Utilizing A Novel Utilizing A Novel Technique for Technique for

Analyzing the Atomic Analyzing the Atomic Lattice of DNA Lattice of DNA

CrystalsCrystalsEmily Cavaliere Emily Cavaliere

Professor Shing Ho’s LabProfessor Shing Ho’s Lab

Why study DNA Why study DNA structure?structure?

Better understanding Better understanding of:of: The effects of DNA The effects of DNA

structure on structure on biological biological processes at the processes at the molecular level molecular level (e.g. replication).(e.g. replication).

How small How small molecules, such as molecules, such as drugs or drugs or carcinogens, affect carcinogens, affect the structure of the structure of DNA.DNA.

http://www.accessexcellence.org/AE/AEPC/NIH/gene02.htmlhttp://www.accessexcellence.org/AE/AEPC/NIH/gene02.html

Our Plan to Study DNAOur Plan to Study DNA

Crystallize Crystallize different different DNA DNA structuresstructures

Compare Compare and and contrast contrast DNA DNA structures structures

http://www.albany.edu/~achm110/abzdna.htmlhttp://www.albany.edu/~achm110/abzdna.html

DNA CrystalsDNA Crystals DNA crystals allow us to DNA crystals allow us to

determine the structure of determine the structure of DNA.DNA.

A solution containing many A solution containing many components is mixed with components is mixed with DNA in one of the 9 wells, DNA in one of the 9 wells, with 2-methyl-2,4-pentanediol with 2-methyl-2,4-pentanediol (MPD) in the reservoir (MPD) in the reservoir beneath.beneath.

The MPD draws the water The MPD draws the water from the aqueous solution in from the aqueous solution in the well.the well.

DNA concentration increases: DNA concentration increases: the solubility decreases and the solubility decreases and DNA falls out of solutionDNA falls out of solution

A DNA crystal is formed.A DNA crystal is formed.

http://www.hamptonresearch.com/hrproducts/3136.htmlhttp://www.hamptonresearch.com/hrproducts/3136.html

DNA CrystalsDNA Crystals

Pictures courtesy of Frank Pictures courtesy of Frank HaysHays

Introduction to Atomic Introduction to Atomic Force MicroscopyForce Microscopy

How Atomic Force How Atomic Force Microscopy WorksMicroscopy Works

small record playersmall record player A very sharp, tiny (5-A very sharp, tiny (5-

20nm) probe moves 20nm) probe moves along the surface of along the surface of the specimen.the specimen.

This probe is This probe is attached to a attached to a cantilever, which cantilever, which acts like a spring, acts like a spring, which scans the which scans the surface of the surface of the specimen.specimen.

http://www.wfmu.org/MACrec/http://www.wfmu.org/MACrec/MT.htmlMT.html

Yang, et al, Methods 29:175-187,2002Yang, et al, Methods 29:175-187,2002

http://www.physics.ucsb.edu/http://www.physics.ucsb.edu/%7Ehhansma/afm-acs_news.htm%7Ehhansma/afm-acs_news.htm http://www.veeco.com/http://www.veeco.com/

An example of what we can see An example of what we can see with AFMwith AFM

This image represents a growing calcium carbonate crystal

Smith et al, Biophys. J. 72:1425-1433, 1997Smith et al, Biophys. J. 72:1425-1433, 1997

1 2

3 4

Advantages of AFMAdvantages of AFM

Can determine the lattice Can determine the lattice structure of the specimen.structure of the specimen.

Less need of higher quality Less need of higher quality crystals.crystals.

Operates under ambient Operates under ambient conditions:conditions: In air In air In liquid: atomic lattice resolution In liquid: atomic lattice resolution

(possibly)(possibly)

Ng et al, NAR 25:2582, 1997

Summer ProjectSummer Project

Growth Growth of of CrystalCrystalBuffers Buffers

and DNAand DNA

Artificial Artificial Mother Mother LiquorLiquor

Affixing Affixing CrystalCrystalss

Atomic Atomic Force Force MicroscopMicroscope imaginge imaging

Tested a variety of buffers to determine

which would

yield most stable

crystals

Affixing the Crystals to the Surface

Glass and Plastic Cover Slips

Tiny Clamp Using agarose as

a “glue”

Crystal Imaged in AirCrystal Imaged in Air

Height v.s. AmplitudeHeight v.s. Amplitude

This is a DNA crystal imaged in air, by tapping mode. Hillocks!

TCGGTACCGATCGGTACCGA

We have tried:We have tried: Different buffers, and have finally Different buffers, and have finally

determined, relatively so, what worksdetermined, relatively so, what works Slight increases in the concentrations of the Slight increases in the concentrations of the

constituents of the mother liquor.constituents of the mother liquor. Attaching crystals to the surface:Attaching crystals to the surface:

the crystals: the crystals: In agarIn agar In agaroseIn agarose Under carbon fibersUnder carbon fibers Growing them on plastic disksGrowing them on plastic disks

All in order to make them stay put All in order to make them stay put and not dissolve!and not dissolve!

The Future of this The Future of this ProjectProject

Found an artificial mother liquor to Found an artificial mother liquor to stabilize the DNA crystalsstabilize the DNA crystals

The possible use of agarose or The possible use of agarose or adhesives to hold the crystal for adhesives to hold the crystal for imaging.imaging.

Possibly with reliable conditions and Possibly with reliable conditions and environment this project will give environment this project will give lattice resolution of the DNA crystal.lattice resolution of the DNA crystal.

AcknowledgmentsAcknowledgments

Professor Shing HoProfessor Shing Ho Bettye Smith, my mentor Bettye Smith, my mentor Trish Khuu, Frank Hays, Jeff Watson, and Trish Khuu, Frank Hays, Jeff Watson, and

Andrea VothAndrea Voth Kevin AhernKevin Ahern Howard Hughes Medical Institute Howard Hughes Medical Institute

ProgramProgram Funding:Funding:

Shing Ho Lab (NIH)Shing Ho Lab (NIH)

ReferencesReferences McPherson, A., Kuznetsov, Y., Malkin, A., Plomp, M. 2003. McPherson, A., Kuznetsov, Y., Malkin, A., Plomp, M. 2003.

Macromolecular crystal growth as revealed by atomic force Macromolecular crystal growth as revealed by atomic force microscopy. J. of Struct. Biol. 142, 32-46.microscopy. J. of Struct. Biol. 142, 32-46.

Ng et al, NAR 25:2582, 1997Ng et al, NAR 25:2582, 1997 Principles of Physical BiochemistryPrinciples of Physical Biochemistry. Johnson, W. C., Shing . Johnson, W. C., Shing

Ho, P., van Holde, K. E. Prentice Hall. New Jersey. 1998.Ho, P., van Holde, K. E. Prentice Hall. New Jersey. 1998. Yang, Y., Wang, H., Erie, D. A., 2002. Quantitative Yang, Y., Wang, H., Erie, D. A., 2002. Quantitative

characterization of biomolecular assemblies and characterization of biomolecular assemblies and interactions using atomic force microscopy. Methods. 29, interactions using atomic force microscopy. Methods. 29, 175-187.175-187.

Smith, B. L., Paloczi, G. T., Walters, D. A., Belcher, A. M., Smith, B. L., Paloczi, G. T., Walters, D. A., Belcher, A. M., Stucky, G. D., Morse, D. E., Hansma, P. K. 1997. Stucky, G. D., Morse, D. E., Hansma, P. K. 1997. Modification of Calcite Crystal Growth by Abalone Shell Modification of Calcite Crystal Growth by Abalone Shell Proteins: An Atomic Force Microscope Study. Biophysical Proteins: An Atomic Force Microscope Study. Biophysical Journal. 72, 1425-1433.Journal. 72, 1425-1433.

X-Ray DiffractionX-Ray Diffraction Currently the only way of finding the atomic Currently the only way of finding the atomic

structure of DNA crystals.structure of DNA crystals. X-ray diffraction: patterns of x-ray diffraction depends X-ray diffraction: patterns of x-ray diffraction depends

on the type and distribution of atoms in the diffracting on the type and distribution of atoms in the diffracting substance (DNA crystals). substance (DNA crystals).

The way a solid deflects x-rays, through complex The way a solid deflects x-rays, through complex computations, reveals the size, shape and arrangement computations, reveals the size, shape and arrangement of molecules in the specimen.of molecules in the specimen.

Disadvantage: the phase problem; gaps in the Disadvantage: the phase problem; gaps in the patterns of the crystal.patterns of the crystal.

Cannot find the Cannot find the DNA relative to the DNA relative to the other molecules in other molecules in the crystal with x-ray the crystal with x-ray diffractiondiffractionCompare the Compare the orientation of orientation of different types of different types of DNADNA

Where’s the DNA? Benefit Where’s the DNA? Benefit of AFMof AFM

Need an Artificial Mother Need an Artificial Mother Liquor for imaging in Liquor for imaging in

fluidsfluids We want atomic lattice resolutionWe want atomic lattice resolution Need to image in liquidNeed to image in liquid Need liquid, only have 10 µL in the Need liquid, only have 10 µL in the

dropdrop Need AML: Need AML:

DNA crystals are very sensitiveDNA crystals are very sensitive Need to be stabilized for many hoursNeed to be stabilized for many hours Need fluid to be on the tip to prevent Need fluid to be on the tip to prevent

breakage (surface tension). breakage (surface tension).

AFM Image of DNA AFM Image of DNA crystalcrystal

Summer ProjectSummer Project

DNA crystals have never before been imaged DNA crystals have never before been imaged on AFM.on AFM.

Goals: Goals: Determine stability of DNA crystals under ambient Determine stability of DNA crystals under ambient

conditions and conducive for AFM imaging.conditions and conducive for AFM imaging. Be able to attach attained crystals to surface for Be able to attach attained crystals to surface for

AFM.AFM. Attain lattice resolution and find the unit cell.Attain lattice resolution and find the unit cell. Compare different types of DNA structures Compare different types of DNA structures

(e.g. B-DNA and Holliday Junctions).(e.g. B-DNA and Holliday Junctions).

Our Plan to Study DNAOur Plan to Study DNA

Crystallize Crystallize different DNA different DNA structures, such structures, such as B-DNA and as B-DNA and Holliday junctions.Holliday junctions.

Compare the two Compare the two types of DNA types of DNA structures.structures.

Attempt to Attempt to determine the determine the differences in the differences in the two structures at two structures at high resolution.high resolution.

http://www.albany.edu/~achm110/abzdna.htmlhttp://www.albany.edu/~achm110/abzdna.html

DNA CrystalsDNA Crystals DNA crystals allow us to DNA crystals allow us to

determine the structure of determine the structure of DNA.DNA.

Recipe For Crystals: salt, Recipe For Crystals: salt, buffer, spermine, water and buffer, spermine, water and DNA in a 10 µL well, and 2-DNA in a 10 µL well, and 2-methyl-2,4-pentanediol (MPD) methyl-2,4-pentanediol (MPD) in the reservoir beneath.in the reservoir beneath.

The MPD draws the water The MPD draws the water from the aqueous solution in from the aqueous solution in the well.the well.

DNA concentration increases: DNA concentration increases: the solubility decreases and the solubility decreases and DNA falls out of solution, DNA falls out of solution, nucleation point.nucleation point.

A DNA crystal is formed.A DNA crystal is formed.

http://www.hamptonresearch.com/hrproducts/3136.htmlhttp://www.hamptonresearch.com/hrproducts/3136.html