTPs from Eurogentec
(Seraing, Belgium), and dUTPs from Roche (Vilvoorde, Belgium). Cycling conditions
for all PCRs were identical: 5 min at 95°C; followed by 40 cycles of 30 sec 95°C, 40
sec 55°C, and 40 sec 72°C; and finally 5 min at 72°C. All PCRs were performed in a
BioMetra T3000 thermocycler (BioMetra, Göttingen, Germany). Products were
analyzed on a 2% or 2.5% agarose gel stained with ethidium bromide, and scored
positive when an amplicon of the expected size (Table 2.5.2) was observed.
2.5.4 OPTIMIZATION AND EVALUATION
Following development of the PCR protocols, the detection limit of the PCRs was
assessed by using 10, 1, 0.1, and 0.01 pg DNA from 5 different parasite isolates or
strains from each species. This was repeated with the addition of DNA extracted from 9
µl naive human blood in each PCR, for which 2.5 µl of 180 µl blood extract eluted in 50
µl was added to the reaction. The discriminatory power for identifying the correct
species was assessed using 100 pg of the DNAs listed in (Table 2.5.1). The optimal
concentration of the recombinant internal control plasmids was determined as the lowest
concentration that consistently amplified in repeated experiments, as tested at least in
triplicate in a 10 fold dilution series, followed by further refining by using 4
intermediate concentrations. Sensitivity of the internal control amplification to PCR
inhibitors was tested by adding 0.01, 0.1, and 1% of SDS (Sodium dodecyl sulphate) to
the reaction.
2.5.5 VALIDATION AND IMPLEMENTATION
For the purpose of validating the final PCR protocols, a blinded test panel was
compiled, including the strains listed in Table 1. DNA from each strain was included
28
twice in the panel: once at an amount of 100 pg per PCR, and once at an amount of 0.2
pg including a DNA equivalent of 1 µl naive human blood per PCR. In addition, the
panel contained 3 negative controls and 3 naïve blood extracted DNAs as quality check
for contamination and cross-reactivity. This makes a total of 90 samples, which were
supplemented by 6 negative controls by the person performing the test. Positive results
were considered valid if no contamination was observed in these 6 added negative
controls, and an amplicon of the expected Leishmania size (Table 2.5.2) was obtained.
Negative PCR results were valid if no product of the expected size was observed, and
the internal control amplicon (Table 2.5.2, Fig. 2.5.2) was amplified (Fig. 2.5.3). In case
one of these conditions was not met, the PCR was repeated. All PCR mixes were
prepared in bulk, containing all reagents except polymerase and Leishmania template.
They were stored at -20°C and when needed an aliquot was taken to which polymerase
and templates were added. For the purpose of implementation in an endemic reference
lab, the tests were transferred to the Kenya Medical Research Institute (KEMRI,
Nairobi, Kenya), where PCR mixes were produced locally. The tests in KEMRI were
performed by a different person as those at ITMA, but using the same blinded test panel
DNA.
2.5.6 CLINICAL SAMPLES (PHASE I STUDY):
We tested our assays on various clinical samples, containing different species of
Leishmania and other pathogens. L. donovani samples were obtained from blood, bone
marrow, and lymph node of visceral leishmaniasis patients from Sudan. L. infantum
samples were obtained from bone marrow of Italian visceral leishmaniasis patients, and
spleen taken from Portuguese dogs suffering of canine leishmaniasis. L. major and L.
tropica samples were obtained from skin lesions of cutaneous leishmaniasis patients in
Tunisia and Kenya. In addition, our assays were performed on blood from patients
suffering Plasmodium falciparum malaria (Uganda) and human African
trypanosomiasis (Democratic Republic of Congo), and on sputum from tuberculosis
patients (Democratic Republic of Congo). DNA from these samples was extracted using
various methods.
2.5.7 DETERMINATION OF THE CAUSATIVE LEISHMANIA SPECIES ON SUDANESE SAMPLES FROM CONFIRMED AND SUSPECTED VISCERAL LEISHMANIASIS (VL) PATIENTS (PHASE II STUDY): L. donovani complex assay was tested on confirmed (40 samples) and suspected (20
samples) which were collected between October 2008 and January 2009 in the Gedarif
state in Sudan. (Table 2.5.3 and 2.5.4), 200 uL of blood (confirmed VL), bone marrow,
29
or lymph node (suspected VL) were preserved in equal volume of L3 and DNA was
extracted according to the method of Boom et al. [90]. DNA was eluted in 100 uL Tris-
EDTA (TE) buffer and stored at-20°C.
Table 2.5.1 Origin of strains used for evaluation and validation:
Species Country Evaluation a Validation a Accession numbers b
L. aethiopica
Ethiopia
Kenya
8
2
8
2
FN677344, FN677347, FN677348, FN677349, FN677350, FN677351, FN677352, FN677353, FN677354, FN677355, FN677356, FN677346
L. donovani c
Ethiopia India Kenya Sudan
2 2 2
2 1 3
FN677363, FN677364 FN677358, FN677359, FN677360, FN677361, FN677362
Infantumc
France Italy Malta Portugal Spain Sudan
1 1 1 3
1 2 1 2 1
L. major Burkina Faso Israel Kenya Saudi Arabia Spain Sudan Tunisia USSR (former Sovjet Union) Uzbekistan
1 1 1 1 1 1 1 1
1 1 1 1 1 1 1 1 1
FN677342 FN677357
L. tropica
Iraq Israel Kenya Palestinian territory USSR (former Soviet Union)
1 2 4 2 1
1 2 2 2 1
FN677341 FN677343, FN677345
a Where possible, different parasite strains were used for the evaluation and validation. b Accession numbers are listed according to species and origin, but are not always determined from the strains or isolates used for the evaluation and validation. c Species of the L. donovani complex (L. donovani and L. infantum) are defined as in [96]..
30
Table 2.5.2: Overview of species-specific PCRs a
a Only reagents differing between the PCRs are listed. Common reagents in all PCRs (buffer, BSA, dNTPs, dUTP) are described in Materials and Methods.
b These amplicon sizes can deviate with a few nucleotides depending on the exact strain or isolate. c Internal control constructs are depicted in Fig. 2, and the amount used in each PCR is given between brackets. The
concentration of the internal control template was estimated spectrophotometrically using the Nanodrop ND-1000 Spectrophotometer (Thermo Scientific, Wilmington, Delaware, USA).
d This is the final concentration used in the PCR, inclusive of the 1.5 mM already present in the Coralload PCR buffer.
e Primer annealing positions are depicted schematically in Fig.2.5 1.
31
Table 2.5.3: The clinical details of the Sudanese VL suspected samples.
Serial No Patient code Type of sample
1 01/SD/GED/SUSPECT/T0810 Lymph node aspirate
2 05/SD/GED/SUSPECT/T0810 Lymph node aspirate
3 08/SD/GED/SUSPECT/T0810 Lymph node aspirate
4 12/SD/GED/SUSPECT/T0810 Lymph node aspirate
5 16/SD/GED/SUSPECT/T0810 Lymph node aspirate
6 17/SD/GED/SUSPECT/T0810 Lymph node aspirate
7 23/SD/GED/SUSPECT/T0810 Lymph node aspirate
8 24/SD/GED/SUSPECT/T0810 Lymph node aspirate
9 55/SD/GED/SUSPECT/T0812 Lymph node aspirate
10 56/SD/GED/SUSPECT/T0812 Lymph node aspirate
11 14/SD/GED/SUSPECT/T0810 Bone marrow aspirate
12 18/SD/GED/SUSPECT/T0810 Bone marrow aspirate
13 26/SD/GED/SUSPECT/T0810 Bone marrow aspirate
14 28/SD/GED/SUSPECT/T0810 Bone marrow aspirate
15 29/SD/GED/SUSPECT/T0810 Bone marrow aspirate
16 30/SD/GED/SUSPECT/T0810 Bone marrow aspirate
17 31/SD/GED/SUSPECT/T0810 Bone marrow aspirate
18 32/SD/GED/SUSPECT/T0810 Bone marrow aspirate
19 37/SD/GED/SUSPECT/T0810 Bone marrow aspirate
20 38/SD/GED/SUSPECT/T0810 Bone marrow aspirate
Table 2.5.4: The clinical details of the Sudanese VL confirmed samples.
Serial No Patient code Type of sample
1 31/SD/GED/Hammad/T0811/VL Venous blood
2 32/SD/GED/Hammad/T0811/VL Venous blood
3 33/SD/GED/Hammad/T0811/VL Venous blood
4 34/SD/GED/Hammad/T0811/VL Venous blood
5 35/SD/GED/Hammad/T0811/VL Venous blood
6 36/SD/GED/Hammad/T0811/VL Venous blood
7 37/SD/GED/Hammad/T0811/VL Venous blood
8 38/SD/GED/Hammad/T0811/VL Venous blood
32
Serial No Patient code Type of sample
9 39/SD/GED/Hammad/T0811/VL Venous blood
10 40/SD/GED/Hammad/T0811/VL Venous blood
11 41/SD/GED/Hammad/T0811/VL Venous blood
12 42/SD/GED/Hammad/T0811/VL Venous blood
13 43/SD/GED/Hammad/T0812/VL Venous blood
14 44/SD/GED/Hammad/T0812/VL Venous blood
15 45/SD/GED/Hammad/T0812/VL Venous blood
16 46/SD/GED/Hammad/T0812/VL Venous blood
17 47/SD/GED/Hammad/T0812/VL Venous blood
18 48/SD/GED/Hammad/T0812/VL Venous blood
19 49/SD/GED/Hammad/T0812/VL Venous blood
20 50/SD/GED/Hammad/T0812/VL Venous blood
21 51/SD/GED/Hammad/T0812/VL Venous blood
22 52/SD/GED/Hammad/T0812/VL Venous blood
23 53/SD/GED/Hammad/T0812/VL Venous blood
24 54/SD/GED/Hammad/T0812/VL Venous blood
25 55/SD/GED/Hammad/T0812/VL Venous blood
26 56/SD/GED/Hammad/T0812/VL Venous blood
27 57/SD/GED/Hammad/T0812/VL Venous blood
28 58/SD/GED/Hammad/T0812/VL Venous blood
29 59/SD/GED/Hammad/T0812/VL Venous blood
30 60/SD/GED/Hammad/T0812/VL Venous blood
31 67/SD/GED/Hammad/T0812/VL Venous blood
32 68/SD/GED/Hammad/T0812/VL Venous blood
33 69/SD/GED/Hammad/T0812/VL Venous blood
34 70/SD/GED/Hammad/T0812/VL Venous blood
35 71/SD/GED/Hammad/T0901/VL Venous blood
36 72/SD/GED/Hammad/T0901/VL Venous blood
37 73/SD/GED/Hammad/T0901/VL Venous blood
38 74/SD/GED/Hammad/T0901/VL Venous blood
39 75/SD/GED/Hammad/T0901/VL Venous blood
40 76/SD/GED/Hammad/T0901/VL Venous blood
33
Fig.2.5.1 Position of the species specific PCR relative to the first nucleotide of the 18S rDNA gene in chromosome 27 of L. major strain Friedlin (www.ebi.ac.uk), accession number CP000079, release 102) Drown to scale .the 18S .ITS1 and 5.8S rDNA fragments are indicated on top, according to the current annotation .Primer as in table 2.5.2, and the annealing position of the 5’ base is indicated, also delineating the start and the end of each amplicon. As the annealing position of all primers is given in relative to L.major fragment sizes calculated from these don’t correspond to those indicated in table 2.5.2 except for L.major itself.
34
Fig.2.5 2. Overview of the 4 cloned PCR products used as internal controls (Table 2.5.2).
These PCR products were cloned in the pCR4-TOPO vector
(tools.invitrogen.com/content/sfs/vectors/pcr4topo_map.pdf), from which the cloning site sequence
is shown below. Amplicons were inserted using the T: A overhang strategy and the orientation in
the obtained plasmids is as shown in the figure. The internal phage lambda fragments are described
in the grey boxes, with positions referring to accession J02459 (www.ebi.ac.uk, accession number
J02459, release 102). The regions corresponding to the Leishmania species-specific primer
sequences (Table 2.5.2) are indicated in the outlined boxes, with the arrows showing the 5’-3’
orientation.
35
Fig. 2.5.3. Agarose gel image of the Leishmania species-specific PCR products (L), and the same
products with internal control amplicon (IC). The GeneRuler 100 bp DNA size marker (Fermentas,
St. Leon-Rot, Germany) is depicted on the left (M), with indicated fragments of 100 (smallest
fragment), 500 (brightest fragment), and 1000 (largest fragment) nucleotides. Expected sizes are
shown in Table 2.5.2.
36
3. RESULTS
3.1. TYPING OF LEISHMANIA STRAINS:
Table 3.1.1 shows the clinical details of the studied Leishmania isolates. All the 22
isolates gave products of PCR amplicon of the expected size (500bp) (Figure 3.1.1).
As shown in (Fig. 3.1.2), in rDNA ITS1 phylogeny, all strains belong to the L. donovani
complex. All the 22 isolates gave products with L. donovani cpb PCR amplicon of the
expected size (300bp) and did not give products of the expected size with L. infantum
cpb PCR (Fig.3.1.3).
An overview of the leishmania typing results is presented in (Tables 3.2.1)
Table 3.1.1 The clinical details of the studied Leishmania isolates.
Number Code No. Disease
1 Sidon-Ged/med7 VL
2 Sidon-Ged 2 VL
3 Sidon-Ged 4 VL
4 Sidon-Ged 6 VL
5 Sidon-Ged 11 VL
6 Sidon-Ged 15 VL
7 Sidon-Ged 23 VL
8 Sidon-Ged 150 VL
9 Sidon-Ged 151 VL
10 Sidon-Ged 153 VL
11 Sidon-Ged 154 VL
12 Sidon-Ged 155 VL
13 Sidon-Ged 156 VL
14 Sidon-SEN 1 PKDL
15 Sidon-SEN 6 VL
16 Sidon-SEN 7 VL
17 Sidon-SEN 8 VL
18 Sidon-SEN 9 VL
19 Sidon-SEN 10 VL
20 Sidon-SEN 14 VL
21 Sidon-SEN 15 VL
22 Sidon-SEN 17 PKDL
37
Figure 3.1.1 ITS1 PCR reactions for sequencing (PCR 10F-14R)
The ITS1 sequences of all the 22 isolates are identical.
CGGTGTTTTATCCGCCCGAAAGTTCACCGATATTTCTTCAATAGAGGAAGCA
AAAGTCGTAACAAGGTAGCTGTAGGTGAACCTGCAGCTGGATCATTTTCCG
ATGATTACACCAAAAAAAACATATACAACTCGGGGAGACCTATGTATATAT
ATATATGTAGGCCTTTCCCACATACACAGCAAAGTTTTGTACTCAAAATTTG
CAGTAAAAAAAAGGCCGATCGACGTTATAACGCACCGCCTATACAAAAGCA
AAAATGTCCGTTTATACAAAAAATATACGGCGTTTCGGTTTTTGGCGGGGTG
GGTGCGTGTGTGGATAACGGCTCACATAACGTGTCGCGATGGATGACTTGG
CTTCCTATTTCGTTGAAGAACGCAGTAAAGTGCGATAAGTGGTATCAATTGC
AGAATCATTCAATTACCGAATCTTTGAACGCAAACGGCGCATGGGAGAAG
SEN1 SEN17
1
2
3
4
5
6
7
8
9
10
11
12
13
16
17
18
19
20
21
15
38
Figure 3.1.2 rDNA ITS1 clustering (Sudanese strains with bold)
Distance 0.1
AJ634365 Ldo -18S-28S-MHOM_SD_62_LRC-L61
Sidon-S1-1
KIT_161B_1
sidon_L86_1 AJ000302 Ltro ITS IROS_NA_76_ROSSI-II
AJ300485 Ltro ITS1-ITS2 MHOM_TN_88_TAT3
AJ000301 Ltro ITS MHOM_KE_84_NLB297
sidon_68-83_1
AJ000289 Lin ITS MHOM_TN_80_IPT1
AJ300482 Lma ITS1-ITS2 MTAT_KE_??NLB089A
SCH_TRO63_1
Sidon_Ged-m7_1 Sidon_Sen9_1 Sidon-Ged15-1 Sidon-Ged11-1 Sidon-Ged6-1 Sidon-Ged4-1 Sidon-Ged23-1 Sidon-Ged2-1 Sidon_Sen6_1 Sidon_Sen17_1 Sidon_sen8_1 Sidon_Sen7_1 Sidon_Sen15_1 Sidon_Sen14_1 Sidon_Sen10_1 Sidon_Ged156_1 Sidon_Ged154_1 Sidon_Ged153_1 Sidon_Ged151_1 Sidon_Ged150_1
AJ634376 Ldo -18S-28S-MHOM_IN_00_DEVI
AJ634371 Lin -18S-28S-MHOM_SD_93_452BM
AJ000304 L chagasi ITS MHOM_BR_74_PP75
AJ634341 Lin -18S-28S-MHOM_ES_93_PM1
AJ000294 Ldo ITS MHOM_CN_00_Wangjie1
AJ634357 Ldo -18S-28S-MHOM_SD_93_GE SCH_TRO58_1
SCH_TRO57_1
Sidon_Wand-89_1
sidon_85-83_1
sidon_103-83_1
SCH_AET08_1
sidon_1561-80_1
sidon_1464-85_1
sidon_32-83_1
sidon_169-83_1
SCH_AET07_1
AJ000311 Laet ITS 1470_94
AY283793 Lma MHOM_Ir02PIIDT1 -ITS1-ITS2-
AJ000310 Lma ITS MHOM_SU_73_5ASKH
100
99
87
96
100
100
98
99
78
100
96
100
donovani complex
tropica
aethiopica
major
39
Figure 3.1.3 Cysteine proteinase B species-specific PCRs
1
2
3
4 6 8
5
7
9
11
13
15 17 19 21
10
12
14
16 18 20 12 22
12 22
Donovani PCR Donovani PCR
Infantum PCR Infantum PCR
40
Table 3.1.2 Leishmania typing results
Number Strain L.donovani cpb PCR rDNA-ITS1 phylogeny Disease
1 Sidon-Ged/med7 Donovani Donovani complex VL
2 Sidon-Ged 2 Donovani Donovani complex VL
3 Sidon-Ged 4 Donovani Donovani complex VL
4 Sidon-Ged 6 Donovani Donovani complex VL
5 Sidon-Ged11 Donovani Donovani complex VL
6 Sidon-Ged 15 Donovani Donovani complex VL
7 Sidon-Ged 23 Donovani Donovani complex VL
8 Sidon-Ged 150 Donovani Donovani complex VL
9 Sidon-Ged 151 Donovani Donovani complex VL
10 Sidon-Ged 153 Donovani Donovani complex VL
11 Sidon-Ged 154 Donovani Donovani complex VL
12 Sidon-Ged 155 Donovani Donovani complex VL
13 Sidon-Ged 156 Donovani Donovani complex VL
14 Sidon-SEN 1 Donovani Donovani complex PKDL
15 Sidon-SEN 6 Donovani Donovani complex VL
16 Sidon-SEN 7 Donovani Donovani complex VL
17 Sidon-SEN 8 Donovani Donovani complex VL
18 Sidon-SEN 9 Donovani Donovani complex VL
19 Sidon-SEN 10 Donovani Donovani complex VL
20 Sidon-SEN 14 Donovani Donovani complex VL
21 Sidon-SEN 15 Donovani Donovani complex VL
22 Sidon-SEN 17 Donovani Donovani complex PKDL
41
3.2. MULTICENTER RING TRIAL:
An overview of the test results at the different laboratories is presented in Tables3.2.1 (Tryp-PCR-OC and Leish PCR-OC) and 3.2.2 (Tryp-NASBA-OC, and Leish-NASBA-OC). Table 3.2.1 Results of Try and Leish PCR-OC tests on the specimen sets in the seven laboratories participating in the study
The Leish-PCR⁄NASBA-OC results of one laboratory were excluded from the data
analysis as unexplained high numbers of invalid results were observed at this
laboratory, probably because of incorrect test execution. A test result is considered
42
invalid when both the test lines as the negative internal control line remain negative.
ACC and CON were calculated for the four tests on the nucleic acids dilution series in
PBS and on the parasite dilution series in blood separately and are presented in Table
3.2.2
Table 3.2.2 Results of Try and Leish NASBA-OC tests on the specimen sets in the seven laboratories participating in the study
43
Table 3.2.3 Overview of accordance and concordance of the Trypanzoon and
Leishmania OligoC-TesT on DNA and blood specimens analyzed during the ring
trial
44
3.3. Laboratory evaluation (phase II study) of PCR-OC and NASBA-OC using
Sudanese samples:
3.3.1 PARTICIPANTS
In the study the following participants were recruited: 90 confirmed and 67 suspected
VL cases with positive DAT, 23 suspected VL cases with negative DAT, 7 confirmed
and 8 suspected CL cases, 2 confirmed PKDL cases and 50 healthy endemic controls.
3.3.2 SENSITIVITY AND SPECIFICITY OF THE LEISHMANIA OLIGOC-
TEST AND NASBA-OC
3.3.2.1 CONFIRMED VL, CL AND PKDL PATIENTS.
The Leishmania OligoC-TesT and the NASBA-OC showed both a sensitivity of 96.8%
on lymph node aspirates from confirmed VL cases and of 96.2% on blood (Table 3.3.1).
The sensitivity on bone marrow was 96.9% and 95.3% for the OligoC-TesT and
NASBA-OC, respectively. All confirmed CL (n= 7) and PKDL (n= 2) cases were
positive with the OligoC-TesT and NASBA-OC. There was no significant difference in
sensitivity between the two index tests (P.0.05). When analyzing different specimen
types from the same VL patient we observed no significant difference in test outcome
(P.0.05).
3.3.2.2 SUSPECTED VL AND CL PATIENTS.
On the suspected VL cases with positive DAT, the OligoC-TesT showed a positive test
result in 37.1%, 76.9% and 72.7% on lymph, blood and bone marrow, respectively;
while for NASBA-OC this was 34.3%, 69.2% and 63.6% (Table 3.3). On the suspected
VL cases with negative DAT, the OligoC-TesT was positive in 30%, 28.6% and 42.9%
on lymph, blood and bone marrow and the NASBA-OC in 30%, 42.9% and 50%. On
the 8 CL suspected cases 7 were positive with the OligoC-TesT and the NASBA-OC.
The Mc Nemar test indicated no significant difference in results of the two tests on the
specimens from suspected cases (P.0.05). No significant difference was observed in test
outcome when different specimen types from the same suspected VL patient were
analyzed (P.0.05). Healthy endemic controls. Five of the 50 healthy endemic controls
showed a positive OligoC-TesT result, while the NASBAOC remained negative on all
endemic controls (Table 1). Hence, the specificity of the OligoC-TesT for disease was
90.0% and of the NASBA-OC 100.0%, which is significantly higher (P, 0.05). Test
agreement. On all specimens analyzed (n= 321) the two tests showed a kappa value of
0.85 (95% CI: 0.75–0.96) indicating almost perfect agreement [97]. An overview of the
agreement analysis on the different specimen types is presented in table 3.3.2.
45
Table 3.3.1 Diagnostic accuracy of leishmania OligoC-Test and NASBA-OC on
confirmed and suspected leishmaniasis cases and on healthy endemic controls from
Sudan
Table 3.3.2 Agreement between the Leishmania OligoC-TesT and NASBA-OC on
blood, lymph, bone marrow and lesion scraping specimens.
46
3.4. LABORATORY EVALUATION OF PCR-OC AND NASBA-OC TESTS ON
KENYAN SAMPLES:
3.4.1 PARTICIPANTS
Eighty-four patients with VL and 98 endemic healthy controls were recruited in Baringo
district in Kenya. An overview of the sensitivity and specificity of the OligoC-TesT and
NASBA-OC on the study population is presented in Table 3.4.
3.4.2 SENSITIVITY OF THE LEISHMANIA OLIGOC-TEST AND NASBA-OC
The Leishmania OligoC-TesT and NASBA-OC on blood showed a positive test result
in 81 and 67 of the patients with VL, respectively. Hence, the sensitivity of the
Leishmania OligoC-TesT is 96.4% (95% CI: 90–98.8%) and of the NASBA-OC 79.8%
(95% CI: 67–87%), which is significantly lower (P < 0.05).
3.4.3 SPECIFICITY OF THE LEISHMANIA OLIGOC-TEST AND NASBA-OC
Eleven out of 98 healthy endemic controls were positive with the Leishmania OligoC-
TesT, while no positive test results were observed with the NASBA-OC, indicating
A specificity of 88.8% (95% CI: 81–93.6%) and 100% (95% CI: 96.3–100%),
respectively. The McNemar test indicated a significant difference in specificity of both
tests (P < 0.05).
3.4.4 TEST AGREEMENT
For the 182 blood specimens analyzed, the kappa index was 0.73 (95% CI: 0.59–0.87),
indicating substantial agreement in results of the two index tests.
Table 3.4.1 Diagnostic accuracy of leishmania OligoC-Test and NASBA-OC on
confirmed VL cases and healthy endemic controls from Baringo district, Kenya
47
3.5 IDENTIFICATION OF OLD WORLD LEISHMANIA SPECIES BY SPECIFIC PCR AMPLIFICATION OF RDNA ITS1: 3.5.1 SEQUENCES The determined rDNA-ITS1 sequences were submitted to the EBI sequence data base,
and were assigned accession numbers listed in (Table 2.5.1)
3.5.2. OPTIMIZATION AND EVALUATION
Internal control templates and amplicons were successfully obtained and are depicted in
Figs. 2.5.2 and 2.5.3. Their amplification was inhibited completely by 0.01% SDS,
indicating their ability to detect PCR inhibitors. All PCRs showed the potential to
amplify as little as 0.1 pg of DNA, which is about half a parasite’s genome. This
detection limit was unaffected by the presence of DNA isolated from human blood, nor
by the addition of the internal control template in its proper limiting concentration. For
some DNA samples the detection limit was 1pg, for others it was possible to amplify
0.01pg, variations probably caused by DNA degradation. No cross-reactivity of any
specific PCR to other species was observed during the evaluation phase, except for 1
out of 10 L. aethiopica DNAs that reacted in the LM PCR specific for L. major.
3.5.3 VALIDATION
Table 3.5.1 lists the results of a blinded panel validation, containing at least 10 isolated
DNAs of each species or species complex. Results obtained at ITMA are given, as well
as those obtained at KEMRI when discordant. In total 6 assays were included in the
validation, both using 100 or 0.2 pg parasite DNA, the latter spiked with naïve human
blood DNA. The 6 assays comprise the 4 species specific assays LA, LDI, LM, and LT1
(Table 2.5.2) evaluated separately, but also as a combined tool (5th assay). In the
separate evaluation, only the results of one PCR at the time are taken into account
(positive or negative), while in the combined assay results from the 4 separate PCRs are
considered simultaneously. In the latter case, a species will be assigned only if 1 out of
4 PCRs scores positive, and is listed as undetermined if none or more than 1 PCR shows
a positive result. The reason for evaluating the PCRs separately is that in reality it is
unlikely that all 4 PCRs are performed on all samples, and more often than not a PCR
will be used to confirm only the expected species. Finally, PCR LT2 makes up the 6th
assay, which was performed following validation of the other assays because of a poor
sensitivity of LT1.
3.5.4 IMPLEMENTATION
As a proof of principle to assess the performance when using the developed PCRs in
another lab, the species-specific PCRs were implemented and validated at KEMRI, a
48
reference lab in Kenya, where leishmaniasis is endemic. Even though the same products
and type of thermocycler were used, there was a problem in the amplification of the
internal control amplicons, as well as with a slight contamination in the L. donovani
complex PCR. This contamination showed a very faint PCR product and was visible in
one out of the 6 user-added negative controls but in none of the negative controls of the
blinded test panel. When ignoring these faint amplicons, and the fact that in many
negative PCRs no internal control amplicon was amplified, the results were almost
identical to those obtained at ITMA (Table 3). PCR LT2 (Table 2.5.2) was not tested in
KEMRI.
3.5.5 CLINICAL SAMPLE ANALYSIS (PHASEI)
Fig. 3.5.1 depicts the results of 4 species-specific PCRs in clinical samples. The species
could successfully be identified in the various Leishmania samples, as only one of the 4
PCRs showed a Leishmania product of the correct size (Table 2.5.2). In all other cases,
only the internal control amplicon amplified. In LT2, occasionally a weak PCR product
is seen in samples not containing L. tropica, but this product is slightly smaller than 100
bp, and clearly below the molecular weight of the product seen in the actual L. tropica
samples. Equally so, a very weak amplicon is observed from the LA PCR in the left
skin lesion scrapping L. tropica sample, but this is much fainter than the L. tropica
amplicon. No products were amplified from patients suffering tuberculosis, sleeping
sickness, or malaria.
3.5.6 SENSITIVITY OF THE L. DONOVANI COMPLEX ASSAY -SPECIFIC
PCR:
3.5.6.1 SUSPECTED VL
All the suspected VL cases showed a positive test result (100%) with L. donovani
complex assay -specific PCR (Figure 3.5.2)
3.5.6.2 CONFIRMED VL
Thirty-nine patients out of the 40 confirmed VL cases showed a positive test result, a
sensitivity of 97.5% with L. donovani complex assay -specific PCR (Figure 3.5.3).
In figure (3.5.3) sample 32 (pointed with the arrow) gave invalid result firstly (no
internal control band) and when it was repeated in (figure 3.5.2) it gave negative result
with internal control band (pointed with the arrow).
49
Table 3.5.1: Overview of blinded panel validation result
a Negatives are TE in the 100 pg panel, naïve human blood in the 0.2 pg panel.
b The geographic origin of the isolates and strains is listed in Table 2.5.1.
c See Table 2. For each PCR assay, the number of positive PCRs per species or negative
sample type is given.
d When there was no agreement between the numbers for the ITMA and KEMRI validation,
the KEMRI result is given between brackets.
e For the combined assay, the number of correctly and wrongly identified isolates from each
species is listed, as determined from a parallel evaluation of LA, LDI, LM, and LT1 PCRs.
f The LT2 PCR was not tested in KEMRI, and was not taken into account in the combined
assay.
g The L. aethiopica isolate MHOM/ET/67/L86 was identified as L. tropica.
50
Fig. 3.5.1. Results from 4 species-specific PCRs on clinical samples. The PCRs are indicated on the
left, as in Tables 2.5.2 and 3.5.1. Species in the clinical samples are depicted on top, as well as the
type of sample analyzed. Only the agarose gel region between 100 and 400 bp is shown, as indicated
by the size marker fragments identified between the left and right gel. The size of the amplified
internal control and Leishmania fragments is as in Table 2.5.2 and Fig. 2.5.3, and is respectively
indicated by white and black arrows on the right.
Figure 3.5.2: L. donovani complex -specific PCR on VL suspected samples.
51
Figure 3.5.3: L. donovani complex -specific PCR on VL confirmed samples.
52
4.1 DISCUSSIONS
4.1.1 CHARACTERIZATION OF SUDANESE ISOLATES OF LEISHMANIA:
Identification of Leishmania species is important since they differ in transmission
patterns, pathology and sensitivity to drugs [98, 99].
In this study two molecular methods were used to characterize 22 leishmania isolates.
These molecular methods are based on the polymerase chain reaction (PCR)
amplification of a Leishmania DNA fragment and they have advantages over multi-
locus enzyme electrophoresis, the current gold standard for species discrimination [57],
the later one is a cumbersome technique requiring mass parasite cultivation.
The first PCR assay amplified the ITS1 region followed by sequencing. All isolates
even the two from PKDL lesions gave almost identical nucleotides sequence on
analysis; all belong to L.donovani complex when compared to reference sequences. In
agreement with previous studies [100, 22] L. donovani is also the causative species of
both VL and PKDL.
No diversity was observed in this ITS1 region for 10 isolates from Kenyan VL clinical
samples. They differed only in one nucleotide position when compared to the Sudanese
isolates. This may indicate homology in this ITS1 region for L.donovani from east
Africa although the number of leishmania isolates is limited in this study. Due to the
conserved sequences in this region for L.donovani and L.infantum, this PCR assay can
not differentiate between the intra- species within the L.donovani complex. As this
region has the advantage of having multiple copies in the genome, detection of the
parasites in clinical samples, as will be mentioned later (Part 5 in this thesis), is
possible. On the other hand, differentiation between L.infantum and L.donovani within
the donovani complex was possible when the cysteine proteinase B species-specific
PCR assays were used in the present and previous [89] studies. ; All isolates including
the Kenyan ones are L.donovani and not L.infantum. However, this PCR assay can not
detect the parasites genome in clinical samples and therefore it is used only on DNA
from culture [89] which could be regarded as a disadvantage of the test.
53
4.1.2 MULTICENTER RING TRIAL:
The evaluation of molecular diagnostics (and even diagnostics in general) is not always
done. It is important to estimate the repeatability (ACC) and reproducibility (CON) of a
new test prior to further phase II and III evaluation studies (which should be performed
in other laboratories than the laboratory where the test was developed). The present
study reports on a multi-centre evaluation study of two molecular assays in seven
laboratories on two continents. Our study’s set-up and data analysis are of interest of
many researchers working on diagnostic test development. The presented work can be
an example for researchers wishing to develop new diagnostics for neglected tropical
diseases, and it highlights some parameters that warrant control. Our main aim was to
validate inter (ACC) and intra (CON) laboratory performance of the Tryp-PCR-OC,
Tryp-NASBA-OC, Leish-PCR-OC and Leish-NASBA-OC tests. When analyzing
purified nucleic acid specimens, the four tests showed an ACC and CON above 95%
and 90%, respectively. The ACC and CON were below 90% when blood specimens
were analyzed. This is not surprising as the nucleic acids had to be extracted from the
blood specimens by the participating laboratories, leading to higher chances of intra and
interlaboratory inconsistencies. In addition, the variation in test results was
predominantly observed in the low parasite range of 1–0 parasites ⁄ ml blood. As this
parasite concentration is close to the analytical sensitivity of the tests (Deborggraeve et
al. [51, 52]; Mugasa et al. [55, 91], slight variations in equipment and operating
procedures may have a major influence on the results obtained with these low parasite
concentrations. Occasional false positive results were observed in the blood specimens
from healthy European controls. Although cross-reaction of the tests with human DNA
or RNA cannot be excluded, carry-over contamination during DNA extraction from the
blood specimens is more likely for two reasons. First, no false positive results were
observed in the specimen sets containing DNA. Secondly, there is the observation that
three of the five false positive results for DNA were obtained in the same laboratory.
The results of one laboratory analyzing the Leish-PCR⁄ NASBA- OC tests had to be
excluded because very high numbers of invalid results were generated, most probably
because of faulty test execution. Similar problems were not encountered at the other
laboratories. To our knowledge, this is the first study evaluating the ACC and CON of
molecular diagnostic tests for human African trypanosomiasis and leishmaniasis on
54
blood samples. The ACC and CON of the Tryp-PCR-OC have already been estimated
in a multicentre ring trial with six participating laboratories on purified DNA
specimens, reported by Claes et al. [101]. In that study, the test showed an ACC of
88.7% (95%CI: 84.4%-92.5%) and CON of 88.1% (95%CI: 84.3%-92.3%), slightly
lower than the results obtained in this study.
55
4.1.3 LABORATORY EVALUATION (PHASE II STUDY) OF PCR-OC AND
NASBA-OC USING SUDANESE SAMPLES:
Molecular diagnostics are attractive alternatives to conventional parasite detection as
they combine sensitivity with specificity. Recently, the Leishmania OligoC-TesT and
NASBA-OC were developed as standardized formats for molecular detection of
Leishmania parasites [52, 55]. Here phase II evaluation of the two tests is presented on
confirmed and suspected VL, CL and PKDL cases and on health endemic controls from
Sudan. Although the study was set out as a phase II diagnostic evaluation, it has some
limitations. A weak point is the lack of external quality control on a subset of specimens
carried out by another reference laboratory. Furthermore, the executors of the index
tests were not blinded to the participant classification and thus the results of the
reference tests. Although these limitations did not influence the study results, these
shortcomings should be avoided in future phase II and III evaluation trials. In addition,
response to treatment was not included in the standard references as we were not able to
follow up the patients after treatment. Lastly, the number of participants in some
subgroups is too low to make major conclusions. The Leishmania OligoC-TesT as well
as the NASBA-OC showed a high sensitivity (.95%) on lymph, blood and bone marrow
from the confirmed VL patients. The observation that analyzing lymph or blood yielded
similar sensitivity as bone marrow is very promising towards less invasive diagnosis.
Indeed this means that the OligoC-TesT and NASBA-OC on lymph or blood could
indicate the infection status of VL suspected cases. Similar findings were reported in a
study on the phase III evaluation of conventional PCR for VL diagnosis in Nepal [102].
Although the number of confirmed CL and PKDL cases in this study was limited, all
were positive with both tests indicating their potential for accurate detection of the
parasites in skin tissues. In addition, the high sensitivity is confirmed by the observation
that the tests were able to detect Leishmania RNA or DNA in the blood or lesion
scrapings of to the majority of the suspected VL and CL cases. Several cases in the
suspected patient with positive DAT group might be true leishmaniasis cases given the
suboptimal sensitivity of the conventional parasite detection tests. In 2008,
Deborggraeve et al. reported a sensitivity of conventional PCR on probable VL cases
(defined as clinical suspicion of VL and positive DAT test but negative in conventional
parasite detection) of 67.6% on blood and 71.8% on bone marrow [102]. The
56
sensitivities of the index tests on the lymph node aspirates of the suspected VL cases is
surprisingly low (34–37%). This might indicate that the parasite load in blood is higher
than in lymph. The fact that this is not observed in the confirmed VL cases is probably
due to the general higher parasite load in this patient group because of the low
sensitivity of the reference test. PCR positivity in the suspected VL group with negative
DAT was not significantly lower than with positive DAT. This confirms the low
correlation in DAT and PCR status in these groups as observed earlier [102]. While
antibody levels in the blood are a marker for the host response, the PCR/ NASBA status
of the blood is a marker for the presence of parasites and might therefore be
complementary. PCR and NASBA can offer an added value compared to
immunodiagnosis in HIV co-infected VL patients.
On the 50 healthy endemic controls, the OligoC-TesT showed a specificity of 90%
while this was 100% for the NASBA-OC. The positive OligoC-TesT results might be
due to asymptomatic infections, which are known to be common in VL endemic
regions. The inclusion of these asymptomatic carriers in the control group could be
explained by the low concordance between negative DAT status and PCR outcome on
blood from endemic control persons as described by Deborggraeve et al. [102] and
Bhattarai et al. [103]. However, while NASBA-OC showed equal sensitivity on the
confirmed and suspected VL cases, the test did not detect these assumed asymptomatic
infections in the endemic control group. This discrepancy can be explained in two ways.
Firstly, although not indicated by the negative controls taken along in specimen
analysis, contamination of the PCR can never be fully excluded. Secondly, the OligoC-
TesT might be slightly more sensitive than the NASBA-OC and thus pick up
asymptomatic infections which might have very low parasite loads in the blood.
The observed equal sensitivity for both tests on the confirmed and suspected VL cases
might be biased by the fact that these cases are individuals presenting syndromes and
thus probably have higher parasite loads than healthy parasite carriers. Hence, NASBA-
OC might provide a better marker for active disease than the OligoC TesT, as NASBA-
OC does not detect asymptomatic infections while more than 95% of the active VL
cases are still positive with the test. Furthermore, both tests might be useful as a test of
cure after treatment of VL. As cure does not always equal parasite clearance, NASBA-
OC might be more suitable than the OligoC-TesT. However, specific evaluation studies
are needed to confirm this hypothesis. One should keep in mind that the PCR-OC and
NASBA-OC are not yet an option for routine diagnosis at the primary care level as they
57
require basic molecular biology lab facilities. VL typically affects populations in rural
areas where health centers most often suffer from infrastructural limitations and thus
only apply less sophisticated diagnostic methods. Yet, they can be valuable tools in
leishmaniasis diagnosis at reference hospitals with basic molecular biology lab
facilities. In addition, the evaluated tools can offer an added value in disease
surveillance and epidemiological studies in which specimens are analyzed at central
reference laboratories.
58
4.1.4 LABORATORY EVALUATION OF PCR-OC AND NASBA-OC TESTS ON
KENYAN SAMPLES:
When analyzing blood from the confirmed VL cases, a significantly higher sensitivity
of the Leishmania OligoC-TesT (96.4%) was observed than the NASBA-OC (79.8%).
As VL diagnosis was confirmed by microscopic analysis of spleen aspirates, the high
sensitivity of the OligoC-TesT on blood is promising. Indeed, this means that the
OligoC-TesT on blood could indicate the infection status of VL-suspected cases. Our
findings are in agreement with the sensitivities shown by conventional PCR techniques
for Leishmania, which generally range from 92% to 100% [104, 105, 106]. The lower
sensitivity of NASBA-OC was unexpected because this test showed similar sensitivity
as the OligoC-TesT in a multicentre evaluation study on Leishmania parasite-spiked
blood [107]. The lower sensitivity observed in the current phase II study might be
because of the fact that NASBA-OC targets the parasite’s RNA, which is known to be
more liable to degradation compared to DNA. Nucleic acid quality might have been
decreased during specimen storage and transportation from the collection sites in the
field to the reference centre in Nairobi. In contrast, the NASBA-OC showed a
significant higher specificity than the OligoC-TesT when analyzing blood from the
healthy endemic controls (100% vs. 88.8%). Because the controls taken along during
specimen analysis did not indicate contamination of the PCR based OligoC-TesT, the
detection of Leishmania DNA in this control group is probably associated with
asymptomatic Leishmania infections, which are known to be common in VL endemic
areas [102, 103]. The inclusion of healthy parasite carriers in the control group can be
explained by the low concordance between negative DAT status and PCR outcome on
blood from endemic control persons, as described by Deborggraeve et al. [102] and
Bhattarai et al. [103]. The observation that these healthy parasite carriers are not picked
up by the NASBA-OC is probably because of its lower sensitivity, as reflected in the
results on the confirmed VL cases. Patients with confirmed VL are individuals
presenting symptoms and thus probably have higher parasite loads than asymptomatic
parasite carriers. The sensitivity and specificity of both tests should also be evaluated in
settings that do not need specimen storage and transport. It might be that in the present
study, the sensitivity of the NASBA-OC is underestimated, and the specificity
overestimated because of RNA degradation during specimen storage or transport. The
59
low specificity of the Leishmania OligoC-TesT in this study confirms that PCR-based
diagnostic tests are a marker of infection rather than disease, as described by
Deborggraeve et al. [102]. As only diseased persons are treated, PCR alone is of less
value for VL diagnosis in endemic regions. However, one could state the same for
diagnosis based on antibody detection tests alone or on clinical data alone because none
of them represent a gold standard for acute disease. Hence, laboratory tests should
always be interpreted in combination with a standardized clinical case definition.
Although molecular diagnostics are not yet applicable in most operational settings
because of their complexity, they can be useful in hospitals with basic molecular
biology facilities. Molecular diagnostics should not replace the existing
immunodiagnostics but give an added value as a marker of infection.
It is important to emphasize that the Leishmania OligoC-Test and NASBA-OC are
important steps forward to improved and standardised molecular detection of the
parasite, but they are still restricted to use in reference centres with basic molecular
biology facilities. Efforts towards further simplification of molecular diagnostics should
therefore be strongly encouraged. In addition, although still to be confirmed by large-
scale studies, molecular detection of the parasite might be useful for cure assessment.
While antibodies remain detectable for years after successful treatment [108], the
parasite’s RNA and DNA are rapidly degraded following parasite death [109].
60
4.1.5 IDENTIFICATION OF OLD WORLD LEISHMANIA SPECIES BY
SPECIFIC PCR AMPLIFICATION OF RDNA ITS1:
In this study 4 ITS1-rDNA PCRs are presented that can faithfully distinguish the Old
World Leishmania species L. aethiopica, L. major, L. tropica, and the L. donovani
species complex comprised of L. donovani and L. infantum. Because the number of
sequences available for this region was limited for certain species, additional ones were
added to the public repositories (Table 2.5.1). Compared to other assays devoid of post-
amplification steps other than agarose gel analysis (reviewed in [89]), this PCR assay
has several advantages. (1) First, this assay is universally applicable in the Old World.
Intra- and inter-species variability was validated by testing all species from diverse
geographical origins (Table 2.5.1). It does not allow to differentiate L. infantum from
other members of the L. donovani complex, for which alternatives are available [89,
110-112]. (2) Second, the detection limit is sufficient to analyze clinical samples, as
between 5 and 1/20 parasite genomes are amplifiable, and it showed amplification in
actual clinical samples. (3) Third, these assays include dUTP, which allows to counter
the effect of amplicon contamination using the dUTP/UNG system [113]. This can be
particularly important in low resource settings, where basic precautions to avoid carry-
over contamination are often not easily adhered to, leading to false positive results. (4)
Fourth, all 4 assays use the exact same thermal amplification conditions, which allows
parallel analysis. As a bonus, PCR mixes containing all components except Leishmania
template and enzyme can be stored at -20°C, facilitating batch quality control and
saving time. (5) Fifth, internal controls allow checking for consistent amplification
across different runs, and PCR sample inhibition [114]. Failure to amplify this control in
a negative Leishmania sample points to the presence of inhibitors or an erroneously
prepared PCR mix, in which case no conclusions must be drawn from the PCR. In a
positive sample, it might simply indicate the Leishmania template out competes the
control for primer annealing. (6)
Finally, as illustrated in Fig. 2.5.1, these assays can be used as a nested PCR in case of
insufficient sensitivity, whereby the Leishmania-specific primers LITSR and L5.8S
[115] generate the outer PCR amplicons. In such case, all 4 specific PCRs must be run
in parallel in the second PCR round to ensure specificity. As can be seen in Table 3.5.1,
when taking results from the validation PCRs LA, LDI, LM, LT1, and the combined
61
assay, at the 100 pg level the species discrimination and identification performance is
100%, except for L. aethiopica isolate MHOM/ET/67/L86 which cross-reacted in the
LT1 PCR. Species identification of this isolate was however based on its unique
zymodeme LON33 [116], and the rDNA-ITS1 region (accession FN677356) clearly
showed an L. tropica sequence, explaining the positive amplification in the L. tropica
PCR. Nevertheless, a limiting amount of L. aethiopica rDNA-ITS1 template is present
in the DNA sample, as evidenced by the additional positive L. aethiopica PCR only at
the 100 pg level, pointing to a hybrid strain or a mixed culture. The other PCRs showed
no cross-reaction at the 0.2 pg level, but some isolates could not be identified. This was
the case especially for L. tropica, where only 4 out of 10 DNAs could be typed. Given
the fact that amplification failure may be caused by DNA degradation or mismatched
primers, it is not surprising that some are not detected at the 0.2 pg level, corresponding
to one parasite only. As the L. tropica PCR however identified merely 4 out of 10 L.
tropica DNAs when supplied with 0.2 pg, an alternative PCR (LT2 in Table 2) was used
including an outer Leishmania-specific DNA primer pair (Fig. 2.51, [115]) to boost the
reaction. This allowed an additional 3 L. tropica to be identified from 0.2 pg, but
resulted in an extra L. aethiopica DNA being detected (Table 3). LT2 must therefore be
used only in parallel with PCRs LA, LDI, and LM. Upon evaluating the blinded test
panel in an endemic reference center in Kenya, two problems were identified: the
internal control amplicon did not amplify consistently, and a slight L. donovani
contamination was observed in one out of six negative controls. Despite using the same
products in the PCR mix, this illustrates the necessity to re-optimize the internal control
template concentration during implementation. This becomes even more important
when changing PCR reagents, such as the type of Taq DNA polymerase. Equally so,
depending on the geographical region and type of clinical samples analyzed, one should
be aware of potential cross-reactivity against species other than Leishmania. And even
though our analysis did not identify cross-reactions against 3 other pathogens, such
problems are region and sample dependent, and a validation should be part of any
implementation process. In this respect it is also highlighted that these assays are to be
used in second line for Leishmania species identification, only after performing
diagnostic – generally more sensitive assays for parasite detection. During
implementation, it is highly recommended to run all 4 PCRs in parallel to assess the
performance of each individual PCR by comparing to the combined assay, as was done
in Table 3.5.1. Once validated, PCR mixes without DNA polymerase can be prepared in
62
bulk and aliquoted, which allows quality control and saves time. When functioning
properly, there is no need to use all 4 PCRs for analyzing each sample (combined assay
in Table 3.5.1), and one could suffice by using an appropriate selection depending on
the exact purpose of the study, and species expected to occur: in endemic settings this
would typically be the sympatric species, in travel clinics all species can be found. At
most 100 pg Leishmania DNA should be used in the assays, as cross-reactivity for
higher concentrations has not been checked for. In clinical samples it is unlikely that a
higher amount of Leishmania DNA is present, but if uncertain it is advisable to run all 4
PCRs in parallel to increase the chance of finding unexpected cross-reactions.
The assays were able to identify the infecting Leishmania species in various clinical
samples (Fig. 3.5.1), and did not show cross-reaction against Mycobacterium
tuberculosis, Plasmodium falciparum, or Trypanosoma brucei. When L.donovani complex specific PCR assay was tested on 40 confirmed and 20
suspected VL clinical samples from Sudan, the sensitivity of the suspected was higher
(100%) than the confirmed cases (97.5) and this can be explained by the presence of the
high parasitemia in lymph node and bone marrow tissues which were the specimens
from suspected cases and were blood specimens from confirmed VL cases.
The high sensitivity of the assay on blood sample is promising towards less invasive
procedures and even the DNA of the only negative sample was possibly degraded due
to long storage period although it gave positive result with the SSU PCR assay
previously.
63
4.2 CONCLUSION:
The entire 22 leishmania isolates lie within the donovani complex in the rDNA-
ITS1 phylogeny with almost identical sequence, and they are all of L.donovani
sub-species.
All four tests (Tryp-PCR-OC, Tryp-NASBA-OC, Leish-PCR-OC and Leish-
NASBA-OC ) demonstrated to be repeatable and reproducible in ring trial study
and can undergo further phase II and III evaluations in variable laboratory
settings in disease endemic countries.
The Leishmania OligoC-TesT and NASBA-OC showed high sensitivity on
lymph and blood of VL patients and on scrapings from CL and PKDL patients
from Sudan. A significant higher specificity for active VL with the NASBA-OC
than with the OligoC-TesT was observed. Both tests are not yet an option for
routine diagnosis of leishmaniasis at the primary care level due to their
infrastructural requirements.
The Leishmania OligoC-TesT showed high sensitivity on blood from Kenyan
patients but a rather low specificity for active disease. In contrast, the sensitivity
of RNA detection by NASBA-OC on blood from Kenyan patients was lower but
the specificity was 100%, indicating that it might be a better marker for active
VL.
The rDNA species specific PCR study presents the first step towards a
standardized Old World Leishmania species typing assay. It focuses on
validation in cultured samples, with emphasis on implementation of the PCRs in
other settings, as a starting point for the use in clinical and epidemiological
studies for which the proof-of-principle was delivered. Validation of the PCRs
and potential unexpected reactions are essential topics to cover before starting
any analysis. These assays showed higher sensitivity when tested on clinical
samples from VL patients from Sudan.
64
4.3 RECOMMENDATION
There is a need to obtain more isolates from different parts of the Sudan,
and characterize them with ITS1 protocol, so as to have a more
comprehensive picture of the distribution of the species causing
leishmaniasis in Sudan.
The Leishmania OligoC-TesT and NASBA-OC can be used as powerful
diagnostic tests in disease surveillance programmes and in monitoring
intervention studies.
The rDNA species specific PCR can be used on an extended set of
clinical samples from leishmaniasis patients with different clinical
presentation as to contribute to the adequate management and follow-up
of Old World leishmaniasis
65
REFERENCE:
1. Desjeux P. The increase in risk factors for leishmaniasis worldwide. Trans R
Soc Trop Med Hyg 2001; 95:239–243.
2. World Health Organization. The world health report 2002: reducing risks,
promoting healthy life. WHO, Geneva.
3. Bryceson ADM. Leishmaniasis. In: Cook GC, ed. Manson’s tropical diseases.
20th ed. London: WB Saunders; 1997.p. 1213-45.
4. Murray H W, JD Berman, CR Davies, and NG Saravia. Advances in
leishmaniasis. Lancet 2005; p: 1561–1577.
5. Ashford RW, Bates PA. Leishmaniasis in the Old World. In: Collier L, Balows
A, Sussman M, eds. Topley and Wilson’s microbiology and microbial
infections. 9 th ed. London: Arnold 1998; p: 215-255.
6. Kettle DS. Psychodidate –Phlebotomine (Sandflies).In: Medical and veterinary
entomology -2 nd ed- Oxford: CAB International 1995; p: 177-268.
7. Herwaldt BL. Leishmaniasis. Lancet 1999: 1191–1199.
8. Chappuis F, S Rijal, A Soto, J Menten, and M Boelaert. A metaanalysis of the
diagnostic performance of the direct agglutination test and rK39 dipstick for
visceral leishmaniasis BMJ 2006; 333:723–726.
9. Antinori S, Calattini S, Longhi E, et al. Clinical use of polymerase chain
reaction performed on peripheral blood and bone marrow samples for the
diagnosis and monitoring of visceral leishmaniasis in HIV-infected and HIV-
uninfected patients: a single-center, 8-year experience in Italy and review of the
literature. Clin Infect Dis 2007; 44:1602–10.
10. Reithinger R, Dujardin JC. Molecular diagnosis of leishmaniasis: current status
and future applications. J Clin Microbiol 2007; 45:21–25.
11. Medicins Sans Frontieres. Manual for the diagnosis and treatment of visceral
leishmaniasis (Kal-azar) under field conditions, 1999.
12. World Health Organization. Manual on visceral leishmaniasis control. Geneva
WHO 1996a:22-6.
13. Berman JD. Human leishmaniasis: clinical, diagnostic, and chemotherapeutic
developments in the last 10 years. Clin Infect Dis 1997; 24:684-703.
66
14. World Health Organization Expert Committee. Control of the leishmaniases. W
H O Technical Report Series (1990)-739.
15. Berman J. Current treatment approaches to leishmaniasis. Curr.Opin.Infect.Dis.
2003; 16:397- 401.
16. Zeese W and Frank W. Present epidemiological situation of kala-azar in the
Republic of Sudan. Zentralbl. Bakt Mik Hyg 1987; A-264: 414-421
17. El-Hassan AM, Zijlstra EE, Ismael A and Ghalib WH. Recent observations on
the epidemiology of kala-azar in the eastern and central states of the Sudan. Trop
Geograph Med 1995; 47: 151-156.
18. Seaman J, Meereer AJ. and Sandrop E. The epidemics of visceral leishmaniasis
in western Upper Nile, southern Sudan: course and impact from 1984 to 1994.
Int J Epidemiol 1996; 25: 862-871.
19. Zijlstra EE and El-Hassan AM. Leishmaniasis in Sudan.3. Visceral
leishmaniasis. Trans R Soc Trop Med Hyg 2001; 95: 27-58.
20. Theodor O. On African sandflies. Bulletin of Entomological Research. 1938;
29:165-173.
21. Kirk R, Lewis, DJ. Studies on leishmaniasis in the Anglo-Egyptian Sudan. XI.
Phlebotomus in relation to leishmaniasis in Sudan. Trans R Soc Trop Med Hyg
1955; 49: 229-240.
22. L. Oskam, F. Pratlong, EE. Zijlstra, CCM. Kroon, JP. Dedet, PA. Kager, G.
Schonian, HW. Ghalib AM. El-Hassan and SEO. Meredith Biochemical and
molecular characterization of Leishmania parasites isolated from an endemic
focus in eastern Sudan. Trans R Soc Trop Med Hyg 2000; 95: 154-155.
23. Adler S, Foner A, Montiglio B. The relationship between human and animal
strains of leishmania from the Sudan. Trans R Soc Trop Med Hyg 1996; 60:
380-386.
24. El-Safi, SH, Peters W, El Toam B, El Kadoro A, and Evan, DA. Studies on the
leishmaniasis in the Sudan. 3. Clinical and parasitological studies on cutaneous
leishmaniasis. Trans R Soc Trop Med Hyg 1991; 85: 465-470.
25. Abdalla RE and Sherif H. Epidemics of cutaneous leishmaniasis in northern
Sudan. Ann. Trop Med Parasitol 1978; 72 : 349-352.
26. El-Safi SH and Peters W. Studies on the leishmaniasis in the Sudan. 1. Epidemic
of cutaneous leishmaniasis. Trans R Soc Trop Med Hyg 1991; 85: 44-47.
67
27. Salah Eldin H. Cutaneous leishmaniasis in Tuti Island, Khartoum, Sudan: a
cross sectional study of schoolchildren and a sample of the population. MSc
thesis, University of Khartoum 1997.
28. Kadaro A Y, Ghalib H W, Ali MS, et al. Prevalence of cutaneous
leishmaniasis along the Nile River north of Khartoum (Sudan) in the aftermath
of an epidemic in. Am J Trop Med Hyg1993; 48: 44-49.
29. El-Hassan AM and Zijlstra EE. Leishmaniasis in Sudan.1. Cutaneous
leishmaniasis. Trans R Soc Trop Med Hyg 2001; 95: 1-17.
30. Gaafar A, Fadl A, El Kadaro AY, El- Hassan MM, Kemp M, Ismail AIA,
Morgos SA and El-Hassan AM. Sporotichoid cutaneous leishmaniasis due to
leishmania major zymodemes in the Sudan and Saudi Arabia: a comparative
study. Trans R Soc Trop Med Hyg 1994; 88: 552-554.
31. Griffith WAD and Dutz W. Repeated tissue sampling with a dental broach.
Atrial in cutaneous leishmaniasis. Br J Dermatol 1975; 93: 43-45.
32. Kubba R and AlGindan Y. Leishmaniasis. Dermatol Clinics 1989; 7: 331- 51.
33. Anderson K, Gaafar A, El-Hassan AM, Ismael A, Dafalla M, Theander TG,
and Kharazmi A. Evaluation of the polymerase chain reaction in the diagnosis of
cutaneous leishmaniasis due to leishmania major. A comparison with direct
microscopy of smears and sections from lesions. Trans R Soc Trop Med Hyg
1996; 90: 133-135.
34. Ghalib HW, El-Toum IA, Kroon CCM and El-Hassan AM. Identification of
Leishmania from mucosal leishmaniasis by recombinant DNA probes. Trans R
Soc Trop Med Hyg 1992; 86: 158-160.
35. Abdalla RE, El Hadi A, Ahmed MA and El-Hassan AM. Sudan mucosal
leishmaniasis. Trans R Soc Trop Med Hyg 1969; 63: 123-128.
36. Veress B, Abdalla RE and El-Hassan, AM. Electron microscopic investigations
on leishmaniasis in the Sudan: II. Ultrastructural morphology of macrophage –
parasite interaction in human and hamster macrophages in vivo. Ann Trop Med
Parasitol 1981; 75:607-613.
37. El-Hassan AM and Zijlstra EE. Leishmaniasis in Sudan.2. Mucosal
leishmaniasis, Trans R Soc Trop Med Hyg 2001; 95: 19-26.
38. Weigle KA, L Valderrama, AL Arias, C Santrich, and NG Saravia. Leishmanin
skin test standardization and evaluation of safety, dose, storage, longevity of
reaction and sensitization. Am J Trop Med Hyg1991; 44:260-271.
68
39. Bensoussan E, A Nasereddin, F Jonas, LF Schnur and C. L. Jaffe. Comparison
of PCR assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol 2006;
44:1435-1439. Bioch Parasitol 18, 27–40.
40. Harith AE, Kolk AHJ, Kager PA, Leeuwenburg J, Muigai R, Kiugu S and
Laarman JJ. A simple and economical direct agglutination test for
serodiagnosis and seroepidemiological studies of visceral leishmaniasis. Trans R
Soc Trop Med Hyg 1986; 80:583–6.
41. Jacquet D, Boelaert M, Seaman J, Rijal S, Sundar S, Menten J, Magnus E.
Comparative evaluation of freeze dried and liquid antigens in the direct
agglutination test for serodiagnosis of visceral leishmaniasis (ITMA-DAT/ VL).
Trop Med Int Health 2006; 11:1777-84.
42. Oliveira EJ, Pedras MJ, Isabella EMA, Rabello A. Improvement of direct
agglutination test (DAT) for laboratory diagnosis of visceral leishmaniasis in
Brazil. Trans Roy Soc Trop Med Hyg 2009; 103: 1279-1281.
43. Chappuis F, Rijal S, Singh R, Acharya P, Karki BM, Das ML, et al. Prospective
evaluation and comparison of the direct agglutination test and an rK39-antigen-
based dipstick test for the diagnosis of suspected kala-azar in Nepal. Trop Med
Int Health 2003; 8:277—85.
44. Pedras MJ, Viana LG, Oliveira EJ, Rabello A. Comparative evaluation of direct
agglutination test, rK39 and soluble antigen ELISA and IFAT for the diagnosis
of visceral leishmaniasis. Trans R Soc Med Trop Hyg 2008; 102:172-8.
45. Singh S, Dey A, Sivakumar R. Applications of molecular methods for
Leishmania control. Rev Expert Rev Mol Diagn 2005; 5: 251-65.
46. Espy MJ, JR Uhl, LM Sloan, SP Buckwalter, MF Jones, EA Vetter, JD Yao, NL
Wengenack, JE Rosenblatt, FR Cockerill III, and TF Smith. Real-time PCR in
clinical microbiology: applications for routine laboratory testing. Clin Microbiol
Rev 2006; 19:165-256.
47. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N,
Hase T. Loop-mediated isothermal amplification of DNA. Nucl Acids Res
2000;28(12): E63.
48. Thekisoe OM, Bazie RS, Coronel-Servian AM, Sugimoto C, Kawazu S, Inoue
N. Stability of Loop-Mediated Isothermal Amplification (LAMP) reagents and
its amplification efficiency on crude trypanosome DNA templates. J Vet Med
Sci 2009; 71(4): 471-475.
69
49. Kuboki N, N Inoue, T Sakurai, F Di Cello, DJ Grab, H Suzuki, C Sugimoto,
and I Igarashi. Loop-mediated isothermal amplification for detection of African
trypanosomes. J Clin Microbiol 2003; 41:5517-5524.
50. De Doncker S, V Hutse, S Abdellati, et al. A new PCR-ELISA for diagnosis of
visceral leishmaniasis in blood of HIV-negative subjects. Trans R Soc Med Trop
Hyg 2005; 99:25-31.
51. Deborggraeve S, F Claes, T Laurent, et al. Molecular dipstick test for diagnosis
of sleeping sickness. J Clin Microbiol 2006; 44:2884–2889.
52. Deborggraeve S, Laurent T, Espinosa D et al. A simplified and standardized
polymerase chain reaction format for the diagnosis of leishmaniasis. J Infect Dis
2008; 198:1565-72.
53. Chang AB, Fox JD. NASBA and other transcription based amplification
methods for research and diagnostic microbiology. Rev Med Microbiol 1999;
10:185-96.
54. Deiman BA, Aarle P, Sillekens P. Characteristics and applications of NASBA.
Mol Biotechnol 2002; 20:163-79.
55. Mugasa C, Laurent T, Schoone G, et al. Simplified molecular detection of
Leishmania parasites in various clinical samples from patients with
leishmaniasis. Parasit Vectors 2010; 3:13
56. Ashford RW, Bettini S. Ecology and epidemiology: Old World. In: Peters W,
Killick-Kendrick R (eds) The leishmaniases in biology and medicine: biology
and epidemiology. Academic Press, London 987;pp 365–424
57. Rioux JA, Lanotte G, Serres E, Pratlong F, Bastien P, Perieres J. Taxonomy of
Leishmania. Use of isoenzymes. Suggestions for a new classification. Ann
Parasitol Hum Comp 1990; 65:111–125
58. Morales MA, Chicharro C, Ares M, Canavate C, Barker DC and Alvar J.
Molecular tracking of infections by Leishmania infantum. Trans R Soc Med
Trop Hyg 2001; 95:104-107.
59. Van Eys GJJM, Schoone GJ, Ligthart GS, Alvar J, Evans DA & Terpstra WJ.
Identification of Old World Leishmania by DNA recombinant probes. Mol
Biochem Parasitol 1989; 34: 53–62.
60. Barker DC. Molecular approaches to DNA diagnosis. Parasitol 1989; 99:125–
146.
70
61. Smith DF, Searle S, Ready PD, Gramiccia M and Ben-Ismail R. A kinetoplast
DNA probe diagnostic for Leishmania major: sequence homologies between
regions of Leishmania minicircles. Am J Trop Med Hyg 1989; 80(6): 935-938
62. Gramiccia M, Smith DF, Angelici MC, Ready PD and Gradoni L. A kinetoplast
DNA probe diagnostic for Leishmania infantum. Parasitolo 1992; 105:29–34.
63. Laskay T, Kiessling R, de Witt RTF and Wirth DF. Generation of species-
specific DNA probes for Leishmania aethiopica. Mol Bioch Parasitol 1991;
44:279–286.
64. Rodriguez N, Rodriguez A, Cardona M, Barrios MA, McCann SH and Barker
DC. Leishmania (Viannia) guyanensis: a new minicricle class exclusive to this
species isolated from a DNA cosmid library useful for taxonomic purposes. Exp
Parasitol 2000; 94: 143–149.
65. Howard MK, Kelly JM, Lane RP and Miles MA. A sensitive repetitive DNA
probe that is specific to the Leishmania donovani complex and its use as an
epidemiological and diagnostic reagent. Mol Bioch Parasitol 1991; 44: 63–72.
66. Van Eys GJJM, Guizani I, Ligthart GS and Dellagi K. A nuclear probe for the
identification of strains within the Leishmania donovani complex. Exp Parasitol
1991; 72: 459–463.
67. Ramos A, Maslov DA, Fernandes O, Campbell DA and Simpson L. Detection
and identification of human pathogenic Leishmania and Trypanosoma species
by hybridization of PCR amplified mini-exon repeats. Exp Parasitol 1996; 82:
242–250.
68. Katakura K, Kawazu SI, Sanjyoba C et al. Leishmania mini-exon genes for
molecular epidemiology of leishmaniasis in China and Ecuador. Tokai J Exp
Clin Med 1998; 23: 393–399.
69. Welsh J and McCleland M. Fingerprinting genomes using PCR with arbitrary
primers. Nucl Acids Res 1990; 18: 7213–7218.
70. Noyes HA, Beli AA and Maingon R. Appraisal of various random amplified
polymorphic DNA-polymerase chain reaction primers for Leishmania
identification. Am J Trop Med Hyg 1996; 55: 98-105. Parasitol; 97: 35–44.
71. Tibayrenc M, Neubauer K, Barnabe C, Guerrini F, Skarecky D and Ayala FJ.
Genetic characterization of six parasitic protozoa: parity between random-primer
DNA typing and multilocus enzyme electrophoresis. Proc Natl Acad Sci U S A
1993; 90:1335–1339.
71
72. Schonian G, Schweyoch C, Zlateva K et al. Identification and determination of
the relationships of species and strains within the genus Leishmania using single
primers in the polymerase chain reaction. Mol Biochem Parasitol 1996; 77: 19–
29.
73. Van Eys GJJM, Schoone GJ, Kroon NCM and Ebeling SB. Sequence analysis of
small subunit ribosomal RNA genes and its use for detection and identification
of Leishmania parasites. Mol Biochem Parasitol 1992; 51: 133–142.
74. Victoir K, Banuls AL, Arevalo J et al. The gp63 gene locus, a target for genetic
characterization of Leishmania belonging to subgenus Viannia. Parasitol 1998;
117: 1–13.
75. Cupolillo E, Grimaldi G, Momen H and Beverly SM. Intergenic region typing
(IRT): a rapid molecular approach to the characterization and evoluation of
Leishmania. Mol Bioch Parasitol 1995; 73:145–155.
76. El Tai NO, El Fari M, Mauricio I et al. Leishmania donovani: intraspecific
polymorphisms of Sudanese isolates revealed by PCR-based analyses and DNA
sequencing. Exp Parasitol 2001; 97: 35–44.
77. Schonian G, Schnur L, el Fari M, Oskam L, Kolesnikov AA, Sokolowska-
Kohler W. Genetic heterogenicity in the species Leishmania tropica revealed by
different PCR-based methods. Trans R Soc Med Trop Hyg 2001; 95:217-224.
78. Mauricio IL, Stothard JR and Miles MA. The strange case of Leishmania
chagasi. Parasitol Today 2000; 16: 188–189.
79. Tibayrenc M and Ayala FJ. Evolutionary genetics of Trypanosoma and
Leishmania. Microb Infect. 1999; 1:465–472
80. Pogue GP, Joshi M, Lee NS et al. Conservation of low-copy gene loci in Old
World Leishmania identifies mechanisms of parasite evolution and diagnostic
markers. Molecular and polymerase chain reaction. Mol Bioch Parasitol 1996;
77: 19–29.
81. Cupolillo E, Aguiar Alves F, Brahim LR et al. Recent Advances in the
taxonomy of the New World leishmanial parasites. Med Microbiol Immunol
2001; 190: 57–60.
82. Sunkin SM, Kiser P, Myler PJ and Stuart K. The size difference between
Leishmania major Friedlin chromosome one homologues is localized to sub-
telomeric repeats at one chromosomal end. Mol Bioch Parasitol 2000; 109:1–15.
72
83. Ivens AC & Blackwell JM. The Leishmania genome comes of age. Parasitol
Today 1999; 15: 225–231.
84. Myler PJ and Stuart KD. Recent developments from the Leishmania genome
project. Curr Opin Microbiol 2000a; 3: 412– 416.
85. McDonagh PD, Myler PJ and Stuart K. The unusual gene organization of
Leishmania major chromosome 1 may reflect novel transcription processes.
Nucl Acids Res 2000; 15: 2800– 2803.
86. Myler PJ, Sisk E, McDonagh PD et al. Genomic organization and gene function
in Leishmania. Biochem Soc Trans 2000b; 28: 527–531.
87. Anthony RM, Brown TJ and French GL. DNA array technology and diagnostic
microbiology. Exp Rev Mol Diag 2001; 1:15–23.
88. Hoogstraal, H. and Heyneman, D. Leishmaniasis in the Sudan Republic: 30.
Final epidemiological report. Am J Trop Med Hyg 1969; 18:1091-1210.
89. Laurent T, Van der Auwera G, Hide M, et al. Identification of old world
Leishmania spp. by specific polymerase chain reaction amplification of cysteine
proteinase B genes and rapid dipstick detection. Diagn Microbiol Infect Dis
2009; 63:173–181
90. Boom R, Sol C, Salimans M, Jansen C, Wertheim van Dillen P and Noordaa
van der J. Rapid and simple method for purification of nucleic acids. J Clin
Microbiol 1990; 28: 495–503.
91. Mugasa C, Laurent T, Schoone GJ, Kager PA, Lubega GW and Schallig HDFH
.Nucleic acid sequence-based amplification with oligochromatography
(NASBA-OC) for the detection of Trypanosoma brucei in clinical samples. J
Clin Microbiol 2009; 47: 630–635.
92. Van der Voet H and van der Raamsdon LWD. Estimation of accordance and
concordance in inter-laboratory trials of analytical methods with qualitative
results. Int J Food Microbiol 2004; 95: 231–234.
93. Davison AC and Hinkley DV. Bootstrap Methods and Their Application.
Cambridge University Press, Cambridge 1997.
94. Harith AE, Kolk AH, Leeuwenburg J, Muigai R, Huiaen E, Telsma T and Kaaer
PA. Improvement of a direct agglutination test for field studies of visceral
leishmaniasis. J Clin Microbiol 1988; 26:132 l-5.
95. WHO, Manual on visceral leishmaniasis control. World Health Organization,
Geneva, Switzerland 1996b, WHO/LEISH/96.40.
73
96. Lukes J, Mauricio IL, Schonian G et al .Evolutionary and geographical history
of the Leishmania donovani complex with a revision of current taxonomy. Proc
Natl Acad Sci USA 2007; 104:9375–9380
97. Landis JR and Koch GG.The measurement of observer agreement for
categorical data. Biometrics 1977; 33: 159–174.
98. Pont-Sucre A. Physiological consequences of drug resistance in Leishmania and
their relevance for chemotherapy. Kinetoplastid Biol Dis 2003; 2:14.
99. Choi CM, Lerner EA. Leishmaniasis as an emerging infection.
J.Invest.Dermatol. 2001; 6:175- 82.
100. ME Ibrahim, DA Evans, TG Theander, AM El Hassan and Arsalan Kharazmi.
Diversity among Leishmania isolates from the Sudan: isoenzyme homogeneity
of L. donovani versus heterogeneity of L. major. Trans R Soc Med Trop Hyg
1995; 89:366-369.
101. Claes F, Deborggraeve S, Verloo D et al. Validation of a PCR-
Oligochromatography test for detection of Trypanozoon parasites in a
multicenter collaborative trial. J Clin Microbiol 2007; 45: 3785–3787.
102. Deborggraeve S, Boelaert M, Rijal S, De Doncker S, Dujardin JC, et al.
Diagnostic accuracy of a new Leishmania PCR for clinical visceral
leishmaniasis in Nepal and its role in diagnosis of disease. Trop Med Int Health
2008; 13: 1378–1383.
103. Bhattarai NR, Van der Auwera G, Khanal B, De Doncker S, Rijal S, et al.
PCR and direct agglutination as Leishmania infection markers among healthy
Nepalese subjects living in areas endemic for Kala-Azar. Trop Med Int Health
2009; 14: 404–411.
104. Anderson K, Gasim S and Elhassan AM. Diagnosis of visceral leishmaniasis
by polymerase chain reaction using blood, bone marrow and lymph node
samples from patients from the Sudan. Trop Med Int Health 1994; 2: 440–444.
105. Salotra P, Screenivas G and Pouge GP. Development of a special species-
specific PCR assay for detection of Leishmania donovani in clinical samples
from patients with kala-azar and post kala-azar dermal leishmaniasis. J Clin
Microbiol 2001; 39:357–361.
106. Maurya R, Singh RK, Kumar B, Salotra P, RaiM and Sundar S. Evaluation of
PCR for diagnosis of Indian kala-azar and assessment of cure. J Clin Microbiol
2005; 43: 3038–3041.
74
107. Mugasa C, Deborggraeve S, Schoone G et al. Accordance and concordance of
PCR and NASBA followed by oligochromatography for the molecular
diagnosis of Trypanosoma brucei and Leishmania. Trop Med Int Health
2010a; 15:800–805.
108. Hailu A. Pre- and post-treatment antibody levels in visceral leishmaniasis.
Trans R Soc Med Trop Hyg 1990; 84:673-675.
109. Prina E, Roux E, Mattei D and Milon G. Leishmania DNA is rapidly degraded
following parasite death: an analysis by microscopy and real-time PCR. Microb
Infect. 2007; 9:1307–1315
110. Botilde Y, Laurent T, Quispe Tintaya W et al. Comparison of molecular
markers for strain typing of Leishmania infantum. Infect Genet Evol 2006;
6:440–446
111. Hide M, Banuls AL. Species-specific PCR assay for L. infantum/L. donovani
discrimination. Acta Trop 2006; 100:241–245
112. Haralambous C, Antoniou M, Pratlong F, Dedet JP, Soteriadou K
Development of a molecular assay specific for the Leishmania donovani
complex that discriminates L. donovani/ Leishmania infantum zymodemes: a
useful tool for typing MON- 1. Diagn Microbiol Infect Dis 2008; 60:33–42
113. Longo MC, Berninger MS, Hartley JL .Use of uracil DNA glycosylase to
control carry-over contamination in polymerase chain reactions. Gene1990;
93:125–128
114. Pham DG, Madico GE, Quinn TC, Enzler MJ, Smith TF, Gaydos CA. Use of
lambda phage DNA as a hybrid internal control in a PCR-enzyme immunoassay
to detect Chlamydia pneumoniae. J Clin Microbiol 1998; 36:1919–1922
115. El Tai NO, Osman OF, El Fari M, Presber W, Schonian G. Genetic
heterogeneity of ribosomal internal transcribed spacer in clinical samples of
Leishmania donovani spotted on filter paper as revealed by single-strand
conformation polymorphisms and sequencing. Trans R Soc Trop Med Hyg
2000; 94:575–579
116. Blancq SM, Belehu A, Peters W. Leishmania in the Old World: 3. The
distribution of L. aethiopica zymodemes. Trans R Soc Trop Med Hyg 1986;
80:360–366