Variable Expressions of ADAM Family Genesin Tissues and Cancer Cells

U N I V E R S I T Y O F T A M P E R E

ACADEMIC DISSERTATIONTo be presented, with the permission of

the Faculty of Medicine of the University of Tampere,for public discussion in the auditorium of Finn-Medi 1,Biokatu 6, Tampere, on June 29th, 2007, at 12 o’clock.

IIVARI KLEINO

DistributionBookshop TAJUP.O. Box 61733014 University of TampereFinland

Cover design byJuha Siro

Printed dissertationActa Universitatis Tamperensis 1236ISBN 978-951-44-6980-0 (print)ISSN 1455-1616

Tampereen Yliopistopaino Oy – Juvenes PrintTampere 2007

Tel. +358 3 3551 6055Fax +358 3 3551 7685taju@uta.fiwww.uta.fi/tajuhttp://granum.uta.fi

Electronic dissertationActa Electronica Universitatis Tamperensis 628ISBN 978-951-44-6981-7 (pdf )ISSN 1456-954Xhttp://acta.uta.fi

ACADEMIC DISSERTATIONUniversity of Tampere, Institute of Medical TechnologyTampere Graduate School in Biomedicine and BiotechnologyFinland

Supervised byAri Huovila, PhDUniversity of TampereProfessor Jorma IsolaUniversity of Tampere

Reviewed byProfessor Pekka LappalainenUniversity of HelsinkiDocent Antero SalminenUniversity of Jyväskylä

To my family

4

CONTENTS

CONTENTS................................................................................................. 4

LIST OF ORIGINAL COMMUNICATIONS............................................. 8

ABBREVIATIONS...................................................................................... 9

ABSTRACT............................................................................................... 13

LYHENNELMÄ ........................................................................................ 14

1. INTRODUCTION.................................................................................. 15

2. REVIEW OF THE LITERATURE........................................................ 16

2.1. ADAM domain structure and function ...........................................................16 2.1.1. Prodomain ..........................................................................................16 2.1.2. Metalloprotease domain .....................................................................17 2.1.3. Disintegrin domain (DI) .....................................................................20 2.1.4. The ADAM cysteine-rich domain (ACR)..........................................24 2.1.5. The EGF-like domain, membrane proximal motif and transmembrane region............................................................................................................28 2.1.6. The ADAM cytosolic tail ...................................................................31

2.2. ADAM-mediated cellular functions ...............................................................33 2.2.1. ADAMs regulate growth factors, cytokines, and chemokine signaling......................................................................................................................33 2.2.2. ADAMs initiate the regulated intramembrane proteolysis pathway..36 2.2.3. ADAMs regulate adhesion molecules, ECM components, and extracellular enzymes...................................................................................39 2.2.4. ADAMs mediate cell adhesion and integrin-signaling through their DI and ACR domains ........................................................................................42 2.2.5. ADAM-mediated intracellular signaling............................................43

2.3. Functional regulation of ADAMs...................................................................45 2.3.1. Subcellular sorting regulates ADAM activity....................................45

2.3.1.1. ER-retention regulates at least ADAM22..............................45 2.3.1.2. The ADAM subcellular localization and metalloprotease activity of ADAMs is regulated by cytosolic interactions..................46 2.3.1.3. ADAM interactions with PDZ domain proteins and the cytoskeleton regulate shedding...........................................................48

2.3.2. Constitutive shedding is mediated by several ADAMs .....................49

5

2.3.3. Engagement induces ADAM-mediated shedding.............................. 50 2.3.4. Cell signaling regulates ADAM-mediated shedding ......................... 50

2.3.4.1. Intracellular Ca2+ and CaM inhibitors activate shedding ...... 51 2.3.4.2. Erk1/2 signaling is involved in ADAM17 sorting and activation ............................................................................................ 52 2.3.4.3. The JNK and p38 MAPK pathways activate shedding ......... 53 2.3.4.4. PKCs regulate ADAM transporting and activation independent of MAPKs ...................................................................... 53

2.3.5. ADAMs mediate triple membrane passing signaling ........................ 54

2.4. ADAM transgenic animals ............................................................................. 56 2.4.1. Metalloprotease-ADAM gene knock-out mice.................................. 56 2.4.2. Non-metalloprotease ADAM11, -22, and -23 gene knock-out mice display defective neurological functions...................................................... 60

2.5. Alternative splicing in ADAM regulation...................................................... 61

2.6. ADAM-mediated cellular functions in the nervous system ........................... 63 2.6.1. ADAMs regulate proliferation, differentiation, and survival signals in the adult CNS ............................................................................................... 63 2.6.2. ADAM-mediated shedding may regulate synapses ........................... 65 2.6.3. ADAM-integrin interaction partners remain to be identified in the nervous system............................................................................................. 68 2.6.4. ADAM22 is a receptor for LGI1 and regulates AMPA receptor synapse recruitment...................................................................................... 69 2.6.5. Other ADAMs functions neural system............................................. 70

2.7. Molecular functions of the ADAM15 protein ................................................ 71

3. AIMS OF THE STUDY......................................................................... 74

4. MATERIALS AND METHODS ........................................................... 75

4.1. Materials and methods used in the individual studies .................................... 75 4.1.1. Cells and cell lines (III and V) ........................................................... 75 4.1.2. Animals and tissues (I-II)................................................................... 76 4.1.3. Molecular biology (I-V)..................................................................... 76 4.1.4. In situ hybridization (I-II) .................................................................. 78 4.1.5. Fluorescent in situ hybridization (III and V) ..................................... 79 4.1.6. Computer aided methods (I-IV)......................................................... 80

5. RESULTS............................................................................................... 83

5.1. ADAM genes and proteins (IV and VI) ......................................................... 83 5.1.1. ADAM web pages (VI)...................................................................... 83 5.1.2. The Number of human and mouse ADAM genes and proteins (VI) .83

6

5.1.3. ADAM family gene structure and protein sequence similarities (IV and VI)..........................................................................................................86

5.1.3.1. Exon/intron structure groups found in ADAM genes............86 5.1.3.2. ADAMs fall into seven protein subfamilies ..........................88

5.2. ADAM expression in the adult central nervous system (I and II) ..................91 5.2.1. Several ADAMs are expressed in the adult mouse brain (I)..............91 5.2.2. Regional expression of ADAMs in the rat CNS (I) ...........................92 5.2.3. ADAMs 10 and 17 are expressed differently in the mouse CNS (I)..93 5.2.4. ADAM11 is expressed in a subset of neurons and in some extra-CNS tissues in adult mouse (II) ............................................................................94 5.2.5. Induction of ADAM11 expression correlates with CNS development......................................................................................................................94

5.3. ADAM15 gene (III, IV, and V) ......................................................................95 5.3.1. The ADAM15 gene is located in the chromosomal band 1q21.3, which is rearranged in breast cancer cell lines (III and V)...........................95 5.3.2. The structure and regulatory regions of the ADAM15 gene (IV)......96 5.3.3. The ADAM15 gene is alternatively spliced in normal tissues and the splicing is altered in breast cancer cell lines (III and IV).............................97

5.3.3.1. ADAM15 variants are expressed differentially in human tissues (IV)..........................................................................................99 5.3.3.2. ADAM15 exon use is altered in breast cancer cell lines (III)99

5.3.4. Alternative splicing regulatory motifs in ADAM15 gene (IV)........100 5.3.5. ADAM15 cytosolic tail protein-interaction-motifs are regulated by alternative splicing .....................................................................................102

6. DISCUSSION ...................................................................................... 104

6.1. The physiological importance and conservation of the ADAM-genes correlate with each other.....................................................................................................104

6.2. ADAMs in the CNS......................................................................................105 6.2.1. The regional CNS expression of the ADAM10 and -17 genes suggests that ADAM10 is the principal APP α-secretase ........................................105 6.2.2. ADAMs 11, 22, and 23 are widely expressed in the CNS (I, II, and VI) ..............................................................................................................106

6.2.2.1. ADAM11 is expressed in the mouse neural systems (I and II)..........................................................................................................106 6.2.2.2. ADAM11 in mouse development (II)..................................107 6.2.2.3. Wide expression of ADAM23 in the CNS points to an important role in the CNS (I)............................................................108 6.2.2.4. Conclusions on the brain-MDC findings (I, II, VI) .............108

6.2.3. ADAM9 and MMM subfamily-ADAMs are widely expressed in the CNS suggesting functional role in CNS.....................................................109 6.2.4. ADAM1, 2, 3, and 21 show restricted expression in the CNS suggesting functional specialization...........................................................110

7

6.3. ADAM15 gene structure and alternative splicing (III, IV, V) ..................... 110 6.3.1. ADAM15 gene rearrangement is not associated with changes in ADAM15 expression levels (III and V)..................................................... 111 6.3.2. ADAM15 gene structure and regulatory regions ............................. 111 6.3.3. ADAM15 alternative exons are widely and differentially used in human tissues and exon use is altered in breast cancer cell lines (III and IV).................................................................................................................... 112 6.3.4. The regulation of ADAM15 alternative splicing (IV) ..................... 113 6.3.5. ADAM15 alternative protein isoforms (III and IV)......................... 114

7. CONCLUSIONS AND PERSPECTIVES ........................................... 116

8. ACKNOWLEDGEMENTS ................................................................. 117

9. REFERENCES..................................................................................... 119

10. ORIGINAL COMMUNICATIONS................................................... 143

8

List of original communications

This thesis is based on the following original scientific communications. These are referred to in the text by the roman numerals I-V. Work VI was the setting up, development, and maintenance of a web resource for ADAM gene family information and internet links.

Full papers

I. Kärkkäinen I., Rybnikova E., Pelto-Huikko M., Huovila A.-P.J. Metalloprotease-disintegrin (ADAM) genes are widely and differentially expressed in the adult CNS. Mol Cell Neurosci 15 (6): 547-60, 2000

II. Rybnikova E., Kärkkäinen I., Pelto-Huikko M., Huovila A.-P.J. Developmental regulation and neuronal expression of the cellular disintegrin ADAM11 gene in mouse nervous system. Neuroscience 112 (4):921-34, 2002

III. Ortiz R.M1, Kärkkäinen I1., Huovila A.-P.J. Aberrant alternative exon use and increased copy number of human metalloprotease-disintegrin ADAM15 gene in breast cancer cells. Genes Chromosomes Cancer. 41 (4):366-78, 2004

IV. Kleino I., Ortiz R.M, Huovila A.-P.J. Human ADAM15 gene structure, promoter identification, and alternative usage of modular exon at cytosolic domain. Submitted to BMC Molecular Biology 2007

Gene localization report V. Kärkkäinen I., Karhu R., Huovila A.-P.J. Assignment of the ADAM15 gene to

human chromosome band 1q21.3 by in situ hybridization. Cytogenet Cell Genet 88 (3-4):206-7, 2000

Internet resource and ADAM relatedness analysis VI. http://www.uta.fi/~loiika/ADAMs/

ADAM gene web pages 1The authors contributed equally and thus share the first authorship. The work III

will be used also in the thesis of Rebekka Ortiz.

9

Abbreviations

Ab antibody ACR ADAM cysteine-rich domain ADAM A Disintegrin And Metalloprotease ADAMTS ADAM with thrombospondin motifs ALCAM activated leukocyte cell adhesion molecule AMPA α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid ang II angiotensin II APLP1 APP-like protein 1 APLP2 APP-like protein 2 APMA p-aminophenylmercuric acetate APP amyloid precursor protein BMP1 bone morphogenetic protein 1 C5a complement protein 5a CAM cell adhesion molecule CCCP carbonyl cyanide m-chloro phenyl hydrazone CELF CUG-BP and ETR-3 like factor CHL1 close homologue of L1 CNS central nervous system COP coatomer protein cPLA2 cytosolic phospholipase a2 CRP collagen-related peptide CX3CL chemokine (C-X3-C motif) ligand c-met Met proto-oncogene / hepatocytes growth factor receptor Dsg-2 desmoglein 2/desmosomal cadherin DI disintegrin domain DLG discs, large homolog Ebola virus GP Ebola virus glycoprotein ECD extra cellular domain ECM extra cellular matrix EGF epidermal growth factor EGFR epidermal growth factor receptor EPCR endothelial protein C receptors EphA3 ephrin receptor A3 EphB2 ephrin receptor B2 EPCR endothelial protein C receptor EPTP epitempin ER endoplasmic reticulum ErbB2 v-erb-b2 erythroblastic leukemia viral oncogene homolog 2 ERK extracellular signal regulated kinase ESE exonic splicing enhancer ESS exonic splicing silencer ET-1 endothelin-1 EVE-1 EVE-1

10

FasL Fas ligand FGFR fibroblast growth factor receptor FHL2 four and a half LIM domains 2 FISH fluorescence in situ hybridization FLRG follistatin-like 3 fMLP N-formyl-methionyl-leucyl-phenylalanine Galectin galactose-specific lectin GFP green fluorescent protein GLUT4 glucose transporter 4 GPCR G-protein coupled receptor GPR56 G-protein coupled receptor 56 GPV glycoprotein V (platelets) GPVI glycoprotein VI (platelets) Grb2 growth factor receptor-bound protein 2 GRP gastrin releasing peptide HA hemagglutinin HB-EGF heparin-binding epidermal growth factor Hck hemopoietic cell kinase HGF hepatocyte growth factor HMEC human mammary epithelial cell hnRNP heterogeneous nuclear ribonucleoprotein HUVEC human umbilical vein endothelial cells HVR highly variable region ICD intracellular domain IGF insulin-like growth factor IGFBP insulin-like growth factor binding protein IL interleukin ISH in situ hybridization JNK C-jun-amino-terminal kinase LDL-R low density lipoprotein receptor LGI1 leucine-rich, glioma inactivated 1 LPA lysophosphatidic acid LRP LDL receptor related protein LDLr low density lipoprotein receptor LRR leucine rich repeat LTA lipoteichoic acid LTB4 leukotriene B4 LTP long term potentiation MAD mitotic arrest deficient MAPK mitogen-activated protein kinase MBNL Muscleblind-like protein MCP-1 Monocyte chemotactic protein-1 M-CSFR Macrophage colony-stimulating factor 1 receptor MDC Metalloprotease Disintegrin Cysteine-rich MEF mouse embryonic fibroblasts Mek mitogen-activated protein kinase kinase MHC major histocompatibility complex

11

MMM metargidin/meltrin/MS2 MMP matrix metalloprotease MP metalloprotease domain mRNA messenger RNA mβCD methyl-β-cyclodextrin MS multiple sclerosis MT-MMP membrane type matrix metalloprotease MUC1 mucin 1 NCAM neural cell adhesion molecule NGF nerve growth factor NgR Nogo receptor NMD nonsense mediated decay NMDA N-methyl-D-aspartic acid NRG neuregulin OGD oxygen-glucose deprivation Pacsin protein kinase C and casein kinase substrate in neurons p75NTR p75 neurotrophin receptor Pcdhγ γ-protocadherins PDB protein databank PDK1 3-phosphoinositide dependent protein kinase-1 PDZ domain present in PSD-95, Dlg, and ZO-1/2 PI3 phosphatidylinositol 3 PI3K phosphatidylinositol 3-kinase PKC protein kinase C PMA phorbol myristate acetate PNS peripheral nervous system PSD postsynaptic density PSGL P-selectin glycoprotein ligand PTPH1 protein tyrosin phosphatase H1 PV pervanadate PX PhoX homologous domain RANKL Receptor activator of NF-κB ligand RANKL Receptor activator of NF-B ligand RGD Arginine-Glycine-Aspartate sequence RIP regulated intramembrane proteolysis RNP ribonucleoprotein particle RTK receptor tyrosine kinase SAP97 synapse-associated protein 97 sAPP soluble APP SF scatter factor SGZ subgranular zone SH3 Src homology 3 siRNA small interfering RNA SNX sorting nexin SP1 Sp1 transcription factor SV40 simian virus 40 SVMP snake venom metalloprotease

12

SVZ subventricular zone TAPI-I tumour necrosis factor-α protease inhibitor TEM tetraspanin-enriched microdomain TFP trifluoroperazine TGF transforming growth factor TGN trans-Golgi network TIMP tissue inhibitor of metalloproteases Tks5/FISH tyrosine kinase substrate-5 /five SH3-domains TM transmembrane tm-collagen transmembrane collage TNF tumor necrosis factor TNFR tumor necrosis factor receptor TPA tetradecanoylphorbol myristate acetate UTR untranslated region UV ultraviolet VAP1 vascular apoptosis-inducing protein 1 VCC Vibrio cholera cytolysin WW domain with 2 conserved Trp (W) residues

13

Abstract

Ectodomain shedding, the proteolytic processing of cell surface proteins is a fast and effective way of regulating cell adhesion, cell signaling, and gene expression. ADAMs have emerged as a major family of cellular proteinases implicated in the ectodomain shedding of growth factors, cytokines, receptors, and cell adhesion proteins. In addition to the catalytic zinc metalloprotease domain, the extracellular part of ADAMs contains characteristic disintegrin and cysteine-rich domains, which mediate cell adhesion and regulate the metalloprotease activity. The subcellular localization and the regulation and targeting of the proteolytic activity of ADAMs are controlled by their cytosolic tail. Furthermore, ADAMs can also mediate intercellular adhesion through integrins or inhibit integrin binding and/or signaling. ADAMs are thus poised to regulate and mediate intercellular adhesion and/or communication important for every cell in multicellular organisms.

Many of the molecular functions shown to be mediated by ADAMs in non-neural cells have been implicated in the regulation of neuron-neuron and neuron-glial cell interactions. The regulation of cell adhesion, cell signaling, and gene expression is particularly important for the synaptic plasticity suggested to form the basis of the learning and memory. For example, ADAM-mediated α-processing of APP is required for normal synaptic regulation. On the other hand, misregulation of the ADAM-APP-processing activity has been associated with accumulation of β-amyloid, a neurotoxic APP derivative, implicated in Alzheimer’s disease. Furthermore, misregulated ADAM-activity has been linked to cancer progression. ADAM-mediated growth factor and adhesion protein shedding provide growth and migration signals for cancer cells. Hence, the characterization of the expression patterns of ADAMs and their mechanisms of regulation in the nervous system and in cancer cell lines may provide important information on the molecular interactions essential for normal brain functions and cancer progression.

The major goal of this thesis was to elucidate the functional regulation of ADAM genes by characterizing their physiological and pathological expression in normal tissues and in cancer cells. This was the first systematic study of the regional expression of multiple ADAMs in the adult CNS and the results established that ADAMs form a major proteinase and adhesion family in the CNS. The regional expression of ADAM10 implies that it is the most likely physiological APP α-secretase. The concomitant induction of ADAM11 expression with neural development and its wide expression in the adult CNS suggest important neural functions for the ADAM11.

The ADAM15 gene was chosen for detailed characterization as a prototype of a functionally important ADAM. The study demonstrated that ADAM15 gene expression is highly and widely regulated in human tissues by alternative splicing. Alternative splicing was found to regulate the ADAM15 cytosolic tail, which is potentially involved in the regulation of ADAM15 activity or cell signaling. Importantly, the alternative splicing was found altered in breast cancer cell lines. Furthermore, the localization of the ADAM15 gene in the chromosomal band 1q21.3 associated with cancers and the gene amplification in breast cancer cell lines suggest involvement of ADAM15 in cancer.

14

Lyhennelmä

Solujen ulkoisten proteiinien proteolyyttinen muokkaus on tehokas ja nopea tapa säädellä solujen välistä adheesiota, solusignalointia ja geenien ilmentymistä. Viimeaikaiset tulokset ovat osoittaneet ADAM:ien muodostavan tärkeän proteaasiperheen, jonka jäsenet säätelevät kasvutekijöiden, sytokiinien, niiden reseptorien sekä soluadheesioproteiinien soluista vapauttamista. Katalyyttisen sinkkimetalloproteaasiosan lisäksi ADAM-proteiinien tyypilliseen rakenteeseen kuuluvat adheesiota välittävä disintegriiniosa, kysteiinirikas osa sekä aktiivisuutta, kypsymistä ja solunsisäistä sijaintia säätelevä solunsisäinen häntä. Solunulkoisten proteiinien muokkauksen lisäksi ADAM:ien on näytetty välittävän solujen välistä adheesiota integriinivälitteisesti. ADAM:it voivat myös toimia integriinien toiminnan estäjinä. Nämä toiminnot liittyvät keskeisesti solujen väliseen viestintään ja vuorovaikutuksiin, mikä viittaa ADAM:ien toiminnan olevan olennaista koko elimistölle.

Useat ADAM:ien välittämät hermoston ulkopuoliset molekyylitason soluvuorovaikutukset on liitetty myös gliasolujen ja neuronien toimintaan keskus- ja ääreishermostossa. Soluadheesion, solusignaloinnin ja geenien ilmentymisen säätely on erityisen tärkeä mekanismi oppimisen ja muistin toimintaan liittyvässä synapsien muokkauksessa. ADAM:it mm. säätelevät synapsien normaaliin toimintaan liittyvää APP proteiinin α-prosessointia. Häiriöt ADAM:ien säätelyssä voivat toisaalta aiheuttaa APP:n α-prosessoinnin häiriöitä, joiden ajatellaan johtavan Alzheimerin taudin puhkeamiseen. Tämän uskotaan johtuvan ADAM-prosessoinnilta karkaavan APP:n β-prosessoinnista syntyvän myrkyllisen β-amyloidin kertymisestä aivoihin. ADAM:ien säätelyn häiriöiden uskotaan myös voivan johtaa syövän kehittymiseen. ADAM:ien ilmentymisen parempi tuntemus aivoissa ja syöpäsolulinjoissa tuottaa siis tietoa tärkeistä molekyylitason toiminnoista normaaleissa aivoissa sekä syövässä.

Tämän väitöskirjan tavoitteena oli selvittää ADAM-geenien fysiologista ja patologista ilmentymisen säätelyä elimistön normaaleissa kudoksissa sekä rintasyöpäsolulinjoissa. Kyseinen työ oli ensimmäinen, jossa systemaattisesti selvitettiin keskushermoston ADAM:ien ilmentymisen laajuutta. Tulokset osoittivat useiden ADAM:ien ilmentyvän laajasti keskushermostossa liittäen ADAM-perheen keskushermoston toimintaan. Tuloksista voitiin myös päätellä ADAM10 olevan todennäköisin APP:n α-prosessoija. Lisäksi, ADAM11:n ilmentymisen aktivoitumisen liittyminen neuronien kehitykseen sekä laaja ilmentyminen aivoissa neuronaalisilla alueilla viittaavat ADAM11:n tärkeään rooliin aivojen toiminnassa.

ADAM15 valittiin prototyyppitutkimuskohteeksi samankaltaisia ADAM:eja sisältävästä ADAM:ien ryhmästä. Vaihtoehtoisen eksonien käytön havaittiin olevan oleellinen osa ADAM15-geenin ilmentymisen säätelyä koko elimistössä. Vaihtoehtoisen eksonien käytön havaittiin säätelevän ADAM15:n solunsisäisiä osia, mikä voi oleellisesti vaikuttaa ADAM15-proteiinin säätelyyn tai signaalinvälitykseen. Rintasyöpäsoluja tutkittaessa vaihtoehtoisen silmukoinnin havaittiin olevan muuntunut syöpäsoluissa. Lisäksi ADAM15-geeni paikallistettiin syöpään liitetylle kromosomialueelle 1q21.3 ja sen havaittiin olevan monistunut rintasyöpäsolulinjoissa. Tulokset viittaavat ADAM15-geenin liittyvän mahdollisesti rintasyövän biologiaan.

15

1. Introduction

Intercellular signaling and adhesion are essential functions for almost every cell of a multicellular organism. In the nervous system, communication between neurons as well as neurons and glial cells play a pivotal role e.g. in the regulation of nervous system homeostasis, neuronal survival, and synapse function. Especially the remodeling of synapses in learning and memory involves the complex regulation of growth factors, cytokines, receptors, and adhesion proteins [1-3]. The ADAM genes (A disintegrin and metalloprotease) encode proteins, which have been shown to regulate and mediate both cell signaling and cell adhesion.

ADAMs comprise a major family of proteinases associated with the processing of cell surface proteins. This cleavage involves the release of the extracellular part of the substrate in a process called ectodomain shedding [4]. ADAM mediated cleavage regulates the activation of a number of growth factors, cytokines, cellular receptors, and adhesion proteins. ADAMs are thus strongly involved in the regulation of cell proliferation, motility, and apoptosis. Ectodomain shedding is pivotal for normal cells, but when misregulated may promote undesirable phenomena like cancerous cell growth, metastasis and anomalies associated in the development of Alzheimer's disease.

In addition to being proteinases, ADAMs act as counter-receptors for integrins taking part in mediating the intercellular adhesion and thus regulating integrins in a cell autonomous way. The interaction of ADAMs to integrins has been shown necessary for the binding of sperm to egg cells and for the differentiation of myoblasts and the formation of myotubes [5-7] and ADAM-integrin interactions have been associated with the regulation of T-cell adhesion [8]. Cell autonomous ADAM-mediated regulation of integrin activity has been suggested to control preadipocyte differentiation [9].

Due to their important role in development, normal physiology, as well as in pathological events, the regulation of the activity of ADAM proteins has received a lot of attention for some time now. Several cellular signaling routes have been associated with the activation ADAMs. Also, intracellular protein interactions have been shown to control the subcellular location and the activity of ADAMs, indicating that the cytosolic tail is involved in the regulation of ADAMs. Recent studies have suggested that a specific mechanism may regulate the shedding of particular substrates. A better understanding of the functional regulation of ADAMs could provide means of controlling ADAMs in a predetermined manner.

16

2. Review of the literature

2.1. ADAM domain structure and function

The first indication, that ADAMs function in mammals was the discovery of antigens implicated in the regulation of sperm-egg fusion (ADAMs 1 and 2) and as proteolytic activity seen in brain myelin fractions (ADAM10) [10, 11]. The first ADAM-cDNAs were cloned from macrophages (ADAM8) and sperm derived mRNAs (ADAMs 1 and 2) [12, 13]. The deduced ADAM-protein sequences were found to resemble hemorrhagic snake venoms involved in the degradation of the extracellular matrix and integrin inhibition [14]. Their roles in fertilization and their relatedness to snake venoms was the basis for naming the proteins; quoted here from the original publication by Wolfsberg et al.: ”We name this gene family ADAM, for proteins containing A Disintegrin And Metalloprotease domain, and in honor of its dual origins in the fields of snakes and fertility.” [15]. Since then, the ADAM family has been found to consist of a large group of proteins with only little variation in the domain structure of the extracellular part between its members. A full length ADAM contains a pro, metalloprotease (MP), disintegrin (DI), ADAM cysteine-rich (ACR), EGF-like, and a transmembrane domain and a highly variable carboxy-terminal cytosolic tail (Figure 1). The only major exceptions to this structure are seen in ADAMs 10 and 17, which lack parts of the ACR domain and EGF-like domains. Also, domain structure variation derived from alternative splicing has been reported and includes e.g. soluble ADAM-isoforms lacking transmembrane and cytosolic parts.

Figure 1. A schematic representation of a prototype ADAM. The figure shows the relative lengths of the domains and the locations of the metalloprotease active site and the disintegrin loop. The bar indicates the length corresponding to 100 amino acids. D, disintegrin loop; H, HEXGH-box.

2.1.1. Prodomain

All ADAMs contain an amino-terminal prodomain preceding the metalloprotease domain (Figure 1). The prodomain has been suggested to function as an intramolecular chaperone enhancing folding of the metalloprotease domain and/or aiding transport through the secretion pathway [4, 16]. Also, the prodomain has been shown to keep the metalloprotease domain in a latent, inactive zymogen form preceding the ADAM-maturation [17, 18]. Blocking of the active site is thought to depend on an unpaired cysteine in the prodomain. The cysteine coordinates the catalytic zinc preventing its availability for active-site histidines [17, 19]. The suggested mechanism resembles the cysteine switch regulation characterized in related MMPs [20]. An alternative

17

hypothesis suggests that the tight interaction of the prodomain and the metalloprotease domain may keep the metalloprotease domain in a partially folded conformation [16]. The mechanisms are not mutually exclusive, and evidence supporting both scenarios has been published [16, 17, 19].

Switching of the ADAM metalloprotease domain from zymogen to fully active form requires the dissociation or displacement of the prodomain from the metalloprotease domain. This is commonly thought to involve proteolytic processing between the pro- and metalloprotease domains and is usually mediated by furin-like proprotein convertases or autocatalysis [21]. As an isolated case, MMP-7 has been reported to mediate the maturation/activation of the soluble isoform of ADAM28 [22]. The maturation takes place in either the trans-Golgi compartment [4, 21, 23] or in the final subcellular compartment e.g. at the plasma membrane [17, 18, 24-26] This suggest that regulation of subcellular transport is involved in controlling ADAM maturation. Also, oxygen radicals have been suggested to induce the maturation of ADAMs [27].

There is no detailed structural data available for the prodomains of ADAMs or related snake venoms. Interestingly, the electron microscope structure of the processed ADAM12-S containing the pro- metalloprotease, disintegrin, and ACR domains resembles that of a four-leafed clover, suggesting that the protein is in a non-extended conformation [28]. It also implies tight a association between the ADAM12 prodomain and metalloprotease domain, even after maturation, which prompted authors to suggest that the processed ADAM12 prodomain could function as an inhibitor of ADAM12 and/or other ADAMs in the extracellular milieu.

2.1.2. Metalloprotease domain

Over half of the human (13/21) and mouse (24/39) ADAM-genes encode proteins with conserved (catalytic) amino acids in their metalloprotease active site. Based on numbers, ADAMs comprise a major family of proteinases. Indeed, ADAMs have been indicated in the ectodomain shedding of a multitude of proteins ranging from large cell adhesion molecules to growth factors, cytokines, and their receptors (section 2.2.1.-3.). It has been estimated that up to 4% of all cell surface proteins are shed by ADAMs or other proteases [4]. While the majority of known ADAM substrates are membrane tethered, ADAMs have also been implicated in the processing of soluble substrates and components of the extracellular matrix (ECM) (section 2.2.1.-3.).

The crystal structures of the metalloprotease domains of ADAMs 17, 33 and related metalloproteases have been solved. The comparative examination of known metalloprotease domain structures and protein sequences has offered clues to the catalytic mechanism and substrate binding properties of ADAM-proteins. ADAMs, ADAMTSs, and ECM degrading snake venom metalloproteases have closely related metalloprotease domains and comprise the adamalysin/reprolysin metalloprotease family [29]. Adamalysins share an overall metalloprotease domain fold and differ mostly by associated domains. Adamalysins and three other zinc metalloprotease families namely astacins, matrixins, and serralysins form the metzincin superfamily [29]. Examples of well known mammalian proteins belonging to the matrixins and astacins are the MMPs and BMP1, respectively [29].

18

The metzincins are thought to share a catalytic mechanism and some features in the metalloprotease active site. All metzincins contain the active site consensus sequence HEXXHXXGXXH, in which the three histidines coordinate the catalytic zinc and the glutamate polarizes the zinc-associated water molecule for the nucleophilic attack towards the target peptide bond (Figure 2). The glycine is required for a tight turn that allows the third histidine to ligate the zinc ion. The “met” prefix in metzincin comes from the shared methionine whose sidechain forms the base of the catalytic site beneath the zinc and enables a sharp methionine-turn [29].

Figure 2. The Human ADAM17 metalloprotease active site with the hydroxamic acid inhibitor TAPI-I. The catalytic zinc is coordinated between the three histidine residues (H405, H409, and H409) that are protruding left out from the atom surface model. TAPI-I is in the active site cleft suggestively covering the binding site of the C-terminal part of the substrate. The furthest parts of the P1’ and P2’ in TAPI-I indicate the locations of the S1’ and S2’ specificity pockets [30]. The Figure was created with the Accelrys DS visualizer based on the structural coordinates of 1BKC retrieved from PDB.

The metzincins structures with the active site cleft bound by inhibitors and transition state peptides suggest that when bound to an ADAM the substrate peptide is in an extended conformation for optimal cleavage efficiency [29-31]. However, the large potential binding surface between the ADAM and its substrate may induce the cleavage of non-extended substrates [29]. The residues flanking the scissile bond in the substrate project into the specificity pockets [29, 30]. The locations of the major specificity pockets S1’ and S2’ in the metalloprotease domain of ADAM17 are indicated in Figure 2 as the pseudo P1’ and P2’ side chains of the TAPI-I [30]. The essentially hydrophobic pockets are formed on both flanks of the connecting amino acids that protrude from the upper and lower walls of the active site cleft. A large part of the substrate specificity of ADAM17 and other adamalysins is thought to be imparted by the shape and electrostatic properties of these specificity pockets [30-33]. Interestingly, the size and sequence of the loops flanking the active site at the N-terminus-docking region (left in the Figure 2) and the principal docking region (right and middle in the Figure 2) show large variation within the adamalysin family [30, 31, 33].

19

Studies with small peptide substrates and metalloprotease inhibitors have shown that individual ADAM metalloprotease domains possess structural features that bestow binding selectivity [17, 32, 34, 35]. Intriguingly, many of the substrate peptides corresponding to the physiological cleavage sequences of ADAM17 substrates show only low efficiency in in vitro cleavage assays [32]. Also, despite their prominent substrate specificity in peptide cleavage assays, many ADAMs are capable of processing e.g. APP, TNF-α, or EGF-like growth factors in vitro and in cells [29, 36-38]. Furthermore, the sequence variation in the physiological cleavage site region in the substrates of particular ADAMs suggests promiscuity in substrate recognition [21, 29, 32, 37, 38]. This is consistent with the large specificity pockets in the metalloprotease domain structures in ADAMs [29-31] and suggests that ADAM substrate selectivity is not imparted solely by metalloprotease specificity pocket interactions, but that also other protein interactions influence substrate recognition and cleavage efficiency.

Substrate orientation at the plasma membrane may also be an important factor in substrate selection. Stöcker et al. suggest that the N-terminus of the substrate would be on the zinc side and the C-terminus on the S1’ pocket side in the active site cleft; left and right in the Figure 2, respectively [29, 30]. The orientation-mediated restriction is particularly interesting since it may drastically limit an ADAMs ability to cleave its substrates; e.g. if the substrate is required to be in an opposite membrane orientation relative to the ADAM, the ADAM and the substrate must be on apposing membranes either in different cells or in intracellular compartment. Consistently, some ADAM-substrates are not cleaved cell autonomously, but are cleaved in trans from a neighboring plasma membrane; e.g. ADAM10 has been reported to cleave substrates from apposing membranes as well as in the membrane it resides in. [39, 40].

Table 1. ADAM inhibitors

ADAM inhibited by insensitive to references ADAM8 - TIMP-1, -2, -3, and -4 [41] ADAM9 - TIMP-1, -2, and -3 [41] ADAM10 TIMP-1 and -3 TIMP-2 and -4 [42] ADAM12 TIMP-3 TIMP-1 and -2 [43, 44] ADAM17* TIMP(-1), -2, -3, and -4 TIMP-1, -2, -4 [35, 45] ADAM19 - TIMP-1, -2, and -3 [46] ADAM28 TIMP-3, -4 TIMP-1 and -2 [22] ADAM33 TIMP(-2), -3, and -4 TIMP-1 [35] ADAM10 GI254023X GW280264X [47] ADAM17 GW280264X GI254023X [47] Brackets indicate partial or weak inhibition; * inconsistency between studies

TIMPs have been shown to inhibit ADAMs. However, the physiological and

pathological significance of this inhibition remain mostly obscure [32, 36]. TIMP-3 has been implicated in the physiological inhibition of ADAM17 mediated TNFα shedding indicating that TIMP-3 plays a role in the restriction of inflammation and responses of innate immunity [48, 49]. The overexpression of TIMP-3 in cancer cells has been suggested to induce apoptosis by inhibiting the ADAM17 mediated shedding of p55TNFR, which in turn inhibits tumor formation of xenocrafts in mice [50]. This suggests that other TIMPs too may have a physiological role in the regulation of ADAMs. TIMPs and specific small molecule ADAM-inhibitors have also been used to

20

identify ADAMs responsible for the shedding of particular substrates in cells. ADAMs that are known to be inhibited by TIMPs or are insensitive to a particular TIMP are shown in Table 1 along with two potent ADAM-specific inhibitors [36].

In conclusion, ADAM metalloprotease domains show promiscuity in substrate selection. This is in contrast to the seemingly high selectivity of physiological substrates [4, 36]. This discrepancy suggests that in addition to selectivity imparted by substrate docking, ADAM-activity is regulated by the meeting of the substrate and the active ADAM. In essence this means that the subcellular localization of the substrate and the ADAM, regulation of ADAM-maturation, and the expression of ADAMs and the inhibitors are controlled in cells in order to attain physiological metalloprotease- substrate connections (section 2.3.).

2.1.3. Disintegrin domain (DI)

Disintegrins are small soluble proteins present in many snake venoms [51]. They were originally found to inhibit platelet activation/aggregation by blocking integrin binding to fibrinogen hence the name disintegrin [52]. Sperm ADAMs were found to contain a region highly similar in sequence to that found in known disintegrins and this disintegrin-like region was subsequently found to be involved in the process of binding egg-integrins during fertilization [12, 53]. The disintegrin name was thus extended to cover the ADAM disintegrin domain, the borders of which were defined by sequence comparison to the structurally and functionally characterized type II SVMP disintegrins. The type II SVMP disintegrins lack the cysteine-rich domains present in ADAMs and in type III SVMPs [15, 54]. See Calvete et al. for snake venom disintegrins [51].

The integrin binding mechanism of type II SVMPs has been carefully studied, and it has been shown to be dependent on a RGD integrin binding motif or related tripeptide at the tip of the protruding loop, designated a disintegrin loop (Figure 3) and [51]. In ADAMs the sequence corresponding to the tip of the DI-loop invariably contains a cysteine, and only the human ADAM15 has been reported to contain an RGD motif in the region correspond to the SVMP disintegrin loop [4, 21, 54]. Bovine and canine ADAM15 contain also the RGD in the corresponding region as deduced from Genbank genomic sequences. However, as pointed out and discussed in [12, 14, 15, 53], the cysteine residue at the tip of the ADAM-disintegrin loop suggests that the loop might be disulphide bridged from the tip and thus mechanistically unavailable for the suggested integrin binding. Recently published structures of the full DI-ACR parts indicate that in ADAM10 and the type III SVMP VAP1 the region corresponding to the type II disintegrin loop tip is cysteine bridged and buried within the structure; compare the type II snake venom structures to ADAM10 and the type III snake venom structure in Figure 4 [33, 39]. This suggests that in ADAMs the DI-loop is not available for integrin binding as a free loop. The structures suggest also that the ADAM-disintegrin domain may be larger than was originally thought, and that the extension is covering the tip of the “disintegrin loop” (Figure 4). The available structural data suggests that the ADAM-integrin interaction is mechanistically distinct from type II SVMP disintegrin-integrin binding.

21

Figure 3. Suggested RGD-dependent binding of echistatin to a closed form of αvβ3 integrin. The tip of the echistatin disintegrin loop projects into the binding site shared by both integrin subunits, and the C-terminal residues of the echistatin increase the binding surface [51]. Integrin subunits are separated by a groove in which the RGD binding site is located. The arginine and glycine binding sites are located in the αv subunit on the left. The aspartate biding pocket in the β3 subunit is buried deep in the intermolecular groove on the right [51]. The figure was made with the Accelrys DS visualizer based on the structural coordinates of αvβ3, 1L5G; echistatin, 1RO3 retrieved from PDB and accommodated to show the suggested echistatin binding in [51].

Figure 4. Disintegrin domain structures. In all the structures the disintegrin loop or region corresponding to it is pointing downwards. A-B The disintegrins derived from type P-II venoms Trimestatin (A) and Echistatin (B) contain freely accessible disintegrin loop tips. C-D The disintegrin loop tips in ADAM10 (C) and type P-III VAP1 (D) disintegrins are covalently bound and buried within an extension of the disintegrin domain. Only the side chains of cysteines and residues at the disintegrin loop tip are shown in Figure. Green balls represent the sites of bound calcium. The Figure was made with the Accelrys DS visualizer based on the structural coordinates of A Trimestatin, 1J2L; B Echistatin 1RO3; C ADAM10, 2AO7; D VAP1, 2ERO retrieved from PDB.

22

Although they lack the RGD integrin-binding motif and the DI-loop, many full length ADAMs and recombinantly produced ADAM-domains have been shown to bind integrins (Table 2). In many cases ADAM-integrin binding has been shown to mediate cell adhesion and ADAMs have been shown capable of activating integrin mediated signaling as well as of inhibiting integrins in cis [6, 7, 9, 21, 55-58]. So, how do the ADAMs bind the integrins? Structural information that would reveal the ADAM-integrin binding mechanism is not available yet, but studies have suggested that amino acids on both strands of the region corresponding to the SVMP-like disintegrin loop regulate integrin binding [6, 21]. Also, an elegant study using a systematic charge-to-alanine scan of the disintegrin domain of ADAM28 showed that several residues, which are critical for α4β1 integrin binding are located outside the “disintegrin loop” [59]. Figure 5 shows the residues that were found critical for integrin binding. The critical residues located on the outer surface of the arched disintegrin domain likely mediate the interaction, and the critical residues located inside the disintegrin domain likely disrupt the folding of the domain [59, 60]. Also, the amino acids in the first half of the disintegrin loop have been suggested to be important for the binding specificity of ADAM15 to the integrins αvβ3 [61, 62]. Altogether this suggests that ADAM-integrin binding is mediated and that the binding specificity is imparted by several residues present on the surface of the disintegrin domain.

Figure 5. The integrin binding surface of the ADAM28 disintegrin domain. A VAP1 based unoptimized model of the ADAM28 disintegrin domain structure showing the locations of residues in red [59] or green [60] that were found important for integrin binding. The calcium in the structure is shown in cyan. The suggested disintegrin extension is at the very bottom in the structure. The ADAM28 homology model was treaded with the Bodil software [63] based on the structural coordinates of VAP1, 2ERO and the DS visualizer was used to decorate the model.

In most reported studies integrin activation either by Mn2+ or antibodies is required for ADAM-integrin binding [6]. The activated integrins have been suggested to exist in an extended conformation in which the binding site between the α- and β-subunits opens up from that shown in Figure 3 [64]. The RGD dependent type II SVMPs and cyclic RGD peptides on the other hand have been suggested to bind integrins in an

23

inactive state, which is in line with their role in integrin inhibition [51]. The requirement for integrin activation suggests that at least some ADAMs only bind integrins, which are in an extended open conformation.

Figure 6. VAP1 and αvβ3 integrin. VAP1 MP-DI-ACR domain structure size comparison to a kinked αvβ3 integrin. The VAP1 disintegrin domain is shown in red, the integrin αv subunit in yellow, the β3 subunit in blue, and the integrin ligand binding site is facing the VAP1. The Figure was created with the Accelrys DS visualizer based on the structural coordinates of VAP1, 1ERO and αvβ3, 1U8C retrieved from PDB.

ADAMs have shown to inhibit integrins cell autonomously presumably by binding integrins in cis [7, 9, 57, 58, 65]. Since ADAMs are much smaller proteins than integrins, the integrins must either be tilted along the membrane or they must be in a bent conformation to bind the ADAM DI-ACR domains on the same membrane; compare the structures in Figure 6, which shows the VAP1 structure corresponding to ADAM ectodomain lacking the pro- and EGF-like domains and bent integrin αvβ3 structure. Integrins are thought to be inactive when in bent conformation and straightening has been suggested to be prerequisite for binding and signaling [64, 66]. Most ADAM-integrin interactions have been reported to require integrin activation, which argues against the notion that ADAMs bind to inactive integrins in cis. However, ADAM2 coated beads bind better to integrins, which are presumably in an intermediate or non-activated state, as indicated by reduced binding to integrins in PMA or Mn2+ activated cells [67, 68]. Also, ADAM12 supports integrin mediated cell binding without integrin activation [55]. Furthermore, ADAMs 12 and 15 have been shown to bind a different state integrins compared to ECM molecules as suggested by different divalent cation integrin activation preferences [69, 70]. This suggests that at least some ADAMs may be able to bind the presumably bent, inactive integrins. It also raises the questions if cis-integrin-binding ADAMs can conceal the integrins from other ligands and/or whether ADAMs can also restrain integrins in a signaling inactive conformation. Alternatively, the cis-inhibition of integrins may involve ADAM-induces cell signaling, which would regulate integrin activation state in an inside-out manner. ADAM-

24

mediated integrin blocking in cis may be physiologically important e.g. during cell differentiation when cells down-regulate integrin-mediated growth and in the regulation of cell migration (section 2.2.4.).

Very recently ADAMs 22 and 23 have been shown to interact with the soluble LGI1 protein by their disintegrin domains [71]. Not much is known about the binding mechanism, but LGI1 binds the ADAMs with its C-terminal domain, which has been predicted to contain seven Epitempin (EPTP) repeats possibly forming a β-propeller domain found also e.g. in integrins and semaphorins [64, 72, 73]. The LGI1 binding to ADAM22 was shown to be abolished by disintegrin domain mutation suggesting that the LGI1 interaction may compete with integrin binding and may hence regulate the cell adhesion or integrin signaling.

Table 2. ADAM interactions with integrins.

ADAM Interaction References ADAM1 α9β1(rD) [74] ADAM2 α4β1(rD), α6β1(rD,DA), α9β1(rD) [74-79] ADAM3 α4β1(rD), α6β1(rD), α9β1(rD) [74, 78, 80] ADAM7 α4β1(D), α4β7(D), α9β1(D) [60] ADAM8 α9β1(rD) [81] ADAM9 α1β1(rD), α2β1(E), α3β1(rD), α6β1(rD,E), α6β4(E), α9β1(rD),

αvβ1(rD), αvβ5(rD, E) [56, 74, 82-85]

ADAM11 αvβ3(rD), α9(β1) (rD), α6(β1) (rD) [86] ADAM12 α2(β1)(F), α3(β1)(F), α4β1(F), α5(β1)(F), α6β1(F), α7β1(DA),

α9β1(rD, F), α?β3(F) [7, 58, 69, 70, 74, 87, 88]

ADAM13 α?β1 [89] ADAM15 α2β1(rD), α4β1(rD), α5β1(E), αvβ3(rD,E), α9β1(rD),

αIIbβ3(rD) [61, 62, 70, 74, 90-93]

ADAM17 α5β1(F) [58, 94] ADAM19 α4β1(F), α5β1(F) [58] ADAM22 αvβ3(rD), α9(β1) (rD), α6(β1) (rD) [86] ADAM23 αvβ3(rD), α9(β1) (rD), α6(β1) (rD) [74, 86, 95] ADAM28 α4β1(D), α4β7(D) α9β1(D) [59, 60, 96] ADAM33 α4β1(F,D), α5β1(F), α9β1(D) [58, 60] The integrin subunits in parentheses are deduced from the expression profile in the used cell lines and “?” indicates that the subunit was not reported. r, bacterial/yeast recombinant (other expressed in insect or mammalian cells), D, only DI; DA, DI and ACR; DAE, DI-EGF; MDC, MP-ACR; E, whole ectodomain, F, the full length ADAM were used in study. Integrin grouping [64]; RGD binding integrins in bold, laminin binding integrins underlined, collagen receptors with I/A domains in italics.

2.1.4. The ADAM cysteine-rich domain (ACR)

The ADAM cysteine-rich domain has been suggested to mediate cell adhesion and/or play an accessory or regulatory role in substrate cleavage (Table 3) and [21, 97, 98]. The ACR was named after its characteristic cysteine content and spacing that is highly conserved in ADAMs and in type III SVMPs [33, 54]. The conserved cysteine bridging is an essential part of DI and ACR structures, as suggested by the ADAM10 and VAP1 structures, which are the only ACR structures obtained so far [33, 39]. ADAM8, -10, and -17 are the only ADAMs that deviate in their cysteine spacing from the conserved ACR domain spacing and thus their ACRs may be structurally divergent from the rest

25

of the ADAMs. The ACR in VAP1 in turn is highly similar to all ADAMs excluding the above mentioned deviants; see the sequence alignment in [33]. In ADAMs 10 and 17 the cysteine spacing diverges from other ADAMs right after the cysteine bridged extension of the disintegrin domain discussed in section 2.1.3. and shown in Figure 4. Furthermore, the DI-extension in ADAM10 adopts a similar fold to that of the one in 7 VAP1, while the rest of the ACR region adopts a differing folding compared to VAP1 [33, 39]. The conservation of the sequence and the structure of the DI and putative DI-extension suggest that the DI-extension may be functionally associated with the DI-domain instead of being part of the ACR domain.

In ADAM10 and VAP1 the ACR domain forms an extended structure with a bulged head or hand. The VAP1 DI-ACR forms a C-shaped structure under the metalloprotease domain (Figure 7). The hand in VAP1 forms a large potential protein interaction surface, which aligns with the metalloprotease active site poised for substrate recognition [33]. Part of the hand-region shows high sequence variation between the ADAMs and is hence called the highly variable region (HVR) [33]. The ADAM10 ACR hand region has been implicated in substrate binding [39]. Altogether, the structures and sequence comparison suggest that in ADAMS the ACR forms a bulge-headed curved domain under the metalloprotease domain with the potential binding interface aligned with the metalloprotease active site (Figure 7).

Table 3. ADAM-ACR domain interactions

ADAM interaction partners references ADAM10 Eph A3* [39] ADAM10 ephrin A1, A2, A5* [39] ADAM8 FLRG [99] ADAM12 syndecans-1, 2, 4, IGFBP-3, -5, FLRG, follistatin [43, 99-102] ADAM13 fibronectin and laminin [6, 89] The interaction is induced upon structural changes

The ACRs of ADAM12 and 13 are implicated in cell adhesion [89, 91]. The

ADAM12-ACR has been shown to bind the cellular proteoglycans of the syndecan family and to support cell attachment through syndecan-4 in solid phase assays [100]. Cell binding to ADAM12-ACR was shown to induce cell spreading dependent on β1 integrin [101]. The molecular mechanisms of the ADAM12-ACR interaction with syndecan and the activation of β1 integrin are not clear, but the authors suggested that ADAM12-ACR acts as a binding partner for both the β1 integrin and the syndecans [100]. Interestingly, the closely related ADAM13 DI-ACR domain has been shown to mediate β1-integrin-dependent cell adhesion, which can be inhibited by an ACR recognizing antibody [89]. ADAM13 was also demonstrated to bind the heparin binding domain II of fibronectin [89]. Provocatively, in many ADAMs the ACR contains putative integrin binding tripeptides (RGD, KGD, and VGD). However, their role in integrin binding has not been reported. This suggests that at least some ADAMs may interact with integrins with the ACR and that the ACR may also support binding to other adhesion mediating proteins including syndecans and fibronectin.

26

Figure 7. C-shaped MP-DI-ACR structure of VAP1. The structural data suggest that ADAMs form a C-shaped molecule in which the metalloprotease active site is located on the same side as the highly variable region (HVR) of the ACR domain, presumably mediating substrate recognition. The figure was made with the Accelrys DS visualizer based on the structural coordinates of VAP1, 1ERO.

The ACR may target the proteolytic activity of ADAMs. ADAM12S and ADAM13 are known to bind laminin and laminin and fibronectin, respectively [89, 103]. Also, both have been shown to cleave fibronectin in vitro [44, 104]. Furthermore, overexpression of a chimeric ADAM with the ADAM10 Pro-MP part fused with the ADAM13 DI-CT was shown to phenocopy the overexpression of ADAM13 indicating function and presumably substrate transfer via the ACR domain [98]. ACR guides the ADAM-interaction with the soluble proteins (Table 3). In the case of IGFBPs, ADAMs have been reported to cleave the interaction partner and thus the ACR domain may target proteolysis of the ADAM-soluble substrates [43, 105]. It remains to be seen if ADAMs also cleave follistatin and FLRG. Altogether this suggests that the ACR mediates ADAM binding to the ECM and/or targets ADAM-mediated proteolysis of the ECM components and/or soluble substrates.

The contribution of the ACR domain to ectodomain shedding has also been demonstrated [39]. A negatively charged cavity on the surface of the ADAM10 ACR hand region was shown essential for ADAM10-mediated ephrin A5 shedding [39]. Experiments with mutants showed that the cavity is required for the binding of ADAM10 to the EphA3/ephrin A5 complex, a prerequisite for cleavage. This observation strongly supports the idea that the ACR domain is involved in substrate recognition. Also, the location of the acidic pocket corresponds to that of the suggested HVR region in the VAP1 structure supporting the idea that ADAM substrate selectivity

27

may be partially imparted by the ACR domain [33, 39]. This is the most convincing evidence that the ACR domain plays a role in substrate selection.

A domain swapping study suggests that the ACR may contribute to the selection of some but not all of the ADAM substrates. The use of a chimeric ADAM17 containing the ADAM10 ACR-TM part indicated that ADAM17-mediated TNF-α and p75TNFR shedding is not dependent on ADAM17 ACR, but that the shedding of IL-1R-II requires the presence of ADAM17 ACR [97]. Note; the ACR was referred to as EGF in the report [97]. On the other hand a chimeric protein consisting of the ADAM10 metalloprotease domain fused with the ADAM17 DI-TM did not cleave any of the tested substrates supporting the importance of the MP in substrate selectivity. This suggests that the ADAM17 metalloprotease domain is sufficient for the recognition of some of the substrates. This is in line with the high variability seen in the ADAM17 recombinant metalloprotease domain in vitro cleavage efficacy towards peptides corresponding to the physiological cellular substrate cleavage sites [32].

Proteolytic processing of the ACR domain may regulate ADAM activity. The autocatalytic cleavage of ADAM19 at the site located in its ACR region has been reported [106]. The cleavage site is located in the ADAM-HVR and in the VAP1 the amino acids corresponding to cleavage site would be in a protruding loop. The processing was reported necessary for ADAM19 proteolytic activity, which suggests that the ADAM19 ACR may block metalloprotease activity unless cleaved. On the other hand, the cleavage site is located in a possible ACR substrate recognition region, and the processing may also alter substrate recognition. The ACR cleavage dependent regulation of MP-activity may be specific to ADAM19, since it has not been reported to occur in other ADAMs.

Most of the membrane bound ADAM-substrates are cleaved at juxtamembrane sites, which implies that during a catalytic reaction the metalloprotease domain is very close to the membrane [36]. This suggests that the ACR promotes substrate cleavage/recognition by binding to the substrate through a region further away from the membrane than the metalloprotease domain. Indeed this seems to be the case with ADAM10-mediated ephrin A5 shedding in which the ADAM10 ACR binds to the EphA3/ephrinA5 complex located in a apposing membrane. [39]. However, in most cases of ectodomain shedding the ADAM and its substrate are thought to be in the same membrane. The restriction of the relative ACR and MP binding locations suggests that for the ACR to augment cleavage, the substrate and the ADAM must be along the membrane. This also suggests that if the ACR domain binding locks the ADAM into a straight-up position, instead of enhancing cleavage, it may in fact inhibit shedding. However, this applies only if the MP-ACR region forms a rigid structure. Alternatively, the MP-ACR region may adopt a different conformation compared to the VAP1 structure when cleaving the substrate in cis.

In conclusion the ACR is involved in the regulation of the ADAM catalytic activity by augmenting substrate recognition as well as possibly regulating the relative position of the ADAM to the membrane. Furthermore, in some ADAMs the ACR domain may function as a cell adhesion domain directly involved in integrin binding or as a component of a larger adhesion complex involving integrins, syndecans, and/or ECM molecules.

28

2.1.5. The EGF-like domain, membrane proximal motif and transmembrane region

Almost all ADAMs contain an EGF-like domain in their ectodomain. A vast number of different cell surface proteins including integrins and several ADAM substrates also contain an EGF-like domain/s. The functional significance of the ADAM EGF-like domain is not known. It may function as a linker between the MP-DI-ACR domain and the cell membrane. The ADAM EGF-like domain may also mediate lateral protein interactions. Curiously, ADAMs 10 and 17, which are the only ADAMs lacking an EGF-like domain are the most effective sheddases (section 2.2.1.-3.). This suggests that the EGF-like domain may hinder ectodomain shedding.

Most ADAMs contain a conserved juxtamembrane sequence motif in their ectodomains. The motif is conserved in most human and mouse ADAMs (Figure 8) and it is also present in species ranging from C. elegans to humans. Only ADAMs 7, 8, 10, 15, 17, and 28 in humans and rodents lack the motif. In ADAMs 11, 22, and 23 the motif is less conserved but still similar. There are no reports on the functional significance of the motif, but it may be important for protein interactions with membrane proteins, or as the motif sequence is rich in glycines and other amino acids, with small side chains, it may provide a flexible stalk for the ectodomain.

Figure 8. The consensus sequence of the membrane proximal motif of ADAMs. Most ADAMs contain a relatively well conserved juxtamembrane sequence motif in their ectodomain. The pictogram showing the consensus motif conservation is from the aligned human and mouse ADAMs 1-6, 9, 11-12, 18-26, 28-30, and 32-40. The size of a letter in the pictogram is relative to the conservation level of the amino acid.

ADAMs are type I single membrane traversing proteins. The presumed length and sequence of the transmembrane helix vary greatly between the ADAMs. However, some ADAMs contain conserved amino acids in particular locations in their transmembrane domain e.g. several ADAMs contain a proline in the very center of the putative transmembrane helix. Also cysteines, methionines, and arginines or clusters of large hydrophobic residues are present in a similar place in many ADAMs (not shown). Furthermore, in some ADAMs the whole transmembrane domain is strikingly conserved throughout evolution as demonstrated by the alignment of ADAM10 transmembrane regions from 22 species ranging from C. elegans to primates in Figure 9. Also, the juxtamembrane cytoplasmic region of many ADAMs contains conserved cysteine residues available for potential covalent modifications. The high level of conservation suggests that the transmembrane region may have a role in ADAM-regulation. There are no structures available on the ADAM EGF-like to TM region, but some studies have revealed important information on how this region may regulate ADAM-mediated shedding.

29

Figure 9. The transmembrane region of ADAM10 from 22 species. Some amino acids in the predicted transmembrane domain (amino acids 3-25) are strictly conserved in animals and there are only three varying amino acid in vertebrates in transmembrane region.

An Important part in the regulation of ADAM-mediated ectodomain shedding is the control of the availability of substrate [21, 36]. The sorting of the ADAM and the substrate into the same membrane domain promotes shedding. The opposite results if enzyme and substrate are restricted to separate membrane domains. Membrane traversing, membrane proximal and cytosolic regions have been implicated in the regulation of protein sorting to subcellular compartments or membrane microdomains. The high level of conservation in the transmembrane part of ADAMs suggests that it may regulate membrane localization or cellular sorting. Indeed, the transmembrane and cytosolic parts of ADAM12 have been shown to contain a trans-Golgi retention signal, which regulates the activity of the enzyme [107]. Also, the transmembrane region of ADAM19 has been reported sufficient and necessary for constitutive targeting to lipid rafts derived from sucrose gradient fractioning from cells [108]. Also NRGβ1, an ADAM19 substrate, was found in lipid rafts, and NRGβ1 shedding was associated with the localization of ADAM19 to the rafts [108]. Interestingly, the constitutive processing of NRGβ may occur in the Golgi-compartment [109, 110], which suggests that the targeting to the heavy lipid fraction for constitutive shedding may take place intracellularly. Lipid rafts thus possibly act as shedding compartments for increase the availability of at least NRGβ1 for ADAM19.

Further support for the association of lipid microdomains in the regulation of shedding has been gathered in cellular cholesterol-depletion experiments. ADAM17, the other reported NRGβ1 sheddase, is not constitutively present in lipid rafts, which suggests that it gets sorted to different membrane domains with NRGβ1 [111-113]. ADAM17 mediated NRGα/β shedding is not constitutive, and requires activation by e.g. PMA [114]. Methyl-β-cyclodextrin (mβCD, a cholesterol depleting agent)

30

treatment has been shown to activate ADAM17 mediated shedding of collagen XVII and IL-6R [111, 115]. mβCD treatment has been suggested to disrupt lipid rafts and thus increase the availability of ADAM17 substrates [111]. The regulation of NRGα/β shedding by ADAM17 may also involve the translocation of ADAM17 or NRGα/β to or from the rafts thus enabling colocalization.

In some studies, most of the mature and thus presumably active ADAM17 has been reported to localize to lipid raft cell fractions and a fraction, which is bound to the cytoskeleton [116, 117]. Also, the ADAM17 substrates TNFα, p75TNFR, and p55TNFR partially localize to lipid fractions of similar density as ADAM17 was found in. PMA activation increased the colocalization of mature ADAM17 and its substrates in the rafts. Authors suggested that most of the mature/active ADAM17 is sequestered to lipid rafts and that cleavage takes place in the rafts [116]. The authors suggested also that the localization of ADAM17 to the lipid rafts is the rate limiting step in ADAM17 mediated shedding and that treatments known to activate shedding would increase the amount of available substrates in the rafts [116]. This is in contrast with above discussed non-raft localization of ADAM17. The discrepancy between the ADAM17 lipid raft localization studies may depend on raft isolation methods and may thus not actually be in conflict. The conclusion that can be drawn is that ADAM17 and its substrates are restricted to different membrane microdomains until shedding signals cause an increase in their colocalization. This may be a general regulatory mechanism of ADAM-mediated shedding.

The involvement of tetraspanin-enriched microdomains (TEMs) in the regulation of ADAM functions has also been suggested. TEMs are distinct membrane microdomains from lipid rafts and consist of clusters of proteins belonging to the tetraspanin family [118]. GPCR activation has been shown to induce the association of ADAM10 and its substrate pro-HB-EGF with CD9 containing TEMs [119]. GPCR activation also induces the ADAM10 mediated shedding of pro-HB-EGF [119]. This suggests that that HB-EGF shedding may be enhanced by the colocalization of ADAM10 and HB-EGF in the TEMs [119]. TEM association has also been shown for the ADAM substrates CD44, MHC class I receptor, TGF-α, and amphiregulin [120-123]. Further supporting the TEMs role as microdomains for ADAM10-mediated shedding, the GPCR-complex, GPR56, G-proteins Gαq, Gα11, and Gβ, proteins, which are suggested to be involved in ADAM10 activation, also show association with TEMs [120, 124, 125]. Intriguingly, the TEM association of the ADAM substrates HB-EGF, TGF-α, and amphiregulin has been reported to protect them from PMA induced shedding [120, 122, 123]. This is consistent with the idea that G-protein activation induces shedding in TEMs since PMA induction has been associated with the general desensitization of GPCR signaling, and with the internalization of GPR56 [124]. Furthermore, this suggests that ADAM17, the principal PMA inducible sheddase, is not localized in the TEMs and that the shedding in the TEMs is mediated by ADAM10 or an other TEM associated ADAM [4, 120, 126]. Altogether, this implies that TEMs function as scaffolds for concentrating ADAMs, their substrates and shedding activation associated signaling proteins.

Palmitoylation of cytosolic cysteines in tetraspanins has been shown crucial for TEM formation, and cholesterol has been indicated in tetraspanin web formation [118]. Also covalent cysteine modifications have been shown to be involved in the regulation of protein association with lipid rafts [127]. The palmitoylation of the ADAM10 substrate TGFα has been reported [128]. Interestingly, many ADAMs contain one or

31

more conserved cysteine residues in their cytosolic tails close to the transmembrane domain (Figure 9) or in conserved positions in more distal parts of the cytosolic tail. However, no evidence of modifications to cysteine residues in ADAMs has been published.

In conclusion, the regulation of sorting and the co-localization of ADAMs and substrates in membrane microdomains plays a role in the shedding activation. It has been shown that an ADAM and its substrate can colocalize constitutively or that ADAM-mediated shedding is activated by the regulated protein localization to membrane microdomains. Lipid and TEM microdomains have been connected to the regulation of ADAM-mediated shedding.

2.1.6. The ADAM cytosolic tail

The cytosolic tail is the most variable part of ADAM proteins showing large variation in sequence and size. On the other hand, the ADAM cytosolic tails have been reported to be under positive selection pressure in evolution, which points to functional importance and the conservation of functions [129]. Phosphorylation dependent and independent protein interactions with the cytosolic tails have been shown to regulate ADAM maturation, subcellular localization, inside-out metalloprotease activation, and outside-in signaling [21]. Several ADAMs contain related protein interaction motifs and/or other prominent features in their cytosolic tails. ADAMs are classified in the Table 4 according to tail size, amino acid composition, repetitive sequence, and protein interaction motifs.

Many ADAM tails contain sequence motifs for potential protein interactions of which the most common target domains are listed in Table 4. As many ADAM tails are rich in proline residues they contain potential SH3 and WW domain interaction motifs. Many SH3 domain proteins, reported to interact with ADAMs, are involved in intracellular signaling, sorting, and/or function as scaffolding proteins (section 2.3.). Many ADAM tails are also rich in putative phosphorylation motifs and phosphorylation has been shown to be an important ADAM regulatory mechanism (section 2.3.). Three ADAMs contain 14-3-3 interaction motifs and of these ADAM22 has been reported to interact with 14-3-3 proteins (section 2.3.1.). Four ADAMs contain a C-terminal consensus binding motif for PDZ interactions two of which have been characterized (section 2.3.1.). Furthermore, motifs rich in arginine and/or lysine are commonly seen in ADAM tails and may regulate sorting and activity. Only the ADAM22 RXR ER-retention signal has been characterized so far (section 2.3.1.). The ADAM cytosolic interactions will be discussed in more detail in section 2.3. along with the regulation of ADAM functions.

Four ADAM tails contain clear repetition in their amino acid sequence. ADAM29 contains ten repetitions of a nine-residue sequence, ADAM30 six nine-residue sequences, and ADAM32 five 13-residue repetitions. Furthermore, in ADAM3 a segment of 20 residues is repeated three times. In an α-helical conformation, the nine residue repetition would form an α-helix with every second repetition on the opposite side of the α-helix. Thus e.g. the cytosolic tail of ADAM30 would form α-helix containing alternating positive, negative, and hydrophilic patches on every side of the

32

helix (not shown). The functional significance of the repetitions is unclear; it remains to be seen if they mediate e.g. ADAM homo or hetero dimerization.

A particularly interesting feature of ADAM tails in respect to ADAM regulation is the large amount of variation arising from the alternative use of cytosolic tail encoding exons (Table 4). All ADAMs with a prominent number of interaction motifs in their cytosolic tails also show variation yielding from alternative splicing. This may indicate more subtle targeting and regulation or more variable signaling functions for these ADAMs.

Table 4. ADAM cytosolic tails.

cytosolic tail type and length ADAMs prominent amino acids

tiny (<20) 4, 11, 16¤, 20, 21, 23A, 26a/b, 34, 37 charged short (21-40) 1a, 2, 6, 18, 25, 36, 38, 39, 40 hydrophilic medium (41-75) 1b, 5, 7, 24a/b, 35¤ repetitive sequence medium and long*

3, 29, 30, 3214 pro, ser, and charged

charged medium (41-75) 10S pro/arg/lys rich charged long (>75) 17S,P arg/asp/glu/ ser/thr

rich hydrophilic long (>75) 8A,S, 9A,S,W,14, 12S,14, 13S¤, 15A,S,P,14,

19A,P,W,S,14, 28A, 33 proline-rich, charged

hydrophilic long (>75) 14¤, 22A,W,14,P A, alternative splicing regulated cytosolic tail; Consensus motifs: S, SH3 [130]; W, WW [131, 132]; P, PDZ [133]; 14, 14-3-3 [134, 135]; *bovine and monkey ADAM1 contain long proline-rich repetitive sequence tails. ¤Not a human or rodent ADAM.

33

2.2. ADAM-mediated cellular functions

2.2.1. ADAMs regulate growth factors, cytokines, and chemokine signaling

An important group of ADAM-metalloprotease substrates are the effector proteins, which are synthesized as membrane bound precursor proteins and become activated by ADAM-mediated ectodomain shedding. These include cytokines, chemokines, growth factors, and larger effector proteins (Table 5). For example all eight known ligands of EGFRs are regulated by ADAM-mediated processing [136]. ADAMs regulate ligands that activate members of the tyrosine kinase (growth factors), GPCR (chemokines), and TNFR (TNFα etc.) receptor families.

ADAMs not only regulate the effector proteins, but shedding also regulates the availability of several types of cellular receptors (Table 6). This directly modulates cellular responsiveness to various stimuli. Furthermore, in many cases the solubilized receptors modulate the cellular responses of their cognate ligands by either enhancing signaling as co-receptors (IL-6R) or by attenuating signaling as soluble decoy receptors (TNFR). ADAMs thus regulate the availability of ligands and their receptors as well as modulate their functions by changing their mode of action.

Some ADAMs, especially soluble ADAM-isoforms, have been shown to process substrates that are not attached to the cell membrane (Table 7). Known soluble substrates include IGFBPs -3 and -5, which inhibit the activity of insulin -like growth factors (IGF). ADAM-mediated processing disinhibits the IGFBPs and activates IGF-growth factor signaling. ADAMs have also been shown to interact with FLRG and follistatin (Table 7), soluble proteins that inhibit the TGF-β superfamily growth factors [99]. It is not known if ADAMs can also cleave and disinhibit TGF-β superfamily binding proteins. It remains to be seen how wide a role ADAMs play in the physiological regulation of soluble effector protein binding proteins.

The ADAM-mediated effector protein, effector protein inhibitor protein, and receptor ectodomain processing have been shown to regulate endocrine, paracrine, juxtacrine, and autocrine cellular signaling, which in turn activate a plethora of cellular responses including proliferation, apoptosis, differentiation and migration [4, 6, 21, 36, 137, 138]. These events are essential during development as well as in the regulation of physiological and metabolic processes in adult organisms. They also regulate inflammation and their misregulation can lead pathologies including cancer, heart and kidney diseases [139-141]. The regulation of protein effectors and their receptors by ADAMs affects cells and cell-communication so profoundly that the discussion of more than selected examples are out of scope of this thesis.

34

Table 5. Effector proteins shed by ADAMs

substrate ADAMs activation references chemokines and cytokines CX3CL-1/fractalkine

10C, 17R PMA [47, 142-144]

CXCL-16 10C, 17R PMA [47, 145, 146] TNFα 8P, 9P, 10C, 17R, 19P,C PMA, PV, LPS, NO, glutamate, OGD,

EGF, histamineact/inhib, ethanolinhib [38, 41, 46, 97, 116, 126, 147-158]

TRANCE/OPGL/ RANKL

10C, 17, 19P,C, 33P [35, 46, 159-162]

KL-1/SF/SCF/Kitl1

8P, 9P, 17R, 19C,P,I, 33P,C

PMA, PV [35, 41, 46, 163]

KL-2/ Kitl2 17C,R PMA [163] FasL 10R PV [164] growth factors amphiregulin 8C, 10C, 15R, 17R PMA, TPA, carbachol, LPA, GRP,

tobacco smoke, oxygen radicals, cannabinoids

[165-173]

betacellulin 8C, 10C,R, 12C, 17C, 19C PMA, ET-1, Ca2+, H2O2, APMA [126, 172-175] EGF 8C, 9C, 10C,R, 12C, 17C,

19C PMA, Ca2+ [126, 162, 173,

176] Epigen 17R PMA, PV, Ca2+ [177] epiregulin 10C, 17R PMA, TPA [126, 172, 173] HB-EGF 8C, 9R, 10C,R, 12R, 15R,

17R, 19C PMA, TPA, LTA, ang II, IL-8, bombesin, serotonin, phenylephrine, gag+ H. pylori, nardilysin, APMA, kainate, NMDA,

[119, 140, 167-169, 172-174, 178-189]

TGFα 10C, 15R, 17R TNFα, PMA, TPA, TFP, vanadate, sorbitol, anisomycin, ionophores

[126, 167-169, 172, 173, 190-192]

Type II NRGα (2/4a/c)

XR, 17R PMA, UV, TFP, vanadate, sorbitol, anisomycin, ionophores

[114, 191, 192]

Type II NRGβ (1/2/4/a/c)

19C, 17R PMA [46, 108, 109, 114, 187, 193]

other effector proteins Semaphorin 4D 17R PMA, collagen, thrombin [194] APP 8P,C, 9P, 10C,R, 17R, 19C,

33P,I PMA, PACAP and various other GPCR agonists that activate PLD, TFP, P2Y2R stimulation with UTP

[17, 35, 41, 192, 195-205]

APLP2 10, 17 PMA, EGF [206, 207] Prion/PrP 10C, 17R TPA, Carbachol [208-210] C, constitutive; R, regulated; P, peptide cleavage assay; K, knock-out or knockdown result; oe, overexpression; I, inhibits; PMA, phorbol myristate acid; PV, pervanadate; LTA, lipoteichoic acid; GRP gastrin-releasing peptide; TFP, trifluoroperazine (calmodulin inhibitor); OGD, oxygen-glucose deprivation; ang II, angiotensin II; ET-1, endothelin-1; APMA, p-aminophenylmercuric acetate; C5a, platelet activating factor; fMLP, N-formyl-methionyl-leucyl-phenylalanine; Calmodulin Inhibitors: (TFP, trifluoperazine; W7; calmidazolium); TPA, tetradecanoylphorbol myristate acetate; LTB4, leukotriene B4. *Likely the ADAM, but not ambiguously identified as the sheddase.

35

Table 6. Receptors regulated by ADAM-mediated shedding

Substrate ADAMs activation references Axl 10C,R, 17R PMA, Gas6 [211, 212] IL-1RII 8P, 17R PMA [41, 97] IL-6R 10R, 17R PMA, mβCD, IL-8, C5a,

LTB4, fMLP, PAF [115, 213, 214]

IL-15Rα 17R PMA [215] c-Kit 17R PMA [216] c-met 17R* PMA [212] M-CSFR 17C,R PMA, TPA, LPS [212, 217] low-affinity IgE receptor/CD23

8P,C, 10C,I,R, 15P, 28P, 33C

Ab, Ca2+ [34, 162]

LAG-3/CD223 10C, 17R PMA, TCR engagement [218] TNFR1/p55TNFR 8P, 17R PMA [97, 116] TNFR2/p75TNFR 9P, 17R PMA, TNFα, NO, ethanolinhib [17, 27, 97, 116,

152, 156, 157] TNFRSF8/CD30 10R,17R PMA, mβCD, Ab [112, 219, 220] TNFRSF5/CD40 17 [221] TNFRSF16/p75NTR 17R PMA, PV, NGF [222-225] EGFR2/ErbB2/HER2 10C,R PV [226, 227] EGFR4/ErbB4-JMa 17R PMA, PV [228] GH receptor 17R PMA [229, 230] FGF2(IIIb) 9C [176] NTRK1/TrkA 17R PMA, PV, CaM inhibitors [192, 231] glycoprotein V 17R PMA [232] RPTPκ 10R Cell density [233] PTP-LAR 17R EGF, PMA [234] EPCR 17C,R PMA [212, 235] TFR1/CD71 17C [236] SHPS-1/SIRPα 17R* PMA [212] SorLA-1 17R PMA [212, 237] MHC class I α-secretase like [125] LDLr 17R PMA [212] LRP1B 17* [238] PAR1 17R* PMA [239] C, constitutive; R, regulated; P, peptide cleavage assay; K, knock-out or knockdown result; oe, overexpression; I, inhibits; PMA, phorbol myristate acid; PV, pervanadate; LTA, lipoteichoic acid; GRP gastrin-releasing peptide; TFP, trifluoroperazine (calmodulin inhibitor); OGD, oxygen-glucose deprivation; ang II, angiotensin II; ET-1, endothelin-1; APMA, p-aminophenylmercuric acetate; C5a, platelet activating factor; fMLP, N-formyl-methionyl-leucyl-phenylalanine; Calmodulin Inhibitors: (TFP, trifluoperazine; W7; calmidazolium); TPA, tetradecanoylphorbol myristate acetate; LTB4, leukotriene B4. *Likely the ADAM, but not ambiguously identified as the sheddase

Knock-out studies in mice have identified ADAMs 10, 17, and 19 as the principal

physiological sheddases of EGF-like growth factors [4, 126, 177, 187]. The studies have suggested that the other ADAMs play less prominent roles in EGF-like growth factor shedding or that they carry out physiologically significant shedding only in certain tissues (section 2.4.). The importance of the ADAM-mediated shedding of several EGFR ligands is apparent during development in tissue development and organogenesis (section 2.4.). Shedding of EGFR ligands is also essential for tissue regeneration and for providing survival signals under normal tissue homeostasis e.g. in the nervous system (section 2.6.1.).

Several ADAMs have been associated with the excessive activation of EGFR-family signaling seen in pathologies. The misregulation or overexpression of various ADAMs

36

has been shown to lead to an abnormal shedding of EGF-like growth factors [4]. This has been shown to cause abnormal cell proliferation and migration involved in cancer progression and in the development of heart and kidney diseases [136, 141, 240]. In many cases cancers cells shed EGF-like growth factors and thus promote cell signaling in an autocrine manner [136]. In addition, abnormal EGF-like growth factor shedding by stromal cells has been suggested as an mechanism for cancer progression [241]. In many cases the GPCR activation by physiological stimuli (section 2.3.5.) has been suggested to be involved in the activation of shedding associated with cancer and diseases of the heart and kidneys [136, 141, 240]. On the other hand, ectodomain shedding is activated by many cell signals elicited by shed effector proteins, and thus ectodomain shedding may regulate its own activity (section 2.3.5.). The molecular mechanisms behind the regulation of pathological shedding of EGF-like growth factors and autocrine and paracrine signaling are not fully understood.

The chemokines and cytokines regulated by ADAMs are best known for their role in chemotactic cell migration and the control of inflammatory responses. In non-immune cells cytokines and chemokines induce complex responses, which vary from apoptosis to proliferation and migration. For example TNFα and FasL are pro-apoptotic for some cells and induce the proliferation of others [242, 243]. ADAMs 10, 17, and 19 are the principal physiological cytokine and chemokine sheddases, while other ADAMs play less prominent roles.

Table 7. Soluble ADAM substrates

substrate ADAMs Activation reference IGFBP-3 12, 28 colocalization [22, 43, 102,

244] IGFBP-5 9, 12 colocalization [43, 102, 105] VCC 17 - [245] Ebola virus GP 17 - [246] FLRG 8*, 12* - [99] Follistatin 12* - [99] *Interaction has been published without indication of cleavage.

2.2.2. ADAMs initiate the regulated intramembrane proteolysis pathway

ADAM-mediated ectodomain shedding has been indicated as the initial step in cellular signaling involving the release of the intracellular domain (ICD) of membrane proteins. ICD-signaling involves two sequential proteolytic steps. The first step, ADAM-mediated ectodomain shedding, regulates the availability of substrate for the second step, which is the intracellular domain releasing step mediated by intramembrane proteases [247]. Hence the name regulated intramembrane proteolysis (RIP) [248]. Ectodomain shedding regulates intramembrane proteolysis, since only proteins with small extracellular domains are cleaved efficiently by intramembrane proteinases [249].

The released ICDs elicit cellular responses. In some cases released kinase domains remain active without tethering restraints after RIP. Most commonly RIPed ICDs regulate gene expression via auxiliary proteins (Figure 10). RIP has relatively recently emerged as a common mechanism in the regulation of gene expression [250]. For a long time the RIP-mediated release of Notch and cadherin ICDs were the only known

37

examples of the phenomenon [248, 250]. Currently, a growing number of ADAM-substrates have been reported to elicit signaling after ectodomain shedding and intramembrane proteolysis and hence RIP mediated signaling has gained importance as a mechanism involved in the regulation of gene expression (Table 8). For example, the released ICDs of APP, CD44, neuregulin-1, and EGFR4 translocate to the nucleus and activate transcription, and the released ICD of LRP in turn inhibits transcription [248].

ADAMs 10 and 17 are the most prominent sheddases involved in RIP (Table 8). Most of the known ADAM10 and a significant fraction of ADAM17 substrates are targeted for intracellular proteolysis and reported to elicit intracellular signals. The regulation of gene expression via the RIP pathway is an especially common signaling mechanism for counter-receptor pairs and adhesion proteins (Table 8). The best known counter-receptor pairs that signal with released ICDs are the ADAM10 substrates of Notch family and their counter-receptors [251]. The engagement of the counter-receptor pair activates shedding of one or both parties, which in turn activates ICD based gene regulation in both receptor harboring cells. Notch signaling is best known for its role in cellular differentiation processes during several developmental stages e.g. in the regulation of the differentiation of neural progenitors to glial or neural cells [251]. Notch-Delta mediated differentiation involves the lateral inhibition of differentiation within a group of originally similar cells [40, 252-254]. The reciprocal Notch/ligand binding and subsequent RIP-signaling between initially similar cells amplifies the weak differences into a one-way Notch signaling in fully differentiated cells [40, 252-254]. Notch signaling has emerged as an important way of regulating gene expression, cell proliferation, and apoptosis also in mature cells e.g. T-cells and neural stem cells [251, 255, 256].

Figure 10. Regulated intramembrane proteolysis (RIP). ADAMs initiate RIP and the subsequent ICD mediated regulation of gene expression. The ADAM cleaves the transmembrane protein e.g. APP, which enables the translocation of the remaining TM-ICD part to the presenilin (PS1) intramembrane proteolysis complex. The intramembrane proteolysis (IP) event releases the intracellular domain which translocates to the nucleus and activates or suppresses gene expression together with co-regulatory proteins.

In addition to their ligand activated receptor signaling, the ADAM17 substrates TNFRs and EGFR4 as well as HB-EGF and neuregulins signal via their released ICDs

38

[257, 258]. The RIPed EGFR4-ICD has been shown to function both as an active tyrosine kinase and as a component of a transcription regulation complex [259, 260]. In neural precursor cells, the released EGFR4-ICD forms a complex with transcription regulatory proteins in a kinase dependent manner, translocates into the nucleus, and represses astrocyte differentiation associated genes [261]. Interestingly, this parallels Notch signaling. In neurons, neuregulin-1 is RIPed upon binding to its receptor complex EGFR4/EGFR2 or after membrane depolarization [262]. The released neuregulin-1-ICD represses the expression of pro-apoptotic genes and induces the expression of the post synaptic protein PSD-95 [258]. The RIP of neuregulin-1 thus promotes neural survival and regulates synapses (section 2.6.2.).

ADAM10 and ADAM17 regulate the release of the ICD of cadherins and MUC1, respectively. The regulation of β-catenin signaling by the RIP of cadherins and MUC1 is a modification to the theme of regulation of gene expression by the release of ICDs. The difference here is that the gene expression regulatory protein β-catenin is associated with cadherin and MUC1 cytosolic tails and upon RIP the ICDs and the β-catenin are released into the cytosol [263, 264]. The RIP of cadherin induces the release of its ICD and associated β-catenin, which increases the cytosolic pool of β-catenin. This enables the translocation of β-catenin to the nucleus and the activation of target genes [265, 266]. The RIP of MUC1 is thought to increase β-catenin signaling in a similar fashion [264]. Interestingly, the released N-cadherin-ICD targets CBP to degradation and subsequently down-regulates CREB mediated gene expression [267]. This indicates that the single RIP event can simultaneously activate some genes and repress others.

In conclusion, the present examples indicate that several RIPed ICDs regulate gene expression in a complex manner. The increasing number of identified RIPed proteins, which regulate gene expression by released ICDs in various cells suggests an essential role for RIP not only during development but also in adult organisms. Notably only a few ADAMs have been associated with the regulation of several different ICDs. Intriguingly, the ICDs released by e.g. ADAM10 can elicit opposite and/or parallel effects in the cells. This rises the question of how ADAM are regulated to achieve biologically sensible shedding?

39

Table 8. ADAMs substrates targeted to RIP pathway

substrate ADAMs activation references APP 8P,C, 9P, 10C,R, 17R, 19C,

33P,I See Table 2 [17, 35, 41, 192,

195-205] E-cadherin, 10R See Table 6 [263, 268, 269] N-cadherin 10R See Table 6 [263, 265, 266] VE-cadherin ? [263] Pcdhγ 10R See Table 6 [270] c-Kit 17R PMA [216] CD44 10R, 17R See Table 6 [271-274] DCC Zinc MP [275] Delta-like-1/Delta 9C, 10R, 12C, 17C LB, engagement [252-254, 276, 277] Dsg-2 10C, 17C [236] EphB2 10R Ca2+ [278] EGFR4/ErbB4-JMa 17R PMA, PV [228] GH receptor 17R PMA [229, 230, 279] HB-EGF 8C, 9R, 10C,R, 12R, 15R,

17R, 19C See Table 2 [119, 140, 167-169,

172-174, 179-189] IL-1RII 8P, 17R PMA [41, 97] IL-15Rα 17R PMA [215] CD23 8P,C, 10C,I,R, 15P, 28P, 33C Ab, Ca2+ [34, 162] Jagged 10R*, 17R* PMA [212, 253] LRP1B 17* [238] M-CSFR 17C,R PMA, TPA, LPS [212, 217] MUC1/CD227 17R PMA [264, 280] Type II NRGα XR, 17R See Table 2 [114, 191, 192] Type II NRGβ 19C, 17R PMA [46, 108, 109, 114,

187, 193] Notch 10R, 17R LB, PMA [40, 247, 281, 282] NgR 17R* PMA [223, 224] Serrate 10 [283] SorLA-1 17R PMA [212, 237] Sortilin/NTR3 10R* PMA [284] RPTPκ 10R Cell density [233] TNFR1/p55TNFR 8P, 17R PMA [97, 116] TNFR2/p75TNFR 9P, 17R See Table 3 [17, 27, 97, 116, 152,

156, 157] TNFRSF16/p75NTR 17R PMA, PV, NGF [222-225] TRANCE/OPGL/ RANKL

10C, 17, 19P,C, 33P [35, 46, 159-162]

Troy 17R* PMA [224] VCAM-1 8, 17R PMA [285-287] NgRH1 Zinc MP [288] *Likely the ADAM, but not ambiguously identified as the sheddase. LB, ligand binding;

2.2.3. ADAMs regulate adhesion molecules, ECM components, and extracellular enzymes

Many of the reported ADAM substrates mediate or regulate intercellular adhesion or cell adhesion to the ECM. These include ECM components, proteases, and cell adhesion molecules of several classes (Table 9). Like cytokine and growth factor mediated cell signaling, cell adhesion influences almost every cell in multicellular organism. The shedding of adhesion regulating proteins controls cell migration, sorting, survival, and

40

differentiation, which are essential events for tissue and organ formation and remodeling during development, and are equally important for the maintenance of tissue and organ homeostasis and morphology in adults. Furthermore, misregulated cell adhesion is a significant factor in the pathogenesis of cancer and kidney diseases. In the nervous systems cell adhesion is essential for establishing neural circuitry and it regulates synapse formation and function (section 2.6.2.). Due to widespread effects on cellular physiology, only a few simplified examples of ADAM-mediated adhesion regulation are discussed here to illustrate the principles of the role of ADAMs in adhesion regulation.

Several cell adhesion molecules function both as cellular adhesion proteins as well as mediators of cell adhesion once they are shed and released into the extracellular milieu. The solubilized ectodomains of adhesion proteins may also function as anti-adhesion proteins by blocking adhesion protein binding and/or by acting as effector proteins that elicit cellular signaling through bound cellular adhesion proteins [139]. ADAMs 8, 10, and 17 have been associated with the ectodomain shedding of various cellular adhesion molecules (Table 9). Due to its widest substrate selection ADAM10 is considered the most important adhesion protein sheddase. ADAM10 substrates are present e.g. in epithelial, endothelial, immune, and neuronal cells and are known to be involved in the regulation of tissue morphogenesis, cell migration, and axon guidance. Many ADAM8 and -17 substrates are important for platelet, blood, neuronal, and endothelial cell functions, which suggests that these ADAMs regulate leukocytes and wound healing.

ADAM-mediated shedding has been implicated in the regulation of leukocyte extravasation associated with inflammation and homing. Recruitment to tissues involves cell adhesion-induced rolling of leukocytes and polymorphonuclear cells along the endothelial cells on vessel walls [289]. The leukocytes adhere to the vessel walls with their PSGL-1 and/or CD44, which mediate binding to the P- and E-selectins present in proinflammatory cytokine activated endothelial cells [289]. The ectodomains of E-selectin and its ligands PSGL-1 and CD44 are shed by ADAMs, which attenuates leukocyte binding. Furthermore, the presence of soluble selectins in the blood stream inhibits leukocyte adhesion to endothelial cells. ADAMs thus regulate the sensitivity of leukocyte binding to selectins on endothelial cells [139].

The activated endothelial cells express the CX3CL1 and CXCL16 transmembrane chemokines which, in addition to promoting migration and chemotaxis as soluble factors, mediate cell adhesion of the extravasating cells when present on cell surface [139]. It has been suggested that ADAM-mediated shedding may be needed to release the leukocyte-chemokine adhesion as extravasation progresses [139]. Also, it has been hypothesized that the ADAM-mediated shedding of other cell adhesion molecules e.g. cadherins loosens the adhesion between the endothelial cells, which facilitates cells migration [139]. ADAMs may also be involved in the degradation of the basal membrane together with the MMPs since some ADAMs have been shown capable of ECM processing (Table 9).

41

Table 9. ECM components, cell adhesion molecules, and enzymes cleaved by ADAMs

substrate ADAMs activation reference ECM components fibronectin 12, 13 colocalization [44, 104] type IV collagen 10, 12, 15 colocalization [44, 290,

291] laminin 9 colocalization [85] gelatin 12 colocalization [44] adhesion proteins Nectin-1 XR TPA, SF, HGF [292] Nectin-4 17R PMA [293] E-cadherin 10R PMA, ionomycin, staurosporin [268, 269] N-cadherin 10R NMDA, Glutamate, KCl [265, 266] Pcdhγ 10R PMA, Glutamate, AMPA, KCl, ionomycin

(Ca2+), staurosporin [270]

L1 10R,C, 17R PMA, mβCD, Ca2+, sphingomyelinase [271, 294, 295]

CHL1 8C [296] NCAM140/180 8R, 10R17R pervanadate [297, 298] ALCAM/CD166 17C,R EGF [236] ICAM-1/CD54 17R PMA, APMA [299] tm-collagen XVII 9C, 10C, 17R PMA, mβCD [111, 300] PSGL-1/CD162 10C, XR# PAF, PMA [301-303] L-Selectin/CD62L 8P, 17R PMA, CaM inhibitors, DPA-NSAINDs [149, 157,

304, 305] GPIbα/CD42b-α 10R*, 17R* PMA, CCCP, W7, mitochondrial injury, aspirin [306-308] GPV 10R, 17R PMA, CRP, CCCP, W13, W7, thrombin, aspirin [232, 307,

308] GPVI 10R*, 17R* PMA, CCCP, W7 [307] CD44 10R, 17R PMA, Ca2+, TFP, EGF, engagement by HA or

Ab, Rac activation [271-274]

MUC1/CD227 17R PMA [280] ephrin A2 10R clustering by EphA3 [309] ephrin A5 10R engagement with EphA3 [39] enzymes ACE2 17R PMA [310] ADAM8/CD156 8CM autocatalysis [26, 34,

311] ADAM12 12M autocatalysis [312, 313] ADAM13 13M autocatalysis [89, 104] ADAM19 19MC autocatalysis [46, 106] ADAM28 28MC autocatalysis [25] BACE1 10R PMA [314] Carbonic anhydrase IX 17R PMA, pervanadate [315] mephrin-β 17R PMA [316] P-LAP/ocytocinase 9C, 12C [312] M, maturation; W13 and W7, CaM inhibitors; SF, Scatter factor; HGF, hepatocyte growth factor; CCCP, mitochondria uncoupling agent; * the in vitro peptide cleavage efficiency different between the ADAMs; #Claimed to be an ADAM substrate, however, no ADAM was identified.

The ADAM-mediated shedding of adhesion proteins has been suggested to promote

tumorigenesis and cancer progression, and the overexpression of ADAMs has been reported in several cancers [139]. Abnormal ADAM10 mediated shedding of E-cadherin disrupts intercellular adhesion and induces β-catenin signaling leading to the detachment of tumorigenic cells and increased cell proliferation and migration [268]. The increase in soluble β-catenin has been shown to activate the expression of genes

42

that support genes and the L1 adhesion protein gene [268, 317]. The ADAM10 and/or ADAM17 mediated shedding of CD44 and the L1 adhesion protein has been shown to activate tumor cell migration by activating motility promoting cell signaling in an autocrine manner [272, 274, 317]. Furthermore, when integrated into the ECM the shed CD44 and L1 ectodomains have been hypothesized to provide integrin attachement sites to support cell adhesion during migration. The increased levels of shed L1, CD44, and E-cadherin in serum or other body fluids often correlates with the onset and/or progression of cancer, which implies a correlation between increased ADAM-mediated shedding and cancer progression [139].

ADAMs have been suggested to promote cell migration by processing ECM components (Table 9). ECM processing by ADAMs 10, 13, and 15 has been suggested to be important for axon extension, cranial neural crest cell migration, and kidney mesangial cell migration, respectively [104, 290, 318]. The processing of fibronectin by ADAM13 is particularly interesting, since it presumably regulates cell migration during X. laevis development and points to a physiological importance for ADAM13 in mediating ECM component cleavage [104]. Although not much of the ADAM-mediated ECM processing is known, it may be important during tissue remodeling or in cancer metastasis. However, the identity of ADAMs hypothesized to be involved in cancer cell invasion is ambiguous.

2.2.4. ADAMs mediate cell adhesion and integrin-signaling through their DI and ACR domains

Several studies have demonstrated that cultured cells bind to and spread on recombinant ADAM-DI, -DI-ACR, or intact -ectodomains (Table 2). Binding has been shown to depend on specific integrins as indicated by the requirement of integrin expression and the abolishment of binding with integrin blocking antibodies (Table 2). Furthermore, the induction of focal contacts and cell spreading upon binding to recombinant ADAMs suggests that binding activates integrin-signaling. At least ADAMs 9, 12, 15, and 23 can induce integrin signaling [7, 9, 55, 56, 82, 87, 92, 95].

Integrin binding to ADAMs has been shown to elicit a different cellular response compared to binding of ECM components. This has been demonstrated e.g. in neuroblastoma cells in which the ADAM23 disintegrin domain was shown to induce microspike formation upon αvβ3 binding, while cells growing on fibronectin showed αvβ3 dependent formation of filopodia like protrusions [95].

Integrins are full-fledged signal transduction receptors that activate many signaling pathways and promote cell proliferation, survival, and motility [64]. ADAM12 has been shown to activate integrin-dependent cell spreading at different levels in cell type specific manner. The cell type specificity depends partially on the integrins present and partially on other ADAM12-binding proteins as demonstrated by the case of syndecan-4 dependent β1 activation [100, 101]. ADAM12-DI binds directly to various β1 and β3 integrins, and induces the activation of PI3-kinase and RhoA and cell spreading [9, 55, 87]. The levels of ADAM12-binding integrins α2, α3, α5, and α6, which all pair with β1, determine the strength of integrin signaling and cell spreading on ADAM12 [55]. On the other hand, the ADAM12-ACR domain promotes β1 integrin-dependent cell

43

adhesion, RhoA activation, cell spreading and stress fiber formation by activating PKCα through syndecan-4 binding [100, 101].

Soluble ADAMs may function as effector proteins that activate integrin signaling. Soluble ADAM9 has been shown to bind and activate integrin-signaling in osteoblasts [56]. The signaling activated by ADAM9 binding to αvβ5 integrin includes the activation of p38 MAPK and cPLA2, which induce the secretion of IL-6 cytokine. This suggests that soluble ADAMs may have a physiological role as effector proteins, which activate integrin-signaling [56]. Hepatic stellate cells have been shown to secrete a soluble ADAM9 isoform [85]. The metalloprotease activity of soluble ADAM9 was suggested to promote tumor cell invasion [85]. However, integrin-activation by soluble ADAM9 may also play a role in the promotion of cancer cell invasion [85].

ADAMs have also been reported to inhibit integrins when both are expressed in the same cell [57, 58]. The cis overexpression of ADAMs 12, 15, 17, 19, and 33 has been shown to inhibit integrin dependent cell migration on ECM components [57, 58]. Supporting the ADAM-integrin interaction in cis, ADAM12 and β1 integrin have been shown to reside in the same protein complex [9]. Also the cis integrin inhibition by ADAM15 has been shown to depend on an RGD sequence in the disintegrin domain suggesting that inhibition involves direct binding to integrins [57]. The molecular mechanism of ADAM-mediated cis integrin-inhibition remains elusive but ADAMs may lock integrins in to an inactive conformation (section 2.1.3).

Cell co-culture experiments indicate that ADAMs mediate cell adhesion. Cells that overexpress ADAM12 or -15 bind to α9β1 integrin expressing cells [70] and the binding of ADAM12 to α9β1 in trans has been shown crucial for myoblast fusion [7]. Recently, ADAM15 was shown to mediate T-cell adhesion to endothelial cells [8]. Despite the results obtained in cell culture experiments, the physiological importance of ADAM-mediated cell adhesion remains poorly understood. The most convincing evidence for a physiological ADAM-integrin interaction is the binding of sperm to egg, which has been shown to depend on one or more ADAM-integrin interactions [5, 6, 78]. This has been corroborated by infertility of the fertilization associated ADAMs (section 2.4.). None of the animals deficient of non-fertilization associated ADAMs show phenotypes that are clearly due to a deficiency in ADAM-integrin binding (section 2.4.). However, this may be because of redundancy in integrin-ADAM interactions.

2.2.5. ADAM-mediated intracellular signaling

ADAMs are thought to function as cell surface receptors or signaling scaffold proteins that can activate or regulate cell signaling [21]. This idea is based on the observation that several ADAMs contain proline-rich cytosolic tails (Table 4), which have been shown to interact with SH3-domain containing signaling proteins (Table 10). However, despite the number of demonstrated interactions with signaling molecules, only a few studies have reported the activation of a signal by ADAM cytosolic tails [319, 320].

ADAM12 has been shown to interact with Src kinase in C2C12 cells, and the overexpression of ADAM12 was reported to activate Src [319]. Co-precipitation of endogenous ADAM12 and active Src suggested a cellular association at physiological expression levels. However, the functional role of ADAM12 mediated Src activation in cells was not demonstrated. The authors suggested that Src signaling may contribute to

44

myogenic differentiation, since ADAM12 has been previously implicated in the process. The consequences of Src activation at the molecular level also remained obscure. It is possible that Src activation regulates the metalloprotease activity or subcellular localization of ADAM12. The phosphorylation of the cytosolic tail of ADAM12 by Src has been reported and the interaction of ADAM12 with Tks5/FISH, an interaction that is thought to affect the activity of ADAM12, is regulated by phosphorylation of Tks5/FISH by Src [321, 322].

ADAM15 has also been reported to interact with and to be phosphorylated by Src family members, and the phosphorylation has been shown to regulate ADAM15 cytosolic interactions [323]. However, information on the significance of the interactions with the Src family protein members in cells is lacking.

ADAM12 has been reported to also activate PI3K [320]. The ADAM12 interaction with the p85α subunit of PI3K was demonstrated in vitro and in vivo and overexpression of the ADAM12 was shown to lead to the activation of PI3K [320]. As PI3K and ADAM12 have been shown indispensable for myogenic differentiation, the authors suggested that ADAM12 mediated PI3K activation could play a role in the process. On the other hand the PX domain of the Tks5/FISH protein was reported to bind phosphoinositols [321] and thus the PI3K activation may regulate ADAM12 localization by regulating the binding of Tks5/FISH to the membrane.

In conclusion, the cytosolic interactions of ADAMs and signaling proteins are poorly understood. Nevertheless the interactions may regulate the ADAMs themselves or they may elicit intracellular signaling cascades, which regulate functions of other cellular components e.g. integrins.

Table 10. Intracellular kinases and phosphatases associated with ADAMs

interaction partner ADAMs putative function references Abl 12S, 15S - [322, 323] Calmodulin 10 C2+ dependent regulation [273] Erk1/2 MAPK 17 phosphorylation [231, 324] Fyn 15S - [323] Hck 15S,Y phosphorylation [323, 325, 326] JNK MAPK regulate shedding [324, 327, 328] Lck 10Y*, 15S,Y - [323, 325, 326] p38 MAPK regulate shedding [329] p85α 12S ADAM activates [320] PDK1 17 phosphorylation [330] PKC-δ 9 phosphorylation [182] [179] PKC-ε 12 phosphorylation [331] PTHP1 17P negative regulation [332] Src 9S, 12S, 15S,

17I ADAM12 activates [319, 322, 323,

325, 326, 330] X-Src 13S - [333] Yes 12S - [323] *preliminary result reported. Interacting domain type: Y, SH2; S, SH3; P, PDZ; 14, L, Lim; 14-3-3; Pr, proline-rich; I, indirect

45

2.3. Functional regulation of ADAMs

2.3.1. Subcellular sorting regulates ADAM activity

The cellular mechanisms that regulate ADAM activity are thought to involve the control of ADAM maturation and subcellular targeting [21]. ADAMs that mediate cell adhesion are present at the plasma membrane and ADAM-mediated shedding is thought to take place at or in a membrane compartment near the cell surface [21]. However, the majority of at least ADAMs 8, 9, 10, 12, 15, 17, and 28 are retained as precursor forms in a subcellular perinuclear compartment and ADAM22 is regulated by ER retention [17, 23, 25, 107, 202, 334-337]. Furthermore, ADAMs are not retained at the plasma membrane and there are no reports indicating the shedding of ADAM-ectodomains. Cytosolic protein interactions and the activation of various cellular signaling pathways have been shown to regulate subcellular localization and the activation of ADAM-mediated shedding. Table 11 lists the reported sorting, scaffolding, and adaptor protein interactions with ADAM cytosolic tails and Table 10 lists signaling proteins associated with ADAMs. The associated functions of the intracellular interaction partners and the subcellular localization data suggest that ADAMs are regulated by retention in the ER and/or in other intracellular compartment, and by cellular sorting to the plasma membrane, and/or other subcellular compartments.

2.3.1.1. ER-retention regulates at least ADAM22

Several ADAMs may be regulated by retaining them in the ER, since they contain putative arginine and lysine ER-retention motifs in their cytosolic tails; see Genbank for ADAM sequences and [338, 339] for the motifs. However, the functional significance of the ER-retention motifs has only been established for ADAM22. ADAM22 has been shown to contain a functional RXR ER-retention motif in its cytosolic tail, the availability of which regulates the release of ADAM22 from the ER [337]. In ADAM22 the 14-3-3 binding motifs flank the ER-retention signals and phosphorylation dependent binding of 14-3-3 proteins suppresses ER-retention [337, 340]. The ADAM22 release from ER has been shown to regulate cell adhesion and spreading, demonstrating a functional significance for ER-retention [337, 340]. In addition, cytosolic tail encoding exons are used alternatively yielding ADAM22 isoforms that lack the ER-retention motifs altogether [341]. This suggests regulation of ADAM22 ER-retention also through alternative splicing [341].

Phosphorylation and/or protein interactions that mask the ER-localization signals are thought to regulate the activity of the ER-retention signals [338, 339]. While ADAM22 is the only ADAM containing 14-3-3 binding motifs in close proximity to the ER-retention motifs, several ADAMs contain SH3-binding motifs next to the putative ER-retention motifs and thus binding of SH3-domain proteins may regulate ER-retention in these ADAMs. PDZ-domain interactions have also been implicated in the regulation of ER-retention [339]; four ADAMs contain a binding motif for PDZ interactions (Table 4). ADAM17 and ADAM22 have been reported to interact with the PDZ domain of SAP97 and PSD-95, respectively [71, 342]. ADAM17 colocalizes with SAP97 in an

46

early secretory pathway compartment suggesting that SAP97 may be involved in the regulation of ADAM17 sorting [342]. SAP97 has also been shown to regulate ADAM10 transport and activity in neurons [343].

Table 11. Cytoplasmic interactions with scaffolding, sorting, and miscellaneous proteins

interaction partner ADAMs putative function references Abi-2/ArgBP1 19Pr Abl binding adaptor protein [344] X-Abi-2 13* adaptor [333] α-actinin-1 12 cytoskeleton anchorage [345] α-actinin-2 12, 15 cytoskeleton anchorage [346] β-Cop 19* Golgi to ER transport [344] Calmodulin 10 Ca2+ dependent regulation [273] Endophilin A1 9S, (12S), 15S, (19S) endocytosis [347] EVE-1 9S, 10S, 12S, 15S,

17S scaffolding [348]

Tks5/FISH 12S, 15S, 19S protein sorting to podosomes [321, 349] FHL2 9**, 17L cytoskeleton anchorage [117, 350] Grb2/Ash 12S, 15S, 22* SH2 and SH3 domains containing

adaptor [322, 323, 351]

MAD2 (10H), 15H, 17H unknown function [323, 352] MAD2β 9H, 15H, 19H unknown function [323, 352] Nephrocystin 15S unknown function [353] X-Pacsin-2 13S, X-10* protein sorting at TGN and plasma

membrane [333]

Pacsin 3 9S, 10S, 12S, 15S, 19S

protein sorting at TGN and plasma membrane

[179, 347]

PSD-95/DLG4 22P sorting and scaffolding [71] SAP97/DLG1 10S, 17P sorting and scaffolding [342, 343] SNX9/SH3PX1 9S, 15S protein sorting at TGN and plasma

membrane [347]

SNX30/SH3PX3 15S protein sorting *** [353] 14-3-3β, -γ, -ε, -ζ, -η, and τ

2214 regulation of ER retention [337, 340, 354]

*preliminary result reported; **interaction claimed, not shown; ***Function suggested by relatedness to sorting nexins; Brackets indicate weak binding. Interacting domain type: Y, SH2; S, SH3; P, PDZ; 14, L, Lim; 14-3-3; Pr, proline-rich; H, Horma

2.3.1.2. The ADAM subcellular localization and metalloprotease activity of ADAMs is regulated by cytosolic interactions

The endocytosis and cellular sorting associated proteins SNX9, SNX30, Endophilin I, Pacsin 3, and SAP97 have been shown to interact with ADAMs through their SH3 domains (Table 11). The functional role in ADAM-regulation has been shown only for Pacsin 3 and SAP97 [179, 343]. Also, Tks5/FISH and EVE-1, which bind ADAMs with their SH3 domains, have been suggested to regulate the subcellular localization and activation of ADAMs. Interactions with a number of sorting proteins suggest that the regulation of ADAMs involves release and/or recycling to and from the putative intracellular ADAM-storage compartment, and subcellular targeting to function-associated membrane domains.

The transmembrane and cytosolic parts of ADAM12 have been associated in ADAM12 TGN-retention [107]. The retention of ADAM12 in the trans-Golgi network

47

(TGN) has been suggested based on the colocalization of retained ADAM12 with the TGN marker TGN38 [107]. Of the ADAM12 interaction partners, Pacsin 3 has been associated with protein sorting in the TGN and thus may be involved in the regulated release of ADAM12 from the TGN [355]. Pacsin 3 and ADAM12 have been shown to colocalize in intracellular vesicles and at the leading edge of the cells, suggesting that Pacsin 3 is involved in sorting ADAM12 to transport vesicles both in the intracellular compartment and at the plasma membrane [179]. Pacsin 3 has also been shown to interact with ADAMs 9, 10, 15, and 19 suggesting involvement in their regulation as well (Table 11). Overexpression of Pacsin 3 has been shown to lead to an increase in TPA-induced, but less so in GPCR activation-induced HB-EGF shedding in a SH3 domain dependent manner [179]. However, the knockdown of Pacsin 3 was shown to reduce both TPA and GPCR activation induced HB-EGF shedding [179]. The difference in the overexpression and knockdown results suggests that Pacsin 3 may regulate the activity of several ADAM-metalloproteases.

Tks5/FISH and EVE-1 have been implicated in the targeted translocation and simultaneous activation of ADAM-metalloproteases [321, 348, 349]. EVE-1 has been shown to colocalize with ADAM12 at the leading edge of the cell and Tks5/FISH has been shown to recruit ADAM12 to actin-rich specialized cellular structures called podosomes [321, 348]. Only the cellular colocalization of ADAM12 with Tks5/FISH and EVE-1 has been shown, however, since other ADAMs have also been shown to bind Tks5/FISH and EVE-1, the observed subcellular targeting of ADAM12 by these proteins may also apply to other ADAMs (Table 11). Tks5/FISH has been shown to mediate APP induced toxicity in a ADAM12 metalloprotease activity dependent manner suggesting that Tks5/FISH takes part in ADAM12 metalloprotease activation [349]. EVE-1 has been implicated in the regulation of the shedding of HB-EGF, TGF-α, amphiregulin, and epiregulin, which include also non-ADAM12 substrates and thus associate EVE-1 with the activation of also other ADAMs [348]. Altogether, this suggests that Tks5/FISH and EVE-1 may recruit ADAMs to and induce ADAM-mediated shedding in different subcellular domains.

The interaction of Tks5/FISH and ADAM12 has been shown to depend on tyrosine phosphorylation of the Tks5/FISH, which induces its translocation from the cytosol to the membrane. This suggests cell signaling dependent ADAM-activation without ADAM phosphorylation [321, 349].

Tks5/FISH and EVE-1 both bind ADAMs through their SH3 domain (Table 11). EVE-1 and Pacsin 3 interact and presumably compete in binding with the same proline motif in the cytosolic tail of ADAM12, whereas the Tks5/FISH binding motif has not been reported [179, 321, 348]. The knockdown of both Pacsin 3 and EVE-1 did not result in a significant difference in the shedding of HB-EGF compared to single knockdowns indicating that both may function in same regulatory pathway.

ADAM10 has been reported to interact with SAP97 and the interaction has been shown to regulate ADAM10 transport to dendritic spines and synapses [343]. The sorting of ADAM10 to synapses was shown to be induced by NMDA receptor activation and SAP97 was show necessary for the relocalization. Furthermore, relocalization of ADAM10 with SAP97 was shown to control ADAM10 mediated APP shedding, indicating a functional role for the SAP97 interaction in ADAM10 sorting and in the regulation of shedding in neurons [343].

48

ADAM10 has been reported to contain a basolateral sorting determinant in its cytosolic tail [269]. The authors were able to pinpoint the sorting determinant to a region containing a putative SH3 binding motif, and based on that suggested that an unidentified SH3 protein would mediate basolateral sorting of ADAM10 [269]. SAP97 or its non-neural counterpart may be the unidentified basolateral sorting protein, since the dendritic sorting in neurons corresponds in many cases to basolateral sorting in non-neural cells [356]. The ADAM10 basolateral sorting determinant was shown to target ADAM10 to adherens junctions in a epithelial-like cell monolayer [269]. Interestingly, the basolateral sorting of ADAM10 was shown necessary for E-cadherin shedding and cell migration, which suggests that the basolateral sorting signal regulates ADAM10 shedding activity also in motile cells [269].

The functional significance of the ADAM9 and ADAM15 interactions with SNX9 and the ADAM15 interaction with SNX30, which is closely related to SNX9, is not known. Intriguingly, SNX9 has been associated with the phosphorylation dependent release of GLUT4 from the intracellular compartment [357]. The SNX9 is located in the cytosolic compartment in non stimulated cells and upon insulin induced tyrosine phosphorylation translocates to the membrane in a SH3 domain dependent manner [357, 358]. SNX phosphorylation has been suggested to modulate the binding specificity of the SNX9-SH3 domain [358]. GLUT4, which is retained in perinuclear storage compartment, is released simultaneously with insulin induced SNX9 membrane translocation, and the microinjection of a SNX9 antibody was shown to reduce the recruitment of GLUT4 to the plasma membrane [357]. SNX9 is thus implicated in cell signaling dependent regulation of protein translocation from the intracellular compartment to the plasma membrane, which suggests that analogous to GLUT4 recruitment, SNX9 may also regulate the sorting of ADAM9 and ADAM15.

Of the ADAM cytosolic interaction partners, SNX9, Pacsin 3, and Endophilin-A1 have been associated with protein endocytosis [355]. Thus these proteins are candidates for regulators of ADAM endocytosis. However, although presumably important for ADAM-activity regulation, the endocytosis of ADAMs is poorly understood and no reports on the subject have been published.

2.3.1.3. ADAM interactions with PDZ domain proteins and the cytoskeleton regulate shedding

PDZ-domain proteins have been implicated in the sorting and stabilization of the membrane localization of their interaction partners [359]. The PDZ domain dependent interaction of ADAM17 and SAP97 has been reported [342]. Overexpression of SAP97 was shown to reduce the basal level of ADAM17 mediated shedding [342]. The authors speculated that the SAP97 interaction might regulate ADAM17 transport and/or intracellular retention to the early secretory pathway, which would result in reduced basal shedding [342].

ADAM17 has been shown to interact with the phosphotyrosine phosphatase PTPH1 PDZ domain [332]. Overexpression of PTPH1 was shown to downregulate ADAM17 activity phosphatase dependently. The authors reported that the PTPH1 phosphatase, even without the ADAM17 interacting PDZ domain, downregulates ADAM17 and that the reduced shedding activity could be a result of the lower levels of cellular ADAM17

49

[332]. On the other hand phosphorylation of the cytosolic tail of ADAM17 has been implicated in the activation of shedding activity, which suggests that the PTPH1 phosphatase activity may counter the phosphorylation dependent ADAM17 activation (section 2.3.4.).

ADAM22 has been shown to interact with the PDZ domain of PSD-95 [71]. Since PSD-95 has been implicated in synaptic sorting, and is related to SAP97, the association of PSD-95 with ADAM22 may regulate ADAM22 sorting analogously to SAP97 regulation of ADAM10. On the other hand, ADAM22 and PSD-95 were reported to be in a complex with the AMPA receptor and ADAM22 was suggested to be involved in the regulation of the AMPA receptor association with postsynaptic membranes [71]. This suggests that ADAM22 may serve as a membrane anchorage for PSD-95 and stabilize its location in post synaptic membranes.

The association of ADAM17 with the actin cytoskeleton has been suggested to regulate ADAM17 shedding activity [116, 117]. The four and half LIM domain 2 (FHL2) protein has been shown to mediate the interaction of a pool of ADAM17 with the intracellular and cell surface actin cytoskeleton. Interestingly, most of the FHL2 associated and actin bound ADAM17 was shown to be of mature form, but maturation was not necessary for actin association [117]. This suggests that the association with the actin cytoskeleton takes place later in secretion route compared to maturation. FHL2 knock-out cells showed increased surface localization of ADAM17, suggesting a larger pool of unbound ADAM17 in these cells. On the other hand, the PMA induced TNFR1 and TNFR2 shedding was reduced in FHL2 knock-out cells, which suggests that ADAM17 association with the actin cytoskeleton may increase at least the shedding of TNFR1 and -2 and that the association may be involved in the regulation of ADAM17 metalloprotease activity [117]. The mechanism of ADAM17 metalloprotease activity regulation by actin association remains to be shown, but it may involve the concomitant sorting of ADAM17 and its substrates to actin-rich membrane compartments [117].

2.3.2. Constitutive shedding is mediated by several ADAMs

ADAM-mediated shedding can be divided into constitutive and stimulated forms. In stimulated shedding cellular signaling or substrate engagement induces shedding (section 2.3.4.). Constitutive shedding takes place in cells spontaneously or it may be caused by a basal level of p38 activity [329]. Studies have indicated that constitutive shedding of a particular substrate is not mediated by one ADAM but several ADAMs contribute to the constitutive shedding of various substrates (Tables 5-8). In many cases ADAM overexpression has been shown to increase the level of unstimulated shedding. This is highly relevant in pathological conditions e.g. in cancer when ADAM expression is elevated beyond physiological levels [4, 139]. What should be emphasized here is that a slight increase in the expression levels of several ADAMs may have an effect similar to a high increase in the expression of a single ADAM.

50

2.3.3. Engagement induces ADAM-mediated shedding

Engagement of ephrin A2 and ephrin A5 with their receptor EphA3 has been shown to activate ADAM10 mediated cleavage of the bound ephrin [39, 309]. Interestingly, two different mechanisms, both based on the engagement of EphA3 with ephrin, regulate the shedding of ephrin A2 and ephrin A5. ADAM10 has been reported to be constitutively associated with ephrin A2 and EphA3 through its ACR domain [39]. In the case of ephrin A2, engagement of the ADAM10-ephrin A2 complex with EphA3 induces the cleavage of ephrin A2 [309]. It is not known how engagement activates ephrin A2 cleavage. In the case of ephrin A5, engagement of the ADAM10-EphA3 complex with ephrin A5 induces a conformational change in ephrin A5 uncovering the binding site for the ADAM10-ACR domain. The interaction of the ADAM10-ACR and ephrin A5 was shown necessary for cleavage to occur [39]. Noteworthy in these two mechanisms is that the former is in the cis and the latter in the trans configuration in cells. Furthermore, in both cases ADAM10 is constitutively associated with a protein involved in the engagement, which presumably poises ADAM10 for cleavage and enables a fast response to receptor engagement.

Engagement and shedding induced by mechanical stimulation are very interesting with respect to cellular events that involve rapid regulation of cell adhesion. Targeted cell migration and axon guidance require that the cell or axon growth cone interprets environmental cues and responds to them appropriately. Ephrins have been suggested to act as repellents of axon guidance and shedding mediated release of ephrins in response to engagement has been shown important for the detachment of axons from the encountered cells [309].

Engagement may be the activation mechanism also for Notch 1-4 and their counter receptor cleavage in analogy to Ephrin cleavage. This is suggested by the constitutive association of ADAMs with the Notch counter receptor Delta-like 1 and the cleavage activation upon the engagement of Notch with its counter receptors [254, 276]. While there is no knowledge of how engagement activates Notch and its counter receptor cleavage, the idea of activation by an engagement induced change in conformation is appealing, since Notch and its counter receptors do not posses enzymatic activity in their cytosolic tails, which could activate shedding.

2.3.4. Cell signaling regulates ADAM-mediated shedding

The induction of ADAM-mediated shedding by the activation of many cell signaling pathways has been demonstrated in various cellular systems [36]. Also, ADAMs have been shown to interact with kinases and phosphatases with their cytosolic tail (Table 10). The known physiological and non-physiological stimuli that have been shown to activate ADAM-mediated shedding include phorbol ester activation of PKCs, tyrosine kinase activation by growth factors, tyrosine phosphatase inhibition by synthetic compounds, activation of GPCRs by various compounds, elevation of intracellular Ca2+, independent GPCR activation, calmodulin (CaM) inhibitors, reactive oxygen species, glutamate, kainate, NMDA, nardilysin, staurosporin, engagement of substrates by antibodies, and cholesterol depleting agents (Tables 5-8).

51

The phosphorylation of the cytosolic tail of ADAMs 9, 17, and 22 has been associated with their maturation and/or translocation to the plasma membrane. This has been shown to regulate shedding or, in the case of ADAM22, cell adhesion [17, 182, 231, 337, 360]. Furthermore, phosphorylation has been shown to regulate cytosolic interactions of ADAMs 15 and 12 suggesting that phosphorylation is involved in the regulation of these ADAMs as well [322, 323].

The suggested cellular mechanisms which activate shedding after stimulation can be divided into five different types. A) intracellular signaling induces ADAM maturation and translocation from the intracellular compartment to the shedding site containing the substrate; B) signaling induces cytosolic protein interactions, which induce colocalization of ADAM and the substrate; C) intracellular signaling induces changes in membrane microdomains i.e. the release of the ADAM from the substrate deserted microdomain or the activation of the fusion of microdomains containing the ADAM and the substrate (section 2.1.6.); D) colocalization of ADAM and the substrate by extracellular domain interactions; E) intracellular signaling elicits inside-out signaling, which activates the ADAM through conformational changes and/or through the release of the pro-domain. In all suggested mechanisms activation may affect one or more of the components: ADAM, substrate, or other interacting proteins. Also, more than one mechanism may act in concert in the regulation.

In conclusion, shedding activation is dependent on the colocalization of the activated ADAM and the substrate and on the concentrations of available regulators. Some evidence supporting all of the above mentioned mechanisms has been reported [4, 6, 21, 32, 139].

2.3.4.1. Intracellular Ca2+ and CaM inhibitors activate shedding

Interaction of the ADAM10 cytosolic tail with CaM at low Ca2+ concentrations is thought to inhibit ADAM10 activity [273]. An elevation in the cytosolic Ca2+ concentration or CaM inhibitors induces dissociation of CaM from the ADAM10 cytosolic tail [273]. This leads to ADAM10 maturation and activation of shedding [273]. The Ca2+ dependent ADAM10 activation may also involve subcellular translocation, and in some cells induced shedding has been reported to take place in a late endosomal compartment or in exosomes [271]. GPCR activation, NMDA receptor activation by glutamate or chemical agonists, mechanical stimulation, and antibody engagement of the substrate have been reported to induce shedding through Ca2+ signaling [174, 175, 186, 219, 273]. Ca2+ induction has been reported to activate ADAM10 mediated shedding of e.g. N-cadherin, CD44, Pcdhγ, L1, and CD30 [174, 266, 271, 273, 294].

CaM has been reported to regulate ADAM17 mediated shedding of L-selectin and glycoprotein V, since CaM inhibitors have been shown to activate their shedding [232, 361]. CaM has been suggested not to interact with ADAM17 [273]. Instead of regulating ADAM17, the CaM interaction with L-selectin and the cytosolic tail of glycoprotein V has been suggested to protect them from shedding [232, 361]. CaM has also been associated with the regulation of the shedding of TGFα, neuregulin α2c, TrkA, and APP since administration of CaM inhibitors induces the shedding of these

52

ADAM substrates [192]. The molecular mechanisms of CaM in regulating shedding in these cases are not known.

Cytosolic Ca2+ is a second messenger, which can activate e.g. PKC, MAPKs, or induce the production of reactive oxygen species (ROS) all of which have been show to activate ADAMs. Indeed, it has been reported that GPCR induced Ca2+ signaling activates ADAM17 mediated HB-EGF shedding through ROS signaling [189]. Interestingly, the activation of ADAM10 mediated shedding of betacellulin has also been reported to involve ROS production [174, 175]. In conclusion, cytosolic Ca2+ can regulate shedding by controlling the association of CaM with ADAM10 or ADAM-substrates. Furthermore, cytosolic Ca2+ is also involved in cell signaling pathways, which regulate shedding.

2.3.4.2. Erk1/2 signaling is involved in ADAM17 sorting and activation

Several studies have suggested a necessity for Erk1/2 activation in ADAM17 mediated shedding [4, 6, 21, 32, 36, 139]. The Erk1/2 pathway is one of the classic MAPK pathways known to be activated by several shedding inducers e.g. activated PKCs, growth factors, serum, and some GPCR agonists and their second messengers. The cytosolic tail of ADAM17 contains 16 serine and 7 threonine residues of which only threonine 735 (P-Q-T735-P) is within a consensus Erk1/2 and p38 phosphorylation motif (P-X-T/S-P). The phosphorylation of ADAM17 Thr735 upon Erk1/2 kinase activation has been reported [231, 360]. The Erk1/2 kinases precipitated from PMA, EGF, NGF, MCP-1, IL-6, and TNFα stimulated cells has been demonstrated to phosphorylate an ADAM17 cytosolic tail peptide in in vitro kinase assays [231, 360]. This suggests an involvement of Thr735 phosphorylation in the regulation of ADAM17.

Transfection of a constitutively active Mek-1 with Erk-2 has been shown to induce cellular redistribution of the wild type but not the Thr735 to Ala735 mutant of ADAM17 [360]. ADAM17 was shown to translocate from the ER to non-ER vesicular and tubular structures without prominent plasma membrane localization [360]. Importantly, most of the Thr735 phosphorylated ADAM17 was still in premature form, suggesting that Thr735 is dephosphorylated concomitantly with maturation or that the Thr735 phosphorylated mature form is degraded efficiently [231, 360]. Other studies have reported that PMA-stimulation induces the rapid maturation of ADAM17, plasma membrane translocation, and subsequent degradation [360, 362]. Consistently, a phospho-ADAM17 mimicking mutant containing E735 was quickly processed to mature form and the turnover rate was three times faster compared to wild type ADAM17 [360]. Furthermore, the total cellular levels of E735 were much lower compared to that of wild type ADAM17 [360]. The phospho-mimic ADAM17 was detected in COPII vesicles and TGN as well as in endosomal and lysosomal compartments consistent with its induced cellular transport [360]. On the other hand the GFP ADAM17 construct used in the study lacked the PDZ domain binding site that has been reported to mediate a SAP97 interaction, and may effect the release of ADAM17 from the ER [342]. Also binding to the PDZ of the ADAM17 phosphatase candidate PTPH1 is dependent on the C-terminus of ADAM17 [332]. Altogether, this suggests that Erk1/2 dependent phosphorylation of ADAM17 Thr735 induces ADAM17 mobilization from the ER, its subsequent transport through subcellular compartments, and finally degradation.

53

In contrast to results suggesting that ADAM17 Thr735 is a MAPK target, EGF, FGF, and serum stimulation have been reported to induce ADAM17 Ser819 phosphorylation Erk1/2 kinase dependently [363]. The Erk1/2 kinase target Thr735 was shown dispensable for ADAM17 Ser-phosphorylation in this study [363]. While the phosphorylation was shown dependent on Erk1/2, the serine kinase responsible for ADAM17 Ser819 phosphorylation was suggested to be downstream of Erk1/2. Interestingly, in serum deprived resting cells ADAM17 Ser791 was shown to be constantly phosphorylated, and upon growth factor stimulation it became dephosphorylated [363]. The effect of Ser791 and Ser819 phosphorylation on the maturation of ADAM17 or its subcellular localization was not monitored in the report. Also, an overexpressed Ser819 mutant and an ADAM17 completely lacking the intracellular tail were as efficient as wild type in a serum induced TGFα shedding assay [363]. This suggests that Ser819 phosphorylation may not be involved in the regulation of ADAM17 activity. However, a more physiological setting or the use of a substrate other than TGFα may have elucidated the functional role of Ser819 phosphorylation. Furthermore, the study associated other kinases in addition to Erk1/2 with the phosphorylation of ADAM17.

2.3.4.3. The JNK and p38 MAPK pathways activate shedding

Indirect evidence suggests p38 and JNK MAPK pathway involvement in shedding activation. Several shedding activators are aloe well known activators of the p38 and JNK pathways. These include serum, TNFα, osmotic stress, sorbitol, UV, pervanadate, lipopolysaccaride, and fMet-Leu-Phe [190, 191, 231, 327, 364]. p38 has been suggested to be responsible for maintaining a constitutive level of shedding [329] and JNK has been shown to inhibit basal level shedding of APP [328]. However, in some cellular models the activation of p38 and/or JNK has been shown necessary for induced shedding [324, 327, 365]. Furthermore, H2O2, implicated in JNK and Erk5 MAPK activation, has been reported to activate robust ADAM10 and -17 mediated shedding [175, 189]. While H2O2 activated shedding has been shown to be independent of JNK activation [366], the role of the Erk5 MAPK pathway have not been reported. On the other hand H2O2 has been suggested to activate shedding directly by enhancing the release of the metalloprotease associated pro-domain [27, 189]. Also, the H2O2 have been shown to regulate activity of cytosolic phosphatases [367]. Altogether this suggests that, in addition to Erk1/2, other MAPKs (p38, JNK, and Erk5) may play a role in the co-activation of shedding or as independent shedding activators.

2.3.4.4. PKCs regulate ADAM transporting and activation independent of MAPKs

Similarly to ADAM17, ADAMs 9 and 12 have been reported to colocalize with and to be regulated by kinases inside cells [182, 331]. In unstimulated RD-cells ADAM12 was reported to colocalize with PKCε in a perinuclear intracellular compartment, and upon PMA stimulation a part of the ADAM12 and PKCε pool co-translocated to the plasma membrane [331]. Overexpressed kinase death PKCε colocalizes with ADAM12 and blocks the PMA induced translocation suggesting that the PKCε activity regulates

54

ADAM12 translocation and presumably also the activity of ADAM12. ADAM9 mediated HB-EGF shedding has been reported to depend on PKCδ interaction and phosphorylation [182]. However, the effect on the subcellular localization or maturation of ADAM9 is not known, since endogenous ADAM9 was mostly in mature form prior to the PMA treatment, and localization data was not presented [182].

2.3.5. ADAMs mediate triple membrane passing signaling

ADAM-mediated GPCR transactivation of EGFR-signaling has been recognized as a physiologically relevant signaling mechanism in various cells and as a very important mechanism for causing abnormal cell growth e.g. in various cancers [141, 166-168, 330, 368]. ADAMs 10, 15, and 17 have been implicated in the transactivation of EGFR in cancer cells [166-168, 240]. GPCR activation by angiotensin II is though to induce cardiac cell hypertrophy by activating ADAM12 mediated shedding of HB-EGF and to induce renal diseases by activating ADAM17 mediated shedding of TGFα leading to the transactivation of EGFR, which elicits growth signals in cells [140, 141, 369]. Acquired or inherited errors in the regulatory system may enable the amplification of a signaling cycle, in which GPCR activation leads to ADAM activation, which is in turn followed by EGF and EGFR activation leading to ADAM recruitment and eventually an amplified GPCR-ADAM-growth factor-GFR activation cycle, which sustains cell growth and activated cell migration.

Evidence gathered from studies on the GPCR-mediated activation of ADAMs in different cells suggests that activation of different GPCRs can lead to ADAM activation in a celltype- and GPCR-specific manner. Furthermore, GPCR-ligands can activate different ADAMs in different cells leading to the shedding of the same or different molecules [139, 370, 371]. The shedding of amphiregulin, betacellulin, and HB-EGF in various cancer cell lines exemplify this elegantly; shedding of these proteins has been demonstrated to be activated by various GPCR agonists in cancerous and normal cells in a celltype- and ADAM-specific manner [140, 167, 168, 183].

A recent study provides insight into the ADAM17 activation mechanism after GPCR activation. Treatment with Gastrin-releasing peptide (GRP) was reported to induce ADAM17 translocation to the plasma membrane leading to the shedding of amphiregulin and TGFα in cells derived from squamous cell carcinoma of the head and neck (SCCHN) [330]. Importantly, the study indicated that although GRP induces MAPK activation, and serine and threonine phosphorylation, the translocation of ADAM17 is induced prior to the EGFR and MAPK phosphorylation and thus would presumably be independent of Erk1/2 activation [330]. EGFR transactivation prior to MAPK activation has been reported also in several other cancer cell lines after LPA activation [167]. The ADAM17 phosphorylation and translocation mechanism in SCCHN was demonstrated to be dependent on Src, PI3K, and PDK1, forming a putative signaling pathway for ADAM17 activation in these cells. PDK1 was shown capable of phosphorylating ADAM17 in vitro. PDK1 knockdown cells failed to induce ADAM17 phosphorylation, translocation to the plasma membrane and amphiregulin shedding activation upon GRP induction suggesting that phosphorylation is dependent on PDK1 [330]. Interestingly, c-Src was shown to translocate and co-precipitate in conjugation with ADAM17 and an indirect interaction between c-Src and an unidentified ADAM17

55

interacting protein was suggested by the authors. Since PDK1 is a downstream signaling molecule part of the IGFR pathway IGF too may activate the shedding of EGF-like growth factors and transactivate EGFR-signaling [372].

Some features of the GRP induced shedding are clearly different compared to the Erk1/2 dependent activation mechanism. In SCCHN cells ADAM17 was localized in scattered cytoplasmic membrane structures even prior to the GRP stimulation, Figures in [330]. Also, all the major protein bands of ADAM17 before and after stimulation, were of the same size suggesting that either very little maturation took place during induction or that most of the ADAM17 was already in mature form as it appears in [330]. This is in contrast to the Erk1/2 induced translocation studies discussed above in which the majority of ADAM17 was in inactive zymogen form. The presence of most of the ADAM17 protein in mature form in SCCHN cells suggests that the majority of ADAM17 had already been transported through the TGN and was present in a non-ER compartment [330] while in the Erk1/2 study the majority of ADAM17 was in the ER [360]. This may explain why the GRP was able to induce the translocation of ADAM17 prior to MAPK kinase activation and suggests the involvement of more than one separate sorting and activation step in the regulation of ADAM17 and presumably also other ADAMs. A very important notion is that the activation mechanisms may vary greatly between cell types.

GPCR activated shedding is not the only physiological receptor activation induced shedding mechanism that induces EGFR transactivation. Recently it was shown that epithelial cells respond to TNFα by activating the shedding of EGF-like growth factors and the secretion of L-1α [190]. This was shown to lead to autocrine/paracrine signaling through the EGFR-family members and IL-1 receptors of which the former promote cell survival and the latter induce apoptosis [190]. The TNFα activated shedding of EGF-like growth factors exemplifies the emerging picture of intricate responses caused by cell signaling events that activate shedding. Various growth factors, cytokines, and the stimulation of neurotransmitters have been shown to activate EGF-like growth factor shedding, which may induce EGFR transactivation (Figure 11). The activation of growth factor shedding and the subsequent signaling induced by extracellular signaling molecules is called triple membrane passing signaling, and it may be a common physiological mechanism of cell signaling modulation and/or amplification. The EGFR transactivation mechanism is thought to be particularly important for malignant cells since it prevents apoptosis and induces DNA synthesis and proliferation [136, 167]. Furthermore EGFR transactivation has been reported to activate the migration of cancer cells [167]. Also the signaling mediated attenuation of signaling may be of importance for cancer cells; ADAMs have been implicated in the shedding of transmembrane phosphatases, which potentially also promote cancer progression [233, 234]. Intriguingly, the shedding of the PTP-LAR membrane phosphatase is induced by EGFR activation.

56

Figure 11. Triple membrane passing signaling (TMPS) Extracellular signaling activates GPCR, receptor tyrosine kinases, or cytokine receptors (1) which activate intracellular signaling (2). The intracellular signaling activates ADAM-mediated shedding (3) which in turn activates the release of EGF-like growth factors. EGF-like growth factors bind to their cognate receptors in autocrine or paracrine fashion (4) and activate intracellular signaling.

2.4. ADAM transgenic animals

ADAM gene knock-out and knock-in mice have revealed phenotypes ranging from embryonic lethal single knock-outs to null phenotypes in triple knock-outs. Tables 12 and 13 list the published ADAM knock-out and knock-in mice and their phenotypes. Selected studies on transgenic animals are reviewed in this section.

2.4.1. Metalloprotease-ADAM gene knock-out mice

The most severe phenotype in an ADAM knock-out mouse is seen when the gene for ADAM10 is a disrupted (Table 12). Mice lacking ADAM10 die during early embryogenesis due to severe defects manifesting especially in the cardiovascular and nervous systems [282]. The pericardial sac of the embryo is overgrown and blood vessel development disrupted, the latter is indicated by an absence of segmental blood vessels between the somites. Embryos also display general irregularity in somitogenesis and the medial somites are severely malformed.

ADAM10 has been suggested to be a Notch site2 protease and a sheddase of the Notch ligands Delta and Jagged (Table 8). Consistently, the defects in the pericardial sac and neural tube in ADAM10 knock-out animals resemble phenotypes associated with Notch disrupted animals [40, 282]. However, the absence of ADAM10 doesn’t affect all tissues that express high levels of Notch [282]. Based on the ability of other ADAMs to cleave Notch and a controversy in cellular experiments on Notch processing, it has been suggested that Notch is processed in a cell and tissue specific manner by several ADAMs [282].

57

Due to the early lethality of the knock-outs, the role of ADAM10 in developing and adult mice remains to be elucidated. Studies with mouse embryonic fibroblasts (MEF) isolated from ADAM10 knock-out embryos have suggested that ADAM10 is the constitutive or regulated physiological sheddase of e.g. EGF, betacellulin, L1 adhesion protein, CD23, CX3CL1, CXCL16, and Pcdhγ (Tables 8-10). However, the APP α-secretase activity was retained in ADAM10-/- MEFs suggesting that ADAM10 is not the only sheddase capable of APP α-processing [282]. The role of ADAM10 as a physiological APP α-secretase has been strongly suggested by ADAM10 knock-in mice, which exhibited resistance to effects of the overexpression of an Alzheimer’s disease causing human APP mutant [203]. Furthermore, ectopic expression of a catalytically inactive ADAM10 in an APP mutant mouse enhanced β-amyloid plaque formation [203].

ADAM10 knock-out and knock-in experiments in fruitflies with a dominant negative form of ADAM10 have indicated the requirement of ADAM10 for axon guidance [40, 318]. The growing axons halt at the inter-commissural region and cross the commissural midline abnormally [318, 373]. The phenotypes strongly associate ADAM10 with axon guidance and may be caused by the disruption of ADAM10 mediated shedding of the axon guidance cue molecules ephrin A2, ephrin A5 and/or the adhesion proteins L1, CD44, NCAM, or cadherins [39, 271, 272, 309]. Abnormal commissural crossing has been genetically associated with repulsive Slit/Roundabout receptor signaling, however, the molecular mechanisms of ADAM10 association with the regulation of Slit/Roundabout complexes is not clear [373].

Mice with a disrupted ADAM17 gene die usually at birth due to multiple developmental defects. Organogenesis of e.g. lung, heart, skin, intestine, mammary gland, and eye are defective, presumably due to impaired shedding of EGF-like growth factors and neuregulin-1 (Table 12) and [126, 150, 157, 374, 375]. Studies on MEFs derived from ADAM17-/- mice have also supported the idea that ADAM17 is the principal sheddase of five EGF-like growth factors and neuregulin-1 [126, 173, 177, 187]. However, many ADAMs have been implicated in the constitutive and/or regulated shedding of EGFR ligands [126, 173, 187] (Table 8). The defects caused by impaired shedding of many ADAM17 substrates are not obvious due to the early lethality of ADAM17-/- mice. It is also possible that other ADAMs compensate for the absence of ADAM17 due to redundant functions, which would mask the physiological role of ADAM17 in those cases.

ADAM19-/- mice display defects in the nervous system and die due to developmental defects in the heart and lungs shortly after birth [159, 193]. The heart and lung defects are partially similar to those seen in ADAM17-/-, mice and the ADAM17 and 19 double knock-out mice show exacerbated defects in heart [187]. Furthermore, while ADAM9 knock-out mice do not exhibit any obvious defects, the double knock-out of ADAMs 9 and 19 show more severe aberrations in the heart than do ADAM19-/- mice [187]. This suggests that ADAMs 9, 17, and 19 either have parallel or redundant functions in heart development, or are partially able to compensate for each others’ absence. The defected heart development in ADAM knock-out mice is thought to be caused by impairment of neuregulin and HB-EGF shedding [187].

The role of ADAM19-/- and ADAM9-/- is unclear at the molecular level since PMA induced shedding of neuregulins and HB-EGF are intact in ADAM19-/- and ADAM9-/- MEFs [187]. This suggests that ADAM9 and -19 contribute to heart development in

58

parallel but separate mechanism compared to ADAM17 or that their cellular activation mechanism has not been found yet. Interestingly, a recent study of ADAM17-/- MEFs has indicated that ADAM8 can also contribute to HB-EGF shedding in the absence of the major HB-EGF sheddase ADAM17 [173]. Also, developmental defects caused by the absence of ADAM12 have been suggested to be due to impaired HB-EGF shedding [181]. Altogether, this suggests that at least five ADAMs may contribute to the developmental regulation of HB-EGF.

ADAM8, -9, -12, -15, and -33 gene knock-out mice are either free of any obvious pathologies or exhibit only mild spontaneous defects (Table 12). Even mice with the triple knock-out of ADAMs 9, 12, and 15 survive and do not display obvious defects or evident pathologies in unchallenged conditions [126, 187]. ADAM12-/- mice have been reported to exhibit partial lethality before weaning and low penetrance impairment in the development of interscapular muscles and fat tissues [181]. The suggested molecular mechanism is impaired shedding of HB-EGF [181]. Aging ADAM15 gene knock-out mice exhibit osteoarthritic lesions in knee joints, which are hypothesized to be caused by the altered survival of ECM adherent chondrocytes in cartilage [376]. ADAM15 knock-out mice also exhibit impaired neovascularization in retinopathy of prematurity model [377]. ADAM15 has been associated with vascular remodeling and the regulation of MMPs -1 and -10 in cell culture experiments [378]. However, the exact molecular mechanisms behind the ADAM15-/- phenotypes are not known.

Implantation of malignant cells or tumor induction in an ADAM knock-out background demonstrates the importance of ADAMs 9, 12, and 15 in cancer development. Implanted mouse melanoma cells produced smaller tumors in ADAM15 gene knock-out mice compared to wild type mice [377]. The difference was likely not due to ADAM15s role in impaired neovascularization, since a comparison of tumors from different ADAM15 backgrounds did not exhibit alteration in tumor morphology or blood vessel distribution within tumors [377]. Interestingly, melanoma cells have been reported to secrete a factor that strongly induces ADAM15 expression and ADAM15 has been associated with vascular remodeling also in a cell culture model system [378, 379]. However, the mechanisms restricting tumor growth in ADAM15-/- mice have not been revealed yet, but the authors pointed out that initiation of vascularization or vessel growth may differ in ADAM15 knock-out mice, which could explain the slower tumor growth [377].

Studies of mouse prostatic, breast and intestinal cancer models in ADAM9 and 12 knock-out backgrounds have indicated a vital role for these ADAMs in cancer growth and progression [176, 241]. The induction of malignant transformation in the prostate or breast activated ADAM12 expression in stromal cells surrounding the cancerous epithelial glands [241]. Tumor growth and progression were retarded in ADAM12-/- mice, which warrants the suggestion that ADAM12 protein may support cancer progression and growth by providing growth signals by shedding EGF-like growth factors [241].

59

Table 12. ADAM knock-out mice

ADAM Phenotype References ADAM1A Infertility, defects in subcellular sorting of sperm ADAMs [380] ADAM1B Defects in ADAM2 subcellular localization in sperm [381] ADAM2 Infertility, defects in ADAM1 subcellular localization in sperm,

defected binding and fusion of sperm and egg [382-385]

ADAM3 Infertility, defects in subcellular sorting or maturation of sperm ADAMs, defected binding of sperm and egg

[384, 385]

ADAM8 No obvious defects; reduced shedding of CHL1 protein in brain [296, 386] ADAM9 No obvious defects [126, 387] ADAM10 Embryonic lethality at day 9.5 with multiple developmental

defects in various tissues [126, 282]

ADAM11 Defects in spatial learning and motor coordination, deficient nociception

[388, 389]

ADAM12 30% lethality before weaning, defects in brown adipose tissue, and resistance to obesity induced by a fat rich diet

[126, 181, 390]

ADAM15 Defects in pathological neovascularization, osteoarthritic lesions due to changes in chondrocyte viability and ECM adhesion

[126, 376, 377]

ADAM17 Perinatal lethality due to multiple defects in organ morphogenesis [126, 150, 157, 374, 375, 391]

ADAM18 Low sperm motility in ADAM18 exon 19 (TM-domain) deficient. Exon 1-3 knock-out chimeric animals exhibit abnormal testis morphology and infertility

[392]

ADAM19 Postnatal lethality (80%) 1-3 days after birth and defects in cardiovascular morphogenesis and neural systems

[126, 159, 193]

ADAM22 Ataxia, tremor, reduced body weight, and death before weaning. Hypomyelination in peripheral neurites

[341, 393]

ADAM23 Ataxia, tremor, and death by two weeks of age [394, 395] ADAM24a No obvious defects [392] ADAM33 No obvious defects [396] ADAM2/3 Infertility, defects in subcellular sorting or maturation of sperm

ADAMs [384]

ADAM9/15 No obvious additional defects compared to single knock-outs [126] ADAM9/19 Exacerbated morphological defects in heart morphology compared

to that of ADAM19-/- mice [187]

ADAM15/19 No additional defects compared to single knock-outs [187] ADAM9/12/15 No additional defects compared to single knock-outs [126, 187] ADAM9/12/15/17 Less than expected quadruple knock-out offspring with additional

partial embryonic lethality [126]

ADAM17/19 Exacerbated morphological defects in heart morphology compared to that of single knock-outs of ADAM17 or 19

[187]

Differing from ADAM12, high ADAM9 expression was detected in cells

undergoing malignant transformation in mouse prostate, breast and intestinal cancer models [176]. In the prostate cancer model high ADAM9 expression levels were detected in well-differentiated tumors but not in more advanced, poorly differentiated tumors. In ADAM9-/- mice, a larger fraction of SV40-induced tumors were of well-differentiated stage compared to the wild type background. Furthermore, none of the tumors had progressed to a poorly differentiated stage, indicating slower tumor progression and suggesting that ADAM9 regulates cancer initiation or progression. Curiously, overexpression of ADAM9 in mouse prostate tissue induced high-grade prostatic intraepithelial neoplasia in mice [176]. The authors suggested that ADAM9

60

could regulate epithelial cell differentiation and growth by shedding FGFR2IIIb and EGF.

Ectopic expression of ADAMs 8, 10, and 12 in transgenic mouse models has resulted in alleviations to experimental asthma, Alzheimer’s disease, and muscular dystrophy, respectively (Table 13). The knock-in studies indicate that although the knock-out of an ADAM gene may not show its importance in normal physiology, the overexpression of the same gene may have a dramatically different effect suggesting importance in non-physiological conditions such as cancer or inflammation.

2.4.2. Non-metalloprotease ADAM11, -22, and -23 gene knock-out mice display defective neurological functions

ADAMs 11, 22, and 23 are highly expressed in the central and peripheral nervous systems (CNS and PNS) [393, 397]. Consistent with the reported ADAM expression patterns, knock-outs of ADAMs 11, 22, and 23 exhibit defects associated with neural functions (Table 12). While the mice deficient of ADAM11 have no apparent morphological defects in the nervous system the cognitive tests have indicated impairments in motor coordination and spatial learning [388]. ADAM11 deficient mice also exhibit lowered chemically induced nociception, while touch and temperature sensations are intact [389]. ADAM11 protein has been suggested to function on a synaptic level, since despite the cognitive impairments, the CNS of ADAM11-/- mice does not show morphological defects. This also suggests that ADAM11 is not necessary for brain development [388]. Interestingly, ADAM11 expression may affect cognitional performance quantitatively as ADAM11 heterozygous mice exhibit an middling phenotype compared to knock-out and homozygous wild type mice [388]. Also the ADAM11 protein levels were concordantly half that of wild type [388].

ADAM22 knock-out mice have been reported to be born in normal Mendelian ratios and they appear normal although have reduced body weight at birth [341]. The ADAM22-/- mice die before weaning, probably due to severe impairment of the nervous system presenting as ataxia, tremor, and convulsive seizures [341]. While substantial hypomyelination was detected in PNS neurites, no obvious morphological CNS defects were reported, which suggests that ADAM22 functions in synapses of the CNS [341]. The hypomyelination was suggested to be due to delayed differentiation of Schwann cells, which were reported to express a specific form of alternatively spliced ADAM22 [341].

Like ADAM22-/- mice, ADAM23-/- mice suffer from severe tremors, ataxia, and die within two weeks after birth [394, 395]. No obvious morphological defects in the CNS or PNS were reported in ADAM23-/- mice, suggesting synaptic involvement also for the ADAM23 protein [394, 395].

ADAM14/Unc-71, the closest homolog of vertebrate ADAMs 11, 22, and 23 in C. elegans, has been strongly associated with cell migration and axon guidance during development [398]. Importantly, C.elegans integrins were shown to function in parallel with ADAM14 in axon guidance and cell migration. The study suggested that interactions between ADAM14 and integrins are essential for proper axon guidance in C.elegans. The evolutionary relationship suggests that ADAMs 11, 22, 23 may also mediate axon guidance in vertebrates; hence the lack of axon guidance defects in

61

ADAM11, 22, or 23 knock-out mice was unexpected. However, the lack of one ADAM may be compensated for by the others (or yet other non-ADAM proteins) in the mice.

Table 13. ADAM ectopic expression in animals.

ADAM Phenotype References ADAM8 Defective leukocyte infiltration [304] ADAM8 Resistance to experimental asthma [285] ADAM10 Overexpression alleviates the mutant APP

induced AD in mouse [203]

ADAM12 Abnormal myogenesis in tumors secreting ADAM12S

[103]

ADAM12 Rescue of mdx mouse from muscular dystrophy [399, 400] ADAM17∆MP ∆MP expression in blood; defective GPIbα

shedding [306]

2.5. Alternative splicing in ADAM regulation

Alternative splicing of primary transcripts has emerged as an important mechanism increasing the functional diversity of gene expression. Alternative splicing of the Drosophila gene Dscam potentially yields 38 016 different splice variants, which is more than the total number of genes in the Drosophila genome [401]. At least 30 % and up to 60 % of mammalian genes have been estimated to be alternatively spliced [402, 403]. Although alternative splicing has been shown to be an essential regulatory mechanism e.g. during development, it is still under debate how much alternative splicing is functionally significant [402]. In many cases alternatively spliced transcripts produce proteins with different or even opposite functions [402]. The alternative splicing of several ADAM transcripts has been reported. In most cases, alternative splicing of ADAM transcripts yields proteins with either variable cytosolic tails or isoforms that lack transmembrane and cytosolic parts altogether.

Alternative variants encoding soluble catalytically active ADAM-isoforms have been reported for the human ADAMs 9, 10, 12, and 28 and the mouse ADAM17 and alternative exon-skipping-transcripts encoding soluble isoforms of the human ADAMs 8 and 17 can be retrieved from Genbank [85, 103, 404-406]. The soluble isoforms of ADAMs 9, 12, and 28 have been implicated in ECM processing as well as in the regulation of insulin-like growth factor signaling by disinihibiting IGFBPs [22, 43, 85, 102, 105, 244]. The ADAM-mediated ECM processing has been suggested important for cancer progression [85, 244].

Of the non catalytic ADAMs, variants encoding soluble isoforms of human ADAM11 and mouse ADAM23 have been reported and a mouse ADAM5 transcript encoding a soluble form of the protein can be retrieved from Genbank [407, 408]. The functional significance of the soluble non-catalytic ADAMs is not known. Activation of integrin-signaling by soluble ADAM9 has been reported [56] and the soluble forms of ADAMs 11 and 23 may activate integrins signaling in similar manner.

The only evolutionarily conserved alternative splicing events in ADAMs regulate exons encoding parts of cytosolic tails in ADAMs 15 and 22 [325, 326, 341, 397, 409]. Conservation in evolution has been suggested to mark the functional importance of

62

alternative splicing, which can be extrapolated to a functional importance for the proteins that are encoded by the alternatively spliced ADAM15 and -22 transcripts [402]. Intriguingly, none of the splice events yielding the soluble ADAM-isoforms mentioned above are conserved in evolution. This may mean that the functions of soluble ADAMs result from evolutionary separation or that the alternative splicing in question has no significance.

Alternative splicing of mouse ADAM22 transcripts results in at least 21 different cytosolic tail isoforms [341]. ADAM22 splice variants have been reported to show cell type specific expression in the CNS and PNS [409]. The variants may differ in their functions, since some of the isoforms lack the ER-retention motif and the binding motifs for 14-3-3 proteins that are known to regulate ADAM22 retention in the ER [337, 354]. Furthermore, some ADAM22 isoforms contain an alternative C-terminus suggesting alternative splicing based regulation of PSD-95 binding and hence an association with synaptic protein complexes [71].

Human ADAM15 isoforms encoded by alternatively spliced transcripts contain differing protein interaction motifs in their cytosolic tails [325, 326, 410]. The shortest ADAM15 isoform has a short cytosolic tail, which lacks proline-rich protein interaction motifs suggesting that it may not be available for regulatory interactions in cells [410]. The so-called long ADAM15 variants encode a cytosolic tail with increased ability for Src-family kinase binding suggesting that they may be more prone for phosphorylation or may activate Src-kinase signaling more potently compared to shorter variants [325].

ADAM genes that produce alternative transcript variants encoding differing cytosolic tails can be retrieved also for the human ADAMs 8, 9, 19, 28, and 32 and the mouse ADAMs 8, 9, 28, and 32. This suggests that alternative splicing of the exons encoding the cytosolic tail is a frequent event. On the other hand, the alternative splicing of these ADAM-genes does not show evolutionary conservation and the cellular levels of these variants are not known. Furthermore, it is not known if they have any biological significance.

Alternative splicing has also been implicated in the regulation of gene expression. Alternative splicing has been shown to regulate transcript levels either by regulating mRNA stability influencing RNA-motifs, which regulate mRNA degradation. Also, alternative splicing may introduce premature stop codons into transcripts, which induce mRNA degradation by the nonsense mediated decay pathway (NMD). As and ADAM example, alternative splicing of ADAM33 transcripts may regulate ADAM33 expression. Most of the ADAM33 transcripts in human airway fibroblasts do not encode full length ADAM33 due to skipping of exons or because of retained introns and 90% of the ADAM33 transcripts are present in the nucleus [411]. Although full length transcripts are selectively transported to the cytoplasm, they still present only a minor fraction of the ADAM33 transcripts in the cytosol [412]. ADAM33 antibodies have been shown to detect a pattern of different sized ADAM33 proteins possibly corresponding to the translation products of the alternatively spliced transcripts [413]. The physiological significance of the complex alternative splicing of ADAM33 transcripts is not known, however most of the detected ADAM33 transcripts do not encode an ADAM protein with all of the functional domains.

The intricate ADAM33 alternative splicing raises question about the regulation of alternative splicing. Why ADAM33 transcripts that contain seemingly intact splicing signals in introns spliced in a manner that resembles random exon skipping? The

63

complexity of constitutive and alternative splicing regulation is easily comparable to transcription regulation [414, 415], as the splicing is regulated on more than one levels. Even constitutive splicing requires the co-operation of donor and acceptor sites, branch point, and a variable number of exonic and/or intronic enhancer elements [416].

2.6. ADAM-mediated cellular functions in the nervous system

The human nervous system consists of a network of over 100 billion neurons and glial cells with trillions of intercellular connections. The regulation of the homeostasis and function of the nervous system calls for a multitude of cellular signals and interactions, which range from close by cellular contacts to chemical and electrical signals that spread over very long distances and to multiple cells. ADAM-mediated and/or regulated cell adhesion and cell signaling is essential for intercellular communication particularly in the nervous system. While most of the ADAM-mediated molecular interactions have been characterized in cell culture models with non-neural cell types, the abundance of ADAMs in the CNS strongly implies an functional importance for ADAMs also in the nervous system [351, 417]. The ADAM-transgenic animals have demonstrated the importance of ADAMs for nervous system development and cognitive functions in adult animals (section 2.4.). However, early lethality of knock-out animals of some key ADAMs hampers the investigation of the molecular functions of ADAMs in the nervous system.

This section reviews the most prominent molecular functions shown or proposed to be mediated by ADAMs in the nervous system. Since ADAMs are postulated to play a role in a multitude of functions in neurons and glial cells, in most cases the functions are just mentioned or discussed only briefly.

2.6.1. ADAMs regulate proliferation, differentiation, and survival signals in the adult CNS

ADAM-mediated ectodomain shedding has been shown to regulate growth factors, receptors, and other proteins important for neural and glial survival and their precursor cell proliferation in the developing and adult nervous system. The role of ADAMs in the shedding process has in most cases been indicated for non-neural cells but is presumably of importance for neural and glial cells as well. In contrast to a long held view, the adult mammalian brain contains stem cells, which proliferate and can differentiate into neurons and glial cells according to growth and differentiation signals [418]. Stem and neural precursor cells have been located only in restricted areas of the CNS in the subventricular zone (SVZ) and in the subgranular zone (SGZ) of the dentate gyrus [418]. EGF, TGFα, HB-EGF, and neuregulin-1, which are known to be regulated by ADAM-mediated shedding (section 2.2.1.), have been associated with the regulation of neural precursor cell proliferation and differentiation [418-420]. Furthermore, the activation of HB-EGF shedding by neurotransmitter receptor excitation with glutamine, kainic acid or N-methyl-D-aspartic acid (NMDA) has been shown in cultured neurons indicating that HB-EGF shedding takes place in both neural and non-neural cells [186].

64

Interestingly, EGF-signaling has been reported to activate APP shedding and the soluble APP ectodomain (sAPP) has been suggested to function as an EGF-co-regulator in neural precursor cell proliferation suggesting a connection between APP shedding and EGFRs-signaling in the CNS [421].

ADAM-mediated shedding of Notch and EGFR4 receptors regulates neural and glial cell differentiation [255, 261]. ADAM10 has been shown to regulate the shedding of Notch and its counter receptors during development and presumably also in the adult brain [251]. Notch signaling regulates several stages of the differentiation of neural stem cells to EGF-dependent NSC/neural progenitor cells and is also required for the maintenance of neural stem cells capable of self-renewal, which supports the involvement of ADAM10 in the process [255]. Also, the shedding and subsequent signaling of the released intracellular domain (ICD) of EGFR4 has been shown to regulate the timing of astrocyte differentiation [261]. ADAM17 has been implicated in the EGFR4 shedding in non-neural cells and hence likely mediate EGFR4 shedding also in astrocyte precursors [228]. Altogether, this indicates that ADAMs 10, 17 and possibly others are part of a signaling network that regulates neurogenesis in the adult brain. As neural activity regulates growth factor shedding it may also regulate survival and proliferation signals in the CNS.

EGF-like growth factors and neuregulins provide survival signals for mature neurons and regulate survival, proliferation, and activity of glial cells by activating the EGFR-family receptors [422, 423]. Also, the soluble CHL1 shed by ADAM8 and its homolog L1 shed by ADAM10 have been reported to activate neurite outgrowth and to elicit neuroprotective effects in cell culture models [296, 424]. TNFα derived from glial cells and shed by ADAM17, has been suggested to both promote neural survival as well as induce neuronal apoptosis [417]. Furthermore, ADAM-initiated release of the intra cellular domain (ICD) of transmembrane proteins has also been indicated as an important mechanism in the regulation of survival and gene expression in mature neurons. N-cadherin shedding and subsequent β-catenin signaling as well as neuregulin-1-ICD signaling have been shown to promote survival in adult neurons [262, 266]. The survival signaling associated RIP is linked to neuronal activity since membrane depolarization, NMDA/AMPA receptor activation by agonists, and GPCR activation by neurotransmitters activate N-cadherin and γ-protocadherin shedding [266, 270, 425].

Altered ADAM-mediated shedding has been suggested to play a role in the memory impairments and loss of neurons associated with Alzheimer’s disease. The hallmark feature of Alzheimer’s disease is the accumulation of Aβ in the brain [426]. Aβ is amyloidogenic peptide generated by β- and γ-proteases from APP. Aβ oligomers are thought to cause the memory loss associated with Alzheimer's disease [426, 427]. ADAMs have been implicated in APP-regulation and APP has been suggested to regulate shedding. The β-processing of APP is thought to occur because of lowered ADAM10 mediated α-processing, which suggests that ADAM10 is involved in the initial propagating stage of the disease [343]. The Aβ oligomers have been suggested to inhibit ADAM10 mediated shedding by inhibiting the NMDA receptor, which is thought to contribute to the Aβ neurotoxicity through reduced N-cadherin shedding and subsequent β-catenin signaling [425]. NMDA signaling has been associated with the activation of the shedding of HB-EGF, neuregulin-1, and APP and possibly other proteins. The Aβ-mediated inhibition may contribute to Aβ-neurotoxicity also by lowered neuronal survival signaling through the afore mentioned proteins. However,

65

there is no direct evidence of βA-mediated inhibition of the processing of all the above mentioned ADAM-substrates.

In conclusion, it seems that ADAMs regulate neural and glial proliferation and survival in the CNS and that neural activity may be a general cue for the activation of shedding. It should be noted that various soluble signaling molecules independent of neural activity have also been reported to activate shedding (section 2.4.1). Based on their substrate assortment ADAMs 10, 17, and 19 are likely responsible for most of the survival associated shedding in the adult nervous system (sections 2.2.1. and 2.4.1.). The contributions of the other ADAMs capable of EGF, APP, Notch, and Notch-ligand shedding to neurogenesis, neural stem cell regulation, glial signaling, and to the mediation of Aβ neurotoxicity are not known. Intriguingly, ADAM12 has been convincingly associated with Aβ mediated neurotoxicity [349].

2.6.2. ADAM-mediated shedding may regulate synapses

An association of many known ADAM-substrates with synaptic plasticity suggests that ADAMs may be involved in the regulation of synapses through their shedding activity. The role of ADAM10 in the regulation of synapses has been strongly suggested by transgenic mice overexpressing the constructs encoding the wild type or a catalytically inactive ADAM10, which increase and decrease the catalytic activity of ADAM10 in neurons, respectively [428]. Interestingly, the increase and reduction of ADAM10 activity in neurons result in different cognitive impairments in mice. Mice with reduced ADAM10 activity show impairment in memory and learning as judged by performance in the Morris water-maze task. While the mice with increased ADAM10 activity also perform sub-optimally in the Morris water-maze task, the impairment may at least partially be related to motivation, since mice show thigmotaxic and floating behavior [428]. This suggests that the catalytic activity of ADAM10 regulates at least spatial learning and memory. The molecular cause of cognitive impairments in ADAM10 transgenic mice may at least partially be due to altered synaptic α-processing of APP, which in turn may regulate synaptic plasticity. This possibility is supported by similar cognitive impairments seen in APP-/- mice suggesting that α-processing of APP is required for learning and memory [417]. The hypothesis is also supported by a mouse model for Alzheimer’s disease in which cognitive impairment caused by a mutant form of APP prone to skip α-processing, can be prevented by the overexpression of ADAM10 in neurons [203].

APP is not the only synaptic ADAM substrate implicated in synaptic regulation. ADAMs have been shown to shed at least one member in the five (cadherins, L1-adhesion proteins, Ephs, ephrins, and NCAMs) of the nine adhesion/signaling protein families implicated in synaptic plasticity [3] and (section 2.2.2.-3.). Mice deficient in the ADAM10 substrate NCAM show impaired long term potentiation (LTP) in the dentate gyrus and knock-out mice lacking the ADAM8 substrate CHL1 show impaired social behavior and enhanced basal synaptic excitatory activity as well as impaired synaptic long term potentiation [429-431]. N-cadherin and γ-protocadherin, both synaptic adhesion proteins implicated in synaptic plasticity, have been identified as ADAM10 substrates [265, 266, 270, 432].

66

It is not well understood how synaptic adhesion proteins regulate long term potentiation [3, 432]. Synaptic activity is thought to induce rearrangement of the synaptic adhesion proteins [3]. ADAMs have been implicated in the regulation of cell adhesion proteins that control fast changes in non-neural cell adhesion. Same adhesion proteins have been suggested to mediate the adhesion also in synapses [3]. Hence, it is tempting to speculate that ADAMs, acting as sheddases of many synaptic adhesion proteins, might also be involved in the regulation of synaptic adhesion [3] and (Tables 5-8). The idea that synaptic activity and NMDA and AMPA receptor activation induces ADAM10 mediated shedding [266, 270, 278] is intriguing. However, ADAM-mediated shedding may be activated also by synaptic cell signaling, involving tyrosine kinases, phosphatase inhibition, or GPCR activation, since these have been shown to activate ADAM-mediated shedding (Tables 5-8).

Classical cadherins including N-cadherin have been shown to form adhesive junctions surrounding the active zone in synapses, and an increase in synaptic activity correlates with the strength of the cadherin mediated synaptic adhesion [432]. Synapse depolarization and NMDA receptor stimulation have been shown to activate ADAM10-mediated N-cadherin shedding and AMPA receptor stimulation shedding of the γ-protocadherin [265, 266, 270]. This suggests that synaptic activity may be regulated by the shedding based reorganization of synaptic adhesion. In synapses, the N-cadherin, γ-protocadherin, and L1-adhesion proteins are associated with NMDA receptors in large protein complexes, and the shedding of adhesion proteins may regulate the dissociation of adhesive contacts and enable the re-localization or internalization of the rest of the complex [270, 432, 433]. This in turn would regulate both the neurotransmitter receptor concentration and the adhesion to opposing synaptic membranes. However, there is so far no direct evidence indicating involvement of the shedding of adhesion proteins in the regulation of synaptic plasticity.

The Eph/Ephrin signaling system has been implicated in the regulation of synaptic plasticity by multiple mechanisms [434]. ADAM-10 has been indicated as the sheddase of Ephrins A2 and A5 and recently also EphB2 [39, 278, 309]. EphA/ephrinA signaling between astrocytes and neurons is though to regulate synaptic spine morphology [434]. The shedding of ephrins A2 and ephrin A5 by ADAM10 might thus be involved in the regulation of EphA signaling between astrocytes and neurons and may hence regulate synaptic spines [39, 309]. EphB2-mediated phosphorylation is thought to regulate NMDA receptor excitability and clustering [435]. EphB2 activity has also been implicated in the regulation of spine morphology through the regulation of the actin cytoskeleton [435]. Furthermore, EphB2 has been implicated in the activation of reverse signaling via ephrinBs, which regulates NMDA-independent synaptic plasticity [435]. Therefore, as a sheddase of EphB2, ADAM10 might regulate synaptic excitability, spine morphology, and presynaptic plasticity by controlling the availability of EphB2 in synapses [278, 436]. ADAM10 has also been shown to activate an intramembrane proteolysis cascade of EphB2 leading to the release of EphB2-ICD possibly regulating gene expression [278]. The function of the released EphB2-ICD has not been reported.

Proteolytic processing of integrin ligands has been suggested as a mechanism in the activation of synaptic plasticity associated with integrin signaling [437]. ADAM-mediated processing of adhesion proteins or ECM components may uncover cryptic integrin binding motifs or solubilize integrin activating ligands [437, 438]. ADAMs including ADAM10 have been implicated in the processing of ECM molecules and this

67

may activate integrin signaling in synapses [6] and (section 2.2.3.). ADAM10 mediated shedding of membrane bound L1 has been shown to induce autocrine integrin signaling in non-neural cells [439]. Similarly, the shedding of integrin interacting cadherins, type XVII collagen, or L1 may activate integrin signaling in synapses. Also, shedding of transmembrane adhesion proteins may activate autocrinic signaling through other receptors, which is indirectly supported by the finding that shed NCAMs and CHL1 promote neuroblast migration and axon guidance [438].

Many of the synaptic ADAM-substrates are targeted for intramembrane proteolysis and their intracellular domains regulate the expression of genes implicated in synaptic regulation (section 2.2.2. and this section). ADAM10 mediated N-cadherin shedding is followed by the release of N-cadherin-ICD, which is known to regulate expression of genes important for long term synaptic changes and neuronal survival [265, 266]. The induction of N-cadherin shedding has been associated with neuronal activity and thus regulates the expression of genes thought to be involved in synapse function. ADAM10-mediated processing of γ-protocadherin activates γ-protocadherin-ICD-mediated up-regulation of γ-protocadherin gene expression, which might enhance synaptic or neural adhesion [440]. RIPed APP-ICD have been shown to activate genes involved in the regulation of the actin cytoskeleton, which may be part of the APP mediated synaptic regulation and involved in the cytoskeletal rearrangements associated with synaptic plasticity [441]. Furthermore, ADAM17 and -19 mediated cleavage of neuregulin-1 may regulate synaptic structure, since neuregulin-1-ICD has been shown to activate the PSD-95 gene of which transcripts encode the post-synaptic density protein involved in synaptic transport and synaptic regulation [258, 262]. ADAM17 mediated shedding induces the release of ICDs from HB-EGF and p75NTR, which are also known to regulate gene expression [225, 257]. The involvement of genes regulated by HB-EGF and p75NTR ICDs in synaptic plasticity is not understood. The emerging picture suggests that RIP-mediated regulation of gene expression is an important mechanism in synaptic regulation. It should be noted that membrane depolarization is not the only mechanism to activate shedding; GPCR and tyrosine kinase activation by non-neurotransmitter ligands have been shown to activate RIP in neurons [39, 262, 266, 270, 425].

TNFα derived from glial cells has been shown to positively regulate the level of AMPA receptors in postsynaptic termini, which suggests an involvement of ADAM17 in the regulation of synaptic plasticity [442]. ADAM17 has also been implicated in the shedding of TrkA and p75NTR, which are neural receptors for neurotrophins and have been strongly associated with synaptogenesis and synapse regulation [443]. The significance of ADAM17 in the regulation of synapses is, however, not known.

Altogether, growing evidence supports the involvement of ADAM-mediated shedding in the regulation of synaptic plasticity. The exact molecular mechanisms and significance of shedding in the regulation of synaptic adhesion are not known. The substrate assortment of ADAMs 8, 10, 17, and 19 suggests that they are involved in the regulation of synaptic plasticity through the shedding of APP, as well as of synaptic adhesion proteins of the cadherin, L1, and NCAM families, and neuregulin-1 and NGF receptors. The role of other ADAMs as sheddases in synaptic regulation is ambiguous, although ADAMs 9, 12, and 33 have been shown capable of APP processing in non-neuronal cells.

68

2.6.3. ADAM-integrin interaction partners remain to be identified in the nervous system

Several studies have indicated an essential role of integrins in the developing and in the adult nervous system [437, 444]. Also, several ADAM-binding integrins have been implicated in neural functions ranging from neuronal migration, axon extension, and synapse formation to the regulation of synaptic plasticity [2, 437, 444-447]. ADAM-integrin interactions in the developing nervous system are supported by the additive impairments in axon guidance caused by ADAM14 and integrins in C. elegans [398]. In contrast to C. elegans, no defects in neuroblast migration or axon guidance have been reported in knock-out mice deficient of ADAMs (section 2.4.). This suggests that either ADAM-integrin interactions do not play role in neuronal migration or in axon guidance or that the absence of ADAMs is compensated for by redundant ADAMs or other types of proteins during mammalian development (section 2.4.). Therefore, the significance of intercellular adhesion mediated by ADAM-integrin interactions during the development of the adult neural system remains to be shown.

An association between ADAMs and synaptic plasticity is suggested indirectly by studies that point to an involvement of ADAM-binding integrins in synapse regulation. Synaptic LTP involves integrin signaling and can be inhibited by ADAM-related snake venom disintegrins and peptidomimetics that inhibit integrin function [444, 448]. Also, treatments with function-blocking antibodies against various integrin subunits have been shown to block the LTP [2, 444, 445, 447, 448]. While in most cases ECM components or other non-ADAM ligands have been suggested as the integrin binding partners and/or integrin signaling activators in synapses, in some cases the integrin interaction partners are still ambiguous [437, 445]. It has been suggested that synaptic plasticity is regulated by multiple overlapping mechanisms and that synapses may differ by their integrin ligand types or that multiple redundant integrin activation mechanisms may regulate integrin activation in synapses [2, 437]. There is no direct evidence indicating ADAM-integrin mediated cell-cell adhesion in synapses. However, since several ADAMs and integrins are expressed in neurons and ADAM-binding integrins are involved in several stages of synapse development and plasticity, it is tempting to speculate that ADAM-integrin interactions may play a role in neuronal and/or glial interactions. ADAMs expressed in neurons might mediate adhesion or activate integrin signaling in synapses or in neuronal-glial cell-cell contacts. Also, the emerging role of ADAMs as integrin inhibitors in cis [9, 57, 410] has not been addressed in the CNS and it is possible, that ADAMs could negatively regulate integrins by suppressing or modulating their binding or signaling in neural systems.

The most evident candidate ADAMs for mediating synaptic integrin interactions in neurons are ADAMs 11, 22, and 23, because they show principal expression in the nervous system and mice deficient of ADAMs 11, -22, or -23 show defects in neuronal functions (section 2.4.2.). Based on these observations, and a lack of impairments in overall CNS morphology and axon guidance in knock-out mice, ADAMs 11, 22, and 23 have been suggested to function in synapses [341, 388, 389, 393-395]. Furthermore, ADAMs 11, 22, and 23 are not active metalloproteases, implying a non-sheddase function. Rather, their recombinant disintegrin domains have been shown to mediate αvβ3, α6β1, α9β1 integrin-dependent cell adhesion [86]. Of the known integrin subunits that bind ADAMs 11, 22, and 23, all except α9 are expressed in the CNS [437,

69

445, 449]. The β3 integrin subunit primarily shows synaptic localization in the CNS and is associated with synaptic maturation and plasticity [437, 444]. Also, inhibition of the αv along with the α3 and α5 integrin subunits with function blocking antibodies suppresses integrin dependent synaptic activation, and blocking of β1 has been shown to inhibit LTP stabilization [450, 451]. Since they are able to bind synaptic integrins, ADAMs 11, 22, and 23 are good candidates for synaptic regulators.

Studies have indicated overlap in ADAM-integrin binding [6], and that at least ADAM12 binds integrins in a hierarchical manner [55], which suggests that a phenotype resulting from the lack of e.g. ADAMs 9, 12, 15, and 19 could be compensated for by other ADAMs. On the other hand, there are no studies reporting possible cognitive impairments in the most of the ADAM gene knock-out mice and the cognitive tests in transgenic mice lacking ADAM11 and ADAM10 are the only reports on the subject [388, 389, 428]. It would be interesting to see how e.g. ADAM 9, 12, 15, and 19 quadruple knock-out mice perform in cognitive tests. Also, studies of mice heterozygous for ADAMs 22 and 23 in a ADAM 9-/-, 12-/-, 15-/-, or 19-/- background could be informative in studying the role of ADAMs in synaptic integrin binding.

2.6.4. ADAM22 is a receptor for LGI1 and regulates AMPA receptor synapse recruitment

ADAM22 has been reported to be an LGI1 receptor [71]. LGI1 is though to be secreted from the presynaptic membrane [72]. LGI1 functions are poorly understand, but the protein consists of a domain rich in leucine-rich repeats at its N-terminus similar to the axon guidance molecules of the Slit and Netrin families, and a C-terminal domain, which is suggested to contain an EPTP type β-propeller domain [71, 72]. The EPTP domain was found to be involved in ADAM22 disintegrin domain binding and the binding was shown to increase the density of AMPA receptors in postsynaptic membranes [71]. The molecular mechanism of ADAM22 dependent AMPA receptor recruitment was suggested to involve ADAM22 associating with a protein complex containing PSD-95, stargazin, and the AMPA receptor. PSD-95 has been implicated in interactions with various synaptic proteins, including the neurotransmitter receptors AMPA and NMDA, whose recruitment to postsynaptic termini PSD-95 regulates [3, 452, 453].

The authors of the above discussed report suggested that the association of LGI1 with ADAM22 could activate a signaling cascade possibly through the dimerization or multimerization of ADAM22, which would then induce AMPA recruitment [71, 454]. The cytosolic part of ADAM22 has not been shown to harbor catalytic activity; signaling activation would thus involve proteins associated with ADAM22. Intriguingly, Novak has reported preliminary results of ADAM22, Src, and Grb2 interactions suggesting that ADAM22 could activate Src [351]. However, due to the presumed role of ADAM22 as an integrin binding partner [86], it is tempting to speculate on other ways that ADAM22 could regulate AMPA receptor recruitment. It is possible that binding of LGI1 to ADAM22 could induce ADAM22 dissociation from integrins, since the LGI1 binding was shown to be mediated through the disintegrin domain of ADAM22. This could lead to alterations in integrin signaling, which have also been associated with the regulation of synaptic density through the AMPA receptor

70

[447]. Also, it is possible that the LGI1 interaction might release ADAM22 from integrin binding mediated restrictions, which could allow ADAM22 to move laterally along the cell membrane, which could in turn allow the translocation of the ADAM22, PSD-95, stargazin, and the AMPA receptor complex to postsynaptic density.

In addition to ADAM22, LGI1 was shown to bind ADAM23 and due to the high sequence similarity between ADAMs 11, 22, and 23, LGI1 is also likely to interact with ADAM11 [71]. LGI1 belongs to a family of at least four highly similar proteins that show variable regional distribution in neural systems [72, 393, 455]. Intriguingly, the LGI4 knock-out mice show similar axon myelination defects as animals with a disrupted ADAM22 [455]. This suggests that other members of the LGI protein family may interact with ADAM22 and that these interactions may regulate extra synaptic cellular events in the nervous system.

Another level of complexity arises from ADAM22 alternative splicing, which yields several ADAM22 isoforms with different cytosolic tails [341, 409]. Only some ADAM22 isoforms contain interaction motifs for PSD-95 and other ADAM22 cytosolic interaction partners (Table 11). ADAM23, the other ADAM implicated in LGI1 binding, carries only a very short cytosolic tail, and is likely to mediate only a few cytosolic interactions at most, which could elicit cytosolic effects. Hence, the ADAM23-LGI1 interaction might negatively regulate the cytosolic effects off the LGI1-ADAM22 complex.

It was suggested that the ADAM22-LGI1 interaction dependent AMPA regulation involves cell signaling [71, 454]. If this is the case, ADAM22 and possibly other ADAMs are not orphan receptors after all, and ADAMs can be classified from now on also as cellular receptors that can be activated by soluble ligands. The future will show if the interaction between LGI1 and ADAM22 truly activates signaling through the ADAM22 cytosolic tail, and if ADAM22 is the only ADAM capable of activating signaling by binding a soluble ligand. Also, it is interesting to see if all LGI1 family proteins or other LGI-related EPTP-domain containing proteins can activate cellular signaling via ADAMs 22, 23, or possibly through other ADAMs.

2.6.5. Other ADAMs functions neural system

ADAMs have also been associated with several cellular events taking place in the developing, mature and aging neural system not mentioned in previous sections. Table 14 lists some of the most important ADAM-functions in the neural system.

71

Table 14. Selected ADAM functions that regulate molecular or cellular functions in the neural systems.

Neural system associated functions associated with ADAMs references Development ADAM10 regulates the processing of Notch and its ligands in neural differentiation [276] ADAM10 regulates several cue molecules and adhesion molecules implicated in axon guidance including ephrins A2 and A5, EphB2, L1 adhesion molecule, various cadherins, Slit,

(Table 9)

ADAM10 mediated ephrin shedding enables rapid growth cone dissociation and retractions after repulsive signals; also shedding of other adhesion mediating protein might contribute to the rapid dissociation

(Tables 5-6)

ADAM17 regulates the shedding and intramembrane proteolysis of receptors implicated in axon guidance, and neuroblast migration (Nogo-66-receptor/NgR, TrkA, p75NTR)

(Table 6)

ADAMs regulate the shedding and intramembrane proteolysis of several peptide signaling molecules implicated in axon guidance, and neuroblast migration (EGFs, neuregulin-1)

(Table 5)

The presence of ADAM21 protein in radial glial cell processes emanating from the sub ventricular zone and ending in cortical regions suggests involvement of ADAM21 in neuroblast migration in the developing CNS.

[456]

ADAM8 regulates CHL1 implicated in axon guidance and synapse targeting [296] ADAMs regulate several molecules involved in the regulation of synapse number in the developing brain including APP, TNFα, and EGFs

(Table 5)

ADAM22 involvement in PNS axon myelination is indicated by an ADAM22 knock-out mice phenotype. The suggested molecular mechanisms include possible interactions with LGI4 and/or α6β1 integrin.

[341, 455]

The ADAM12 and 28 substrates IGFBP-3 and -5 regulate IGF-1 implicated in myelin formation in the CNS.

[457]

ADAMs 10, 17 and 19 may be involved in the myelinization process as pro-neuregulin-1 and pro-EGFs processing enzymes

[458]

Adult CNS ADAM17 regulates TNFα implicated in microglial activation and migration in the CNS

(Table 5)

The presence of ADAM21 protein in glial processes within the rostral migratory stream suggests involvement of ADAM21 in neuroblast migration in the adult CNS.

[456]

ADAMs regulate EGF-like growth factors that mediate retrograde signaling (Table 5)

2.7. Molecular functions of the ADAM15 protein

ADAM15 is a metalloprotease and a cell adhesion protein, and it has been shown to interact with cytosolic signaling proteins [323, 459]. Human ADAM15 is the only ADAM reported in the literature to contain an RGD integrin-binding motif in its disintegrin loop. The ADAM15 gene is widely expressed in normal mammalian tissues and an induction of expression is detected in e.g. injured sciatic nerves, atherosclerotic lesions, osteoarthritic cartilage, and inflammatory bowel disease [459-463]. ADAM15 is thought to play roles in tissue repair and remodeling, as suggested by cell culture studies and the ADAM15 gene knock-out studies, which indicate defective cartilage remodeling and pathological neovascularization in ADAM15-/- mice [376, 377].

ADAM15 has been associated with the regulation of cell motility and proliferation. Manipulation of its expression has associated ADAM15 with the regulation of kidney

72

mesangial and bladder cancer cell migration [167, 290]. In both cases the involvement of the ADAM15 metalloprotease activity was suggested. Upregulated expression of ADAM15 has been reported in lung, cartilage, and stomach cancers [371], and has been associated with aggressive metastatic phenotypes in breast and prostate cancers [464]. Increased ADAM15 expression has been reported in EBC-1 cell bone metastasis in nude mice [465]. In contrast to the promotion of cell migration, ADAM15 expression has been shown to enhance intercellular adhesion and suppress cell motility in fibroblast-derived cells [466]. Also, ADAM15 expression has been shown to suppress cell migration and proliferation cell autonomously and RGD dependently in an ovary cancer cell line and in intestinal epithelial cells [57, 410]. In these cases ADAM15 was proposed to be a cellular anti-integrin signaling/adhesion molecule [57, 410]. Furthermore, ectopic expression of the soluble ADAM15 disintegrin domain in mice has been shown to suppress tumor growth, presumably due to reduced neovascularization [467]. This is in line with the suggested role of ADAM15 as a pro-angiogenic molecule with the possibility that the soluble ADAM15 disintegrin domain may inhibit normal ADAM15 function [378, 379]. Collectively this suggests that ADAM15 can activate cell proliferation, migration, and invasion and is involved in tissue remodeling through its metalloprotease activity. On the other hand, ADAM15 might suppress the same cellular phenomena by its disintegrin domain presumably by suppressing integrin mediated cell adhesion and/or signaling.

No physiological protease substrates have been found for ADAM15 and several studies have suggested that the mouse ADAM15 may not be an active metalloprotease and cannot cleave EGF-like growth factors [173]. In contrast to mice, the human ADAM15 has been implicated in the shedding of amphiregulin, epiregulin, and HB-EGF and to mediate GPCR induced EGFR transactivation in cancer cells [167-169]. More support for the role of its metalloprotease activity came from in vitro cleavage assays, which have shown that the human ADAM15 metalloprotease domain can cleave type IV collagen and peptides mimicking the known physiological cleavage sites of various proteins [34, 290]. While the human ADAM15 can cleave a CD23 cleavage site peptidomimetic in vitro [34], studies with mouse MEFs has suggested that mouse ADAM15 cannot cleave CD23 in cells [162].

In conclusion, the studies so far suggest that the cellular substrates of ADAM15 remain to be found or that ADAM15 is not an efficient metalloprotease. Alternatively, as indicated by aforementioned observations, the human but not the mouse ADAM15 is an active metalloprotease, and some of the human ADAM15 cellular substrates have already been found [167-169]. If ADAM15 is active metalloprotease in human, more ADAM15 substrates are likely to be found.

The overexpression of ADAM15 in cellular models and studies with a recombinant ADAM15 DI domain have indicated that the human ADAM15 is a integrin adhesion partner as well as an inhibitor of integrin binding in cis [8, 57, 410]. Human ADAM15 has been shown to bind to integrins α2β1, α4β1, α5β1, αvβ3, α9β1, and αIIbβ3 while mouse ADAM15 has been shown to interact only with α9β1 integrin [61, 62, 70, 74, 90-93]. Most of the studies so far have been carried out with recombinant disintegrin domains, which may have produced some non-physiological results. However, the human ADAM15 seems to interact with a wider assortment of integrins compared to mice and thus the mouse and human version of the protein may be functionally different.

73

This thesis study reports alternative ADAM15 pre-mRNA splicing that yields proteins with differing cytosolic tails in immune system cell lines and in intestinal epithelial cells [325, 326, 410]. While all but three ADAM15 cytosolic tail interaction studies have used the short isoform identified in the original cloning report, a number of ADAM15 protein interaction partners has since been identified. The originally identified ADAM15 cytosolic tail has been shown to interact with Src-family kinases, α-actinin-2, EVE-1, Tks5/FISH, MAD2, MAD2β, and endophilin 1 and the sorting nexins -9 and -30 (Table 11). The additional interaction motifs in the longer ADAM15 cytosolic tail isoforms have been shown to interact with Src-family kinases and they may also interact with Nephrocystin and Tks5/FISH (Table 11). The large number of cytosolic interactions with functionally differing proteins suggests that ADAM15 may be involved in many intracellular interactions, and/or that ADAM15 may be regulated in a complex manner.

Despite the demonstrations of interactions with Src-kinases, ADAM15-dependent cellular signaling has not been reported. On the other hand, at least Hck can phosphorylate the ADAM15 cytosolic tail in cells [323]. Phosphorylation was shown to enhance the ADAM15 interaction with Src-kinases and Grb2 and to reduce the interaction with MAD2 indicating that interactions with the cytosolic tail of ADAM15 depend on phosphorylation [323]. Endophilin I, Tks5/FISH, and sorting nexins have been implicated in protein sorting, MAD2 in the regulation of cell cycle progression, and EVE-1 has been shown to regulate the metalloprotease activity of ADAM12. However, there are no reports indicting the functional significance of any of the ADAM15 cytosolic interactions.

At the time when ADAM15 was initially cloned, it seemed to be one of the most potent ADAMs to mediate physiological processes related to cell adhesion, shedding, and signaling. Despite the anticipated importance, the ADAM15 gene knock-out mice are viable and lack obvious strong phenotypes in unchallenged conditions [126, 376, 377]. The knock-out studies have indicated an involvement of ADAM15 in pathological neovascularization and cartilage remodeling [126, 376, 377].

At the molecular level the ADAM15 interactions involved in physiological processes remain to be elucidated. Interestingly, the rodent and human ADAM15s may differ functionally both in their metalloprotease activity and in integrin binding. The mouse ADAM15 functions may be more restricted compared to human, therefore the mild phenotype of the mice with a disrupted ADAM15 gene may not represent the full extent of ADAM15 cellular functions in other organisms. Also, the significance of alternative splicing in ADAM15 regulation is poorly understood, and the use of different ADAM15 isoforms in future studies may reveal new cellular functions for ADAM15

74

3. Aims of the study

In the beginning of this thesis project the number of known ADAM genes was growing rapidly. Specific functions for some individual ADAMs had been identified and they indicated the potential of ADAMs for targeted proteolysis, cell adhesion, and possibly signal transduction. All of these molecular functions are manifest in the nervous system and, on the other hand, misregulated in pathological conditions such as cancer. The major goal of this thesis project was to elucidate the functional regulation of ADAM genes by characterizing their physiological and pathological expression in the CNS and breast cancer cells. ADAM15 was characterized in detail as a prototype ADAM to gain understanding of the regulatory mechanisms underlying the differential expression of ADAM genes. The individual specific aims of the project were:

1. identification of ADAM genes expressed in the adult mammalian CNS 2. characterization of the CNS expression pattern of selected ADAMs 3. characterization of ADAM15 expression in human breast cancer cell lines 4. characterization of ADAM15 alternative splicing in normal human tissues and

breast cancer cell lines 5. functional and comparative characterization of the ADAM15 gene

75

4. Materials and methods

4.1. Materials and methods used in the individual studies

Cells and cell lines III-V Animals and tissues I and II Molecular biology methods Reverse transcription I, III, and IV PCR, RT-PCR I, III, and IV Quantitative PCR LightCycler III Fragment analysis III and IV Cloning and sequencing I, III-V Northern hybridization I and III Oligo-in situ hybridization I and II Fluorescent in situ hybridization IV and V Luciferase constructs IV Transfection IV Luciferase assay IV Computer aided methods I-VI Clustering III Image analysis I-III Sequence handling I-VI Gene structure analysis III, IV, and VI Sequence alignments III, IV, and VI Transcription factor site prediction IV Splicing factor prediction IV Protein sequence similarity analysis IV and VI The supplier’s hometown and country are not mentioned if the supplier is

international company.

4.1.1. Cells and cell lines (III and V)

Cell lines used in thesis project were provided by the Cancer Biology and Cancer Genetics Laboratories of the Institute of Medical Technology (IMT), University of Tampere, Finland and were cultured according to ATCC-recommended culture conditions. Cells were provided by the Cancer Genetics Laboratory as a live cell cultures, as interphase nuclei preparation on glass slides, or immersed in Trizol reagent (Invitrogen) frozen in -70°C for RNA purification,

Metaphase chromosome preparations (V). Metaphase chromosomes were prepared from human peripheral blood lymphocytes collected from karyotypically normal donors. The metaphase slides were prepared according to standard protocols. Shortly, the cells were cultured for four days in RPMI 1640 medium with 20 % serum,

76

stimulated with phytohemagglutin (PHA) and treated with 0.125 µg/ml Colcemid (Gibco-BRL/Invitrogen) for 1 hour. Cells were collected and subjected to a hypotonic solution of 0.56% potassium chloride for 15-25 minutes at +37°C. Lyzed and intact cells were collected with centrifugation and fixed with methanol-acetic acid (3:1). The collection-fixation step was repeated until the cell pellet became white (4 fixations). The cell suspension was spotted onto microscope slides, checked for proper metaphase density, and air-dried and aged for approximately 3 days before use. Slides were used immediately after ageing or stored at -20°C for later use.

Interphase nuclei preparations (III). In part VI the interphase nuclei slides derived from cancer cells were prepared as described for metaphase nuclei, except that the cells were cultured without serum to maximize the amount of cells in G1 interphase and the cells were trypsinized before collection. Subsequent steps were identical to metaphase preparations starting from the 0.56% potassium chloride hypotonic treatment.

Cell culture. For the ADAM15 promoter identification luciferase reporter assay the SK-BR-3 and HCC-1954 cell lines were cultured according to ATCC recommendations. The following cell lines were provided frozen in -70°C immersed in Trizol reagent and as interphase nuclei preparations on glass slides: breast cancer-derived cell lines BT-474, CAMA-1, DU-4475, HCC-1419, HCC-1599, HCC-1954, HCC-202, HCC-38, MCF-7, MDA-134, MDA-157, MDA-361, MDA-415, MDA-436, MPE-600, SK-BR-3, SUM-190, SUM-225, SUM-44-PE, T47-D, UACC-732, UACC-812, UACC-893, UACC-2436, UACC-3133, ZR-75-1, and ZR-75-30; the non tumorigenic breast epithelia-derived cell line HBL-100; the prostate cancer-derived cell line DU145. The RNA from normal human mammary epithelial cells (HMEC) was a kind gift from Dr. Päivikki Kauraniemi and Professor Anne Kallioniemi (IMT Cancer Genetics Laboratory).

4.1.2. Animals and tissues (I-II)

The Balb/c mouse, NMRI mouse, and Wistar rats were provided by the animal facilities of Universities of Tampere and Kuopio. Animals were handled according to the animal experimental regulations of the Universities of Tampere and Kuopio. All efforts were used to minimize the number of animal used and possible suffering.

Mice were sacrificed with cervical dislocation or with carbon dioxide when tissues were used for RNA isolation or in situ hybridization, respectively. Rats were killed with carbon dioxide and their heads were separated with a guillotine. Excised tissues were immediately frozen in liquid nitrogen or in dry ice and stored at -70°C or immersed into Trizol reagent (Invitrogen) or RNAlater (Ambion, Austin, TX) for storage at -20°C.

4.1.3. Molecular biology (I-V)

RNA extraction and PCR (I, III-IV) Total RNA was extracted with Trizol reagent according to the manufacturer’s manual with the exceptions of a extra 10 min centrifugation at 12000 g and the genomic pellet removal steps preceding the phenol chloroform extraction. The additional steps remove most of the genomic DNA and some of the lipid and protein components thus facilitating the subsequent RNA

77

purification and DNase I treatment. mRNA was purified from total RNA with Oligotex mRNA purification reagents (Qiagen).

Reverse transcription and cDNAs. RNAs were reverse transcribed with M-MuLV Superscript II (Gibco-BRL/Invitrogen), or M-MuLV, (Fermentas or New England Biolabs) reverse transcriptases according to the manufacturers’ protocols and with dT16-

25VN-oligo, random hexamers, or various gene specific primers. The template RNA was digested with RNase H (Gibco-BRL/Invitrogen) before PCR. The human tissue cDNA panels MTC I and II used to determine the alternative splicing profile of ADAM15 were purchased from Clontech.

RT-PCR and PCR. Various PCR reactions and strategies were used as described in more detail in the original communications. The primers were purchased from DNA technology A/S (Aarhus, Denmark) or Proligo (Paris, France). The Dynazyme II and Dynazyme EXT (Finnzymes, Espoo, Finland) were used to amplify cDNA, PAC DNA, or plasmid DNA in I, III, IV-V. The Platinum Pfx DNA polymerase (Gibco-BRL/Invitrogen) was used in the amplification of a highly GC-rich region upstream of the ADAM15 gene. DNA restrictions were carried out with enzymes from Fermentas (Vilnius, Lithuania) or New England Biolabs (NEB).

One-tube RT-PCR (I) was carried out with the MasterAmp direct RT-PCR kit (Epicentre, Madison, WI) or with a one-tube RT-PCR mix prepared with Dynazyme EXT (Finnzymes) and M-MuLV (NEB) enzymes in a 1:1 mix (III). Dynazyme EXT/M-MuLV one-tube RT-PCR was used for semi-quantitative PCR. Briefly, the RT-PCR was tested with increasing numbers of PCR cycles for some of the target mRNAs and with each used primer pair. The PCR products were detected and quantified in an agarose gel, and an optimal cycle number from the middle of the log linear phase was chosen to be used with samples.

Detection and quantification of PCR products. PCR products were separated in agarose gels (0.8 %-1-5 %), stained with ethidium bromide and the DNA was detected under a UV illuminator and photography system (GeneGenius) with the PCI BUS Master frame grabber and the Genesnap software (version 4.00.00, Syngene, Cambridge, UK). The recorded PCR products were quantified with the Syngene Genetools software version 3.00.22.

Quantitative-PCR with LightCycler. ADAM15 and its expression levels were analyzed with LightCycler quantitative PCR (Roche), the QuantiTect SYBR Green PCR Kit (Qiagen), and LightCycler capillaries (Roche). The primer pairs for quantitative ADAM15 and TBP amplification were GAGAAAGCCCTCCTGGATG (ADAM15-forward), GGGCAGAATTCAGGCAAGT (ADAM15-reverse), GAATATAATCCCAAGCGGTTTG (TBP-forward), and ACTTCACATCACAGCTCCCC (TBP-reverse).

Fluorescence-PCR and fragment analysis. Variant mRNA profiles for were deduced from the PCR products amplified with 5-FAM labeled CTCAGCTCAAAGCAACCAGCTG (ADAM15 forward) and non-labeled GGTCTGGAGGGTACCACTAGG (ADAM15 reverse). The Amplified ADAM15 DNAs and the ROX-1000 (Applied Biosystems) size standard were added to HiDi formamide (Applied Biosystems) and resolved with an Applied Biosystems 3130 Genetic Analyzer. The Applied Biosystems Genoprofiler software was used for fragment length and volume analysis. For the ADAM15 variants 6a and 6b peak volumes were used in the exon 20 a/b ratio deduction.

78

Cloning and sequencing (I, III-V) PCR amplified and gel purified (Qiagen) DNA fragments were TA-cloned with T4 ligase into the pGem-T-Easy vector (Promega) or with the topoisomerase based pCR2.1 or pCRII cloning systems (Invitrogen). Luciferase pGL2 (Promega) constructs were prepared according to standard molecular biology protocols [468] with restriction enzymes and the T4 DNA ligase from Fermentas. The plasmids were purified in part I with the Wizard miniprep Kit (Promega) and in other parts with the Qiagen plasmid miniprep kit (Qiagen).

The sequencing of PCR products, purified plasmids and PAC DNA was carried out with the ABI dye terminator mix (I) and ABI BigDye sequencing reagents in 10 µl reactions substituting half of the Terminator mix/Big dye reagent with a dilution buffer (400 mM Tris-HCl, 10 mM MgCl2, pH 9.0). The sequences were read with ABI Prism 310 and 3100 Genetic Analyzers (Applied Biosystems) and the sequence data was processed with the ABI data collection software (Applied Biosystems). The sequences were scanned for errors with the sequence trace file visualization and sequence editing program Chromas 1.5 (http://www.technelysium.com.au/chromas.html copyright 1998 technelysium Pty Ltd.).

Northern hybridization (I and III) Total RNA (10 µg or 20 µg) and mRNA (5 µg) extracted from appropriate tissues or cell lines were separated in denaturing formaldehyde (0.7M), 1x MOPS, agarose (1.2%) gels and transferred with capillary transfer to Hybond nylon membranes (Promega). The RNA was UV-cross linked to the membrane. The MultipleChoice mouse multi tissue and rat brain blots I and II were obtained from Origene (Rockville, MD).

Hybridization. The RNA blots were hybridized with dATP-α-32P-labeled (Amersham and ICN) DNA probes prepared with the Strip-EZ random priming kit (Ambion) according to the Strip-EZ protocol. Membranes were prehybridized and blocked overnight at 42°C in a buffer containing 50 % (v/v) formamide, 5x SSPE, 2x Denhardt’s solution, 0.1% SDS (w/v), 10% dextran sulfate (w/v), and herring sperm DNA (100 µg/ml) in work (I). Hybridizations in part VI were carried out in Northern Max Hybridization buffer (Ambion). Both Northern protocols continued with 3x 15 minute washes at RT in 1x SSPE / 0.5% SDS buffer. Followed by a 30 minute wash in 0.2x SSPE / 0.1% SDS buffer at 55°C. Radioactivity levels were monitored with a hand-held Geiger meter, and washes were continued until the background signal was under 20 c.p.s. After the optimal level of radioactivity was achieved, the blots were rinsed 2 times with 2xSSC at RT and wrapped in plastic film.

Signal detection and quantification. PhosphorImager screens (molecular Dynamics) were exposed to the hybridized blots and the intensities of the hybridized probes were detected with a Molecular Dynamics PhosphorImager. Quantifications were carried out with the ImageQuant 5.0 program (Molecular Dynamics).

4.1.4. In situ hybridization (I-II)

Tissue sections. Mouse tissue sections for in situ hybridization (ISH) were prepared as follows. The frozen tissues were cut to 14 µm sections in a Microm HM 500 cryostat, and thaw mounted on Menzel polysine glass slides. The sections were stored at -20°C until use.

79

The gene specific antisense oligonucleotide DNA probes were designed to accommodate a 45-65 % GC content in 39-53 nt long oligos. DNA oligos were purchased from DNA technology A/S, Genset, or Proligo. The terminal deoxynucleotidyl transferase (Amersham/Invitrogen) was used to 3’end label the hybridization oligos with dATP-α32P (New England Nuclear Research) to a specific activity of 1x109 c.p.m./µg.

Hybridization. The hybridizations in I, II, and III were carried out as briefly described here. The tissue section slides were hybridized for 18 h at 42°C in humidified boxes in a hybridization buffer containing one or more of the labeled DNA oligo probes at a concentration of 5 ng/ml each. The control hybridizations contained a 100 time excess of non-labeled DNA oligos corresponding to the labeled ones. The hybridization mixture contained 50% (v/v) molecular biology grade formamide, 4x SSC, 1x Denhardt’s solution, 1% sarkosyl (w/v), 0.02 M sodium phosphate, pH 7.0, and 10% dextran sulfate (w/v). Subsequent washes were performed as follows: four times 1x SSC at 55°C for 15 minutes and one wash slowly cooling from 55°C to RT in 1x SSC lasting approximately for 1 h. Sections were transferred to distilled water and dehydrated in two 30 s ethanol rinses in 60 % and 90 % ethanol.

Detection of ISH signals. Air dried tissue sections were covered with Biomax MR autoradiography film (Kodak) for 30 to 90 days at RT. The films were developed with an LX 24 developer (Kodak) for 2 minutes and fixed with Unifix (Agfa-Gevert) for 15 minutes. For the cellular level signals the hybridized sections were covered with Kodak NTB2 photography emulsion and exposed for 60 days at 4°C. The photography emulsion was developed as above, and the sections were stained with Cresyl Violet and examined and photographed with a Nikon Mikrophot-FXA microscope.

Image analysis. The digital images of exposed and developed films were acquired with a digital image acquisition system connected to a personal computer (PC). The system consisted of a SensiCam digital camera (PCO Computer Optics, Kellheim, Germany), a Nikon 55-mm lens and a Northern Light precision illuminator (Image Research, St. Catharines, Canada). The Image-Pro Plus program (Media Cybernetics) was used to determine the intensity of the signal in interactively delimited regions. The autoradiography levels were normalized to 14C-plastic standards. The average intensity of the delimited region was calculated, and it was used in comparisons to other delimited areas of interest to obtain relative expression levels.

4.1.5. Fluorescent in situ hybridization (III and V)

FISH-probes. For the ADAM15 gene specific probe an arrayed PAC library [469] containing human genomic fragments was screened with an ADAM15 specific PCR. Two clones (PAC 240 C4 and PAC 240 C8) were identified as positive for ADAM15 and were later found to contain the complete ADAM15 gene region. The PAC DNAs were purified from bacterial cultures with a standard PAC purification protocol or with the Qiagen plasmid miniprep kit (Qiagen).

Digoxygenin-11-dUTP-probes were prepared from PAC DNA with a standard nick translation protocol (III) or with the BioPrime random Priming labeling system (Invitrogen) according to the manufacturers protocol except that instead of a biotin labeled dNTP mix a 2 mM dNTP mix supplemented with digoxygenin-11-dUTP to 0.35

80

mM was used. The chromosome 1 centromere reference probe was prepared from a pUC177 plasmid containing the target sequence [470] with nick translation in the presence of a fluerescein-12-dUTP (FITC), dATP, dGTP, dCTP mix (Boehringer-Mannheim). The chromosome 1 centromere plasmid was a kind gift from Professor Jorma Isola. The hybridized digoxygenin-probes were detected with an anti-digoxygenin-rhodamine antibody (Vector Laboratories Inc., Burlingame, CA).

Hybridization. The denatured and dehydrated metaphase chromosome slides and cancer-derived cell line interphase nuclei slides were hybridized overnight in the presence of the digoxygenin conjugated ADAM15 gene probe and the FITC conjugated chromosome 1 centromere probe. Each probe lot was tested for an optimal hybridization concentration. Hybridizations were carried out in a solution containing 50% (v/v) formamide, 0.1 g/ml dextran sulfate, 2x SSC (pH 7), 100 ng/µl Cot-1-DNA, and lot specific amounts of probes.

FISH signal detection. In part V the hybridization signals were detected and the digital images were acquired with a system that consisted of a Zeiss Axioplan 2 epifluorescence microscope with a computer controlled filter cubicle loaded with suitable filters (Chroma Technology Corp., Rockingham, VT, USA) for rhodamine, FITC, and DAPI detection, a Hamamatsu C9585 CCD camera (Hamamatsu Photonics K.K., Hamamatsu-city, Japan), a personal computer, and the ISIS software (Metasystems GmbH, Altslussheim, Germany). In part III the hybridization signals were detected with an Olympus BX50 epifluorescence microscope equipped with a filter wheel loaded with suitable filters for rhodamine, FITC, and DAPI detection.

Transfection and luciferase reporter assay (IV). The ADAM15 gene promoter containing genomic region was identified with firefly luciferase reporter plasmid pGL2-Basic (Promega) constructs. Different sized ADAM15 upstream regions were inserted in forward orientation to the upstream cloning site of enhancerless luciferase vector pGL2-Basic and 4 µg of the different construct plasmid, empty pGL2-basic vector, or SV40 positive pGL2-promoter were transiently transfected to SK-BR-3 and HCC-1954 cell lines. Transfections were done with Lipofectamine Plus reagent (Invitrogen) with standard protocol in optimem medium (Invitrogen).

Luciferase activity elicited by transfected constructs were detected from collected cell lysates with a luciferase substrate reagent system (Promega) according to the manufacturer’s protocol. A 1254 Luminova Luminometer (Bio-Orbit, Turku, Finland) or a Luminoskan Ascent multi-plate luminometer (Thermo/Labsystems, Vantaa, Finland) were used to quantify luciferase activity. Total protein amounts in samples were analyzed with a Detergent Compatible Protein Assay kit (Bio-Rad, Hercules, CA, USA) according to the protocol provided with the kit.

4.1.6. Computer aided methods (I-IV)

Clustering analysis (III) Individual cancer cell lines were statistically sorted to groups according to similarities between the ADAM15 isoform expression patterns detected with RT-PCR. The grouping was carried out with standard parameters in the Genespring statistical clustering software (Silicon Genetics, http://www.silicongenetics.com). Hierarchical clustering and K-means clustering were used and compared to each other. Gene copy number and expression levels between the

81

cell line groups were statistically tested with the nonparametric Wilcoxon two sample test using the R 1.7.1 statistical analysis software.

Sequence retrieval and handling (I-VI). The Genbank sequence databases were searched for novel ADAMs using different Blast programs (http://www.ncbi.nlm.nih.gov/BLAST/) and from published literature in Pubmed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?). The ADAM gene sequence aliases and nomenclature were collected from the literature, Genbank sequence annotations, Judith White’s ADAM web resource; http://www.people.virginia.edu/%7Ejw7g/Table_of_the_ADAMs.html, and the HUGO gene nomenclature committee pages http://www.gene.ucl.ac.uk/nomenclature/. The collected data was published as publicly available ADAM web pages at http://www.uta.fi/~loiika/ADAMs. This ADAM-collection was used as a sequence collection base for ADAM searches, sequence comparisons, gene structure comparisons, and in the design of primers and oligo probes.

The Genedoc program (http://www.psc.edu/biomed/genedoc/) [471] was used for the handling of DNA and protein sequenced. Genedoc was also used for alignment optimizations, sequence comparisons, cDNA and genomic contig sequence assemblies, and construct planning. Different protein and DNA sequence motifs were also searched for with Genedoc.

Genomic DNA alignments. The human, mouse, and rat ADAM15 genes were aligned using two methods (IV). The alignment used in the Consite analysis was assembled in three steps. 1) Human, mouse, and rat genomic and cDNA sequences were aligned with the Clustal W program [472]. 2) Subsequently the alignment was modified in Genedoc guided with the similarity areas identified with the Blast2 program (NCBI, http://www.ncbi.nlm.nih.gov/blast/bl2seq/bl2.html). 3) Finally poorly aligned regions were aligned by hand, or defined as unrelated sequence and were left as they were after automated alignments. This alignment was later found to be very close to the alignment produced with BlastZ, which uses a resembling but fully automated alignment algorithm based on the Blast-program. Due to poor alignment at the promoter region with automated alignment programs, manual alignment was used in the Consite analysis. The raw BlastZ [473] alignment was used in PiP-maker visualization [474], because the PiP-maker requires the use of the accompanying alignment program.

ADAM protein alignments (IV and VI). ADAM protein sequences were collected as described above. The initial alignment with the human ADAMs 1-30 was made with ClustalW [472]. The alignment suggested an initial subfamily division, which was used for subsequent separate automatic ADAM subfamily ClustalW alignments from, which the full ADAM-family-alignment was assembled. This alignment was refined in Genedoc by using primary sequence information and secondary and tertiary structure information extracted from available metalloprotease-, disintegrin- and ACR-domain 3D-structures. The structures of ADAM17 and -33 metalloprotease domains (pdb ids. 1BKC, 1R54, 1R55) and snake venom metalloproteases VAP1 (pdb id. 1ERQ), acutolysin A (pdb id. 1BSW), and atrolysin C (pdb id. 1ATL) were used to guide the metalloprotease domain alignment. The secondary and tertiary structure data of ADAM10 (pdb id. 2AO7), VAP1 (pdb id. 1ERQ), flavoridin (pdb id. 1FVL), kistrin (pdb id. 1N4Y), and echistatin (pdb id. 2ECH) were used in the refinement of DI-ACR alignment. The exon/intron structure data of ADAM genes was used to refine the alignment in regions with ambiguous alignment. Novel ADAMs were added to the

82

family alignment according to their sequence similarity to existing ADAMs and structure information included within the alignment. The alignment or parts of the alignment have been used in protein sequence relation comparisons in works IV and VI.

ADAM protein sequence relationship (IV and VI). The ClustalX 1.83 software [475] running on a personal computer was used to build the sequence relationship tree and bootstrap the branching of the tree depicting the sequence similarity of the ADAMs. The dendrograms were visualized with Unrooted.exe.

ADAM exon/intron structure determination (IV and VI). Human, mouse, nematode, and frog protein and genomic sequences retrieved from Genbank were used to deduce the genomic organization of ADAM-genes in the Wise2 program. Ambiguous intron borders were resolved by manual cDNA, protein, and genomic sequence comparison. information on intron location and phase was included into the full ADAM-family protein alignment and this was used in the full ADAM-family gene structure comparison in IV and VI.

Transcription factor binding site prediction and promoter search (IV). To locate the putative promoter region and to predict its type, several different transcription factor binding site searches were used. Searches based on Transfac 6.0 [476] matrices for binding sites were used with the public version of the Match program (http://www.gene-regulation.com/cgi-bin/pub/programs/match/bin/match.cgi?). Composite transcription factor binding site elements within the promoter region were searched for with the Compel Pattern Search 1.0 program (http://compel.bionet.nsc.ru/FunSite/CompelPatternSearch.html) [477]. Phylogenetically conserved transcription factor binding sites were searched for with the Consite [478] and rVista [479] programs.

Splicing factor binding site prediction (IV) Exonic splicing enhancer sites were searched for with the ESE-finder [480] and rescue-ESE [481] programs. The consensus sequences for different splicing factor binding sites were also collected from literature, and sites were located in human, mouse, and rat ADAM15 genes interactively with the Genedoc search.

Miscellaneous programs (IV and VI) Genomic sequences were examined for repeat sequences with the RepeatMasker program (http://ftp.genome.washington.edu/RM/RepeatMasker.html, copyright Smit, AFA & Green, P). CpG islands were detected with the cpgplot program (http://www.ebi.ac.uk/emboss/cpgplot/) [482]. Restriction sites within DNA sequences were located with the Webcutter 2.0 (http://rna.lundberg.gu.se/cutter2/index.html, Webcutter 2.0, copyright 1997 Max Heiman).

83

5. Results

The first part of this section reviews and extrapolates the combined results of gene and protein sequence studies of the whole ADAM-family in parts IV and VI. The latter sections review the salient findings described in parts I-V, the detailed information of which the can be found in the original publications.

5.1. ADAM genes and proteins (IV and VI)

5.1.1. ADAM web pages (VI)

At the time when this work began ADAMs (already) comprised a large and expanding gene family. To possess up-to-date knowledge of the size of the ADAM gene family and relatedness of its members, full length and parts of putative novel ADAM sequences were collected and comparatively analyzed. The sequence collection results were published as web pages also containing information of nomenclature and chromosomal locations of ADAMs (VI). Easily accessible links to ADAM sequences and to the most appropriate general gene information pages (NCBI gene, Locus link, OMIM) were included in the pages. Recently, the ADAM pages have been replenished with information on alternatively spliced ADAM transcripts and links to ADAM protein sequences in various species.

The ADAM pages have been visited over 10 000 times and they have been cited in several high impact peer reviewed publications by the ADAM community, see e.g. [21, 370, 387]. Most of the visits to the human and mouse ADAM pages have been from Finland, USA, Japan, and Korea, from computers in academic or non-profit organizations or belonging to bio-company networks (data not shown).

5.1.2. The Number of human and mouse ADAM genes and proteins (VI)

Currently 40 numbers have been reserved for ADAM genes in different species (VI and http://people.virginia.edu/~jw7g/Table_of_the_ADAMs.html). The number of ADAM genes varies between species. The human genome contains 21 potentially functional ADAM genes, of which an ortholog for ADAM20 is absent from the mouse genome (Table 15). The mouse genome contains 39 potentially functional ADAM genes of which 20 are orthologous to functional human genes and 19 are absent or likely non-functional in humans (Table 15). Four reserved ADAM-numbers (13, 14, 16, and 35) correspond to ADAMs that do not have unambiguous human or mouse orthologs (Figure 13). Mouse orthologs of human ADAMs 18 and 21 have been named ADAMs 27 and 31, respectively, and therefore these two ADAMs reserve four numbers. ADAMs 1, 4, 6, and 26 contain several paralogs that are highly similar to each other and are named 1A, 1B, 4A, 4B, 4C, 6A, and 6B (Table 15). Contrasting the naming

84

scheme of ADAMs 4A-C and 6A-B ADAMs 34, 36, 37 and ADAMs 25, 39, and 40, which are similarly very close in sequence, are given their own numbers. Some of the full length open reading frame containing ADAM genes may actually be ADAM-gene derived pseudogenes, however, this depends on the definition of ‘pseudogene’. On the other hand, the presumed pseudogenes with long open reading frames may be functional and even highly relevant genes. For example, activation of the human ADAM21P pseudogene has been reported in a T-cell receptor inversion event that is frequent in T-cell malignancies [483]. Altogether there are 60 separate potentially functional ADAM genes and in addition several ADAM gene derived pseudogenes in the human and mouse genomes.

Alternative pre-mRNA processing is an important cellular mechanism fore increasing the number of functionally differing proteins without increasing the number of genes. Many ADAM pre-mRNAs are processed alternatively to encode, in addition to a full length ADAM, a potentially soluble ADAM-isoform containing an in frame stop between the disintegrin and transmembrane domains (Table 15). Alternative splicing of the cytosolic tail encoding exons is common and in some alternative ADAM-transcripts the exon encoding part of the EGF-like domain is skipped (Table 15). The Genbank sequences of ADAM variant transcripts suggest that the number of potentially functional ADAM protein isoforms is at least 50 in human and at least 80 in mouse (VI).

85

Table 15. Human and mouse ADAM genes

ADAM Species MP* exons locus alt. spl. CommentADAM2 human no multi 8p11.2 noADAM3 human no multi 8p21-12 yes Complex alt. spl. In frame stop in alt exonADAM5P human no multi 8p11.2 yes Non-functional multi-exon pseudogeneADAM7 human no multi 8p21.2 yesADAM8 human mp multi 10q26.3 yes Soluble alt. / tail isoformADAM9 human mp multi 8p11.23 yes Soluble alternativeADAM10 human mp multi 15q22 yes Soluble alternative reportedADAM11 human no multi 17q21.3 yes Soluble alternativeADAM12 human mp multi 10q26.3 yes Soluble alternativeADAM15 human mp multi 1q21.3 yes Alt. cytosolic tailsADAM17 human mp multi 2p25 yes Soluble alt. / tail isoformADAM18 human no multi 8p11.22 yesADAM19 human mp multi 5q32-33 yes Alt. cytosolic tailsADAM20 human mp single 14q24.1 noADAM21 human mp single 14q24.1 noADAM21P human mp single 14q24.1 no pseudogeneADAM22 human no multi 7q21.1 yes Alt. cytosolic tailsADAM23 human no multi 2q23 yesADAM28 human mp multi 8p21.2 yes Soluble alt. / tail isoformADAM29 human no single 4q34.2 noADAM30 human mp single 1p11-13 noADAM32 human no multi 8p11.23 yes Alt. cytosolic tailADAM33 human mp multi 20p13 yes Complex alt. splicing e.g. EGF-skipping formADAM1A mouse mp single 5 F noADAM1B mouse mp single 5 F noADAM2 mouse no multi 14 D1 yesADAM3 mouse no multi 8 A2 noADAM4A mouse no single 12 C3 noADAM4B mouse no single 8 C2 noADAM4C mouse no single 12 C3 noADAM5 mouse no multi 8 A2 yes Soluble alternativeADAM6A mouse no single 12 F1 noADAM6B mouse no single 12 F1 noADAM7 mouse no multi 14 D1 noADAM8 mouse mp multi 7 F3-F5 yes Alt. cytosolic tailsADAM9 mouse mp multi 8 A2 yes Alt. cytosolic tailsADAM10 mouse mp multi 9 D noADAM11 mouse no multi 11 E1 yes Alt. cytosolic tailsADAM12 mouse mp multi 7 F4-F5 noADAM15 mouse mp multi 3 F1 yes Alt. cytosolic tailsADAM17 mouse mp multi 12 A1.3 yes Soluble alternativeADAM18 mouse no multi 8 A2 noADAM19 mouse mp multi 11 A5-B1.1 yes Alt. cytosolic tailsADAM21 mouse mp single 12 D1 noADAM22 mouse no multi 5 A1 yes Alt. cytosolic tailsADAM23 mouse no multi 1 C2 yes Soluble alt. / tail isoformADAM24A mouse mp single 8 A4 noADAM24B mouse mp single 8 A4 noADAM25 mouse mp single 8 A4 noADAM26A mouse mp single 8 B1.1 noADAM26B mouse mp single 8 B1.1 noADAM32 mouse no multi 8 A2 yes Soluble alternativeADAM28 mouse mp multi 14 D1 yes Soluble alt. / tail isoformADAM29 mouse no single 8 B2 noADAM30 mouse mp single 3 F3 noADAM33 mouse mp multi 2 F1 yes Complex alt. splicing e.g. EGF-skipping formADAM34 mouse mp single 8 B1.1 noADAM36 mouse mp single 8 B1.1 noADAM37 mouse mp single 8 B1.1 noADAM38 mouse mp single 8 A4 noADAM39 mouse mp single 8 A4 noADAM40 mouse mp single 8 A4 noADAM13 Clawed frog mp na na na Frog ADAMxMDC13 Clawed frog mp na na na PseudocopyADAM14 Neamatode no multi na no Nematode ADAMADAM16 Clawed frog mp na na na Frog ADAMADAM35 Chicken mp single na no Chicken ADAM* metalloprotease active site consensus (HEXGH) present, # chromosomal location, ¤ alternative splicing variants detected

86

5.1.3. ADAM family gene structure and protein sequence similarities (IV and VI)

Close relatedness of genes implies conservation of functions and/or regulation. Also, the similarity in protein sequence suggests functional conservation. Furthermore, conservation of genes derived from diverse species suggests physiological importance. The relatedness of ADAMs was studied in order to sort out the ADAMs with potentially the greatest physiologically importance and to find the functionally related or redundant ADAMs. This was carried out by analyzing the human, mouse, and nematode ADAM gene structures and human, mouse, nematode, fruitfly, zebrafish, frog, and chicken ADAM-protein sequence similarities comparatively. In this study the animal furthest from human was the nematode. Since nematodes and humans are evolutionary very far apart, the high similarity in their ADAMs indicates very broad conservation in the animal kingdom and thus suggests physiological importance.

5.1.3.1. Exon/intron structure groups found in ADAM genes

The human, mouse, and nematode ADAM genes fell into five groups (ADAM10s, ADAM17s, brain-MDCs, rest of multiple-exon-ADAMs, and single encoding exon ADAMs) based on their exon/intron structures (Table 16 and Figure 12 and VI). The exon/intron structures show group specific conservation in a region encoding the extra-cellular to transmembrane domain portion. However, gene structures at regions encoding the cytosolic tails are different in almost each ADAM in the brain-MDC and multiple-exon groups, and there are differences even between the human and mouse orthologs (IV). The gene structures in the groups ADAM10 and ADAM17 differ from the rest of the ADAMs through out the gene region and from each other, especially by exon/intron structure at regions encoding metalloprotease- and ACR-domains important for proteolytic-functions. The brain-MDC gene-structure-group differs from other ADAM genes by group-specific extra introns at pro-, disintegrin-, and ACR-domain encoding regions. On the other hand, several intron locations and phases are conserved in brain-MDCs and other ADAM genes. The multiple-exon ADAMs that do not belong to the ADAM10, ADAM17 or brain-MDC group, are almost identical in the exon/intron organization of their extracellular to TM encoding region and thus form their own group depicted here as the multiple-exon-ADAMs (Table 16 and IV). The only major exception is the ADAM15 gene, which has lost an intron (IV). Also, the length of the extracellular juxta-membrane region encoding exon varies within the group, and the ADAM proteins 7, 8, 15, and 28 lack the membrane proximal conserved ADAM motif (VI). The simplest exon/intron structures are those of ADAM1A, ADAM1B, and testase genes (Figure 12), the protein encoding region of which is not interrupted by introns (IV).

87

Table 16. ADAM-family gene structures at the ectodomain to transmembrane domain encoding region.

Figure 12. Intron locations in the ADAM-family. The vertical lines indicate intron locations relative to the ADAM protein sequence alignment. The tilted lines indicate the intron phase from zero to two. The numbers above the introns are order numbers and correspond to numbers in the upmost row in Table 16.

AD

AMG

roup

12

34

56

78

910

1112

1314

1516

1718

1920

2122

2324

2526

2728

2930

3132

3334

3536

3738

3940

4142

4344

4546

4748

49A

DAM

10A

DAM

101

-2

--

1-

--

1-

0-

0-

0-

-1

--

--

0-

--

1-

--

2-

--

--

-0

--

-1

--

--

01

ceAD

AM

10A

DAM

100

-2

--

10

--

2-

--

--

00

-1

--

--

-1

--

--

--

--

0-

--

--

--

-1

--

--

00

AD

AM17

AD

AM17

1-

2-

-1

-0

--

-1

-0

-0

0-

-1

-0

--

--

0-

--

-2

--

1-

--

--

1-

--

-0

-1

0ce

ADA

M17

AD

AM17

1-

1-

-1

--

--

0-

--

-2

0-

--

--

1-

--

0-

--

1-

--

2-

--

--

1-

--

-0

-1

0AD

AMs

11, 2

2, &

23

Brai

n-M

DC

s1

0-

20

-2

-0

-1

00

-0

--

2-

-0

--

-1

2-

-0

0-

-0

--

00

--

1-

2-

2-

-0

12

mm

dB

rain

-MD

Cs

10

-2

0-

--

0-

--

--

2-

-2

--

--

--

1-

--

00

--

0-

--

-1

--

-2

-2

--

01

2A

DAM

14B

rain

-MD

Cs

1-

--

--

--

--

--

0-

0-

--

--

--

--

--

--

00

--

--

--

--

--

--

--

--

--

2m

-exo

n AD

AM

sm

-exo

n AD

AM

s1

0-

20

-2

--

--

00

-0

--

2-

-0

--

--

2-

--

0-

-0

--

--

--

1-

2-

-0

-0

12

ceAD

M-2

m-e

xon

ADA

Ms

--

-2

0-

1-

--

1-

0-

0-

-2

--

0-

--

--

--

--

--

--

--

0-

--

-2

--

0-

12

2A

DAM

15m

-exo

n AD

AM

s1

0-

20

-2

--

--

00

-0

--

2-

-0

--

--

2-

--

0-

-0

--

--

--

--

2-

-0

-0

12

Sin

gle-

enco

ding

exo

ns-

enco

ding

exo

n-

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

--

Run

ning

num

ber 1

-49

indi

cate

s in

tron

loca

tions

in A

DAM

pro

tein

alig

nmen

t fro

m s

tart

to fi

rst c

ytos

olic

par

t enc

odin

g ex

on a

nd 0

-3 in

tron

phas

e. S

imila

rity

grou

ps a

re s

epar

ated

by

horiz

onta

l lin

es. m

-exo

n AD

AMs

are

hum

an a

nd m

ouse

mul

ti-ex

on-A

DAM

s ex

clud

ing

ADAM

s 10

, 15,

17,

11,

22,

23

and

sing

le e

ncod

ing

ADAM

s ar

e AD

AMs

1a, 1

b, a

nd te

stas

es (F

ig. P

hylo

). Sh

adin

g in

dica

tes

loca

tion

in d

iffer

ent A

DAM

-dom

ains

Pro

, pro

; M

P, m

etal

lopr

otea

se; D

I, di

sint

egrin

, AC

R, A

DAM

cys

tein

e ric

h; E

GF,

EG

F-lik

e; T

M, t

rans

meb

rane

par

t.

TMD

IM

PPR

OE

GF

AC

R

*D

H

CS

TTM

EG

FAC

RD

IM

PPr

oPr

e

21

35

46

87

911

1012

1315

1416

1817

1921

202223

2524

2628

2729

3032

3133

3534

363837

3940

4241

4345

4446

484749

88

5.1.3.2. ADAMs fall into seven protein subfamilies

The ADAM-protein sequence similarity analysis paralleled the gene-structure-grouping almost completely; compare the branching of the ADAM similarity tree in Figure 13 and the gene structures in Table 16. Based on the two analyses the ADAM-family was divided into seven subfamilies and four ambiguous ADAMs (Figure 13). In this part, the subfamilies were named after the subfamily members; ADAM9, -10, -17, metargidin/meltrin/MS2 (MMM) subfamilies; or by their historical name and/or prominent functional or structural feature, or preferred expression; brain-MDCs, non-MP-fertilins, and testases.

Protein sequence conservation from nematode to human implies broad conservation in the animal kingdom and thus functional importance for protein in question. Four ADAMs are expressed in nematode and of those ADAM10 and ADAM17 are highly similar to the corresponding ADAM proteins in the fruitfly and vertebrates (Figure 13). Altogether the proteins in subfamilies of ADAM10 and -17 are tightly clustered (Figure 13) indicating very high sequence similarity, which in turn suggests conserved functions and a physiological importance for these ADAMs. All ADAMs in these two subfamilies contain the metalloprotease active site consensus residues (HEXGH) and most have been shown to be catalytically active. The most prominent subfamily specific sequences in the ADAM10 and 17 subfamilies are present in the ACR-domain and transmembrane-, and cytosolic parts (data not shown). Furthermore, the ADAM10 and 17 proteins lack the EGF-like domain.

The brain-MDC subfamily contains, in addition to vertebrate proteins, well-conserved ADAMs found in nematode and fruitfly genomes (Figure 14). However, instead of one ADAM in the nematode and fruitfly, vertebrates contain three ADAMs, which form a cluster of highly conserved ADAMs. This suggests highly conserved functions and a physiological importance for ADAMs 11, 22, and 23. All brain-MDCs lack the consensus metalloprotease active site residues, which is consistent with their functional relatedness.

The fourth nematode/fruitfly ADAM pair (adm-2/neu3) is not clearly orthologous to any vertebrate ADAM by sequence similarity (Figure 13). Furthermore, adm-2 and neu3 protein sequences show similar levels of conservation with a large number of vertebrate ADAMs. Also the exon intron structure of adm-2 shows similarity with ADAMs in the MMM-, ADAM9, and non-MP-testase subfamilies (Table 16 and Figure 13). However, the presence of metalloprotease active site residues and multiple proline-rich motifs in cytosolic tails as seen in MMM- and ADAM9 subfamily members, suggests that adm-2 and neu3 belong to the MMM- or ADAM9 subfamilies.

The vertebrate members of the MMM-subfamily can be subdivided into ADAM15, ADAM12, ADAM19/-13/-33, ADAM7, ADAM8, and ADAM28 groups according to protein sequence similarity. Also, the seemingly isolated ADAM9 group contains members with almost identical gene structures and high sequence similarity in key parts of the protein compared to MMM-subfamily members, thus suggesting closer functional relatedness than the overall sequence relatedness suggests. The ADAMs in the MMM- and ADAM9 subfamilies show lower a level of conservation between the orthologs compared to that of the brain-MDCs, ADAM17s, or ADAM10s. This suggests less conserved and less important functions for individual ADAMs in these groups.

89

Functional relatedness of ADAMs in the MMM- and ADAM9 subfamilies is also supported by the presence of metalloprotease active site amino acids for catalytic activity in all their members except ADAM7s. Furthermore, most of the MMM- and ADAM9 group members contain a variable number of related proline-rich sequence motifs in their cytosolic tails (data not shown). Also, the similarity in the cytosolic tail encoding region exon/intron structures parallels the similarity of the proline-rich motifs in ADAMs 8, 9, 12, 15, 19, and 28, which supports relatedness for these ADAMs (IV). Many of the exons encoding cytosolic tails in these ADAMs are used alternatively, and there are differences between the vertebrate orthologs in the gene structures at region encoding their cytosolic tails (IV).

ADAMs 1A, 1B, and 16 and members of the testase and non-MP-fertilin subfamilies are found only in vertebrate genomes and all but ADAMs 1A, 4, 5, and 21 are expressed mostly in the testis or in other reproductive organs. The testases, ADAM1A, and ADAM1B differ from the non-MP-fertilins by gene structure since they have only one encoding exon, and the non-MP-fertilin genes have a gene structure similar to the MMM-subfamily ADAMs. Most testases result from recent gene duplication events in the rodent genome and are not found in other studied vertebrates. Testase genes have been duplicated also in other animal lineages as indicated by the human specific ADAM20 and chicken specific ADAM35 gene (Figure 13). Furthermore, several testase related genes with or without inframe stop codons are also present in other vertebrate genomes (data not shown). Testases are likely redundant in function because a large number of highly similar genes are expressed in reproductive tissues. ADAMs with and without metalloprotease active site consensus are present in this subfamily.

Mouse ADAMs 1A and 1B are likely products of a gene conversion event between two closely related genes with a 99 % identical middle portion and differing 5’ and 3’ portions. The expressed proteins contain an almost identical amino-terminal half, and a differing carboxy-terminal-half starting from disintegrin domain. The single human ADAM1 gene contains an early in-frame stop codon, and is thus likely not functional. ADAM1A and ADAM1B without in-frame stops can be found in e.g. the macaque and bovine genomes (data not shown) and thus it is surprising that the human genome contains only one ADAM1.

The non-MP-fertilin subfamily proteins are encoded by multiple-exon ADAM genes. They do not have metalloprotease active site consensus residues and are likely adhesion proteins. The human ADAM genes 3 and 5 contain in frame stop codons and are presumably multiple-exon pseudogenes. Furthermore, genes or proteins corresponding to the mouse ADAMs 3-5 were not found in chicken or zebrafish, although ggADAM pred2 may belong to the non-MP-fertilin subfamily supported by its exon/intron structure and the lack of metalloprotease active site residues (data not shown). Frog ADAM16 may also belong to non-MP-fertilins since its protein sequence is closest to ADAMs 1, 9, 35, and non-MP-fertilins and it does not contain amino acids for catalytic activity. However, since there is no gene structure available, the ADAM16 grouping remains ambiguous.

90

Figure 13. The ADAM family tree of relatedness and grouping according to protein sequence similarity and gene structure comparison. The tree branching and branch length indicate the similarity between ADAMs. The suggested subfamilies are indicated with encircling. The ADAMs from different animals in the tree are indicated with two letter prefixes as follows: nematode (C. elegans, ce), fruitfly (D. melanogaster, dm), sea urchin (S. purpuratus, sp) frogs (X. laveis, xl, X. tropicalis xt), birds (G. gallus, gg; C. coturnix, cc), zebrafish (D. rerio, dn), mouse (M. musculus, mm), and human (H. sapiens, hs). Partial proteins and proteins predicted from genomic sequences are marked with part and pred, respectively. The black dots indicate loss of conserved amino acids required for catalytic activity (HEXGH). The bar indicates length of the 10 % sequence divergence in the aligned proteins.

Testases

Non-MP-fertilins

AD

AM

-9ADAM-17

ADAM-10

Brain-MDC

Met

argi

din/

Mel

trin/

MS2

(MM

M)

dmM

ind-m

eld

ceADAM-14

mmADAM-7ggADAM

-22 pa

rt

hsA

DA

M-2

2mmADAM

-22

drADAM-22

part

xlADAM-22

hsA

DA

M-1

1

mm

AD

AM

-11

drA

DA

M-2

3 pa

rt

ggA

DA

M-2

3 pa

rths

AD

AM

-23

mm

AD

AM

- 23

drA

DA

M-1

1 pa

rt

ggA

DA

M-1

1 pa

rtxl

AD

AM

-11

part

hsADAM-7

mmADAM-33drADAM-8B pred

drADAM-8ggADAM-8 pred

hsADAM-8mmADAM-8xlADAM-28 pred

drADAM-28 pred

hsADAM-28

mmADAM-28

dmADAM

neu3A

ceADM-2

hsADAM-15

mmADAM-15

drADAM-15 pred

drADAM-12 pred

ggADAM-12 predhsADAM-12

mmADAM-12

hsADAM-19mmADAM-19

ggADAM-13 pred

drADAM-13 predxlMDC13xlADAM-13

spADM-1

hsADAM-33

drADAM-19 predccADAM-19

ggADAM-19 predccADAM-12xtADAM-12

ggAD

AM

- 18 p ar tggA

DA

M-32 part

mm

AD

AM

-32

hsAD

AM

-32

mm

AD

AM

-2

hsAD

AM

-2

mm

AD

AM

-18

hsAD

AM

-18m

mA

DA

M-3

mm

AD

AM

-5

ggA

DA

M- p

red2ggAD

AM-3

5gg

AD

AM

- pre

d1

xlADAM-9ggADAM-9mmADAM-9

hsADAM-9

mmADAM-4AmmADAM-4BmmADAM-4A

mmADAM-6AmmADAM-6B

mmADAM-30hsADAM-30

mmADAM-1A

mmADAM-1BxlADAM-16

mmADAM-26AmmADAM-26B

mmADAM-34

mmADAM-37

mmADAM-36

mmADAM-24A

mmADAM-24B

mmADAM-29

hsADAM

-29hs

ADAM-2

1P

hsADAM

-21

mm

ADAM

-21/

31hs

ADAM

-20mmADAM-39

mmADAM-40

mmADAM-25mmADAM-38

ggADAM-9-like pred

ceAD

AM

-17

dmA

DA

M-17

drAD

AM

-17B pred

drAD

AM

-17A pred

xlAD

AM

-17

ggADAM

-17

hsADAM-17

mm

ADAM-17

dmADAM-10B

dmADAM-10A

ceADAM-10drADAM-10A

ggADAM-10

xlADAM-10hsADAM-10

mmADAM-10

drADAM-9 pred

drADAM-10B pred

0.1

91

5.2. ADAM expression in the adult central nervous system (I and II)

When beginning parts I and II the ADAMs comprised a growing family of genes potentially important for the central nervous system (CNS). Integrins had been shown to be involved in CNS development and had been implicated in the regulation of synaptic plasticity [484]. However, physiological ligands for integrins had not been identified. Also, the ADAM-related snake venoms were known to inhibit synaptic integrins, suggesting involvement of ADAMs in synaptic inhibition [448]. Furthermore, the role of ADAM as a major family of sheddases was emerging, and the involvement of ADAMs in APP processing suggested an association with neural pathology [202]. The regional CNS expression of most of the ADAMs was uncharacterized. In this study ADAMs were examined at the mRNA level, in order to identify ADAMs expressed in the CNS. Furthermore, to comparatively analyze the candidate APP α-secretase ADAMs 10 and 17, their regional expression was characterized by in situ hybridization.

5.2.1. Several ADAMs are expressed in the adult mouse brain (I)

The expression of sixteen ADAM genes belonging to ten different ADAM subfamilies was detected in the CNS by RT-PCR (Table 17). Eight of the sixteen ADAMs showed expression level high enough for detection by Northern hybridization (Table 17). These eight transcripts belonged to the ADAM9, -10, -17, brain-MDC and MMM ADAM-subfamilies. All studied subfamily members were detected in the CNS, suggesting that the relatedness correlates with the CNS expression. The expression levels of eight ADAMs belonging to the ADAM1, non-mp-fertilin, or testase subfamilies were either under the detection level or barely detectable in our Northern hybridization protocol. The results suggest low or restricted CNS expression for these ADAMs (Table 17).

Table 17. ADAMs in mouse brain

ADAM Subfamily MP DI RT-PCR Brain NBADAM1A ADAM-1 + + + weakADAM2 non-mp-fertilins - + + ndADAM3 non-mp-fertilins - + + ndADAM4 non-mp-fertilins - + + ndADAM5 non-mp-fertilins - + + ndADAM7 non-mp-fertilins - + + ndADAM21 testase + + + naADAM10 ADAM-10 + + + strongADAM17 ADAM-17 + + + weakADAM11 brain-MDCs - + + strongADAM22 brain-MDCs - + + naADAM23 brain-MDCs - + + strongADAM9 ADAM-9 + + + strongADAM12 ADAM-12 + + + moderateADAM15 ADAM-15 + + + naADAM19 ADAM-13/19/33 + + + weakADAM33 ADAM-13/19/33 + + + naMP/DI indicate potential functionality as metalloprotease and/or adhesion protein in cells. Brain NB indicate signal strength compared to other mouse tissues. Abreviations na, data not available and nd, not detected.

92

5.2.2. Regional expression of ADAMs in the rat CNS (I)

The distribution of ADAM expression in the adult rodent CNS was studied with RNA-blots containing total mRNAs extracted from 12 different rat CNS regions. The relative expression profiles of detected ADAM 9, 10, 11, 15, 17, and 23 transcript variants are shown in Figure 15. Expression of ADAM12 and 22 was also detected but the hybridization results were not reliably quantifiable on reused blots after several probing and stripping cycles and are thus not presented.

ADAMs 10 and 15, and the major variant of ADAM9, all belonging to different ADAM subfamilies, showed the most prominent CNS expression. The signals of variants of these ADAMs were distributed relatively evenly in the different CNS regions. The lowest regional signal of the individual variant was over 40 % compared to the strongest expression. The ADAM9 minor variant expression levels were 20-30 times lower than the levels of the major variant and are thus considered negligible and omitted in discussion. One should note that expression levels between the different ADAMs are not comparable.

Figure 14. The regional expression profiles of ADAM variants in rat brain Northern blots. Colors represent the relative expression of ADAM variant mRNA in regions of the rat brain. Black/100% represents the strongest and white/0 % the lowest relative total mRNA expression. The expression levels are not comparable between different ADAMs. Average indicates the average relative signal level of the particular ADAM variant.

ADAM17 showed a variable expression pattern with generally low expression levels. All telencephalic regions showed a low signal intensity (<40%) compared to the highest signal detected in the midbrain, medulla, and spinal cord. Thalamus, cerebellum and pons showed moderate ADAM17 expression levels.

The ADAM12 (8.1 kb) signal in CNS regions was detected in the hippocampus, thalamus, cerebellum, midbrain, pons, and medulla (unpublished data). However, ADAM12 negative regions; the frontal cortex, entorhinal cortex, and olfactory bulb, had

93

high signal to noise ratios and were unreliable for quantification. Although incomplete, the result suggests wide expression of ADAM12 in the CNS.

The ADAM11 5.5 kb major variant showed high or moderate expression in eight of the twelve CNS regions (Figure 15). Less than a third of the highest signal intensity in the entorhinal cortex was detected in the pons, spinal cord, frontal cortex, and olfactory bulb. The signal corresponding to the 4.4 kb ADAM11 variant showed very high levels in the cerebellum, high levels in the midbrain and medulla and moderate levels in five other regions. The strongest but still relatively weak signal of the ADAM11 3.7 kb minor variant was detected in the frontal cortex, hippocampus entorhinal cortex, and striatum.

Two transcript variants of ADAM23 showed variable regional expression in the rat CNS. However, the differences were not as prominent as between the ADAM11 variants. A signal for the 6.7 kb major variant was detected at a level of at least 50 % in nine CNS regions. The frontal cortex, olfactory bulb, and striatum showed 34 to 48 % signal levels compared to the strongest signal in the spinal cord. The 3.0 kb minor variant signal levels varied more, and the lowest detected signal level in the hippocampus was only 13 % of the strongest seen in the thalamus. The midbrain, entorhinal cortex and olfactory bulb showed also less than one third of the intensity of the strongest signal. In the rest of the regions the signal level was over 45 % of the strongest level detected in the thalamus.

5.2.3. ADAMs 10 and 17 are expressed differently in the mouse CNS (I)

ADAMs 10 and 17 have been indicated as amyloid precursor protein (APP) α-secretases in cultured cells (section 2.1.3.). Disturbed β-APP processing has been suggested to cause Alzheimer’s disease [426] and thus the regional CNS expression of the candidate α-secretases, ADAM10 and 17, was of special interest.

ADAM10 showed relatively weak overall expression level as deduced from the long exposure time (90 days) that was required for a prominent ISH signal. A moderate or strong ADAM10 signal was detected in the cerebellum, all cortical regions, the hippocampus, and the inferior colliculus. A low signal was detected in several regions in the diencephalon (I) and a diffuse low signal was detected throughout the CNS.

ADAM17 also showed weak overall expression as deduced from the long exposure time (90 days) required for a prominent signal. The overall expression was much more restricted compared to that of ADAM10 and the hippocampus was the only region showing even low signals in telencephalon or diencephalon. A much more prominent ADAM17 signal was observed in the inferior colliculus and cerebellum, which were the only regions showing strong or moderate expression of both ADAM10 and ADAM17. The pontine nuclei were the only areas in the CNS showing clearly stronger relative ADAM17 expression compared to ADAM10.

94

5.2.4. ADAM11 is expressed in a subset of neurons and in some extra-CNS tissues in adult mouse (II)

ADAM11 is a prototype of a preferentially neurally expressed non-metalloprotease ADAM subfamily, which has been linked to neuronal development in Xenopus laevis [393, 485]. ADAM11 was also a candidate ligand for neural integrins associated with CNS functions, but lacking known interaction partners. Therefore, a detailed analysis of ADAM11 expression in mouse was carried out to provide information about a gene putatively important for the normal function and development of the CNS.

Differing levels of ADAM11 expression were detected throughout the mouse CNS and PNS (see the Figures and more detailed information in II). In the telencephalon the strongest ADAM11 mRNA expression was detected in hippocampal pyramidal neurons, the dentate gyrus, in all cortical fields, the medial habenular nucleus, and neurons of mitral and glomerular layers in the olfactory bulb. The only major CNS field that wasn’t labeled was the corpus striatum. Diencephalic and brainstem nuclei showed variable strength in ADAM11 labeling. The strongest signal in the diencephalon was detected in the epithalamic medial habenular nucleus, thalamic ventroposterior medial/lateral nuclei, and hypothalamic mammilary bodies. Several brainstem nuclei were very strongly labeled as was the grey matter in the spinal cord. The reticular part of the midbrain substantia nigra and most of the medullary nuclei were the most prominent brainstem fields devoid of detectable ADAM11 mRNA. In the cerebellum a positive signal was detected uniformly in the granular layer, molecular layer interneurons between the Purkinje-cells, and in a subset of large neurons in cerebellar deep nuclei. The Purkinje-cells themselves were negative for ADAM11 labeling. The location and morphological features suggest that the ADAM11 positive cerebellar molecular layer neurons represent lateral inhibition mediating basket cells. Glial cells expressed only very low or undetectable levels of ADAM11 in the adult CNS and PNS.

ADAM11 mRNA was detected also in some extra-CNS tissues in adult mice. The neurons in ganglia of the PNS and bipolar and ganglion cells in retina as well as the cornea showed a prominent ADAM11 signal. Testicular spermatocytes, ductal epithelial cells in the kidneys, and epidermal cells were moderately positive for ADAM11 expression. Hepatocytes showed a centrally weakening signal in liver lobules. Eleven other mouse tissues were tested but they did not show any labeling (II).

5.2.5. Induction of ADAM11 expression correlates with CNS development

ADAM11 gene expression was examined in developing mice starting from embryonic day 10 to postnatal pups. The induction of expression correlated with the mouse CNS and extra-CNS development. ADAM11 expression was detected in neural crest cell derived cells in all studied developmental stages. At E10-E11 the labeling in neural crest derived cell populations e.g. the sensory and autonomic ganglia were stronger than in cells of the neural tube. Expression in the PNS ganglia was maintained through out development and in adulthood. The neural tube label intensified during the E11-E13 days concomitantly with the development of the major anatomical CNS divisions derived from the neural tube, and all regions except the neocortex and the striatum showed a strong, relatively uniform signal (see the work I for Figures and details). The

95

signal in the neocortex and striatum intensified paralleling the development of these regions, and at E17 the strongest ADAM11 signal in the CNS was detected in the neocortex. The general increase in ADAM11 expression from E13 to E17 and P1.5 in the telencephalon contrasted the decrease in overall diencephalic and brainstem expression. The ADAM11 expression remained high or very high in most of the adult telencephalon, many of the diencephalic and brainstem nuclei, spinal cord, and sensory and autonomic ganglia. The notable exception was the striatum in which the strong hybridization during development changed to negligible in the adult. The cerebellar ADAM11 mRNA levels showed the opposite effect by staying low or negligible during pre- and perinatal development and showing the most intense signal in the adult mouse. The ADAM11 signal in retinae of the eye was first detected at E15 and it increased to very strong at P1.5 and remained strong through adulthood. In general, the ADAM11 signal increased concomitantly with neuronal cell maturation in the CNS and PNS and was maintained in most of the neural tissues in adult mice.

Restricted ADAM11 expression during development was detected also in a few non-neural tissues including kidney, heart, and brown adipose tissue. A very strong but weakening signal was detected in brown adipose tissue from embryonic day 17 onwards, and in P1.5 pups the signal was weak. The developing heart showed moderate transient expression around developing stage E13. The signal in heart was absent at the later developmental stages or in the adult mice. Low ADAM11 expression was detected in the developing kidneys at the same developmental stage as in the heart. In contrast to the heart, restricted expression was detected also in the kidneys of adult mice.

5.3. ADAM15 gene (III, IV, and V)

5.3.1. The ADAM15 gene is located in the chromosomal band 1q21.3, which is rearranged in breast cancer cell lines (III and V)

Northern blot and in situ hybridization results indicated wide and variable ADAM15 regional expression in the rodent CNS as well as in other tissues (I and unpublished results). ADAM15 is one of the archetype ADAMs showing association to various cellular functions with its metalloprotease, disintegrin, ACR, and cytosolic domains [62, 168, 323]. Moreover, it is the only ADAM with an RGD-integrin binding motif in its disintegrin loop [459]. Elevated ADAM15 expression after induced nerve injury and the association of ADAM15 with pathological neovascularization, tumor cell growth and migration suggest that ADAM15 is involved in tissue remodeling and cancer [377, 460]. Despite the hypothesized important roles in physiology and pathology, the ADAM15 chromosomal location and genetic linkages to human diseases were not known. This prompted us to determine the chromosomal location of the ADAM15 gene and, in more recent work, to select the ADAM15 gene for detailed investigation.

The ADAM15 chromosomal localization of ADAM15 was determined with a fluorescent probe made from isolated PAC-clone containing the ADAM15 genomic region. The FISH signal indicated localization of the ADAM15 gene at 1q21.3 (V). The chromosomal band 1q21.3 has been reported to contain genes rearranged in breast

96

cancer and sarcomas [486-488]. This suggested association of ADAM15 with cancer and prompted the search for genomic aberrations in breast cancer cell lines. The ADAM15 genomic-probe was used to examine the genomic copy numbers in breast cancer cell lines (III). The analysis indicated ADAM15 gene amplification in 73 % of the 26 studied breast cancer cell lines (>5 copies). Over 10 copies of the ADAM15 gene were detected in 23 % of the cell lines. This suggested that the ADAM15 gene is included in the 1q21.3 genomic region often amplified in breast and possibly also in other cancers.

While ADAM15 expression levels showed only small overall variation, most of the breast cancer cell lines showed slightly elevated ADAM15 expression as compared to a human mammary epithelial cell (HMEC) control. A two-fold or greater increase in ADAM15 mRNA levels was detected in 24 % of the examined breast cancer cell lines. However, the ADAM15 expression level and gene copy number did not show a statistical correlation. Also, rearrangement did not cause overall splicing aberrations of ADAM15 transcripts as indicated by cloned transcripts.

5.3.2. The structure and regulatory regions of the ADAM15 gene (IV)

The ADAM15 gene was sequenced in order to study its structure and the mechanisms of its regulation. The sequencing of the human genomic PAC clone 240C indicated that the clone contained all ADAM15 encoding exons and the presence of exons of upstream and downstream genes suggested that the full length ADAM15 gene sequence had been resolved (IV). The overall length of the ADAM15 gene from the translation start to the polyadenylation signal is 11367 bp and appears to be the shortest of the multiple-exon human ADAM genes and is relatively short human gene in general [403]. ADAM15 exons are normal sized varying from 63 to 316 bp but all 22 introns varying from 79 to 1283 bp are well below the human average of ~5300 bp [403].

The ADAM15 gene contains 23 exons of which exons 19 to 21 are used alternatively. Furthermore, exons 20 and 21 have alternative 5’ or 3’ ends, respectively (see the publication IV for details). All ADAM15 constitutive and alternative introns start with GT and end with AG nucleotides implying splicing by a canonical splicing machinery. Branch site analysis suggested that most ADAM15 introns contain good putative branch sites. The branch sites in introns 3, 6, 10 and 19 scored lower than an average human branch site and intron 1 did not score at all in the Branch-Site Analyzer analysis.

5’-end RT-PCR experiments indicated multiple ADAM15 transcription start sites in cell lines at a region -266 through -110 relative to the adenine in the translation start codon. In line with this, a luciferase reporter assay indicated a functional promoter at a location -266 through -23. Furthermore, sequence analysis indicated that this transcription promoting region is located within a CpG-island and that the region contains a cluster of conserved transcription factor binding motifs.

Consistent with the multiple transcription start sites, the human and mouse ADAM15 promoter region sequences lack the CAAT and TATA boxes. A phylogenetic transcription factor binding site analysis indicated that the human promoter region contains six SP1 transcription factor binding motifs (Figure 15) of which five SP1/GC-box motifs are conserved in rodents (IV) and similar SP1 motif-rich-sequences are

97

present also in the canine and bovine genomes at corresponding locations (unpublished observation). The region was tested with a luciferase promoter construct and found to support transcription. Deletion of five of the six SP1 motifs from the reporter construct reduced the activity by two thirds suggesting involvement of SP1 sites in ADAM15 gene regulation (IV). In addition to the SP1 motifs, the indicated promoter region contains predicted binding motifs for the Pax-4, En-1, and HoxA3 vertebrate transcription factors and a composite Sp1/MyoD recognition motif (Figure 15). Of these, HOXA3 and En-1 motifs are present also in the rodent ADAM15 promoter but in nearby non-conserved locations compared to the site in human.

Figure 15. Schematic representation of the putative human ADAM15 core promoter structure. The graphics show relative locations of transcription factor binding motifs in the human transcription supporting region. The key is integrated into the graphics.

The phylogenetic footprinting analysis that was carried out to identify extra-promoter regulatory regions, indicated prominent conserved sequences with potential transcription regulatory motifs in introns 1 and 2. Similar putative regulatory sequences in introns 1 and 2 are present in the human, rodent, as well as in the bovine and canine ADAM15 genomic regions at corresponding locations (IV and unpublished observation). The regions contain transcription and splicing factor binding motifs suggesting a role in the regulation of splicing and/or transcription. No indication of a role as part of a gene other than ADAM15 was found for these conserved regions.

The introns flanking the alternatively used exons 19 to 21 also contain conserved regions. However, the relative location in the gene and the low number of predicted conserved transcription factor binding motifs suggests a role other than transcription regulation. The conservation of these regions is more likely due to their role in ADAM15 splicing.

Altogether, the results suggest that the most critical ADAM15 transcription-supporting elements, and thus the core promoter are located within the region -266 to -23. The introns 1 and 2 may contain extra-promoter transcription regulatory elements; however, no experimental data to support the notion is available.

5.3.3. The ADAM15 gene is alternatively spliced in normal tissues and the splicing is altered in breast cancer cell lines (III and IV)

Sequencing of ADAM15 transcripts in breast cancer cell lines revealed two alternatively used ADAM15 exons that did not belong to previously known ADAM15

Sp1/GC

Pax-4HOXA3 Sp1

En-1 Sp1-MyoD

-220 -180 -160 -140 -120 -100

98

transcripts. Further studies indicated that in addition to the novel exons 20 and 21 the previously known exon 19 is also used alternatively (see IV for details). No alternative use of exons 1-18 and 22-23 was detected suggesting constitutive use. Furthermore, exons 20 and 21 contain alternative 5’ and 3’ ends, respectively, giving rise to the exon variants 20a/20b and 21a/21b (Figure 16). Theoretically these three alternative exons could produce 18 (2 x 3 x 3) different splice variants. However, variant expression analysis in cell lines and tissues has suggested that seven of the ADAM15 splice variants are expressed at relatively high levels while six variants show generally low expression levels (III and IV). Five of the theoretical ADAM15 variants have not been detected in any of the studied samples. The exon usage of detected variants and average overall expression in human tissues is shown in Figure 16B.

A B

Figure 16. A schematic representation of human ADAM15 alternative exons. A) Exon numbers and the number of possible alternatives per exon, and exon sizes are indicated in the graphics. The dashed lines indicate splicing sites in ADAM15 alternative exons. B) A schematic presentation of ADAM15 variants. The average usage in human tissues is shown on the right. *Relative expression levels are estimated based on 4b levels since variants 4a and 5 cannot be resolved due to same sized PCR products.

The isoform expression analysis in cell lines indicated that several ADAM15 variants are expressed concomitantly in a given cell type. This suggested that in order to analyze the expression of functional ADAM15 the whole variant expression pattern had to be determined. The ADAM15 variant pattern in these studies consists of the detected

19 20a/b 21a/b 2322

v9

18

v2

v4a/b

v5

v6a/b

v7a/b

v8

v1

v3a/b

11.6 %

60.4 %

< 1%

< 1%

< 1%

< 1%

3.8 %* / 4.0 %

3.8 %*

5.3 % / 8.8 %

avg

18 19 20a/b 21a/b 2322exonx1 x2 x3 x3 x1x1alternatives

length bp 70 72/75 72/214

99

relative expression levels of the variants in a given sample. For example, a simple ADAM15 pattern could consist of the relative expression of 73 % of variant 2, 8 % of variant 4a, 7 % of variant 4b, 12 % of variant 5, and negligible expression of other variants. For this purpose methods based on different sized RT-PCR products and their analysis were developed (III, IV, and submitted manuscript; Ortiz, Kleino, and Huovila).

5.3.3.1. ADAM15 variants are expressed differentially in human tissues (IV)

The tissue distribution of ADAM15 variants was examined with a panel of cDNAs representing 16 human tissues. Variant expression patterns were analyzed by amplification of the alternative exon containing region with RT-PCR. In this study different amplification products were resolved in a Abi genetic analyzer that could separate individual variants except variants 3a/9 and 4a/5 that are of the same size (Figure 16). Tissue specific cDNAs showed divergent ADAM15 variant patterns with 9 to 12 different variants expressed at differing relative levels. On average the ADAM15 variants 1, 2, 6a, and 6b showed the highest relative expression varying from 5.3 % of variant 6a to over 60 % of the predominant variant 2 (Figure 16). Variants 4a, 4b, and 5 each showed relative expression levels of around 4 % of the all ADAM15 transcripts. Other detected variants 3b, 7a, 7b, and 8 showed relative expression levels below 1%. The complexity of the observed patterns varied from the placenta expressing only two variants (1 and 2) with relative expression levels of over 5 % to peripheral leukocytes expressing seven variants with relative expression levels of over 5 %.

The tissue variant patterns did not show clustering with statistical methods indicating high variance. However, the variant patterns in tissues were generally more complex than in the examined cell lines (unpublished results). No correlation between total expression levels in tissues and variant patterns or pattern complexity was detected. The total expression levels summed up from variants in the Abi genetic analyzer and measured with LightCycler from the same cDNAs correlated at a level of 0.905 in the Pearson coefficient test.

5.3.3.2. ADAM15 exon use is altered in breast cancer cell lines (III)

22 breast cancer cell lines were analyzed for ADAM15 variant expression by amplifying the alternative exon region with RT-PCR. In this study, as apposed to the analysis of human tissues, variant patterns were resolved by agarose gel electrophoresis, which allowed the detection of amplification products differing only by exon number. This results from the similar sizes of alternative exons 19, 20a/b, and 21a (Figure 16A). Therefore any alternative exon combination with the same number of alternative exons (zero to three) would seem to co-migrate and would be detected in gel as one signal. The signal from the shortest band indicated the levels of the expression of variant 1, the signal given by a band 70 bp longer corresponded to variants 2, 3a, 3b, and 9, the signal from around a 140 bp longer band corresponded to any combination of two alternative exons (variants 4a, 4b, and 5), and finally the signal from the longest band corresponded to the expression level of variants 6a and 6b (Figure 16B). Exon 21b differs from the

100

other alternative exons considerably. Its expression was not detected with the agarose gel method.

The studies breast cancer cell lines, human mammary epithelial cells (HMEC), the non tumorigenic HBL-100 cell line, and the prostate cancer cell line DU145 showed variable levels of expression of the ADAM15 variants. The statistical clustering methods indicated that cells express only a limited number of distinct ADAM15 variant patterns, which fell into six clusters (III). The HMECs, HBL-100, and DU145 cell lines formed a separate cluster, number 2, differing from all of the breast cancer cell lines. Cells in cluster 2 showed clearly the highest relative expression of ADAM15 variants with one alternative exon (73 % to 84 %).

The breast cancer cell lines fell into five clusters as defined by ADAM15 variant patterns. The prominent characteristic of cluster 1 was the low level use of alternative exons (III). This was indicated by over 40% of the transcripts being of variant 1. Importantly, the level of variants containing two alternative exons was relatively high in cluster 1. This suggests that there is no strong interdependence in exon 19 regulation compared to exons 20a/b and 21a/b. Clusters 3 and 5 showed an increase in the levels of variants with two or three alternative exons. Notably, the levels of variants 6a and 6b with three alternative exons were lower than those of variants 4a, 4b, and 5 with two alternative exons. The characteristic feature defining clusters 4 and 6 was the increased levels of variants with three alternative exons compared to levels of such transcripts in clusters 3 and 5.

In conclusion, cultured breast cancer cells showed a limited set of ADAM15 variant patterns. Importantly, none of the cellular variant patters or the average pattern of cell lines was close to a random pattern. Furthermore, some potential cluster types e.g. a uniform pattern and patterns with high proportions of both short and long isoforms were absent. This implies that ADAM15 alternative exon use is controlled and regulated by specific regulatory factors in cells.

5.3.4. Alternative splicing regulatory motifs in ADAM15 gene (IV)

ADAM15 is a widely expressed gene that shows complex alternative splicing in various human tissues. Furthermore, the distinct alternative splicing of ADAM15 in breast cancer cell lines suggested that ADAM15 or molecules regulating alternative splicing may play a role in breast cancer malignancy. Studying the mechanisms behind alternative exon use could not only shed light on ADAM15 regulation, but also produce information of the more general cellular mechanisms that are altered in breast cancer. This motivated the ADAM15 gene sequence examination in pursuit to identify sequence elements that regulate ADAM15 alternative splicing. Only the most salient findings are presented here; see the original communication for details (IV).

Roughly half of the information for splicing has been estimated to reside in splice and branch site sequences [489]. Splice site analysis of ADAM15 suggested weak 5’ss in introns 18, 20, and 21a and a weak 3’ss in intron 18, and a weak branch site in intron 19. This suggests the presence of non-optimal splice signals in these basic splicing motifs in introns flanking the alternatively used exons in the ADAM15 gene (Figure 18).

101

The second half of the information required for splicing regulation is located outside splice and branch sites in sequences within exons and introns. The analysis of alternatively used ADAM15 exon sequences suggested that they contain only few enhancer and silencer regulatory motifs (see original communication for details). The especially low number of exonic splicing enhancers (ESE) suggests suboptimal splicing enhancement from alternative exons compared to constitutive exons.

In contrast to alternative exons, the introns flanking them were found rich in various sequence motifs associated with splicing regulation (IV). All alternative introns contained a number of intronic splicing enhancers (ISE), as well as various hnRNP and SR-protein binding motifs. Furthermore, introns were rich in ESEs and exonic splicing silencer (ESS) motifs. Despite their association with an exonic locations by name, these motif are also relevant intronic splicing regulators elements. The hnRNP and SR-protein motifs showed an evident uneven distribution between the introns. While intron 19 was rich in hnRNP H/F binding motifs, intron 20 contained many conserved SRp20, SRp30b, SRp40, hnRNP F/H, and hnRNP B/D/E binding motifs. Curiously, intron 21a contained conserved hnRNP H/F binding motifs near the ends (IV).

Figure 17. ADAM15 alternative exon regulation. The figure shows the locations of putative motifs for the regulation of alternative exon. Exon numbers are indicated above the schematic presentation. Weak splice and branch sites are marked above the schematic gene: X, weak 5’ss; O, weak 3’ss; B, weak branch site. The locations of alternative splicing regulatory motifs are marked under the schematic gene: A, predicted alternative splicing regulatory motif; F, Fox-family binding motif; N, Nova-family binding motif; C, CELF/BrunoL binding motif; M, MBNL family binding motif. Conserved binding motifs are in bold.

In addition to splicing regulators, which can be considered general due to their ubiquitous but variable level expression, regulators with greater tissue and cell type specificity have been identified. ADAM15 alternative introns were found to be rich in tissue specific alternative splicing regulatory motifs (Figure 17). Conspicuously, many of these motifs were found to be conserved in the human, rodent as well as bovine and canine ADM15 genes (IV and unpublished observation).

ADAM15 alternative introns were found to contain four of the most significant alternative splicing-associated upstream sequence motifs (AUGCAU, CUGCUA, GCAUGC, and UGCAUG) [490]. Protein(s) that bind to the AUGCAU and CUGCUA motifs have not been identified, while GCAUGC, and UGCAUG both contain the GCAUG sequence, a known binding motif of Fox-family alternative splicing regulator proteins [491]. Intron 18 contains an the AUGCAU and CUGCUA motifs close to its 3’ ss and 5’ ss, respectively and introns 19, 20, and 21 contain two, four, and one Fox-family (GCAUGC or UGCAUG) binding motifs, respectively. Six of the seven motifs are conserved from human to at least one of the rodents (Figure 17).

Unequally distributed binding motifs for the tissue specific alternative splicing regulator proteins Nova-1/2, members belonging to the CELF/BrunoL family, and

18 19 20a/b 21a/b 2322X X XO B

MM M M MN NNNN NN N N C CCCF FFFF FFA A

102

Muscleblind-like protein 1 (MBNL1) were found in the alternative introns of ADAM15. Four, one, and four Nova-1/2 binding motifs are located in introns 18, 19, and 20, respectively. Three CELF/BrunoL-protein family binding motifs are located in intron 19 and one in exon 19. MBNL1 binding motifs were found in exon 20 and in introns 20 and 21. Most of these binding motifs are conserved in human, rat and mouse (Figure 17).

5.3.5. ADAM15 cytosolic tail protein-interaction-motifs are regulated by alternative splicing

Of all the ADAM15 exons alternative use of only exons 19-21 was detected. These exons encode parts of the cytosolic tail. The presence of exon 19 regulates which of the two reading frames are translated following exon 18 (IV). This is because the length of exon 19 is 70 bp and its length cannot thus be divided by three. The lengths of exons 20a, 20b, and 21a can, in turn, be divided by three and thus their alternative use does not cause switching of the translated reading frame in the exons following them (IV). The presence of exon 21b inserts an inframe stop codon into both alternative reading frames before exons 22 and 23, and causes the truncation of the cytosolic tail (IV). However, exon 21b was detected in only a few transcripts.

The cytosolic tails of ADAM15 isoforms contain different numbers of ser, thr, and tyr phosphorylation target residues and consensus binding motifs for 14-3-3, PDZ, WW, and SH3 domain proteins. The ADAM15 variants containing the exon 19 (2, 4a/b, 5, 6a/b, 7a/b, and 8) encode cytosolic tails with binding motifs for 14-3-3, PDZ, WW, and SH3 proteins (Figure 18). Each of the exons 19-23 translated along the first reading frame encodes a cluster of prolines, each cluster of which contains one or two SH3 domain consensus binding motifs. These protein isoforms thus contain two to eight SH3 consensus binding motifs depending on the presence of exons 20a/b, 21a, and 21b (Figure 18). Furthermore, exon 19 encodes a region with a putative 14-3-3 binding motif, and the exons 22 and 23 that are translated along the first reading frame, encode a putative class III WW and class II PDZ binding motifs, respectively.

The variants lacking the exon 19 (1, 3a/b, and 9) encode cytosolic tails that are translated along the second reading frame contain only a few consensus protein interaction motifs. The isoforms encoded by variants 3a and 3b contain a single SH3 binding motif, while proteins encoded by variants 1 and 9 are devoid of known consensus protein binding motifs altogether (Figure 18).

In conclusion, the use of exon 19 regulates the protein sequence and protein interaction motifs of the entire cytosolic tail of ADAM15. Inclusion of exons 20a/b and/or 21a regulates the presence of protein segments enriched with SH3 binding motifs without changing the rest of the cytosolic tail (Figure 18).

103

Figure 18. ADAM15 alternative cytosolic tails. ADAM15 cytosolic tails are aligned according to translated exons. The consensus protein binding motifs are highlighted, and amino acids are indicated by one letter codes: X, any; # aliphatic; @, aromatic or aliphatic; pS, phosphoserine; pT, phosphothreonine. The key is integrated into the graphics. Consensus binding motifs: SH3 domains [130, 492], WW domains [131, 132], EVH1 [131, 493], PDZ [133],14-3-3 [134].

104

6. Discussion

6.1. The physiological importance and conservation of the ADAM-genes correlate with each other

The human and mouse genomes contain 21 and 39 functional ADAM genes, respectively, which produce over twice as many transcripts through alternative splicing (IV). In this study, the gene structure and protein sequence-similarity were compared to evaluate the relatedness and evolutionary conservation of the ADAM gene variants. The wide conservation of the genes in animals indicates functional conservation and suggests that the gene plays important physiological role. The observed conservation in ADAM genes parallels with the severity of the phenotypes of published ADAM gene knock-out animals (section 2.4.1.).

The gene structure and protein similarity comparison suggest a conserved and physiologically important role for ADAM10s and -17s. Consistently with these observations, gene disruption studies have indicated severe phenotypes for mice deficient of the ADAM10 or -17 gene (section 2.4.1.). The most prominent protein sequence and gene structure divergence between ADAM10 and -17 subfamilies was seen in the ACR to cytosolic tail region associated with the regulation of ADAM-activity (section 2.3.). Consistently, ADAMs from both subfamilies have been shown capable of shedding the same substrates but are known to be activated by different stimuli (sections 2.2. and 2.3.).

The brain-MDC subfamily also showed wide evolutionary conservation suggesting a physiologically important these proteins as well. The presence of three brain-MDCs compared to one brain-MDC in nematode and Drosophila may indicate functional diversification in vertebrates. The high sequence conservation within and diversification between the ADAM11, -22, and -23 groups in vertebrates supports the idea of functional diversification within the brain-MDC subfamily. The functional importance and diversification are in line with the reported severe but differing phenotypes of the ADAM11, -22, and -23 gene knock-out mice (section 2.4.2.).

ADAM groups in the MMM and ADAM9 subfamilies showed an average level of intra-group conservation compared to the other ADAM groups. The lower intra-group similarity compared to ADAM10, ADAM17, and brain-MDC subfamilies might indicate redundancy or less important physiological functions for ADAMs of the MMM and ADAM9 subfamilies. Consistent with the average level of intra-group conservation mice deficient of ADAMs belonging to the MMM or ADAM9 subfamilies are viable and fertile (section 2.4.1.).

The conservation level within groups correlates with the severity of the phenotypes of knock-out mice. The knock-out mice of the most conserved ADAM-group member, ADAM19, present with most severe phenotype (80 % postnatal mortality) in the MMM subfamily (section 2.4.). The ADAM12 and -15 groups are next most conserved after ADAM19. Consistently, mice deficient of ADAM12 show 30 % postnatal mortality and knocking-out the ADAM15 genes results in spontaneous defects only in aged mice (section 2.4.). The lack of obvious deficiencies in ADAM8 and -33 knock-out mice

105

parallels the even lower intra-group conservation. The phenotypes of ADAM 7 and 28 knock-out animals have not been reported.

ADAM-groups in the non-MP-fertilin subfamilies showed the lowest level of intra-group conservation among the ADAMs. Also, the number of ADAMs in the testases, ADAM1s and non-MP-fertilin subfamilies varied in different species, and putative orthologs were absent from the nematode and Drosophila genomes. The low conservation may be due to relaxed conservation pressure in a large set of genes with redundant functions. Contrasting the suggested redundant role, the mice deficient of ADAMs 1A, 2, or 3 are infertile (section 2.4.). Intriguingly, many sperm ADAMs have been suggested to regulate each others maturation and subcellular localization implying a functional linkage between reproductive ADAMs (section 2.4.). Alternatively, the low relative sequence conservation and faster rate of evolution in these ADAMs may be related to a role in reproduction [129]. The faster evolution rate in proteins involved in reproduction directly influences reproductive success and favorable changes are efficiently positively selected for. Supporting the latter possibility, most of the ADAMs in the testase and non-MP-fertilin subfamilies are expressed mostly in reproductive tissues. A consistent with observations reported in this study, a faster evolution rate has been reported for ADAM genes linked to reproduction [129]. The severity of the knock-out phenotypes and the connection between the subfamily members suggests important functions for the non-MP-fertilins and ADAM1s and thus the faster evolutionary rate is more likely due to their functional association with reproduction.

6.2. ADAMs in the CNS

When this work started very little was known about ADAMs in the CNS. ADAMs were suggested to form a major family of integrin counter receptors mediating cell adhesion, and to act as fusion proteins, and their role in ectodomain shedding was emerging [494, 495]. The expression of several integrins lacking relevant ligands in the CNS had been reported [484]. It was feasible to think that at least some ADAM-integrin interactions would play an important role in the CNS. Part I was the first systematic study of the regional expression of multiple ADAMs in the adult CNS.

6.2.1. The regional CNS expression of the ADAM10 and -17 genes suggests that ADAM10 is the principal APP α-secretase

ADAMs 10 and 17 both have been suggested candidates for a principal APP α-secretase [196, 202], and both have been identified as sheddases of proteins with essential roles in the CNS (section 2.6.1.-2.). Therefore the regional expression of ADAM10 and -17 in the CNS is of particular interest.

The strongest expression of ADAM10 in the CNS was detected in neuron enriched regions e.g. the cortical and hippocampal fields. This points to expression of ADAM10 in neuronal cells. The expression of ADAM10 in neurons suggests that it could be involved in neuronal functions. Consistently, many of the known ADAM10 substrates have been associated with the regulation of neuronal survival, axon guidance, and

106

synapse functions (section 2.6.1.-2.). The regional expression pattern of ADAM10 overlaps extensively with the reported APP expression pattern [496]. In contrast to ADAM10, ADAM17 showed a more restricted expression pattern in the CNS and the results indicated only low expression in areas with high APP expression in the telencephalon. This suggests that ADAM10 but not ADAM17 is the principal APP α-secretase in neurons of the CNS. A more recent report by Marcinkiewicz et al. has corroborated these findings [497]. Their results indicated co-expression of ADAM10 and APP at the cellular level thus supporting and extending our findings. Consistent with our results on the neuronal expression of ADAM10 in mouse, ADAM10 immunoreactivity was detected in neurons of the human CNS [498]. Since most of the normal APP processing is thought to take place in neurons [499, 500], our observations strongly suggest that ADAM10 but not ADAM17 is the principal α-secretase in the normal CNS.

Paralleling presented observations on the regional expression of ADAM17 in rodents, ADAM17 immunoreactivity was detected in astrocytes and endothelial cells in the human CNS [501]. Consistent with the glial cell expression pattern, many of the neural ADAM17 substrates are of glial cell origin (section 2.6.1.-2.) and ADAM17 has been suggested to be involved in the regulation of inflammation reactions in the CNS [502]. Induction of TNF-α expression has been reported in astrocytes and endothelial cells, that is the same cell types that express ADAM17 in the adult CNS [501].

6.2.2. ADAMs 11, 22, and 23 are widely expressed in the CNS (I, II, and VI)

A well conserved, predominantly CNS expressed brain-MDC subfamily in vertebrates is comprised of ADAMs 11, 22, 23 [393, 397]. The brain-MDCs are devoid of consensus amino acids for metalloprotease activity and have been suggested to function as integrin-binding proteins [393, 397, 485]. The high level of conservation in vertebrates suggests an important role for the brain-MDCs (VI).

6.2.2.1. ADAM11 is expressed in the mouse neural systems (I and II)

ADAM11, the first cloned member of the brain-MDCs [503], showed almost ubiquitous but variable expression levels in the adult mouse CNS fields. The strongest expression in fields with a high content of neurons suggested neuronal expression. A more detailed analysis confirmed the suggested neuronal expression. This indicates that at least in mouse most of the ADAM11 expression is in neurons and that ADAM11 may have a prominent role in subset of neurons in the CNS. Partially paralleling results obtained by immunostaining the human CNS slices with an anti-ADAM11 antibody indicated the presence of the ADAM11 protein in a subset of neurons and astrocytes [86].

ADAM11 showed differences in the regional expression of the mRNA variants. There is no data available on variant expression in specific CNS nuclei or at the cellular level. Nor is known, which kind of proteins the rat ADAM11 variants encode for. In humans the alternative splice variants of ADAM11 were reported to encode soluble and cell bound ADAM11 isoforms as well as variants with alternative 5’ UTRs [407].

107

Because of the high conservation in gene structure and protein sequence, it is likely that rat ADAM11 alternative transcripts correspond to the reported human variants.

Consistent with the detected neuronal expression, ADAM11 protein has been suggested to play a functional role in synapses [388, 389]. Mice deficient of ADAM11 do not show cross anatomical defects in CNS or PNS morphology, which points to normal neuroblast, axon, and dendrite migration and guidance [388, 389]. However, ADAM11 knock-out mice are deficient in certain types of nociception [389] and show defects in spatial learning and motor coordination [388]. The restricted cognitive defects suggest that ADAM11 may modulate subtypes of synapses in restricted regions of the CNS. Based on the ADAM11 expression profile the deficiencies in spatial learning might be due to a lack of ADAM11 in hippocampal pyramidal neurons and/or in cortical pyramidal neurons. The impairment in motor coordination might be due to deficient functions of cerebellar interneurons and/or in cortical pyramidal neurons.

6.2.2.2. ADAM11 in mouse development (II)

Wide expression of ADAM11 was detected in the nervous system of developing mice. Induction of the ADAM11 gene correlated with neural differentiation and prevailed after neural maturation. This suggests that ADAM11 function is associated with neural maturation or that functions manifest after neural differentiation. Consistent with the detected ADAM11 expression in differentiating neurons, concomitant ADAM11 gene activation and retinoic acid induced neural differentiation in cell culture have been reported [504]. ADAM11 expression was retained in most of the neural fields except in the striatum. Interestingly, the most prominent ADAM23 expression in mouse at birth is detected in the striatum [395] implying exclusive expression of these two ADAMs in different cells of the nervous system.

The ADAM11 protein has been suggested to mediate integrin dependent cell adhesion or signaling during development in the processes of neuroblast migration, axon guidance, neurite outgrowth, and dendrite induction via neuro-astrocyte contacts (2.6.3.). The ADAM11 adhesion partner, the α6β1 integrin, is expressed in the cortical plate during CNS development and mice lacking the α6 or β1 integrin have abnormal cortical neuron organization [505, 506]. Also, the β1 integrin has been linked to hippocampal synapse function [447]. It is thus possible that interactions between ADAM11 and the α6β1 integrin could contribute to the migration of neurons, and/or the maturation or stabilization of synapses [507]. In cell culture, synapse maturation has been reported to be depend on the β3 integrin [508]. Integrin α6β1 has also been implicated in the migration of neuroblasts along the rostral migratory stream both in the developing and in the adult brain [509]. ADAM11 may thus mediate or regulate integrin binding in tangentially migrating cells. Opposing the function of ADAM11 in adhesion mediation, laminin is though to mediate promigratory integrin binding. It remains to be seen if ADAM11 is involved in the migration process.

A particularly interesting neuro-developmental phenomenon, with respect to ADAM11 and other brain-MDCs, is the induction of synapse formation in developing neurons. It has been shown that integrin dependent direct contacts between astrocytes and developing neurons activate PKC signaling that in turn activates synapse induction [510]. Supporting the role of ADAM11 in this process, the astrocytes express the α6β1

108

and αvβ3 integrins [457], both reported to be capable of binding brain-MDCs and other ADAMs [86]. However, the lack of evident defects during development in ADAM11 knock-out mice [388, 393] argues against the role of ADAM11 in synaptogenesis. But this result may be due to the possible compensatory actions of closely related brain-MDCs or by other ADAMs.

6.2.2.3. Wide expression of ADAM23 in the CNS points to an important role in the CNS (I)

The ADAM23 distribution in different regions in the rat CNS was as wide but more uniform than the ADAM11 distribution. A more recent report on the regional ADAM23 expression in the rodent CNS is well in line with the results presented here [394, 511]. In other studies ADAM23 showed wide expression throughout the rodent CNS, with the highest expression levels in cerebellar Purkinje, granular, and deep nuclei neural cells, all the layers of the cortex, and the hippocampal pyramidal neurons in the dentate gyrus, the CA1, and CA3 fields as well as the retinal ganglion cell layer, and basal ganglia [394, 511]. The high level of conservation and the detected wide neural expression suggest an important role for ADAM23 in the CNS (I and VI). In agreement, the disruption of the ADAM23 gene in mouse causes tremor and ataxia [394, 395]. Similarly to ADAMs 11 and 22 no obvious morphological defects in the CNS have been reported in ADAM23-/- mice [394, 395].

6.2.2.4. Conclusions on the brain-MDC findings (I, II, VI)

The wide neural expression of closely related highly conserved brain-MDCs suggested their involvement in important ADAM-mediated non-metalloprotease functions in the CNS. ADAMs 11, 22, and 23 are the primary candidates for mediating neuronal ADAM-integrin interactions potentially important for synapse regulation or neuron-glial adhesion (section 2.6.3.).

Recently, a novel type of ADAM interaction partner from the LGI1-protein family was reported for ADAMs 22 and 23 [71]. Binding of the LGI1 to ADAM22 was shown to regulate synaptic excitability corroborating the suggested role of ADAM22 in synapse regulation. Interestingly, the similar phenotypes of the ADAM22 and LGI4 knock-out mice suggest that the LGI4-ADAM22 interaction might be involved in the regulation of myelinization carried out by Schwann cells (section 2.6.4.). Both LGIs 1 to 4 and ADAMs 11, 22, and 23 show a wide but varying pattern of expression in the nervous system [72, 455]. Altogether, the circumstantial evidence suggests that brain-MDCs and LGIs might be functionally connected in the regulation of neural development and synaptic excitability.

The presented and published results on the regional expression of the brain-MDCs indicate that they are expressed in overlapping regions in the CNS. Also, their interactions with integrins and LGI1 proteins show redundancy [71, 86]. On the other hand, the expression of ADAM11 and -23 in different subpopulations of neurons in the cerebellum, and in the striatum indicates functional divergence for these two proteins [394, 511].

109

ADAM11 knock-out mice show cognitional impairments, and the ADAM22 and -23 gene knock-out mice are postnatal lethal, which prevents cognitive studies. Interestingly, the function of ADAM11 in the CNS may be quantitative since heterozygous animals show intermediate phenotypes compared to knock-outs (section 2.4.). Hence, the different combinations of double or triple heterozygous mice for ADAMs 11, 22, and 23 genes could reveal the neural functions of the ADAMs 11, 22, 23.

6.2.3. ADAM9 and MMM subfamily-ADAMs are widely expressed in the CNS suggesting functional role in CNS

Expression of ADAM9 and all of the studied members of the MMM subfamily was detected in the rodent CNS. All of these ADAMs, with the exception of ADAM7, are catalytically active proteases (section 2.2.). All have been shown to interact with at least one integrin and intracellular interactions have been reported for many ADAMs in these subfamilies (sections 2.1.3. and 2.3.). Therefore ADAM9 and MMM subfamily ADAMs may mediate several types of ADAM-functions in CNS.

ADAMs 9 and 15 both showed a relatively high and uniform CNS expression and sequence conservation in vertebrates suggests functional role for them in CNS. The presented observations have been corroborated in a more recent report describing wide expressed of ADAM9 in neuronal regions as well as in delimiting mesenchymal cells [387]. At the cellular level a particularly high expression of ADAM9 was reported in hippocampal pyramidal neurons, neurons in the central part of the hypothalamus, and Purkinje cells in the cerebellum [387]. Also, the presented ADAM15 regional CNS expression is consistent with the more recent report indicating wide ADAM15 expression in the neural and non-neural cells in the rat CNS [460].

ADAMs 12 and 19 both were detected in the mouse brain, while detection in the rat was hampered by technical reasons. CNS expression and sequence conservation in vertebrates suggests functional role for ADAMs 12 and 19 in the CNS. The detected expression of ADAM12 has been corroborated in a more recent paper reporting restricted ADAM12 expression in a subset of oligodendrocytes in the adult human and rat brain [512]. The detected brain expression of ADAM19 has been corroborated in papers reporting moderate expression of ADAM19 in the adult mouse and human brains [513, 514].

ADAM7 expression was detected in the mouse brain only with RT-PCR, which is consistent with a paper reporting highly restricted CNS expression in the anterior pituitary [515]. An ADAM7 knock-out mouse has not been reported and the function of ADAM7 in the anterior pituitary is not known. Since ADAM7 does not contain metalloprotease consensus amino acids and it has been reported to interact with the integrins α4β1, α4β7, and α9β1 [60] it may function as an adhesion protein.

ADAMs in ADAM9 and MMM subfamilies have been shown to bind integrins and are known to shed the substrates with prominent CNS functions (sections 2.2.4. and 2.6.2.-3.). The molecular interactions and presented wide expression in the CNS suggest prominent functional role for ADAM9 and MMM subfamily ADAMs in CNS. Despite the suggested functional role in CNS, the studies of mice deficient of ADAMs in ADAM9 and MMM subfamilies have not indicated major abnormalities in adult the

110

CNS (section 2.4.). However, the studies have not reported whether mice deficient of one or more of ADAM9 or MMM subfamily ADAMs have impairments in cognitive functions.

6.2.4. ADAM1, 2, 3, and 21 show restricted expression in the CNS suggesting functional specialization

The low expression level of ADAMs 1A, 2, 3, 4, 5, and 21 belonging to testases and non-MP-fertilins was detected in the mouse brain. The low general level of expression suggests that these ADAMs either have very low wide expression or the expression is restricted to a narrow population of cells in the CNS.

ADAM21 is one of the few relatively conserved ADAMs in the testase group suggesting possible functional importance of the gene. The presented low level expression of ADAM21 has been corroborated recently in a report describing restricted CNS expression of ADAM21 protein in the mouse CNS [456]. ADAM21 expression was reported in cells of ependymal and subependymal layers and in glial processes within rostral migratory stream from subventricular zone (SVZ) to olfactory bulb and in subset of olfactory neuron axons projecting to glomeruli region [456]. ADAM21 was suggested to function as a metalloprotease in neuroblast migration [456], however, there is no functional data to support that idea.

Low levels expression of ADAMs 1a, 2, 3, 4, and 5 were detected in the mouse brain. Low expression levels had already been reported for ADAMs 1a, 4, and 5 [516] and the expression of ADAM4 in the mouse brain has also been confirmed in a more recent paper [517]. Consistently with the low levels of expression detected in this study, a very restricted immuno-signal for ADAM2 in ventricular ependymal cells and for ADAM3 in astrocytes in the ventral hypothalamus have been reported [456]. There is no information of the regional CNS expression of ADAMs 1a, 1b, 4, and 5, but their relatedness to ADAMs 2 and 3 suggests that they may also have very restricted regional expression in the CNS. Correlating with the suggested restricted functionality in the brain, no impairments in the CNS functions have been reported in mice deficient of ADAMs 1A, 1B, 2, or 3 (section 2.4.1.).

6.3. ADAM15 gene structure and alternative splicing (III, IV, V)

The ADAM15 gene is one of the most widely expressed ADAMs. It has been implicated in the regulation of integrin mediated cell adhesion and possibly signaling (sections 2.7.). The prominent set of identified cytosolic interactions suggests involvement of ADAM15 also in cell signaling and/or its regulation with cytosolic interactions. At the cellular level ADAM15 protein has been associated with the regulation of cell migration and EGF-like growth factor signaling. Cellular and gene disruption studies have indicated ADAM15 involvement in vasculature and cartilage remodeling (sections 2.7.). In pathological situations, ADAM15 overexpression has been associated with an aggressive phenotype in adenocarcinomas and its

111

overexpression has also been reported in other cancers (sections 2.7.). The present studies have indicated that ADAM15 is located in a chromosomal region associated with and indeed rearranged in breast cancer cell lines. Also, the results indicate that ADAM15 expression is physiologically regulated by alternative splicing, and that this alternative splicing is altered in breast cancer cell lines.

6.3.1. ADAM15 gene rearrangement is not associated with changes in ADAM15 expression levels (III and V)

The localization of ADAM15 gene to the chromosomal region 1q21.3 associated ADAM15 with breast and/or other cancers. The amplification of chromosomal region 1q21 has been associated with an aggressive phenotype of prostate cancer [518]. Overexpression of ADAM15 has been detected in lung, cartilage, and stomach cancers [371]. Furthermore, overexpression of ADAM15 has been associated with a aggressive phenotype of several adenocarcinomas including breast and prostate cancers [464]. This strongly suggests association of ADAM15 with cancer biology.

Gene copy number examination indicated that the ADAM15 gene containing chromosomal region is rearranged in breast cancer cell lines. Since the ADAM15 gene is relatively short in length and the whole gene sequence was present in the genomic FISH-probe, it is likely that the whole gene and its regulatory regions are amplified as such in breast cancer cell lines. The gene copy number variation may also be due to normal inherited chromosomal copy number variation, however, the ADAM15 gene is not included in chromosomal regions reported to show natural copy number variation [519]. Collectively, this suggests that the ADAM15 gene region is amplified bona fide during cancer progression.

The amplification of the ADAM15 gene did not show clear correlation with ADAM15 expression levels in breast cancer cell lines. Still, a moderately elevated expression, compared to HMEC control cells, was detected in most of the cancer cell lines. Interestingly, the general activation of ADAM15 expression has been reported in cultured SMCs and HUVECs compared to the low expression in corresponding tissues [461]. Also, low expression levels of ADAM15 in normal breast tissue have been reported [464]. Hence, the ADAM15 expression level in HMECs may correspond to an increase in the activation of expression, which may mask the real extent of the copy number related change of ADAM15 expression levels in breast cancer cell lines.

6.3.2. ADAM15 gene structure and regulatory regions

The ADAM15 gene structure, sequence, and phylogenetic footprinting analyses were conducted in order to identify the mechanisms behind ADAM15 expression regulation. The studies suggested several regions in the ADAM15 gene that may be important for the regulation of its expression and splicing.

The ADAM15 gene contains exons of normal size while the average intron size is less than one tenth of the overall average human intron size [403]. This results in a short overall gene span, which is only one third of the average human gene although ADAM15 contains two and a half times the number of exons found in a average human

112

gene [520]. Furthermore, ADAM15 is the shortest multiple-exon ADAM gene. This suggests that ADAM15, or the chromosomal region it resides in, has been under selection pressure towards a shorter length.

Reporter and sequence analyses indicated the presence of a CAATless and TATAless promoter with multiple conserved transcription promoting Sp1 transcription factor binding motifs upstream of the ADAM15 translation initiation site. Consistent with the type of the promoter there was no definite single transcription start site, instead the ADAM15 transcription was found to start from multiple sites at a region overlapping the Sp1 motifs.

The promoter was found to be within a CpG-rich region, which is consistent with the reported wide tissue expression of the ADAM15 gene and suggests that the ADAM15 gene may be regulated by CpG-methylation [521]. The inducibility of ADAM15 expression e.g. after sciatic neural injury suggests that the ADAM15 gene is regulated also by non methylation dependent mechanisms [460]. Phylogenetic footprinting suggested extra-promoter regulatory regions in introns 1 and 2. However, there is no experimental data to support their functionality.

6.3.3. ADAM15 alternative exons are widely and differentially used in human tissues and exon use is altered in breast cancer cell lines (III and IV)

Previous studies have considered the ADAM15 variant 2 as “the” ADAM15. Functional expression of the other variants has not been addressed in previous studies. Only the presence of ADAM15 mRNA variants corresponding to the human variants 2, 5, and 6 in few mouse tissues and human cell lines have been reported [325, 326]. Also the presence of the shortest ADAM15 variant v1 has been reported in cultured human colon cells [410]. ADAM15 alternative splicing in cancer cell lines or in normal human tissues has not been addressed in previous studies. The work presented here demonstrates that normal human tissues display distinctively complex patterns of at least 13 ADAM15 mRNA variants. Moreover, breast cancer cell lines show a limited set of pattern types that are generally simpler compared to patterns found in tissues.

The alternative variant analysis showed that several of the ADAM15 variants are widely expressed at relatively high levels in normal human tissues. This suggests that they play a role in ADAM15 mediated physiological functions. Furthermore, the wide but varying use of ADAM15 alternative exons in human tissues strongly suggests that alternative splicing is a prominent part of ADAM15 expression regulation. Importantly, different cell types in tissues may express distinct ADAM15 variant patterns. This is suggested by more complex patterns in complete human tissues with multiple cell types compared to simpler patterns in single cell type cultures.

All studied breast cancer cell lines showed altered ADAM15 splicing compared to HMEC control. Importantly, clustering analysis suggested that the breast cancer cell lines displayed only limited non-random sets of ADAM15 variant patterns. Our more recent studies have indicated that the altered ADAM15 alternative splicing is not restricted to breast cancer cell lines. Altered ADAM15 alternative splicing has been detected also in the breast and astrocytoma tumor samples (Ortiz. et al. submitted

113

manuscripts). This suggests that, in addition to ADAM15 overexpression, ADAM15 alternative splicing may contribute to cancer progression.

6.3.4. The regulation of ADAM15 alternative splicing (IV)

The limited number of ADAM15 variant patterns in breast cancer cell lines indicates that alternative exon use is not random and that there are exact cellular mechanisms that regulate the exon use. The relatively independent alternative use of exon 19 from that of 20a/b and 21a/b suggests that exon 19 is regulated by different mechanisms compared to two other alternative exons. The higher than expected occurrence of variants 6a and 6b in relation to variants 4a, 4b, and 5 indicates that the use of exons 20a/b, and 21a is linked in some breast cancer cell lines. Interestingly, in astrocytomas exons 20 and 21 are regulated independently indicating cell type specific regulation also for exon 21 (Ortiz et al. submitted manuscript). Altogether, this suggests that more than one separate mechanism regulates the splicing of ADAM15 alternative exons.

ADAM15 splicing enhancing signals for alternative intron splice sites and in alternatively used exons were suggested to be suboptimal. This implies that the ADAM15 alternative exons may be prone to skipping and that a small amount of a splicing silencing signal could cause exon skipping. On the other hand, suboptimal exonic splicing signals and a low number of exonic regulatory motifs suggest that the regulation of alternative exon use is likely to involve splicing promoting and silencing signals from extra-exonic elements (for a more detailed discussion see IV).

Sequence analysis suggested that several conserved alternative splicing regulatory motifs are present in the alternatively used introns. This supports the idea of intronic splicing regulation. These motifs include putative binding sites for both highly tissue specific as well as more general alternative splicing regulatory proteins and RNPs. Curiously; many of the motifs are present in clusters suggesting that these regions may function as regulatory elements. The complexity of alternative splicing regulation and the lack of exact molecular level information of regulation factors prevent the reliable prediction of how ADAM15 alternative splicing is regulated. However, some notions may provide clues on the mechanisms.

The idea of cell type dependent regulation of each ADAM15 alternative exon was raised by the presented observation of splice patterns in tissues and cell lines and more recently in tumor samples (Ortiz. et al. submitted manuscripts). This is supported by the uneven distribution of the specific splice regulatory motifs between the alternative introns; e.g. binding motifs for tissue specific splice regulators of the Nova, MBNL, and CELF families show intron specific distribution. Also, the alternative splicing associated motifs CUGCUA and AUGCAU are present only in intron 18. On the other hand, the Fox-family binding motifs are present in three of the four alternative introns suggesting a role in the regulation of more than one ADAM15 alternative exons. Also the number and relative intronic locations of more general splicing factor binding motifs of SR-proteins and hnRNPs differ between introns. This suggests that expression levels of these splice-factors may regulate the relative inclusion level of each ADAM15 alternative exon.

In conclusion, ADAM15 alternative splicing is likely regulated by several different types of regulatory factors. The present results have identified several putative

114

regulatory motifs, which are concentrated in intronic elements. The factors include both highly tissue specific as well as more general splicing regulators suggesting highly complex regulation, which is in line with complex splicing patterns detected in human tissues and cancer cell lines. Further studies are needed to resolve the role of individual motifs and elements in ADAM15 alternative splicing regulation. ADAM15 is a particularly suitable target for alternative splicing studies due to its relatively complex but cell type specific splice patterns and because of the presence of candidate regulatory motifs within concentrated regions in short introns.

6.3.5. ADAM15 alternative protein isoforms (III and IV)

The cytosolic tails of ADAM15 isoforms contain different sets of putative phosphorylation targets and protein interaction motifs. Protein interaction studies have indicated that pro- and mature forms of the ADAM15 isoform 2 interact with a panoply of SH3 and SH2 domain containing proteins in a complex phosphorylation dependent manner [321, 323, 347, 348, 353]. These ADAM15 interaction partners have been implicated in cell signaling, protein sorting, or are known scaffolding or adaptor proteins. EVE-1, Tks5/FISH, and Pacsin 3 have been implicated in the regulation of the cellular activity of ADAM12, while the functional significance for the interaction with ADAM15 has not been shown [179, 321, 348]. Similarly, interactions between ADAM15 , α-actinin-2, MAD2, and MAD2β have been indicated, but their functional significance remains to be elucidated [346, 352]. Most of the studies have considered only the ADAM15 isoform 2 and only a few studies with other isoforms have been published so far.

ADAM15 isoforms encoded by the variants lacking exon 19 are devoid of putative cell sorting signals. The bulk of the isoform 2 has been reported to reside in intracellular compartments [23]. Also, the cytosolic tail has been indicated to regulate ADAM15 localization to adherens junctions [522]. The expression of truncated ADAM12 and -13 recombinant proteins has shown that the cytosolic ADAM-tail regulates intracellular retention and forms lacking the cytosolic tail are readily transported to the cell surface. The sorting associated proteins SNX-9 and endophilin A1 interact with a portion of the ADAM15 isoform 2 cytosolic tail that is absent from isoforms translated along the second reading frame or contain a stop codon before exon 22. Thus it is tempting to speculate that these ADAM15 isoforms would escape intracellular retention, sorting, and/or endocytosis and thus would be able to exert function(s) at the cell surface. Supporting the idea, overexpression of isoform 1 has been shown to inhibit cell migration in a wound healing assay [410]. Importantly, the expression of variant 1 is relatively high in several tissues, cancer cell lines, and tumors, which suggest a functional importance the isoform in physiology and pathology (III, IV, and Ortiz et al. submitted manuscripts).

The ADAM15 isoform 6 shows the widest SH3-protein interaction potential as evaluated by the number of cytosolic proline motifs. Also, studies have suggested that the mouse and human ADAM15 isoform 6 interacts with the Src and Lck tyrosine kinases more efficiently than isoform 2 [325, 326]. Furthermore, novel ADAM15 cytosolic tail interaction partner candidates were rescued in SH3-phage-library panning when the cytosolic tail of isoform 6 was used as a bait [353]. The novel interaction

115

partners included the SH3-domain of nephrocystin and the first SH3-domain of Tks5/FISH. The large number of cytosolic interactions suggests involvement of the longest ADAM15 isoforms in a multitude of different cellular protein complexes. However, since controversy on the cellular role of ADAM15 still exists, the physiological significance of these interactions remains elusive.

ADAM15 isoforms may be functional differing. The overexpression-shedding assays have only used isoform 2 and it is possible that some of the other isoforms are more potent sheddases. ADAM15 has been indicated as an active metalloprotease in vitro and ADAM15 expression has been associated with GPCR activation induced EGF shedding and subsequent EGFR transactivation in cancer cell lines [34, 167, 168, 290]. In contrast to its suggested role as a sheddase, the overexpression of the ADAM15 variant 2 has failed to induce robust shedding of EGFs or other substrates in mouse primary fibroblasts [173]. Also cells deficient of ADAM15 have not shown impairments in regulated shedding of the tested substrates [173]. The controversy in the role of ADAM15 as a sheddase may be explained by differences between ADAM15 isoforms.

The ADAM15 metalloprotease activity has been reported to degrade collagen and to induce mesangial cell migration and invasion [290]. Inhibition of ADAM15 expression by siRNA associated ADAM15 with cancer cell migration [167]. The siRNA inhibition also suggested ADAM15 to be involved in cell invasion associated with vascular tube morphogenesis [378]. Interestingly, ADAM15 inhibition caused the concomitant downregulation of MMP-1 and -10, but the molecular mechanisms behind this remain elusive [378]. In contrast to promotion of cell motility and invasion ADAM15 overexpression has been suggested to inhibit cell migration by blocking integrin mediated binding to the substratum by mediating strong intercellular adhesion [57, 466]. The controversy in role of ADAM15 in cell migration may be because promigratory results were acquired by nonselective inhibition of all ADAM15 variants while in overexpression studies only variant 2 were used. It is thus plausible that variant 2 is antimigratory and that variant 6, which has been associated with a stronger interaction with Src family kinases, can elicit invasion and migration promoting signals. Alternatively, the ADAM15 isoforms with few SH3 binding motifs are more efficiently transported to the cell surface and can more readily process ADAM15 substrates.

In conclusion, the novel ADAM15 variants may have cellular or physiological roles that diverge from the known ADAM15 variant used in most of the functional studies so far. This is suggested by the relatively high physiological expression of many alternative variants in tissues and the prominent differences in cytosolic tail sequences encoded by ADAM15 variants. Altogether this suggests that ADAM15 alternative splicing is an important part of its functional regulation.

116

7. Conclusions and perspectives

ADAMs have been indicated in the regulation of a panoply of pivotal molecular functions in non-neural tissues. However, many of the ADAM substrates also play an essential role in the CNS. In addition, integrins that have been shown to bind ADAMs have been implicated in glial-neural interactions and the regulation of cellular signaling and adhesion in synaptic plasticity. The present study indicated a wide range of expression of several ADAMs from different ADAM-groups in the CNS. This suggested that ADAMs comprise a major family of sheddases and adhesion proteins also in the CNS. The result indicated ADAM10 as the physiological α-secretase of APP, which has been corroborated by subsequent studies in model animals [428]. The CNS study also suggested the association of ADAM11 expression with neural functions, which has been corroborated in more recent knock-out animal studies [388].

The careful examination of the prototype ADAM15 gene indicated alternative splicing as the prominent physiological mechanism in the regulation of ADAM15 expression. The work indicated that several poorly characterized ADAM15 variants are widely expressed in normal human tissues. Furthermore, the alternative use of exons encoding cytosolic tails suggested that ADAM15 alternative splicing yields a set of potentially functionally differing proteins. The alternative protein isoforms may differ in their mechanisms of regulation, or the identified isoforms may be involved in cell signaling. A particularly interesting finding was the wide expression of the ADAM15 variant with only a short cytosolic tail, which has been associated with regulation cell adhesion in T-cells [8].

The ADAM15 gene was located in the chromosomal band 1q21.3, which has been previously associated with cancer [518]. The result indicated that the ADAM15 gene is in a region amplified in breast cancer derived cell lines. The amplification did not seem to change ADAM15 expression, although the cell culture setting may have masked the effects on expression levels. Importantly, ADAM15 alternative splicing was found altered in breast cancer cell lines. This indicated that at least ADAM15 alternative splicing is misregulated in breast cancer cell lines providing for the first time evidence of misregulated ADAM-splicing in cancer. ADAM15 has been associated with tissue remodeling and pathological neovascularization, which presumably supports tumor growth [377, 467]. Altogether, this suggests that ADAM15 alternative splicing may play a role in cancer progression and that ADAM15 is a candidate cancer promoting gene.

117

8. Acknowledgements

This study was carried out in the laboratory of molecular biology at the Institute of Medical Technology, University of Tampere, Finland. I want to thank the former and present heads of the institute, Professors Kai Krohn and Olli Silvennoinen for giving me the opportunity to use the excellent facilities and to be part of the enthusiastic scientific community of the IMT. The spirit of IMT (on the) rocks. Ari-Pekka Huovila has been the most patient, diligent, and kind supervisor equipped with good humor. My sincere gratitude to Ari, for giving me the opportunity to work in ADAMs-lab, guiding my growth as a scientist, and discussing with me of my ideas; good, bad, and crazy ones. Well, some even led to something. I want to express my gratitude to Professor Jorma Isola, who gave me an opportunity to work at the former Cancer Genetics laboratory. Jorma’s advices and views have been of great help and contained great deal of wisdom. I am deeply grateful to Rebekka Ortiz for being an excellent colleague, workmate, and co-author. Concluded from our discussion: Is there any other important genes in addition to ADAMs? I am also most thankful to my co-authors Professor Markku Pelto-Huikko, Elena Rybnikova, and Ritva Karhu without whom this thesis would not exist. I also greatly appreciate the technical assistance provided by Arja Alkula, and Ulla Jukarainen, who have contributed to the lab-works. A very special thanks to Professor Kalle Saksela for support, advices, and patience to let me work as half-pre-post-doc in your lab. Thanks also to members of the Saksela groups at Tampere and Helsinki. I am grateful for Professor Pekka Lappalainen and Docent Antero Salminen who reviewed my thesis in a short period of time. My sincere thanks goes to Helen Cooper, who made this thesis better by her improvements on the language. Many thanks also to Professors Mauno Vihinen and Heikki Kainulainen for looking over the progress of this thesis. Special thanks goes for Soile Levälahti for help and patience in printing this thesis. TGSBB has made my work, studies, and congress trips possible. Many thanks to all people at TGSBB, especially Mika Wallen and Professor Anne Kallioniemi. Also, Professor Howy Jacobs is acknowledged for organizing excellent courses. Anne and Howy are also thanked for letting me to attend their journal clubs. Thanks also to Kaarin Forsman for helping with the many finance-related things. Heimo, Kaisu, Kati, Amer, Toni, and other people at the “help-desks” have made life so much easier at IMT, not only because of their helping hands but also because of the great attitude and humor. During my time at IMT, I have interacted with several people who are acknowledged for their help. Special thanks goes to Anja Rovio for helping with the sequencer. I want to specially thank all members of the “original” Cancer Genetics lab with whom it was

118

so nice to work and chat. Extra special thanks to Olli’s, Tapio’s, Anne’s, Jorma’s, and Mauno’s lab-members; many of you have contributed to this thesis as organizers of the fun part of the lab work. I am deeply grateful for Päivikki Kauraniemi for everything you gave me for this thesis and for my life. Very special thanks to the members of the Mika Rämet’s lab for nice time at lunches, around the champagne glasses, and also outside the IMT. Special thanks to Susanna for journal clubs and reading the manuscript. I have been privileged to enjoy the company of some outstanding people outside the work. Their friendship, activities organized by them have kept me afloat from sinking completely into scientific work. Extra special thanks goes to Petteri for personal training, gaming, discussions, and outside activities as well as for long friendship starting from well…almost from the beginning. Thanks also to Riikka, who gave me and Anni an opportunity to be members of the Tampere Wine and Food society. Big thanks also for the other members of the gaming and sporting “ring”. Big thanks for the guys from the society of the Three Golden Nuggets (Juha, Ilkka, Kristian, Vesa, Jani, Mikko, Tommi, Seppo, Antti, and Kalle) for introducing me to the “supex” activities. Many thanks to Taiganpojat (Jussi P., Jussi V., Janne, Esko, Otso, Jokke, Vesku) for organization of possibly the healthiest but also the unhealthiest outdoor activities and for the great friendship and for salt and fat humor. Thanks also to Laura the all-around fun organizing person for help.

My warmest thanks to my parents Viljo and Anja for love, understanding, patience, support, and everything. Your contribution to this thesis and to my life is which has made this thesis possible. My loved and loving wife Anni, by words I can’t express the gratitude and love for you (we have seen/heard this earlier). Your patience, wisdom, food and wine, skills, and help have been invaluable for the accomplishment of this work. I thank you with all my heart. This thesis was financially supported by the Tampere Graduate School in Biomedicine and Biotechnology, Medical Research Fund of Tampere University Hospital, Emil, Aaltonen Foundation, and University of Tampere, the Finnish Cultural Foundation main fund, and the Finnish Cultural Foundation, Pirkanmaa Regional Fund of the Finnish Cultural Foundation. The printing of this thesis was supported by the Academic Foundation of the city of Tampere.

Tampere, June 2007 Iivari Kleino

119

9. References

1. Bonhoeffer, T. and R. Yuste, Spine motility. Phenomenology, mechanisms, and

function. Neuron, 2002. 35(6): p. 1019-27. 2. Lynch, G., C.S. Rex, and C.M. Gall, LTP consolidation: substrates, explanatory

power, and functional significance. Neuropharmacology, 2007. 52(1): p. 12-23. 3. Latefi, N.S. and D.R. Colman, The CNS synapse revisited: gaps, adhesive welds,

and borders. Neurochem Res, 2007. 32(2): p. 303-10. 4. Blobel, C.P., ADAMs: key components in EGFR signalling and development.

Nat Rev Mol Cell Biol, 2005. 6(1): p. 32-43. 5. Evans, J.P., Fertilin beta and other ADAMs as integrin ligands: insights into cell

adhesion and fertilization. Bioessays, 2001. 23(7): p. 628-39. 6. White, J.M., ADAMs: modulators of cell-cell and cell-matrix interactions. Curr

Opin Cell Biol, 2003. 15(5): p. 598-606. 7. Lafuste, P., et al., ADAM12 and alpha9beta1 integrin are instrumental in human

myogenic cell differentiation. Mol Biol Cell, 2005. 16(2): p. 861-70. 8. Charrier, L., et al., ADAM-15/metargidin mediates homotypic aggregation of

human T lymphocytes and heterotypic interactions of T lymphocytes with intestinal epithelial cells. J Biol Chem, 2007.

9. Kawaguchi, N., et al., ADAM12 induces actin cytoskeleton and extracellular matrix reorganization during early adipocyte differentiation by regulating beta1 integrin function. J Cell Sci, 2003. 116(Pt 19): p. 3893-904.

10. Chantry, A., N.A. Gregson, and P. Glynn, A novel metalloproteinase associated with brain myelin membranes. Isolation and characterization. J Biol Chem, 1989. 264(36): p. 21603-7.

11. Primakoff, P., H. Hyatt, and J. Tredick-Kline, Identification and purification of a sperm surface protein with a potential role in sperm-egg membrane fusion. J Cell Biol, 1987. 104(1): p. 141-9.

12. Blobel, C.P., et al., A potential fusion peptide and an integrin ligand domain in a protein active in sperm-egg fusion. Nature, 1992. 356(6366): p. 248-52.

13. Yoshida, S., et al., Molecular cloning of cDNA encoding MS2 antigen, a novel cell surface antigen strongly expressed in murine monocytic lineage. Int Immunol, 1990. 2(6): p. 585-91.

14. Blobel, C.P. and J.M. White, Structure, function and evolutionary relationship of proteins containing a disintegrin domain. Curr Opin Cell Biol, 1992. 4(5): p. 760-5.

15. Wolfsberg, T.G., et al., ADAM, a novel family of membrane proteins containing A Disintegrin And Metalloprotease domain: multipotential functions in cell-cell and cell-matrix interactions. J Cell Biol, 1995. 131(2): p. 275-8.

16. Leonard, J.D., F. Lin, and M.E. Milla, Chaperone-like properties of the prodomain of TNFalpha-converting enzyme (TACE) and the functional role of its cysteine switch. Biochem J, 2005. 387(Pt 3): p. 797-805.

17. Roghani, M., et al., Metalloprotease-disintegrin MDC9: intracellular maturation and catalytic activity. J Biol Chem, 1999. 274(6): p. 3531-40.

18. Gonzales, P.E., et al., Inhibition of the tumor necrosis factor-alpha-converting enzyme by its pro domain. J Biol Chem, 2004. 279(30): p. 31638-45.

19. Loechel, F., et al., Regulation of human ADAM 12 protease by the prodomain. Evidence for a functional cysteine switch. J Biol Chem, 1999. 274(19): p. 13427-33.

20. Van Wart, H.E. and H. Birkedal-Hansen, The cysteine switch: a principle of regulation of metalloproteinase activity with potential applicability to the entire matrix metalloproteinase gene family. Proc Natl Acad Sci U S A, 1990. 87(14): p. 5578-82.

120

21. Seals, D.F. and S.A. Courtneidge, The ADAMs family of metalloproteases: multidomain proteins with multiple functions. Genes Dev, 2003. 17(1): p. 7-30.

22. Mochizuki, S., et al., ADAM28 is activated by MMP-7 (matrilysin-1) and cleaves insulin-like growth factor binding protein-3. Biochem Biophys Res Commun, 2004. 315(1): p. 79-84.

23. Lum, L., M.S. Reid, and C.P. Blobel, Intracellular maturation of the mouse metalloprotease disintegrin MDC15. J Biol Chem, 1998. 273(40): p. 26236-47.

24. Anders, A., et al., Regulation of the alpha-secretase ADAM10 by its prodomain and proprotein convertases. Faseb J, 2001. 15(10): p. 1837-9.

25. Howard, L., R.A. Maciewicz, and C.P. Blobel, Cloning and characterization of ADAM28: evidence for autocatalytic pro-domain removal and for cell surface localization of mature ADAM28. Biochem J, 2000. 348 Pt 1: p. 21-7.

26. Schlomann, U., et al., The metalloprotease disintegrin ADAM8. Processing by autocatalysis is required for proteolytic activity and cell adhesion. J Biol Chem, 2002. 277(50): p. 48210-9.

27. Zhang, Z., et al., Reactive oxygen species mediate tumor necrosis factor alpha-converting, enzyme-dependent ectodomain shedding induced by phorbol myristate acetate. Faseb J, 2001. 15(2): p. 303-5.

28. Wewer, U.M., et al., ADAM12 is a four-leafed clover: the excised prodomain remains bound to the mature enzyme. J Biol Chem, 2006. 281(14): p. 9418-22.

29. Stocker, W., et al., The metzincins--topological and sequential relations between the astacins, adamalysins, serralysins, and matrixins (collagenases) define a superfamily of zinc-peptidases. Protein Sci, 1995. 4(5): p. 823-40.

30. Maskos, K., et al., Crystal structure of the catalytic domain of human tumor necrosis factor-alpha-converting enzyme. Proc Natl Acad Sci U S A, 1998. 95(7): p. 3408-12.

31. Orth, P., et al., Crystal structure of the catalytic domain of human ADAM33. J Mol Biol, 2004. 335(1): p. 129-37.

32. Black, R.A., et al., Substrate specificity and inducibility of TACE (tumour necrosis factor alpha-converting enzyme) revisited: the Ala-Val preference, and induced intrinsic activity. Biochem Soc Symp, 2003(70): p. 39-52.

33. Takeda, S., et al., Crystal structures of VAP1 reveal ADAMs' MDC domain architecture and its unique C-shaped scaffold. Embo J, 2006. 25(11): p. 2388-96.

34. Fourie, A.M., et al., Catalytic activity of ADAM8, ADAM15, and MDC-L (ADAM28) on synthetic peptide substrates and in ectodomain cleavage of CD23. J Biol Chem, 2003. 278(33): p. 30469-77.

35. Zou, J., et al., Catalytic activity of human ADAM33. J Biol Chem, 2004. 279(11): p. 9818-30.

36. Huovila, A.P., et al., Shedding light on ADAM metalloproteinases. Trends Biochem Sci, 2005. 30(7): p. 413-22.

37. Black, R.A. and J.M. White, ADAMs: focus on the protease domain. Curr Opin Cell Biol, 1998. 10(5): p. 654-9.

38. Zheng, Y., et al., Evaluation of the contribution of different ADAMs to tumor necrosis factor alpha (TNFalpha) shedding and of the function of the TNFalpha ectodomain in ensuring selective stimulated shedding by the TNFalpha convertase (TACE/ADAM17). J Biol Chem, 2004. 279(41): p. 42898-906.

39. Janes, P.W., et al., Adam meets Eph: an ADAM substrate recognition module acts as a molecular switch for ephrin cleavage in trans. Cell, 2005. 123(2): p. 291-304.

40. Pan, D. and G.M. Rubin, Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell, 1997. 90(2): p. 271-80.

41. Amour, A., et al., The enzymatic activity of ADAM8 and ADAM9 is not regulated by TIMPs. FEBS Lett, 2002. 524(1-3): p. 154-8.

42. Amour, A., et al., The in vitro activity of ADAM-10 is inhibited by TIMP-1 and TIMP-3. FEBS Lett, 2000. 473(3): p. 275-9.

43. Loechel, F., et al., ADAM 12-S cleaves IGFBP-3 and IGFBP-5 and is inhibited by TIMP-3. Biochem Biophys Res Commun, 2000. 278(3): p. 511-5.

121

44. Roy, R., et al., ADAM 12 cleaves extracellular matrix proteins and correlates with cancer status and stage. J Biol Chem, 2004. 279(49): p. 51323-30.

45. Amour, A., et al., TNF-alpha converting enzyme (TACE) is inhibited by TIMP-3. FEBS Lett, 1998. 435(1): p. 39-44.

46. Chesneau, V., et al., Catalytic properties of ADAM19. J Biol Chem, 2003. 278(25): p. 22331-40.

47. Ludwig, A., et al., Metalloproteinase inhibitors for the disintegrin-like metalloproteinases ADAM10 and ADAM17 that differentially block constitutive and phorbol ester-inducible shedding of cell surface molecules. Comb Chem High Throughput Screen, 2005. 8(2): p. 161-71.

48. Mohammed, F.F., et al., Abnormal TNF activity in Timp3-/- mice leads to chronic hepatic inflammation and failure of liver regeneration. Nat Genet, 2004. 36(9): p. 969-77.

49. Smookler, D.S., et al., Tissue inhibitor of metalloproteinase 3 regulates TNF-dependent systemic inflammation. J Immunol, 2006. 176(2): p. 721-5.

50. Smith, M.R., et al., TIMP-3 induces cell death by stabilizing TNF-alpha receptors on the surface of human colon carcinoma cells. Cytokine, 1997. 9(10): p. 770-80.

51. Calvete, J.J., et al., Snake venom disintegrins: evolution of structure and function. Toxicon, 2005. 45(8): p. 1063-74.

52. Huang, T.F., et al., Trigramin. A low molecular weight peptide inhibiting fibrinogen interaction with platelet receptors expressed on glycoprotein IIb-IIIa complex. J Biol Chem, 1987. 262(33): p. 16157-63.

53. Wolfsberg, T.G., et al., The precursor region of a protein active in sperm-egg fusion contains a metalloprotease and a disintegrin domain: structural, functional, and evolutionary implications. Proc Natl Acad Sci U S A, 1993. 90(22): p. 10783-7.

54. Stone, A.L., M. Kroeger, and Q.X. Sang, Structure-function analysis of the ADAM family of disintegrin-like and metalloproteinase-containing proteins (review). J Protein Chem, 1999. 18(4): p. 447-65.

55. Thodeti, C.K., et al., Hierarchy of ADAM12 binding to integrins in tumor cells. Exp Cell Res, 2005. 309(2): p. 438-50.

56. Karadag, A., M. Zhou, and P.I. Croucher, ADAM-9 (MDC-9/meltrin-gamma), a member of the a disintegrin and metalloproteinase family, regulates myeloma-cell-induced interleukin-6 production in osteoblasts by direct interaction with the alpha(v)beta5 integrin. Blood, 2006. 107(8): p. 3271-8.

57. Beck, V., et al., ADAM15 decreases integrin alphavbeta3/vitronectin-mediated ovarian cancer cell adhesion and motility in an RGD-dependent fashion. Int J Biochem Cell Biol, 2005. 37(3): p. 590-603.

58. Huang, J., L.C. Bridges, and J.M. White, Selective modulation of integrin-mediated cell migration by distinct ADAM family members. Mol Biol Cell, 2005. 16(10): p. 4982-91.

59. Bridges, L.C., et al., Integrin alpha4beta1-dependent adhesion to ADAM 28 (MDC-L) requires an extended surface of the disintegrin domain. Biochemistry, 2003. 42(13): p. 3734-41.

60. Bridges, L.C., D. Sheppard, and R.D. Bowditch, ADAM disintegrin-like domain recognition by the lymphocyte integrins alpha4beta1 and alpha4beta7. Biochem J, 2005. 387(Pt 1): p. 101-8.

61. Zhang, X.P., et al., Specific interaction of the recombinant disintegrin-like domain of MDC-15 (metargidin, ADAM-15) with integrin alphavbeta3. J Biol Chem, 1998. 273(13): p. 7345-50.

62. Jeon, O.H., et al., Novel function of human ADAM15 disintegrin-like domain and its derivatives in platelet aggregation. Thromb Res, 2006.

63. Lehtonen, J.V., et al., BODIL: a molecular modeling environment for structure-function analysis and drug design. J Comput Aided Mol Des, 2004. 18(6): p. 401-19.

64. Hynes, R.O., Integrins: bidirectional, allosteric signaling machines. Cell, 2002. 110(6): p. 673-87.

122

65. Cao, Y., et al., Role of metalloprotease disintegrin ADAM12 in determination of quiescent reserve cells during myogenic differentiation in vitro. Mol Cell Biol, 2003. 23(19): p. 6725-38.

66. Luo, B.H. and T.A. Springer, Integrin structures and conformational signaling. Curr Opin Cell Biol, 2006. 18(5): p. 579-86.

67. Chen, H. and N.S. Sampson, Mediation of sperm-egg fusion: evidence that mouse egg alpha6beta1 integrin is the receptor for sperm fertilinbeta. Chem Biol, 1999. 6(1): p. 1-10.

68. Luo, B.H., C.V. Carman, and T.A. Springer, Structural Basis of Integrin Regulation and Signaling. Annu Rev Immunol, 2007.

69. Zhao, Z., et al., Interaction of the disintegrin and cysteine-rich domains of ADAM12 with integrin alpha7beta1. Exp Cell Res, 2004. 298(1): p. 28-37.

70. Eto, K., et al., RGD-independent binding of integrin alpha9beta1 to the ADAM-12 and -15 disintegrin domains mediates cell-cell interaction. J Biol Chem, 2000. 275(45): p. 34922-30.

71. Fukata, Y., et al., Epilepsy-related ligand/receptor complex LGI1 and ADAM22 regulate synaptic transmission. Science, 2006. 313(5794): p. 1792-5.

72. Staub, E., et al., The novel EPTP repeat defines a superfamily of proteins implicated in epileptic disorders. Trends Biochem Sci, 2002. 27(9): p. 441-4.

73. Gherardi, E., et al., The sema domain. Curr Opin Struct Biol, 2004. 14(6): p. 669-78.

74. Eto, K., et al., Functional classification of ADAMs based on a conserved motif for binding to integrin alpha 9beta 1: implications for sperm-egg binding and other cell interactions. J Biol Chem, 2002. 277(20): p. 17804-10.

75. Almeida, E.A., et al., Mouse egg integrin alpha 6 beta 1 functions as a sperm receptor. Cell, 1995. 81(7): p. 1095-104.

76. Bigler, D., et al., Sequence-specific interaction between the disintegrin domain of mouse ADAM 2 (fertilin beta) and murine eggs. Role of the alpha(6) integrin subunit. J Biol Chem, 2000. 275(16): p. 11576-84.

77. Chen, M.S., et al., Role of the integrin-associated protein CD9 in binding between sperm ADAM 2 and the egg integrin alpha6beta1: implications for murine fertilization. Proc Natl Acad Sci U S A, 1999. 96(21): p. 11830-5.

78. Tomczuk, M., et al., Role of multiple beta1 integrins in cell adhesion to the disintegrin domains of ADAMs 2 and 3. Exp Cell Res, 2003. 290(1): p. 68-81.

79. Zhu, X. and J.P. Evans, Analysis of the roles of RGD-binding integrins, alpha(4)/alpha(9) integrins, alpha(6) integrins, and CD9 in the interaction of the fertilin beta (ADAM2) disintegrin domain with the mouse egg membrane. Biol Reprod, 2002. 66(4): p. 1193-202.

80. Takahashi, Y., et al., Sequence-specific interaction between the disintegrin domain of mouse ADAM 3 and murine eggs: role of beta1 integrin-associated proteins CD9, CD81, and CD98. Mol Biol Cell, 2001. 12(4): p. 809-20.

81. Rao, H., et al., Alpha9beta1: a novel osteoclast integrin that regulates osteoclast formation and function. J Bone Miner Res, 2006. 21(10): p. 1657-65.

82. Nath, D., et al., Meltrin gamma(ADAM-9) mediates cellular adhesion through alpha(6)beta(1 )integrin, leading to a marked induction of fibroblast cell motility. J Cell Sci, 2000. 113 ( Pt 12): p. 2319-28.

83. Zhou, M., et al., MDC-9 (ADAM-9/Meltrin gamma) functions as an adhesion molecule by binding the alpha(v)beta(5) integrin. Biochem Biophys Res Commun, 2001. 280(2): p. 574-80.

84. Mahimkar, R.M., et al., The disintegrin domain of ADAM9: a ligand for multiple beta1 renal integrins. Biochem J, 2005. 385(Pt 2): p. 461-8.

85. Mazzocca, A., et al., A secreted form of ADAM9 promotes carcinoma invasion through tumor-stromal interactions. Cancer Res, 2005. 65(11): p. 4728-38.

86. D'Abaco, G.M., et al., ADAM22, expressed in normal brain but not in high-grade gliomas, inhibits cellular proliferation via the disintegrin domain. Neurosurgery, 2006. 58(1): p. 179-86; discussion 179-86.

87. Thodeti, C.K., et al., ADAM12-mediated focal adhesion formation is differently regulated by beta1 and beta3 integrins. FEBS Lett, 2005. 579(25): p. 5589-95.

123

88. Brzoska, E., et al., Integrin alpha3 subunit participates in myoblast adhesion and fusion in vitro. Differentiation, 2006. 74(2-3): p. 105-18.

89. Gaultier, A., et al., ADAM13 disintegrin and cysteine-rich domains bind to the second heparin-binding domain of fibronectin. J Biol Chem, 2002. 277(26): p. 23336-44.

90. Nath, D., et al., Interaction of metargidin (ADAM-15) with alphavbeta3 and alpha5beta1 integrins on different haemopoietic cells. J Cell Sci, 1999. 112 ( Pt 4): p. 579-87.

91. Iba, K., et al., Cysteine-rich domain of human ADAM 12 (meltrin alpha) supports tumor cell adhesion. Am J Pathol, 1999. 154(5): p. 1489-501.

92. Langer, H., et al., ADAM 15 is an adhesion receptor for platelet GPIIb-IIIa and induces platelet activation. Thromb Haemost, 2005. 94(3): p. 555-61.

93. Lu, D., et al., Integrin binding characteristics of the disintegrin-like domain of ADAM-15. Thromb Haemost, 2006. 96(5): p. 642-51.

94. Bax, D.V., et al., Integrin alpha5beta1 and ADAM-17 interact in vitro and co-localize in migrating HeLa cells. J Biol Chem, 2004. 279(21): p. 22377-86.

95. Cal, S., et al., ADAM 23/MDC3, a human disintegrin that promotes cell adhesion via interaction with the alphavbeta3 integrin through an RGD-independent mechanism. Mol Biol Cell, 2000. 11(4): p. 1457-69.

96. Bridges, L.C., et al., The lymphocyte metalloprotease MDC-L (ADAM 28) is a ligand for the integrin alpha4beta1. J Biol Chem, 2002. 277(5): p. 3784-92.

97. Reddy, P., et al., Functional analysis of the domain structure of tumor necrosis factor-alpha converting enzyme. J Biol Chem, 2000. 275(19): p. 14608-14.

98. Smith, K.M., et al., The cysteine-rich domain regulates ADAM protease function in vivo. J Cell Biol, 2002. 159(5): p. 893-902.

99. Bartholin, L., et al., FLRG, a new ADAM 12-associated protein, modulates osteoclast differentiation. Biol Cell, 2004.

100. Iba, K., et al., The cysteine-rich domain of human ADAM 12 supports cell adhesion through syndecans and triggers signaling events that lead to beta1 integrin-dependent cell spreading. J Cell Biol, 2000. 149(5): p. 1143-56.

101. Thodeti, C.K., et al., ADAM12/syndecan-4 signaling promotes beta 1 integrin-dependent cell spreading through protein kinase Calpha and RhoA. J Biol Chem, 2003. 278(11): p. 9576-84.

102. Shi, Z., et al., ADAM 12, a disintegrin metalloprotease, interacts with insulin-like growth factor-binding protein-3. J Biol Chem, 2000. 275(24): p. 18574-80.

103. Gilpin, B.J., et al., A novel, secreted form of human ADAM 12 (meltrin alpha) provokes myogenesis in vivo. J Biol Chem, 1998. 273(1): p. 157-66.

104. Alfandari, D., et al., Xenopus ADAM 13 is a metalloprotease required for cranial neural crest-cell migration. Curr Biol, 2001. 11(12): p. 918-30.

105. Mohan, S., et al., ADAM-9 is an insulin-like growth factor binding protein-5 protease produced and secreted by human osteoblasts. Biochemistry, 2002. 41(51): p. 15394-403.

106. Kang, T., et al., Autolytic processing at Glu586-Ser587 within the cysteine-rich domain of human adamalysin 19/disintegrin-metalloproteinase 19 is necessary for its proteolytic activity. J Biol Chem, 2002. 277(50): p. 48514-22.

107. Hougaard, S., et al., Trafficking of human ADAM 12-L: retention in the trans-Golgi network. Biochem Biophys Res Commun, 2000. 275(2): p. 261-7.

108. Wakatsuki, S., T. Kurisaki, and A. Sehara-Fujisawa, Lipid rafts identified as locations of ectodomain shedding mediated by Meltrin beta/ADAM19. J Neurochem, 2004. 89(1): p. 119-23.

109. Shirakabe, K., et al., Roles of Meltrin beta /ADAM19 in the processing of neuregulin. J Biol Chem, 2001. 276(12): p. 9352-8.

110. Yokozeki, T., et al., Meltrin beta (ADAM19) mediates ectodomain shedding of Neuregulin beta1 in the Golgi apparatus: fluorescence correlation spectroscopic observation of the dynamics of ectodomain shedding in living cells. Genes Cells, 2007. 12(3): p. 329-43.

111. Zimina, E.P., L. Bruckner-Tuderman, and C.W. Franzke, Shedding of collagen XVII ectodomain depends on plasma membrane microenvironment. J Biol Chem, 2005. 280(40): p. 34019-24.

124

112. von Tresckow, B., et al., Depletion of cellular cholesterol and lipid rafts increases shedding of CD30. J Immunol, 2004. 172(7): p. 4324-31.

113. Kay, J.G., et al., Cytokine secretion via cholesterol-rich lipid raft-associated SNAREs at the phagocytic cup. J Biol Chem, 2006. 281(17): p. 11949-54.

114. Montero, J.C., et al., Differential shedding of transmembrane neuregulin isoforms by the tumor necrosis factor-alpha-converting enzyme. Mol Cell Neurosci, 2000. 16(5): p. 631-48.

115. Matthews, V., et al., Cellular cholesterol depletion triggers shedding of the human interleukin-6 receptor by ADAM10 and ADAM17 (TACE). J Biol Chem, 2003. 278(40): p. 38829-39.

116. Tellier, E., et al., The shedding activity of ADAM17 is sequestered in lipid rafts. Exp Cell Res, 2006. 312(20): p. 3969-80.

117. Canault, M., et al., FHL2 interacts with both ADAM-17 and the cytoskeleton and regulates ADAM-17 localization and activity. J Cell Physiol, 2006. 208(2): p. 363-72.

118. Hemler, M.E., Tetraspanin functions and associated microdomains. Nat Rev Mol Cell Biol, 2005. 6(10): p. 801-11.

119. Yan, Y., K. Shirakabe, and Z. Werb, The metalloprotease Kuzbanian (ADAM10) mediates the transactivation of EGF receptor by G protein-coupled receptors. J Cell Biol, 2002. 158(2): p. 221-6.

120. Le Naour, F., et al., Profiling of the tetraspanin web of human colon cancer cells. Mol Cell Proteomics, 2006. 5(5): p. 845-57.

121. Andre, M., et al., Proteomic analysis of the tetraspanin web using LC-ESI-MS/MS and MALDI-FTICR-MS. Proteomics, 2006. 6(5): p. 1437-49.

122. Shi, W., et al., The tetraspanin CD9 associates with transmembrane TGF-alpha and regulates TGF-alpha-induced EGF receptor activation and cell proliferation. J Cell Biol, 2000. 148(3): p. 591-602.

123. Inui, S., et al., Possible role of coexpression of CD9 with membrane-anchored heparin-binding EGF-like growth factor and amphiregulin in cultured human keratinocyte growth. J Cell Physiol, 1997. 171(3): p. 291-8.

124. Little, K.D., M.E. Hemler, and C.S. Stipp, Dynamic regulation of a GPCR-tetraspanin-G protein complex on intact cells: central role of CD81 in facilitating GPR56-Galpha q/11 association. Mol Biol Cell, 2004. 15(5): p. 2375-87.

125. Carey, B.W., D.Y. Kim, and D.M. Kovacs, Presenilin/gamma-secretase and alpha-secretase-like peptidases cleave human MHC Class I proteins. Biochem J, 2007. 401(1): p. 121-7.

126. Sahin, U., et al., Distinct roles for ADAM10 and ADAM17 in ectodomain shedding of six EGFR ligands. J Cell Biol, 2004. 164(5): p. 769-79.

127. Resh, M.D., Palmitoylation of ligands, receptors, and intracellular signaling molecules. Sci STKE, 2006. 2006(359): p. re14.

128. Resh, M.D., Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins. Biochim Biophys Acta, 1999. 1451(1): p. 1-16.

129. Glassey, B. and A. Civetta, Positive selection at reproductive ADAM genes with potential intercellular binding activity. Mol Biol Evol, 2004. 21(5): p. 851-9.

130. Cesareni, G., et al., Can we infer peptide recognition specificity mediated by SH3 domains? FEBS Lett, 2002. 513(1): p. 38-44.

131. Kay, B.K., M.P. Williamson, and M. Sudol, The importance of being proline: the interaction of proline-rich motifs in signaling proteins with their cognate domains. Faseb J, 2000. 14(2): p. 231-41.

132. Ilsley, J.L., M. Sudol, and S.J. Winder, The WW domain: linking cell signalling to the membrane cytoskeleton. Cell Signal, 2002. 14(3): p. 183-9.

133. Harris, B.Z. and W.A. Lim, Mechanism and role of PDZ domains in signaling complex assembly. J Cell Sci, 2001. 114(Pt 18): p. 3219-31.

134. Yaffe, M.B., How do 14-3-3 proteins work?-- Gatekeeper phosphorylation and the molecular anvil hypothesis. FEBS Lett, 2002. 513(1): p. 53-7.

135. Coblitz, B., et al., C-terminal binding: an expanded repertoire and function of 14-3-3 proteins. FEBS Lett, 2006. 580(6): p. 1531-5.

125

136. Ohtsu, H., P.J. Dempsey, and S. Eguchi, ADAMs as mediators of EGF receptor transactivation by G protein-coupled receptors. Am J Physiol Cell Physiol, 2006. 291(1): p. C1-10.

137. Kheradmand, F. and Z. Werb, Shedding light on sheddases: role in growth and development. Bioessays, 2002. 24(1): p. 8-12.

138. Loewer, A. and G. Lahav, Cellular conference call: external feedback affects cell-fate decisions. Cell, 2006. 124(6): p. 1128-30.

139. Reiss, K., A. Ludwig, and P. Saftig, Breaking up the tie: disintegrin-like metalloproteinases as regulators of cell migration in inflammation and invasion. Pharmacol Ther, 2006. 111(3): p. 985-1006.

140. Asakura, M., et al., Cardiac hypertrophy is inhibited by antagonism of ADAM12 processing of HB-EGF: metalloproteinase inhibitors as a new therapy. Nat Med, 2002. 8(1): p. 35-40.

141. Lautrette, A., et al., Angiotensin II and EGF receptor cross-talk in chronic kidney diseases: a new therapeutic approach. Nat Med, 2005. 11(8): p. 867-74.

142. Garton, K.J., et al., Tumor necrosis factor-alpha-converting enzyme (ADAM17) mediates the cleavage and shedding of fractalkine (CX3CL1). J Biol Chem, 2001. 276(41): p. 37993-8001.

143. Hundhausen, C., et al., The disintegrin-like metalloproteinase ADAM10 is involved in constitutive cleavage of CX3CL1 (fractalkine) and regulates CX3CL1-mediated cell-cell adhesion. Blood, 2003. 102(4): p. 1186-95.

144. Tsou, C.L., C.A. Haskell, and I.F. Charo, Tumor necrosis factor-alpha-converting enzyme mediates the inducible cleavage of fractalkine. J Biol Chem, 2001. 276(48): p. 44622-6.

145. Gough, P.J., et al., A disintegrin and metalloproteinase 10-mediated cleavage and shedding regulates the cell surface expression of CXC chemokine ligand 16. J Immunol, 2004. 172(6): p. 3678-85.

146. Abel, S., et al., The transmembrane CXC-chemokine ligand 16 is induced by IFN-gamma and TNF-alpha and shed by the activity of the disintegrin-like metalloproteinase ADAM10. J Immunol, 2004. 172(10): p. 6362-72.

147. Black, R.A., et al., A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature, 1997. 385(6618): p. 729-33.

148. Moss, M.L., et al., Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-alpha. Nature, 1997. 385(6618): p. 733-6.

149. Condon, T.P., et al., ADAM17 but not ADAM10 mediates tumor necrosis factor-alpha and L-selectin shedding from leukocyte membranes. Antisense Nucleic Acid Drug Dev, 2001. 11(2): p. 107-16.

150. Jackson, L.F., et al., Defective valvulogenesis in HB-EGF and TACE-null mice is associated with aberrant BMP signaling. Embo J, 2003. 22(11): p. 2704-16.

151. Doedens, J.R., R.M. Mahimkar, and R.A. Black, TACE/ADAM-17 enzymatic activity is increased in response to cellular stimulation. Biochem Biophys Res Commun, 2003. 308(2): p. 331-8.

152. Zhang, Z., et al., Activation of tumor necrosis factor-alpha-converting enzyme-mediated ectodomain shedding by nitric oxide. J Biol Chem, 2000. 275(21): p. 15839-44.

153. Lunn, C.A., et al., Purification of ADAM 10 from bovine spleen as a TNFalpha convertase. FEBS Lett, 1997. 400(3): p. 333-5.

154. Hurtado, O., et al., TACE/ADAM17-TNF-alpha pathway in rat cortical cultures after exposure to oxygen-glucose deprivation or glutamate. J Cereb Blood Flow Metab, 2002. 22(5): p. 576-85.

155. Wang, K.Y., et al., Switch of histamine receptor expression from H2 to H1 during differentiation of monocytes into macrophages. FEBS Lett, 2000. 473(3): p. 345-8.

156. Zhang, Z., et al., Inhibition of TNF-alpha processing and TACE-mediated ectodomain shedding by ethanol. J Leukoc Biol, 2000. 67(6): p. 856-62.

157. Peschon, J.J., et al., An essential role for ectodomain shedding in mammalian development. Science, 1998. 282(5392): p. 1281-4.

158. Dehmel, T., et al., The cell-specific expression of metalloproteinase-disintegrins (ADAMs) in inflammatory myopathies. Neurobiol Dis, 2007.

126

159. Zhou, H.M., et al., Essential role for ADAM19 in cardiovascular morphogenesis. Mol Cell Biol, 2004. 24(1): p. 96-104.

160. Lum, L., et al., Evidence for a role of a tumor necrosis factor-alpha (TNF-alpha)-converting enzyme-like protease in shedding of TRANCE, a TNF family member involved in osteoclastogenesis and dendritic cell survival. J Biol Chem, 1999. 274(19): p. 13613-8.

161. Hikita, A., et al., Negative regulation of osteoclastogenesis by ectodomain shedding of receptor activator of NF-kappa B ligand. J Biol Chem, 2006.

162. Weskamp, G., et al., ADAM10 is a principal 'sheddase' of the low-affinity immunoglobulin E receptor CD23. Nat Immunol, 2006.

163. Kawaguchi, N., et al., Different ADAMs have distinct influences on Kit ligand processing: phorbol-ester-stimulated ectodomain shedding of Kitl1 by ADAM17 is reduced by ADAM19. J Cell Sci, 2007. 120(Pt 6): p. 943-52.

164. Schulte, M., et al., ADAM10 regulates FasL cell surface expression and modulates FasL-induced cytotoxicity and activation-induced cell death. Cell Death Differ, 2007.

165. Lemjabbar, H., et al., Tobacco smoke-induced lung cell proliferation mediated by tumor necrosis factor alpha-converting enzyme and amphiregulin. J Biol Chem, 2003. 278(28): p. 26202-7.

166. Gschwind, A., et al., TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells. Embo J, 2003. 22(10): p. 2411-21.

167. Schafer, B., A. Gschwind, and A. Ullrich, Multiple G-protein-coupled receptor signals converge on the epidermal growth factor receptor to promote migration and invasion. Oncogene, 2004. 23(4): p. 991-9.

168. Schafer, B., et al., Distinct ADAM metalloproteinases regulate G protein-coupled receptor-induced cell proliferation and survival. J Biol Chem, 2004. 279(46): p. 47929-38.

169. Hart, S., et al., GPCR-induced migration of breast carcinoma cells depends on both EGFR signal transactivation and EGFR-independent pathways. Biol Chem, 2005. 386(9): p. 845-55.

170. Hart, S., O.M. Fischer, and A. Ullrich, Cannabinoids induce cancer cell proliferation via tumor necrosis factor alpha-converting enzyme (TACE/ADAM17)-mediated transactivation of the epidermal growth factor receptor. Cancer Res, 2004. 64(6): p. 1943-50.

171. Sunnarborg, S.W., et al., Tumor necrosis factor-alpha converting enzyme (TACE) regulates epidermal growth factor receptor ligand availability. J Biol Chem, 2002. 277(15): p. 12838-45.

172. Hinkle, C.L., et al., Selective roles for tumor necrosis factor alpha-converting enzyme/ADAM17 in the shedding of the epidermal growth factor receptor ligand family: the juxtamembrane stalk determines cleavage efficiency. J Biol Chem, 2004. 279(23): p. 24179-88.

173. Horiuchi, K., et al., Substrate Selectivity of Epidermal Growth Factor-Receptor Ligand Sheddases and their Regulation by Phorbol Esters and Calcium Influx. Mol Biol Cell, 2007. 18(1): p. 176-188.

174. Sanderson, M.P., et al., ADAM10 mediates ectodomain shedding of the betacellulin precursor activated by p-aminophenylmercuric acetate and extracellular calcium influx. J Biol Chem, 2005. 280(3): p. 1826-37.

175. Sanderson, M.P., et al., Hydrogen peroxide and endothelin-1 are novel activators of betacellulin ectodomain shedding. J Cell Biochem, 2006. 99(2): p. 609-23.

176. Peduto, L., et al., Critical function for ADAM9 in mouse prostate cancer. Cancer Res, 2005. 65(20): p. 9312-9.

177. Sahin, U. and C.P. Blobel, Ectodomain shedding of the EGF-receptor ligand epigen is mediated by ADAM17. FEBS Lett, 2007. 581(1): p. 41-4.

178. Gooz, M., et al., 5-HT2A receptor induces ERK phosphorylation and proliferation through ADAM-17 tumor necrosis factor-alpha-converting enzyme (TACE) activation and heparin-bound epidermal growth factor-like growth

127

factor (HB-EGF) shedding in mesangial cells. J Biol Chem, 2006. 281(30): p. 21004-12.

179. Mori, S., et al., PACSIN3 binds ADAM12/meltrin alpha and up-regulates ectodomain shedding of heparin-binding epidermal growth factor-like growth factor. J Biol Chem, 2003. 278(46): p. 46029-34.

180. Kodama, T., et al., ADAM12 is selectively overexpressed in human glioblastomas and is associated with glioblastoma cell proliferation and shedding of heparin-binding epidermal growth factor. Am J Pathol, 2004. 165(5): p. 1743-53.

181. Kurisaki, T., et al., Phenotypic analysis of Meltrin alpha (ADAM12)-deficient mice: involvement of Meltrin alpha in adipogenesis and myogenesis. Mol Cell Biol, 2003. 23(1): p. 55-61.

182. Izumi, Y., et al., A metalloprotease-disintegrin, MDC9/meltrin-gamma/ADAM9 and PKCdelta are involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Embo J, 1998. 17(24): p. 7260-72.

183. Lemjabbar, H. and C. Basbaum, Platelet-activating factor receptor and ADAM10 mediate responses to Staphylococcus aureus in epithelial cells. Nat Med, 2002. 8(1): p. 41-6.

184. Keates, S., et al., cag+ Helicobacter pylori induce transactivation of the epidermal growth factor receptor in AGS gastric epithelial cells. J Biol Chem, 2001. 276(51): p. 48127-34.

185. Nishi, E., et al., Nardilysin enhances ectodomain shedding of heparin-binding epidermal growth factor-like growth factor through activation of tumor necrosis factor-alpha-converting enzyme. J Biol Chem, 2006. 281(41): p. 31164-72.

186. Shishido, Y., et al., Activity-dependent shedding of heparin-binding EGF-like growth factor in brain neurons. Biochem Biophys Res Commun, 2006. 348(3): p. 963-70.

187. Horiuchi, K., et al., Evaluation of the contributions of ADAMs 9, 12, 15, 17, and 19 to heart development and ectodomain shedding of neuregulins beta1 and beta2. Dev Biol, 2005. 283(2): p. 459-71.

188. Tanida, S., et al., The mechanism of cleavage of EGFR ligands induced by inflammatory cytokines in gastric cancer cells. Gastroenterology, 2004. 127(2): p. 559-69.

189. Mifune, M., et al., G protein coupling and second messenger generation are indispensable for metalloprotease-dependent, heparin-binding epidermal growth factor shedding through angiotensin II type-1 receptor. J Biol Chem, 2005. 280(28): p. 26592-9.

190. Janes, K.A., et al., The response of human epithelial cells to TNF involves an inducible autocrine cascade. Cell, 2006. 124(6): p. 1225-39.

191. Montero, J.C., et al., Mitogen-activated protein kinase-dependent and -independent routes control shedding of transmembrane growth factors through multiple secretases. Biochem J, 2002. 363(Pt 2): p. 211-21.

192. Diaz-Rodriguez, E., et al., Stimulation of cleavage of membrane proteins by calmodulin inhibitors. Biochem J, 2000. 346 Pt 2: p. 359-67.

193. Kurohara, K., et al., Essential roles of Meltrin beta (ADAM19) in heart development. Dev Biol, 2004. 267(1): p. 14-28.

194. Zhu, L., et al., Regulated surface expression and shedding support a dual role for semaphorin 4D in platelet responses to vascular injury. Proc Natl Acad Sci U S A, 2007. 104(5): p. 1621-6.

195. Naus, S., et al., Identification of candidate substrates for ectodomain shedding by the metalloprotease-disintegrin ADAM8. Biol Chem, 2006. 387(3): p. 337-46.

196. Buxbaum, J.D., et al., Evidence that tumor necrosis factor alpha converting enzyme is involved in regulated alpha-secretase cleavage of the Alzheimer amyloid protein precursor. J Biol Chem, 1998. 273(43): p. 27765-7.

197. Tanabe, C., et al., ADAM19 is tightly associated with constitutive Alzheimer's disease APP alpha-secretase in A172 cells. Biochem Biophys Res Commun, 2007. 352(1): p. 111-7.

128

198. Allinson, T.M., et al., ADAMs family members as amyloid precursor protein alpha-secretases. J Neurosci Res, 2003. 74(3): p. 342-52.

199. Koike, H., et al., Membrane-anchored metalloprotease MDC9 has an alpha-secretase activity responsible for processing the amyloid precursor protein. Biochem J, 1999. 343 Pt 2: p. 371-5.

200. Asai, M., et al., Putative function of ADAM9, ADAM10, and ADAM17 as APP alpha-secretase. Biochem Biophys Res Commun, 2003. 301(1): p. 231-5.

201. Kojro, E., et al., The neuropeptide PACAP promotes the alpha-secretase pathway for processing the Alzheimer amyloid precursor protein. Faseb J, 2006. 20(3): p. 512-4.

202. Lammich, S., et al., Constitutive and regulated alpha-secretase cleavage of Alzheimer's amyloid precursor protein by a disintegrin metalloprotease. Proc Natl Acad Sci U S A, 1999. 96(7): p. 3922-7.

203. Postina, R., et al., A disintegrin-metalloproteinase prevents amyloid plaque formation and hippocampal defects in an Alzheimer disease mouse model. J Clin Invest, 2004. 113(10): p. 1456-64.

204. Lee, R.K., et al., Amyloid precursor protein processing is stimulated by metabotropic glutamate receptors. Proc Natl Acad Sci U S A, 1995. 92(17): p. 8083-7.

205. Camden, J.M., et al., P2Y2 nucleotide receptors enhance alpha-secretase-dependent amyloid precursor protein processing. J Biol Chem, 2005. 280(19): p. 18696-702.

206. Endres, K., et al., Shedding of the amyloid precursor protein-like protein APLP2 by disintegrin-metalloproteinases. Febs J, 2005. 272(22): p. 5808-20.

207. Xu, K.P., et al., A role for MAP kinase in regulating ectodomain shedding of APLP2 in corneal epithelial cells. Am J Physiol Cell Physiol, 2001. 281(2): p. C603-14.

208. Vincent, B., et al., The disintegrins ADAM10 and TACE contribute to the constitutive and phorbol ester-regulated normal cleavage of the cellular prion protein. J Biol Chem, 2001. 276(41): p. 37743-6.

209. Parkin, E.T., et al., Dual mechanisms for shedding of the cellular prion protein. J Biol Chem, 2004. 279(12): p. 11170-8.

210. Alfa Cisse, M., et al., M1 and M3 muscarinic receptors control physiological processing of cellular prion by modulating ADAM17 phosphorylation and activity. J Neurosci, 2007. 27(15): p. 4083-92.

211. Budagian, V., et al., Soluble Axl is generated by ADAM10-dependent cleavage and associates with Gas6 in mouse serum. Mol Cell Biol, 2005. 25(21): p. 9324-39.

212. Guo, L., et al., A proteomic approach for the identification of cell-surface proteins shed by metalloproteases. Mol Cell Proteomics, 2002. 1(1): p. 30-6.

213. Marin, V., et al., Chemotactic agents induce IL-6Ralpha shedding from polymorphonuclear cells: involvement of a metalloproteinase of the TNF-alpha-converting enzyme (TACE) type. Eur J Immunol, 2002. 32(10): p. 2965-70.

214. Althoff, K., et al., Shedding of interleukin-6 receptor and tumor necrosis factor alpha. Contribution of the stalk sequence to the cleavage pattern of transmembrane proteins. Eur J Biochem, 2000. 267(9): p. 2624-31.

215. Budagian, V., et al., Natural soluble interleukin-15Ralpha is generated by cleavage that involves the tumor necrosis factor-alpha-converting enzyme (TACE/ADAM17). J Biol Chem, 2004. 279(39): p. 40368-75.

216. Cruz, A.C., et al., Tumor necrosis factor-alpha-converting enzyme controls surface expression of c-Kit and survival of embryonic stem cell-derived mast cells. J Biol Chem, 2004. 279(7): p. 5612-20.

217. Rovida, E., et al., TNF-alpha-converting enzyme cleaves the macrophage colony-stimulating factor receptor in macrophages undergoing activation. J Immunol, 2001. 166(3): p. 1583-9.

218. Li, N., et al., Metalloproteases regulate T-cell proliferation and effector function via LAG-3. Embo J, 2007. 26(2): p. 494-504.

129

219. Eichenauer, D.A., et al., ADAM10 inhibition of human CD30 shedding increases specificity of targeted immunotherapy in vitro. Cancer Res, 2007. 67(1): p. 332-8.

220. Hansen, H.P., et al., CD30 shedding from Karpas 299 lymphoma cells is mediated by TNF-alpha-converting enzyme. J Immunol, 2000. 165(12): p. 6703-9.

221. Contin, C., et al., Membrane-anchored CD40 is processed by the tumor necrosis factor-alpha-converting enzyme. Implications for CD40 signaling. J Biol Chem, 2003. 278(35): p. 32801-9.

222. Weskamp, G., et al., Evidence for a critical role of the tumor necrosis factor alpha convertase (TACE) in ectodomain shedding of the p75 neurotrophin receptor (p75NTR). J Biol Chem, 2004. 279(6): p. 4241-9.

223. Ahmed, Z., et al., TACE-induced cleavage of NgR and p75NTR in dorsal root ganglion cultures disinhibits outgrowth and promotes branching of neurites in the presence of inhibitory CNS myelin. Faseb J, 2006. 20(11): p. 1939-41.

224. Ahmed, Z., et al., Schwann cell-derived factor-induced modulation of the NgR/p75NTR/EGFR axis disinhibits axon growth through CNS myelin in vivo and in vitro. Brain, 2006. 129(Pt 6): p. 1517-33.

225. Urra, S., et al., TrkA receptor activation by nerve growth factor induces shedding of the p75 neurotrophin receptor followed by endosomal gamma-secretase-mediated release of the p75 intracellular domain. J Biol Chem, 2007. 282(10): p. 7606-15.

226. Liu, P.C., et al., Identification of ADAM10 as a Major Source of HER2 Ectodomain Sheddase Activity in HER2 Overexpressing Breast Cancer Cells. Cancer Biol Ther, 2006. 5(6): p. 657-64.

227. Codony-Servat, J., et al., Cleavage of the HER2 ectodomain is a pervanadate-activable process that is inhibited by the tissue inhibitor of metalloproteases-1 in breast cancer cells. Cancer Res, 1999. 59(6): p. 1196-201.

228. Rio, C., et al., Tumor necrosis factor-alpha-converting enzyme is required for cleavage of erbB4/HER4. J Biol Chem, 2000. 275(14): p. 10379-87.

229. Zhang, Y., et al., Tumor necrosis factor-alpha converting enzyme (TACE) is a growth hormone binding protein (GHBP) sheddase: the metalloprotease TACE/ADAM-17 is critical for (PMA-induced) GH receptor proteolysis and GHBP generation. Endocrinology, 2000. 141(12): p. 4342-8.

230. Schantl, J.A., et al., The growth hormone receptor interacts with its sheddase, the tumour necrosis factor-alpha-converting enzyme (TACE). Biochem J, 2004. 377(Pt 2): p. 379-84.

231. Diaz-Rodriguez, E., et al., Extracellular signal-regulated kinase phosphorylates tumor necrosis factor alpha-converting enzyme at threonine 735: a potential role in regulated shedding. Mol Biol Cell, 2002. 13(6): p. 2031-44.

232. Rabie, T., et al., Evidence for a role of ADAM17 (TACE) in the regulation of platelet glycoprotein V. J Biol Chem, 2005. 280(15): p. 14462-8.

233. Anders, L., et al., Furin-, ADAM 10-, and gamma-secretase-mediated cleavage of a receptor tyrosine phosphatase and regulation of beta-catenin's transcriptional activity. Mol Cell Biol, 2006. 26(10): p. 3917-34.

234. Ruhe, J.E., et al., EGFR signaling leads to downregulation of PTP-LAR via TACE-mediated proteolytic processing. Cell Signal, 2006. 18(9): p. 1515-27.

235. Qu, D., et al., Regulated endothelial protein C receptor shedding is mediated by tumor necrosis factor-alpha converting enzyme/ADAM17. J Thromb Haemost, 2006.

236. Bech-Serra, J.J., et al., Proteomic identification of desmoglein 2 and activated leukocyte cell adhesion molecule as substrates of ADAM17 and ADAM10 by difference gel electrophoresis. Mol Cell Biol, 2006. 26(13): p. 5086-95.

237. Bohm, C., et al., SorLA signaling by regulated intramembrane proteolysis. J Biol Chem, 2006. 281(21): p. 14547-53.

238. Liu, C.X., et al., gamma -Secretase mediated release of the LDL receptor-related protein 1B (LPR1B) intracellular domain suppresses anchorage independent growth of neuroglioma cells. J Biol Chem, 2007.

130

239. Ludeman, M.J., et al., Regulated shedding of PAR1 N-terminal exodomain from endothelial cells. J Biol Chem, 2004. 279(18): p. 18592-9.

240. Fischer, O.M., et al., EGFR signal transactivation in cancer cells. Biochem Soc Trans, 2003. 31(Pt 6): p. 1203-8.

241. Peduto, L., et al., ADAM12 is highly expressed in carcinoma-associated stroma and is required for mouse prostate tumor progression. Oncogene, 2006. 25(39): p. 5462-6.

242. Chen, G. and D.V. Goeddel, TNF-R1 signaling: a beautiful pathway. Science, 2002. 296(5573): p. 1634-5.

243. Wajant, H., The Fas signaling pathway: more than a paradigm. Science, 2002. 296(5573): p. 1635-6.

244. Mitsui, Y., et al., ADAM28 is overexpressed in human breast carcinomas: implications for carcinoma cell proliferation through cleavage of insulin-like growth factor binding protein-3. Cancer Res, 2006. 66(20): p. 9913-20.

245. Valeva, A., et al., A Cellular Metalloproteinase Activates Vibrio cholerae Pro-cytolysin. J Biol Chem, 2004. 279(24): p. 25143-8.

246. Dolnik, O., et al., Ectodomain shedding of the glycoprotein GP of Ebola virus. Embo J, 2004. 23(10): p. 2175-84.

247. Selkoe, D. and R. Kopan, Notch and Presenilin: regulated intramembrane proteolysis links development and degeneration. Annu Rev Neurosci, 2003. 26: p. 565-97.

248. Landman, N. and T.W. Kim, Got RIP? Presenilin-dependent intramembrane proteolysis in growth factor receptor signaling. Cytokine Growth Factor Rev, 2004. 15(5): p. 337-51.

249. Struhl, G. and A. Adachi, Requirements for presenilin-dependent cleavage of notch and other transmembrane proteins. Mol Cell, 2000. 6(3): p. 625-36.

250. Fortini, M.E., Gamma-secretase-mediated proteolysis in cell-surface-receptor signalling. Nat Rev Mol Cell Biol, 2002. 3(9): p. 673-84.

251. Bray, S.J., Notch signalling: a simple pathway becomes complex. Nat Rev Mol Cell Biol, 2006. 7(9): p. 678-89.

252. Six, E., et al., The Notch ligand Delta1 is sequentially cleaved by an ADAM protease and gamma-secretase. Proc Natl Acad Sci U S A, 2003. 100(13): p. 7638-43.

253. LaVoie, M.J. and D.J. Selkoe, The Notch ligands, Jagged and Delta, are sequentially processed by alpha-secretase and presenilin/gamma-secretase and release signaling fragments. J Biol Chem, 2003. 278(36): p. 34427-37.

254. Dyczynska, E., et al., Proteolytic processing of delta-like 1 by ADAM proteases. J Biol Chem, 2006.

255. Hitoshi, S., et al., Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes Dev, 2004. 18(15): p. 1806-11.

256. Osborne, B.A. and L.M. Minter, Notch signalling during peripheral T-cell activation and differentiation. Nat Rev Immunol, 2007. 7(1): p. 64-75.

257. Nanba, D., et al., Proteolytic release of the carboxy-terminal fragment of proHB-EGF causes nuclear export of PLZF. J Cell Biol, 2003. 163(3): p. 489-502.

258. Bao, J., et al., Activity-dependent transcription regulation of PSD-95 by neuregulin-1 and Eos. Nat Neurosci, 2004. 7(11): p. 1250-8.

259. Aqeilan, R.I., et al., WW domain-containing proteins, WWOX and YAP, compete for interaction with ErbB-4 and modulate its transcriptional function. Cancer Res, 2005. 65(15): p. 6764-72.

260. Linggi, B., et al., The ErbB-4 s80 intracellular domain is a constitutively active tyrosine kinase. Oncogene, 2006. 25(1): p. 160-3.

261. Sardi, S.P., et al., Presenilin-dependent ErbB4 nuclear signaling regulates the timing of astrogenesis in the developing brain. Cell, 2006. 127(1): p. 185-97.

262. Bao, J., et al., Back signaling by the Nrg-1 intracellular domain. J Cell Biol, 2003. 161(6): p. 1133-41.

131

263. Marambaud, P., et al., A presenilin-1/gamma-secretase cleavage releases the E-cadherin intracellular domain and regulates disassembly of adherens junctions. Embo J, 2002. 21(8): p. 1948-56.

264. Singh, P.K. and M.A. Hollingsworth, Cell surface-associated mucins in signal transduction. Trends Cell Biol, 2006. 16(9): p. 467-76.

265. Reiss, K., et al., ADAM10 cleavage of N-cadherin and regulation of cell-cell adhesion and beta-catenin nuclear signalling. Embo J, 2005. 24(4): p. 742-52.

266. Uemura, K., et al., Characterization of sequential N-cadherin cleavage by ADAM10 and PS1. Neurosci Lett, 2006. 402(3): p. 278-83.

267. Fortini, M.E., Neurobiology: double trouble for neurons. Nature, 2003. 425(6958): p. 565-6.

268. Maretzky, T., et al., ADAM10 mediates E-cadherin shedding and regulates epithelial cell-cell adhesion, migration, and beta-catenin translocation. Proc Natl Acad Sci U S A, 2005. 102(26): p. 9182-7.

269. Wild-Bode, C., et al., A basolateral sorting signal directs ADAM10 to adherens junctions and is required for its function in cell migration. J Biol Chem, 2006.

270. Reiss, K., et al., Regulated ADAM10-dependent ectodomain shedding of gamma-protocadherin C3 modulates cell-cell adhesion. J Biol Chem, 2006. 281(31): p. 21735-44.

271. Stoeck, A., et al., A role for exosomes in the constitutive and stimulus-induced ectodomain cleavage of L1 and CD44. Biochem J, 2006. 393(Pt 3): p. 609-18.

272. Murai, T., et al., Engagement of CD44 promotes Rac activation and CD44 cleavage during tumor cell migration. J Biol Chem, 2004. 279(6): p. 4541-50.

273. Nagano, O., et al., Cell-matrix interaction via CD44 is independently regulated by different metalloproteinases activated in response to extracellular Ca(2+) influx and PKC activation. J Cell Biol, 2004. 165(6): p. 893-902.

274. Murai, T., et al., Epidermal growth factor-regulated activation of Rac GTPase enhances CD44 cleavage by metalloproteinase disintegrin ADAM10. Biochem J, 2006. 395(1): p. 65-71.

275. McFarlane, S., Metalloproteases: carving out a role in axon guidance. Neuron, 2003. 37(4): p. 559-62.

276. Bland, C.E., P. Kimberly, and M.D. Rand, Notch-induced proteolysis and nuclear localization of the Delta ligand. J Biol Chem, 2003. 278(16): p. 13607-10.

277. Qi, H., et al., Processing of the notch ligand delta by the metalloprotease Kuzbanian. Science, 1999. 283(5398): p. 91-4.

278. Litterst, C., et al., Ligand binding and calcium influx induce distinct ectodomain/gamma -secretase processing pathways of EPHB2 receptor. J Biol Chem, 2007.

279. Cowan, J.W., et al., Growth hormone receptor is a target for presenilin-dependent gamma-secretase cleavage. J Biol Chem, 2005. 280(19): p. 19331-42.

280. Thathiah, A., C.P. Blobel, and D.D. Carson, Tumor necrosis factor-alpha converting enzyme/ADAM 17 mediates MUC1 shedding. J Biol Chem, 2003. 278(5): p. 3386-94.

281. Brou, C., et al., A novel proteolytic cleavage involved in Notch signaling: the role of the disintegrin-metalloprotease TACE. Mol Cell, 2000. 5(2): p. 207-16.

282. Hartmann, D., et al., The disintegrin/metalloprotease ADAM 10 is essential for Notch signalling but not for alpha-secretase activity in fibroblasts. Hum Mol Genet, 2002. 11(21): p. 2615-24.

283. Sapir, A., et al., Unidirectional Notch signaling depends on continuous cleavage of Delta. Development, 2005. 132(1): p. 123-32.

284. Navarro, V., J.P. Vincent, and J. Mazella, Shedding of the luminal domain of the neurotensin receptor-3/sortilin in the HT29 cell line. Biochem Biophys Res Commun, 2002. 298(5): p. 760-4.

285. Matsuno, O., et al., Role of ADAM8 in experimental asthma. Immunol Lett, 2006. 102(1): p. 67-73.

132

286. Garton, K.J., et al., Stimulated shedding of vascular cell adhesion molecule 1 (VCAM-1) is mediated by tumor necrosis factor-alpha-converting enzyme (ADAM 17). J Biol Chem, 2003. 278(39): p. 37459-64.

287. Singh, R.J., et al., Cytokine stimulated vascular cell adhesion molecule-1 (VCAM-1) ectodomain release is regulated by TIMP-3. Cardiovasc Res, 2005. 67(1): p. 39-49.

288. Walmsley, A.R., A.K. Mir, and S. Frentzel, Ectodomain shedding of human Nogo-66 receptor homologue-1 by zinc metalloproteinases. Biochem Biophys Res Commun, 2005. 327(1): p. 112-6.

289. Sperandio, M., Selectins and glycosyltransferases in leukocyte rolling in vivo. Febs J, 2006. 273(19): p. 4377-89.

290. Martin, J., et al., The role of ADAM 15 in glomerular mesangial cell migration. J Biol Chem, 2002. 277(37): p. 33683-9.

291. Millichip, M.I., et al., The metallo-disintegrin ADAM10 (MADM) from bovine kidney has type IV collagenase activity in vitro. Biochem Biophys Res Commun, 1998. 245(2): p. 594-8.

292. Tanaka, Y., et al., Ectodomain shedding of nectin-1alpha by SF/HGF and TPA in MDCK cells. Biochem Biophys Res Commun, 2002. 299(3): p. 472-8.

293. Fabre-Lafay, S., et al., Nectin-4, a new serological breast cancer marker, is a substrate for tumor necrosis factor-alpha-converting enzyme (TACE)/ADAM-17. J Biol Chem, 2005. 280(20): p. 19543-50.

294. Gutwein, P., et al., ADAM10-mediated cleavage of L1 adhesion molecule at the cell surface and in released membrane vesicles. Faseb J, 2003. 17(2): p. 292-4.

295. Gutwein, P., et al., Cleavage of L1 in exosomes and apoptotic membrane vesicles released from ovarian carcinoma cells. Clin Cancer Res, 2005. 11(7): p. 2492-501.

296. Naus, S., et al., Ectodomain shedding of the neural recognition molecule CHL1 by the metalloprotease-disintegrin ADAM8 promotes neurite outgrowth and suppresses neuronal cell death. J Biol Chem, 2004. 279(16): p. 16083-90.

297. Hinkle, C.L., et al., Metalloprotease-induced ectodomain shedding of neural cell adhesion molecule (NCAM). J Neurobiol, 2006. 66(12): p. 1378-95.

298. Kalus, I., et al., Proteolytic cleavage of the neural cell adhesion molecule by ADAM17/TACE is involved in neurite outgrowth. J Neurochem, 2006. 98(1): p. 78-88.

299. Tsakadze, N.L., et al., Tumor necrosis factor-alpha-converting enzyme (TACE/ADAM-17) mediates the ectodomain cleavage of intercellular adhesion molecule-1 (ICAM-1). J Biol Chem, 2006. 281(6): p. 3157-64.

300. Franzke, C.W., et al., Transmembrane collagen XVII, an epithelial adhesion protein, is shed from the cell surface by ADAMs. Embo J, 2002. 21(19): p. 5026-35.

301. Davenpeck, K.L., et al., Activation of human leukocytes reduces surface P-selectin glycoprotein ligand-1 (PSGL-1, CD162) and adhesion to P-selectin in vitro. J Immunol, 2000. 165(5): p. 2764-72.

302. Schobel, S., et al., Expression cloning screen for modifiers of amyloid precursor protein shedding. Int J Dev Neurosci, 2006. 24(2-3): p. 141-8.

303. Lichtenthaler, S.F., et al., The cell adhesion protein P-selectin glycoprotein ligand-1 is a substrate for the aspartyl protease BACE1. J Biol Chem, 2003. 278(49): p. 48713-9.

304. Higuchi, Y., et al., CD156 transgenic mice. Different responses between inflammatory types. Pathobiology, 2002. 70(1): p. 47-54.

305. Gomez-Gaviro, M.V., et al., Structure-function relationship and role of tumor necrosis factor-alpha-converting enzyme in the down-regulation of L-selectin by non-steroidal anti-inflammatory drugs. J Biol Chem, 2002. 277(41): p. 38212-21.

306. Bergmeier, W., et al., Tumor necrosis factor-alpha-converting enzyme (ADAM17) mediates GPIbalpha shedding from platelets in vitro and in vivo. Circ Res, 2004. 95(7): p. 677-83.

307. Gardiner, E.E., et al., Controlled shedding of platelet glycoprotein (GP)VI and GPIb-IX-V by ADAM family metalloproteinases. J Thromb Haemost, 2007.

133

308. Aktas, B., et al., Aspirin induces platelet receptor shedding via ADAM17 (TACE). J Biol Chem, 2005. 280(48): p. 39716-22.

309. Hattori, M., M. Osterfield, and J.G. Flanagan, Regulated cleavage of a contact-mediated axon repellent. Science, 2000. 289(5483): p. 1360-5.

310. Lambert, D.W., et al., Tumor necrosis factor-alpha convertase (ADAM17) mediates regulated ectodomain shedding of the severe-acute respiratory syndrome-coronavirus (SARS-CoV) receptor, angiotensin-converting enzyme-2 (ACE2). J Biol Chem, 2005. 280(34): p. 30113-9.

311. Schlomann, U., et al., Tumor necrosis factor alpha induces a metalloprotease-disintegrin, ADAM8 (CD 156): implications for neuron-glia interactions during neurodegeneration. J Neurosci, 2000. 20(21): p. 7964-71.

312. Ito, N., et al., ADAMs, a disintegrin and metalloproteinases, mediate shedding of oxytocinase. Biochem Biophys Res Commun, 2004. 314(4): p. 1008-13.

313. Cao, Y., et al., Intracellular processing of metalloprotease disintegrin ADAM12. J Biol Chem, 2002. 277(29): p. 26403-11.

314. Hussain, I., et al., Characterization of the ectodomain shedding of the beta-site amyloid precursor protein-cleaving enzyme 1 (BACE1). J Biol Chem, 2003. 278(38): p. 36264-8.

315. Zatovicova, M., et al., Ectodomain shedding of the hypoxia-induced carbonic anhydrase IX is a metalloprotease-dependent process regulated by TACE/ADAM17. Br J Cancer, 2005. 93(11): p. 1267-76.

316. Hahn, D., et al., Phorbol 12-myristate 13-acetate-induced ectodomain shedding and phosphorylation of the human meprinbeta metalloprotease. J Biol Chem, 2003. 278(44): p. 42829-39.

317. Gavert, N., et al., L1, a novel target of beta-catenin signaling, transforms cells and is expressed at the invasive front of colon cancers. J Cell Biol, 2005. 168(4): p. 633-42.

318. Fambrough, D., et al., The cell surface metalloprotease/disintegrin Kuzbanian is required for axonal extension in Drosophila. Proc Natl Acad Sci U S A, 1996. 93(23): p. 13233-8.

319. Kang, Q., Y. Cao, and A. Zolkiewska, Metalloprotease-disintegrin ADAM 12 binds to the SH3 domain of Src and activates Src tyrosine kinase in C2C12 cells. Biochem J, 2000. 352 Pt 3: p. 883-92.

320. Kang, Q., Y. Cao, and A. Zolkiewska, Direct interaction between the cytoplasmic tail of ADAM 12 and the Src homology 3 domain of p85alpha activates phosphatidylinositol 3-kinase in C2C12 cells. J Biol Chem, 2001. 276(27): p. 24466-72.

321. Abram, C.L., et al., The adaptor protein fish associates with members of the ADAMs family and localizes to podosomes of Src-transformed cells. J Biol Chem, 2003. 278(19): p. 16844-51.

322. Suzuki, A., et al., Meltrin alpha cytoplasmic domain interacts with SH3 domains of Src and Grb2 and is phosphorylated by v-Src. Oncogene, 2000. 19(51): p. 5842-50.

323. Poghosyan, Z., et al., Phosphorylation-dependent interactions between ADAM15 cytoplasmic domain and Src family protein-tyrosine kinases. J Biol Chem, 2002. 277(7): p. 4999-5007.

324. Ma, G., et al., Short-term interleukin-1(beta) increases the release of secreted APP(alpha) via MEK1/2-dependent and JNK-dependent alpha-secretase cleavage in neuroglioma U251 cells. J Neurosci Res, 2005. 80(5): p. 683-92.

325. Yasui, A., et al., Expression of splice variants of the human ADAM15 gene and strong interaction between the cytoplasmic domain of one variant and Src family proteins Lck and Hck. Pathobiology, 2004. 71(4): p. 185-92.

326. Shimizu, E., et al., Structure and expression of the murine ADAM 15 gene and its splice variants, and difference of interaction between their cytoplasmic domains and Src family proteins. Biochem Biophys Res Commun, 2003. 309(4): p. 779-85.

327. Fischer, O.M., et al., Oxidative and osmotic stress signaling in tumor cells is mediated by ADAM proteases and heparin-binding epidermal growth factor. Mol Cell Biol, 2004. 24(12): p. 5172-83.

134

328. Bandyopadhyay, S., et al., Interleukin-1alpha stimulates non-amyloidogenic pathway by alpha-secretase (ADAM-10 and ADAM-17) cleavage of APP in human astrocytic cells involving p38 MAP kinase. J Neurosci Res, 2006. 84(1): p. 106-18.

329. Fan, H. and R. Derynck, Ectodomain shedding of TGF-alpha and other transmembrane proteins is induced by receptor tyrosine kinase activation and MAP kinase signaling cascades. Embo J, 1999. 18(24): p. 6962-72.

330. Zhang, Q., et al., Phosphorylation of TNF-alpha converting enzyme by gastrin-releasing peptide induces amphiregulin release and EGF receptor activation. Proc Natl Acad Sci U S A, 2006. 103(18): p. 6901-6.

331. Sundberg, C., et al., Regulation of ADAM12 cell-surface expression by protein kinase C epsilon. J Biol Chem, 2004. 279(49): p. 51601-11.

332. Zheng, Y., J. Schlondorff, and C.P. Blobel, Evidence for regulation of the tumor necrosis factor alpha-convertase (TACE) by protein-tyrosine phosphatase PTPH1. J Biol Chem, 2002. 277(45): p. 42463-70.

333. Cousin, H., et al., PACSIN2 is a regulator of the metalloprotease/disintegrin ADAM13. Dev Biol, 2000. 227(1): p. 197-210.

334. Kang, T., et al., Intracellular activation of human adamalysin 19/disintegrin and metalloproteinase 19 by furin occurs via one of the two consecutive recognition sites. J Biol Chem, 2002. 277(28): p. 25583-91.

335. Schlondorff, J., J.D. Becherer, and C.P. Blobel, Intracellular maturation and localization of the tumour necrosis factor alpha convertase (TACE). Biochem J, 2000. 347 Pt 1: p. 131-8.

336. Choi, S.J., J.H. Han, and G.D. Roodman, ADAM8: a novel osteoclast stimulating factor. J Bone Miner Res, 2001. 16(5): p. 814-22.

337. Gödde, N.J., et al., Efficient ADAM22 surface expression is mediated by phosphorylation-dependent interaction with 14-3-3 protein family members. J Cell Sci, 2006. 119(Pt 16): p. 3296-305.

338. Michelsen, K., H. Yuan, and B. Schwappach, Hide and run. Arginine-based endoplasmic-reticulum-sorting motifs in the assembly of heteromultimeric membrane proteins. EMBO Rep, 2005. 6(8): p. 717-22.

339. Nufer, O. and H.P. Hauri, ER export: call 14-3-3. Curr Biol, 2003. 13(10): p. R391-3.

340. Zhu, P., et al., The interaction between ADAM 22 and 14-3-3zeta: regulation of cell adhesion and spreading. Biochem Biophys Res Commun, 2003. 301(4): p. 991-9.

341. Sagane, K., et al., Ataxia and peripheral nerve hypomyelination in ADAM22-deficient mice. BMC Neurosci, 2005. 6(1): p. 33.

342. Peiretti, F., et al., Identification of SAP97 as an intracellular binding partner of TACE. J Cell Sci, 2003. 116(Pt 10): p. 1949-57.

343. Marcello, E., et al., Synapse-associated protein-97 mediates alpha-secretase ADAM10 trafficking and promotes its activity. J Neurosci, 2007. 27(7): p. 1682-91.

344. Huang, L., et al., Screen and identification of proteins interacting with ADAM19 cytoplasmic tail. Mol Biol Rep, 2002. 29(3): p. 317-23.

345. Cao, Y., Q. Kang, and A. Zolkiewska, Metalloprotease-disintegrin ADAM 12 interacts with alpha-actinin-1. Biochem J, 2001. 357(Pt 2): p. 353-61.

346. Galliano, M.F., et al., Binding of ADAM12, a marker of skeletal muscle regeneration, to the muscle-specific actin-binding protein, alpha -actinin-2, is required for myoblast fusion. J Biol Chem, 2000. 275(18): p. 13933-9.

347. Howard, L., et al., Interaction of the metalloprotease disintegrins MDC9 and MDC15 with two SH3 domain-containing proteins, endophilin I and SH3PX1. J Biol Chem, 1999. 274(44): p. 31693-9.

348. Tanaka, M., et al., ADAM binding protein Eve-1 is required for ectodomain shedding of epidermal growth factor receptor ligands. J Biol Chem, 2004. 279(40): p. 41950-9.

349. Malinin, N.L., et al., Amyloid-beta neurotoxicity is mediated by FISH adapter protein and ADAM12 metalloprotease activity. Proc Natl Acad Sci U S A, 2005. 102(8): p. 3058-63.

135

350. Govoni, K.E., et al., Regulation of insulin-like growth factor binding protein-5, four and a half lim-2, and a disintegrin and metalloprotease-9 expression in osteoblasts. Growth Horm IGF Res, 2006. 16(1): p. 49-56.

351. Novak, U., ADAM proteins in the brain. J Clin Neurosci, 2004. 11(3): p. 227-35. 352. Nelson, K.K., J. Schlondorff, and C.P. Blobel, Evidence for an interaction of the

metalloprotease-disintegrin tumour necrosis factor alpha convertase (TACE) with mitotic arrest deficient 2 (MAD2), and of the metalloprotease-disintegrin MDC9 with a novel MAD2-related protein, MAD2beta. Biochem J, 1999. 343 Pt 3: p. 673-80.

353. Kärkkäinen, S., et al., Identification of preferred protein interactions by phage-display of the human Src homology-3 proteome. EMBO Rep, 2006. 7(2): p. 186-91.

354. Zhu, P., et al., ADAM22 plays an important role in cell adhesion and spreading with the assistance of 14-3-3. Biochem Biophys Res Commun, 2005. 331(4): p. 938-46.

355. McNiven, M.A. and H.M. Thompson, Vesicle formation at the plasma membrane and trans-Golgi network: the same but different. Science, 2006. 313(5793): p. 1591-4.

356. Schuck, S. and K. Simons, Polarized sorting in epithelial cells: raft clustering and the biogenesis of the apical membrane. J Cell Sci, 2004. 117(Pt 25): p. 5955-64.

357. MaCaulay, S.L., et al., Insulin stimulates movement of sorting nexin 9 between cellular compartments: a putative role mediating cell surface receptor expression and insulin action. Biochem J, 2003. 376(Pt 1): p. 123-34.

358. Worby, C.A., et al., Drosophila Ack targets its substrate, the sorting nexin DSH3PX1, to a protein complex involved in axonal guidance. J Biol Chem, 2002. 277(11): p. 9422-8.

359. Muth, T.R. and M.J. Caplan, Transport protein trafficking in polarized cells. Annu Rev Cell Dev Biol, 2003. 19: p. 333-66.

360. Soond, S.M., et al., ERK-mediated phosphorylation of Thr735 in TNFalpha-converting enzyme and its potential role in TACE protein trafficking. J Cell Sci, 2005. 118(Pt 11): p. 2371-80.

361. Matala, E., et al., The cytoplasmic domain of L-selectin participates in regulating L-selectin endoproteolysis. J Immunol, 2001. 167(3): p. 1617-23.

362. Endres, K., et al., Tumor necrosis factor-alpha converting enzyme is processed by proprotein-convertases to its mature form which is degraded upon phorbol ester stimulation. Eur J Biochem, 2003. 270(11): p. 2386-93.

363. Fan, H., C.W. Turck, and R. Derynck, Characterization of growth factor-induced serine phosphorylation of tumor necrosis factor-alpha converting enzyme and of an alternatively translated polypeptide. J Biol Chem, 2003. 278(20): p. 18617-27.

364. Gechtman, Z., et al., The shedding of membrane-anchored heparin-binding epidermal-like growth factor is regulated by the Raf/mitogen-activated protein kinase cascade and by cell adhesion and spreading. J Biol Chem, 1999. 274(40): p. 28828-35.

365. Gutwein, P., et al., Role of Src kinases in the ADAM-mediated release of L1 adhesion molecule from human tumor cells. J Biol Chem, 2000. 275(20): p. 15490-7.

366. Frank, G.D. and S. Eguchi, Activation of tyrosine kinases by reactive oxygen species in vascular smooth muscle cells: significance and involvement of EGF receptor transactivation by angiotensin II. Antioxid Redox Signal, 2003. 5(6): p. 771-80.

367. Rhee, S.G., et al., Intracellular messenger function of hydrogen peroxide and its regulation by peroxiredoxins. Curr Opin Cell Biol, 2005. 17(2): p. 183-9.

368. Gschwind, A., et al., Cell communication networks: epidermal growth factor receptor transactivation as the paradigm for interreceptor signal transmission. Oncogene, 2001. 20(13): p. 1594-600.

136

369. Ohtsu, H., et al., ADAM17 mediates epidermal growth factor receptor transactivation and vascular smooth muscle cell hypertrophy induced by angiotensin II. Arterioscler Thromb Vasc Biol, 2006. 26(9): p. e133-7.

370. Schlondorff, J. and C.P. Blobel, Metalloprotease-disintegrins: modular proteins capable of promoting cell-cell interactions and triggering signals by protein-ectodomain shedding. J Cell Sci, 1999. 112 ( Pt 21): p. 3603-17.

371. Arribas, J., J.J. Bech-Serra, and B. Santiago-Josefat, ADAMs, cell migration and cancer. Cancer Metastasis Rev, 2006. 25(1): p. 57-68.

372. Alessi, D.R., Discovery of PDK1, one of the missing links in insulin signal transduction. Colworth Medal Lecture. Biochem Soc Trans, 2001. 29(Pt 2): p. 1-14.

373. Schimmelpfeng, K., S. Gogel, and C. Klambt, The function of leak and kuzbanian during growth cone and cell migration. Mech Dev, 2001. 106(1-2): p. 25-36.

374. Zhao, J., et al., Pulmonary hypoplasia in mice lacking tumor necrosis factor-alpha converting enzyme indicates an indispensable role for cell surface protein shedding during embryonic lung branching morphogenesis. Dev Biol, 2001. 232(1): p. 204-18.

375. Shi, W., et al., TACE is required for fetal murine cardiac development and modeling. Dev Biol, 2003. 261(2): p. 371-80.

376. Bohm, B.B., et al., Homeostatic effects of the metalloproteinase disintegrin ADAM15 in degenerative cartilage remodeling. Arthritis Rheum, 2005. 52(4): p. 1100-9.

377. Horiuchi, K., et al., Potential role for ADAM15 in pathological neovascularization in mice. Mol Cell Biol, 2003. 23(16): p. 5614-24.

378. Saunders, W.B., et al., Coregulation of vascular tube stabilization by endothelial cell TIMP-2 and pericyte TIMP-3. J Cell Biol, 2006. 175(1): p. 179-91.

379. Loffek, S., et al., Melanoma cell-derived vascular endothelial growth factor induces endothelial tubulogenesis within fibrin gels by a metalloproteinase-mediated mechanism. Eur J Cell Biol, 2006. 85(11): p. 1167-77.

380. Nishimura, H., et al., Possible function of the ADAM1a/ADAM2 Fertilin complex in the appearance of ADAM3 on the sperm surface. J Biol Chem, 2004. 279(33): p. 34957-62.

381. Kim, E., et al., Mouse sperm lacking ADAM1b/ADAM2 fertilin can fuse with the egg plasma membrane and effect fertilization. J Biol Chem, 2006. 281(9): p. 5634-9.

382. Cho, C., et al., Fertilization defects in sperm from mice lacking fertilin beta. Science, 1998. 281(5384): p. 1857-9.

383. Cho, C., et al., Analysis of mouse fertilin in wild-type and fertilin beta(-/-) sperm: evidence for C-terminal modification, alpha/beta dimerization, and lack of essential role of fertilin alpha in sperm-egg fusion. Dev Biol, 2000. 222(2): p. 289-95.

384. Nishimura, H., et al., Analysis of loss of adhesive function in sperm lacking cyritestin or fertilin beta. Dev Biol, 2001. 233(1): p. 204-13.

385. Stein, K.K., et al., Defects in secretory pathway trafficking during sperm development in Adam2 knockout mice. Biol Reprod, 2005. 73(5): p. 1032-8.

386. Kelly, K., et al., Metalloprotease-disintegrin ADAM8: expression analysis and targeted deletion in mice. Dev Dyn, 2005. 232(1): p. 221-31.

387. Weskamp, G., et al., Mice lacking the metalloprotease-disintegrin MDC9 (ADAM9) have no evident major abnormalities during development or adult life. Mol Cell Biol, 2002. 22(5): p. 1537-44.

388. Takahashi, E., et al., Deficits in spatial learning and motor coordination in ADAM11-deficient mice. BMC Neurosci, 2006. 7: p. 19.

389. Takahashi, E., et al., Altered nociceptive response in ADAM11-deficient mice. Brain Res, 2006. 1097(1): p. 39-42.

390. Masaki, M., et al., Role of Meltrin {alpha} (ADAM12) in obesity induced by high-fat diet. Endocrinology, 2005.

137

391. Sternlicht, M.D., et al., Mammary ductal morphogenesis requires paracrine activation of stromal EGFR via ADAM17-dependent shedding of epithelial amphiregulin. Development, 2005. 132(17): p. 3923-33.

392. Bolcun-Filas, E., Expression and functional analysis of the testis expressed genes ADAM 27 and testase 2, in der Mathematisch-Naturwissenschaftlichen Fakultäten. 2003, Georg-August-Universität zu Göttingen: Göttingen. p. 174.

393. Sagane, K., et al., Cloning and chromosomal mapping of mouse ADAM11, ADAM22 and ADAM23. Gene, 1999. 236(1): p. 79-86.

394. Mitchell, K.J., et al., Functional analysis of secreted and transmembrane proteins critical to mouse development. Nat Genet, 2001. 28(3): p. 241-9.

395. Leighton, P.A., et al., Defining brain wiring patterns and mechanisms through gene trapping in mice. Nature, 2001. 410(6825): p. 174-9.

396. Chen, C., X. Huang, and D. Sheppard, ADAM33 is not essential for growth and development and does not modulate allergic asthma in mice. Mol Cell Biol, 2006. 26(18): p. 6950-6.

397. Sagane, K., et al., Metalloproteinase-like, disintegrin-like, cysteine-rich proteins MDC2 and MDC3: novel human cellular disintegrins highly expressed in the brain. Biochem J, 1998. 334 ( Pt 1): p. 93-8.

398. Huang, X., et al., UNC-71, a disintegrin and metalloprotease (ADAM) protein, regulates motor axon guidance and sex myoblast migration in C. elegans. Development, 2003. 130(14): p. 3147-61.

399. Kronqvist, P., et al., ADAM12 alleviates the skeletal muscle pathology in mdx dystrophic mice. Am J Pathol, 2002. 161(5): p. 1535-40.

400. Moghadaszadeh, B., et al., Compensation for dystrophin-deficiency: ADAM12 overexpression in skeletal muscle results in increased alpha 7 integrin, utrophin and associated glycoproteins. Hum Mol Genet, 2003. 12(19): p. 2467-79.

401. Schmucker, D. and J.G. Flanagan, Generation of recognition diversity in the nervous system. Neuron, 2004. 44(2): p. 219-22.

402. Sorek, R., R. Shamir, and G. Ast, How prevalent is functional alternative splicing in the human genome? Trends Genet, 2004. 20(2): p. 68-71.

403. Gibbs, R.A., et al., Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature, 2004. 428(6982): p. 493-521.

404. Yavari, R., et al., Human metalloprotease-disintegrin Kuzbanian regulates sympathoadrenal cell fate in development and neoplasia. Hum Mol Genet, 1998. 7(7): p. 1161-7.

405. Roberts, C.M., et al., MDC-L, a novel metalloprotease disintegrin cysteine-rich protein family member expressed by human lymphocytes. J Biol Chem, 1999. 274(41): p. 29251-9.

406. Cerretti, D.P., et al., Characterization of the cDNA and gene for mouse tumour necrosis factor alpha converting enzyme (TACE/ADAM17) and its location to mouse chromosome 12 and human chromosome 2p25. Cytokine, 1999. 11(8): p. 541-51.

407. Katagiri, T., et al., Human metalloprotease/disintegrin-like (MDC) gene: exon-intron organization and alternative splicing. Cytogenet Cell Genet, 1995. 68(1-2): p. 39-44.

408. Sun, Y.P., et al., Two novel isoforms of Adam23 expressed in the developmental process of mouse and human brains. Gene, 2004. 325: p. 171-8.

409. Harada, T., et al., The specific expression of three novel splice variant forms of human metalloprotease-like disintegrin-like cysteine-rich protein 2 gene inBrain tissues and gliomas. Jpn J Cancer Res, 2000. 91(10): p. 1001-6.

410. Charrier, L., et al., ADAM-15 inhibits wound healing in human intestinal epithelial cell monolayers. Am J Physiol Gastrointest Liver Physiol, 2005. 288(2): p. G346-53.

411. Powell, R.M., et al., The splicing and fate of ADAM33 transcripts in primary human airways fibroblasts. Am J Respir Cell Mol Biol, 2004. 31(1): p. 13-21.

412. Holgate, S.T., et al., The genetics of asthma: ADAM33 as an example of a susceptibility gene. Proc Am Thorac Soc, 2006. 3(5): p. 440-3.

413. Haitchi, H.M., et al., ADAM33 expression in asthmatic airways and human embryonic lungs. Am J Respir Crit Care Med, 2005. 171(9): p. 958-65.

138

414. Graveley, B.R., Sorting out the complexity of SR protein functions. RNA, 2000. 6(9): p. 1197-211.

415. Singh, R. and J. Valcarcel, Building specificity with nonspecific RNA-binding proteins. Nat Struct Mol Biol, 2005. 12(8): p. 645-53.

416. Black, D.L., Mechanisms of alternative pre-messenger RNA splicing. Annu Rev Biochem, 2003. 72: p. 291-336.

417. Yang, P., K.A. Baker, and T. Hagg, The ADAMs family: coordinators of nervous system development, plasticity and repair. Prog Neurobiol, 2006. 79(2): p. 73-94.

418. Abrous, D.N., M. Koehl, and M. Le Moal, Adult neurogenesis: from precursors to network and physiology. Physiol Rev, 2005. 85(2): p. 523-69.

419. Jin, K., et al., Neurogenesis and aging: FGF-2 and HB-EGF restore neurogenesis in hippocampus and subventricular zone of aged mice. Aging Cell, 2003. 2(3): p. 175-83.

420. Esper, R.M., M.S. Pankonin, and J.A. Loeb, Neuregulins: versatile growth and differentiation factors in nervous system development and human disease. Brain Res Brain Res Rev, 2006. 51(2): p. 161-75.

421. Caille, I., et al., Soluble form of amyloid precursor protein regulates proliferation of progenitors in the adult subventricular zone. Development, 2004. 131(9): p. 2173-81.

422. Kornblum, H.I., et al., Multiple trophic actions of heparin-binding epidermal growth factor (HB-EGF) in the central nervous system. Eur J Neurosci, 1999. 11(9): p. 3236-46.

423. Wong, R.W. and L. Guillaud, The role of epidermal growth factor and its receptors in mammalian CNS. Cytokine Growth Factor Rev, 2004. 15(2-3): p. 147-56.

424. Nishimune, H., et al., Neural adhesion molecules L1 and CHL1 are survival factors for motoneurons. J Neurosci Res, 2005. 80(5): p. 593-9.

425. Uemura, K., et al., Amyloid beta inhibits ectodomain shedding of N-cadherin via down-regulation of cell-surface NMDA receptor. Neuroscience, 2007.

426. Walsh, D.M. and D.J. Selkoe, Deciphering the molecular basis of memory failure in Alzheimer's disease. Neuron, 2004. 44(1): p. 181-93.

427. Walsh, D.M., et al., Naturally secreted oligomers of amyloid beta protein potently inhibit hippocampal long-term potentiation in vivo. Nature, 2002. 416(6880): p. 535-9.

428. Schmitt, U., et al., Over-expression of two different forms of the alpha-secretase ADAM10 affects learning and memory in mice. Behav Brain Res, 2006.

429. Stoenica, L., et al., In vivo synaptic plasticity in the dentate gyrus of mice deficient in the neural cell adhesion molecule NCAM or its polysialic acid. Eur J Neurosci, 2006. 23(9): p. 2255-64.

430. Nikonenko, A.G., et al., Enhanced perisomatic inhibition and impaired long-term potentiation in the CA1 region of juvenile CHL1-deficient mice. Eur J Neurosci, 2006. 23(7): p. 1839-52.

431. Morellini, F., et al., Reduced reactivity to novelty, impaired social behavior, and enhanced basal synaptic excitatory activity in perforant path projections to the dentate gyrus in young adult mice deficient in the neural cell adhesion molecule CHL1. Mol Cell Neurosci, 2006.

432. Halbleib, J.M. and W.J. Nelson, Cadherins in development: cell adhesion, sorting, and tissue morphogenesis. Genes Dev, 2006. 20(23): p. 3199-214.

433. Husi, H., et al., Proteomic analysis of NMDA receptor-adhesion protein signaling complexes. Nat Neurosci, 2000. 3(7): p. 661-9.

434. Goldshmit, Y., S. McLenachan, and A. Turnley, Roles of Eph receptors and ephrins in the normal and damaged adult CNS. Brain Res Rev, 2006. 52(2): p. 327-45.

435. Palmer, A. and R. Klein, Multiple roles of ephrins in morphogenesis, neuronal networking, and brain function. Genes Dev, 2003. 17(12): p. 1429-50.

436. Klein, R., Eph/ephrin signaling in morphogenesis, neural development and plasticity. Curr Opin Cell Biol, 2004. 16(5): p. 580-9.

139

437. Dityatev, A. and M. Schachner, The extracellular matrix and synapses. Cell Tissue Res, 2006. 326(2): p. 647-654.

438. Maness, P.F. and M. Schachner, Neural recognition molecules of the immunoglobulin superfamily: signaling transducers of axon guidance and neuronal migration. Nat Neurosci, 2007. 10(1): p. 19-26.

439. Mechtersheimer, S., et al., Ectodomain shedding of L1 adhesion molecule promotes cell migration by autocrine binding to integrins. J Cell Biol, 2001. 155(4): p. 661-73.

440. Hirayama, T. and T. Yagi, The role and expression of the protocadherin-alpha clusters in the CNS. Curr Opin Neurobiol, 2006. 16(3): p. 336-42.

441. Muller, T., et al., Modulation of gene expression and cytoskeletal dynamics by the amyloid precursor protein intracellular domain (AICD). Mol Biol Cell, 2007. 18(1): p. 201-10.

442. Ullian, E.M., K.S. Christopherson, and B.A. Barres, Role for glia in synaptogenesis. Glia, 2004. 47(3): p. 209-16.

443. Esper, R.M. and J.A. Loeb, Rapid axoglial signaling mediated by neuregulin and neurotrophic factors. J Neurosci, 2004. 24(27): p. 6218-27.

444. Milner, R. and I.L. Campbell, The integrin family of cell adhesion molecules has multiple functions within the CNS. J Neurosci Res, 2002. 69(3): p. 286-91.

445. Chan, C.S., et al., Integrin requirement for hippocampal synaptic plasticity and spatial memory. J Neurosci, 2003. 23(18): p. 7107-16.

446. Washbourne, P., et al., Cell adhesion molecules in synapse formation. J Neurosci, 2004. 24(42): p. 9244-9.

447. Chan, C.S., et al., Beta 1-integrins are required for hippocampal AMPA receptor-dependent synaptic transmission, synaptic plasticity, and working memory. J Neurosci, 2006. 26(1): p. 223-32.

448. Chun, D., et al., Evidence that integrins contribute to multiple stages in the consolidation of long term potentiation in rat hippocampus. Neuroscience, 2001. 105(4): p. 815-29.

449. Pinkstaff, J.K., et al., Integrin subunit gene expression is regionally differentiated in adult brain. J Neurosci, 1999. 19(5): p. 1541-56.

450. Kramar, E.A., et al., Integrins modulate fast excitatory transmission at hippocampal synapses. J Biol Chem, 2003. 278(12): p. 10722-30.

451. Bernard-Trifilo, J.A., et al., Integrin signaling cascades are operational in adult hippocampal synapses and modulate NMDA receptor physiology. J Neurochem, 2005. 93(4): p. 834-49.

452. Talmage, D.A. and L.W. Role, Multiple personalities of neuregulin gene family members. J Comp Neurol, 2004. 472(2): p. 134-9.

453. Funke, L., S. Dakoji, and D.S. Bredt, Membrane-associated guanylate kinases regulate adhesion and plasticity at cell junctions. Annu Rev Biochem, 2005. 74: p. 219-45.

454. Snyder, S.H., Neuroscience. Adam finds an exciting mate. Science, 2006. 313(5794): p. 1744-5.

455. Bermingham, J.R., Jr., et al., The claw paw mutation reveals a role for Lgi4 in peripheral nerve development. Nat Neurosci, 2006. 9(1): p. 76-84.

456. Yang, P., K.A. Baker, and T. Hagg, A disintegrin and metalloprotease 21 (ADAM21) is associated with neurogenesis and axonal growth in developing and adult rodent CNS. J Comp Neurol, 2005. 490(2): p. 163-79.

457. Baron, W., H. Colognato, and C. ffrench-Constant, Integrin-growth factor interactions as regulators of oligodendroglial development and function. Glia, 2005. 49(4): p. 467-79.

458. Colognato, H., et al., CNS integrins switch growth factor signalling to promote target-dependent survival. Nat Cell Biol, 2002. 4(11): p. 833-41.

459. Krätzschmar, J., L. Lum, and C.P. Blobel, Metargidin, a membrane-anchored metalloprotease-disintegrin protein with an RGD integrin binding sequence. J Biol Chem, 1996. 271(9): p. 4593-6.

460. Bosse, F., et al., Cellular localization of the disintegrin CRII-7/rMDC15 mRNA in rat PNS and CNS and regulated expression in postnatal development and after nerve injury. Glia, 2000. 32(3): p. 313-27.

140

461. Herren, B., E.W. Raines, and R. Ross, Expression of a disintegrin-like protein in cultured human vascular cells and in vivo. Faseb J, 1997. 11(2): p. 173-80.

462. Bohm, B.B., et al., Up-regulation of MDC15 (metargidin) messenger RNA in human osteoarthritic cartilage. Arthritis Rheum, 1999. 42(9): p. 1946-50.

463. Mosnier, J.F., et al., ADAM15 upregulation and interaction with multiple binding partners in inflammatory bowel disease. Lab Invest, 2006. 86(10): p. 1064-73.

464. Kuefer, R., et al., ADAM15 disintegrin is associated with aggressive prostate and breast cancer disease. Neoplasia, 2006. 8(4): p. 319-29.

465. Shintani, Y., et al., Overexpression of ADAM9 in non-small cell lung cancer correlates with brain metastasis. Cancer Res, 2004. 64(12): p. 4190-6.

466. Herren, B., et al., ADAM15 overexpression in NIH3T3 cells enhances cell-cell interactions. Exp Cell Res, 2001. 271(1): p. 152-60.

467. Trochon-Joseph, V., et al., Evidence of antiangiogenic and antimetastatic activities of the recombinant disintegrin domain of metargidin. Cancer Res, 2004. 64(6): p. 2062-9.

468. Sambrook, J. and D.E. Russell, Molecular Cloning: A Laboratory Manual. 3rd ed. Vol. 1. 2001, Cold Spring Harbor: Cold Spring Harbor Laboratory Press.

469. Ioannou, P.A., et al., A new bacteriophage P1-derived vector for the propagation of large human DNA fragments. Nat Genet, 1994. 6(1): p. 84-9.

470. Cooke, H.J. and J. Hindley, Cloning of human satellite III DNA: different components are on different chromosomes. Nucleic Acids Res, 1979. 6(10): p. 3177-97.

471. Nicholas, K.B., N.H.B. Jr., and D.W.I. Deerfield, GeneDoc: Analysis and Visualization of Genetic Variation. EMBNEW.NEWS, 1997. 4(14).

472. Thompson, J.D., D.G. Higgins, and T.J. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 1994. 22(22): p. 4673-80.

473. Schwartz, S., et al., Human-mouse alignments with BLASTZ. Genome Res, 2003. 13(1): p. 103-7.

474. Schwartz, S., et al., PipMaker--a web server for aligning two genomic DNA sequences. Genome Res, 2000. 10(4): p. 577-86.

475. Thompson, J.D., et al., The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res, 1997. 25(24): p. 4876-82.

476. Wingender, E., et al., TRANSFAC: an integrated system for gene expression regulation. Nucleic Acids Res, 2000. 28(1): p. 316-9.

477. Kel-Margoulis, O.V., et al., COMPEL: a database on composite regulatory elements providing combinatorial transcriptional regulation. Nucleic Acids Res, 2000. 28(1): p. 311-5.

478. Lenhard, B., et al., Identification of conserved regulatory elements by comparative genome analysis. J Biol, 2003. 2(2): p. 13.

479. Loots, G.G., et al., rVista for comparative sequence-based discovery of functional transcription factor binding sites. Genome Res, 2002. 12(5): p. 832-9.

480. Cartegni, L., et al., ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res, 2003. 31(13): p. 3568-71.

481. Fairbrother, W.G., et al., Predictive identification of exonic splicing enhancers in human genes. Science, 2002. 297(5583): p. 1007-13.

482. Rice, P., I. Longden, and A. Bleasby, EMBOSS: the European Molecular Biology Open Software Suite. Trends Genet, 2000. 16(6): p. 276-7.

483. Haider, S., et al., TCR variable gene involvement in chromosome inversion between 14q11 and 14q24 in adult T-cell leukemia. J Hum Genet, 2006. 51(4): p. 326-34.

484. Jones, L.S. and S.Y. Grooms, Normal and aberrant functions of integrins in the adult central nervous system. Neurochem Int, 1997. 31(4): p. 587-95.

485. Cai, H., et al., Neural crest-specific and general expression of distinct metalloprotease-disintegrins in early Xenopus laevis development. Dev Biol, 1998. 204(2): p. 508-24.

141

486. Gendler, S.J., et al., The locus of the polymorphic epithelial mucin (PEM) tumour antigen on chromosome 1q21 shows a high frequency of alteration in primary human breast tumours. Int J Cancer, 1990. 45(3): p. 431-5.

487. Waltz, M.R., et al., A microsatellite within the MUC1 locus at 1q21 is altered in the neoplastic cells of breast cancer patients. Cancer Genet Cytogenet, 1998. 100(1): p. 63-7.

488. Forus, A., et al., Amplification and overexpression of PRUNE in human sarcomas and breast carcinomas-a possible mechanism for altering the nm23-H1 activity. Oncogene, 2001. 20(47): p. 6881-90.

489. Lim, L.P. and C.B. Burge, A computational analysis of sequence features involved in recognition of short introns. Proc Natl Acad Sci U S A, 2001. 98(20): p. 11193-8.

490. Brudno, M., et al., Computational analysis of candidate intron regulatory elements for tissue-specific alternative pre-mRNA splicing. Nucleic Acids Res, 2001. 29(11): p. 2338-48.

491. Jin, Y., et al., A vertebrate RNA-binding protein Fox-1 regulates tissue-specific splicing via the pentanucleotide GCAUG. Embo J, 2003. 22(4): p. 905-12.

492. Cestra, G., et al., The SH3 domains of endophilin and amphiphysin bind to the proline-rich region of synaptojanin 1 at distinct sites that display an unconventional binding specificity. J Biol Chem, 1999. 274(45): p. 32001-7.

493. Volkman, B.F., et al., Structure of the N-WASP EVH1 domain-WIP complex: insight into the molecular basis of Wiskott-Aldrich Syndrome. Cell, 2002. 111(4): p. 565-76.

494. Huovila, A.P., E.A. Almeida, and J.M. White, ADAMs and cell fusion. Curr Opin Cell Biol, 1996. 8(5): p. 692-9.

495. Blobel, C.P., Metalloprotease-disintegrins: links to cell adhesion and cleavage of TNF alpha and Notch. Cell, 1997. 90(4): p. 589-92.

496. Mita, S., E.A. Schon, and J. Herbert, Widespread expression of amyloid beta-protein precursor gene in rat brain. Am J Pathol, 1989. 134(6): p. 1253-61.

497. Marcinkiewicz, M. and N.G. Seidah, Coordinated expression of beta-amyloid precursor protein and the putative beta-secretase BACE and alpha-secretase ADAM10 in mouse and human brain. J Neurochem, 2000. 75(5): p. 2133-43.

498. Bernstein, H.G., et al., Comparative localization of ADAMs 10 and 15 in human cerebral cortex normal aging, Alzheimer disease and Down syndrome. J Neurocytol, 2003. 32(2): p. 153-60.

499. Ling, Y., K. Morgan, and N. Kalsheker, Amyloid precursor protein (APP) and the biology of proteolytic processing: relevance to Alzheimer's disease. Int J Biochem Cell Biol, 2003. 35(11): p. 1505-35.

500. Small, S.A. and S. Gandy, Sorting through the cell biology of Alzheimer's disease: intracellular pathways to pathogenesis. Neuron, 2006. 52(1): p. 15-31.

501. Goddard, D.R., R.A. Bunning, and M.N. Woodroofe, Astrocyte and endothelial cell expression of ADAM 17 (TACE) in adult human CNS. Glia, 2001. 34(4): p. 267-71.

502. Probert, L., et al., TNFR1 signalling is critical for the development of demyelination and the limitation of T-cell responses during immune-mediated CNS disease. Brain, 2000. 123 ( Pt 10): p. 2005-19.

503. Emi, M., et al., A novel metalloprotease/disintegrin-like gene at 17q21.3 is somatically rearranged in two primary breast cancers. Nat Genet, 1993. 5(2): p. 151-7.

504. Freemantle, S.J., et al., Developmentally-related candidate retinoic acid target genes regulated early during neuronal differentiation of human embryonal carcinoma. Oncogene, 2002. 21(18): p. 2880-9.

505. Georges-Labouesse, E., et al., Essential role of alpha 6 integrins in cortical and retinal lamination. Curr Biol, 1998. 8(17): p. 983-6.

506. Graus-Porta, D., et al., Beta1-class integrins regulate the development of laminae and folia in the cerebral and cerebellar cortex. Neuron, 2001. 31(3): p. 367-79.

507. Schmid, R.S. and E.S. Anton, Role of integrins in the development of the cerebral cortex. Cereb Cortex, 2003. 13(3): p. 219-24.

142

508. Chavis, P. and G. Westbrook, Integrins mediate functional pre- and postsynaptic maturation at a hippocampal synapse. Nature, 2001. 411(6835): p. 317-21.

509. Emsley, J.G. and T. Hagg, alpha6beta1 integrin directs migration of neuronal precursors in adult mouse forebrain. Exp Neurol, 2003. 183(2): p. 273-85.

510. Hama, H., et al., PKC signaling mediates global enhancement of excitatory synaptogenesis in neurons triggered by local contact with astrocytes. Neuron, 2004. 41(3): p. 405-15.

511. Goldsmith, A.P., S.J. Gossage, and C. ffrench-Constant, ADAM23 is a cell-surface glycoprotein expressed by central nervous system neurons. J Neurosci Res, 2004. 78(5): p. 647-58.

512. Bernstein, H.G., et al., ADAM (a disintegrin and metalloprotease) 12 is expressed in rat and human brain and localized to oligodendrocytes. J Neurosci Res, 2004. 75(3): p. 353-60.

513. Inoue, D., et al., Cloning and initial characterization of mouse meltrin beta and analysis of the expression of four metalloprotease-disintegrins in bone cells. J Biol Chem, 1998. 273(7): p. 4180-7.

514. Wei, P., et al., Expression and enzymatic activity of human disintegrin and metalloproteinase ADAM19/meltrin beta. Biochem Biophys Res Commun, 2001. 280(3): p. 744-55.

515. Cornwall, G.A. and N. Hsia, ADAM7, a member of the ADAM (a disintegrin and metalloprotease) gene family is specifically expressed in the mouse anterior pituitary and epididymis. Endocrinology, 1997. 138(10): p. 4262-72.

516. Wolfsberg, T.G., et al., ADAM, a widely distributed and developmentally regulated gene family encoding membrane proteins with a disintegrin and metalloprotease domain. Dev Biol, 1995. 169(1): p. 378-83.

517. Choi, I., et al., Characterization and comparative genomic analysis of intronless Adams with testicular gene expression. Genomics, 2004. 83(4): p. 636-46.

518. Alers, J.C., et al., Identification of genetic markers for prostatic cancer progression. Lab Invest, 2000. 80(6): p. 931-42.

519. Redon, R., et al., Global variation in copy number in the human genome. Nature, 2006. 444(7118): p. 444-54.

520. Lander, E.S., et al., Initial sequencing and analysis of the human genome. Nature, 2001. 409(6822): p. 860-921.

521. Antequera, F., Structure, function and evolution of CpG island promoters. Cell Mol Life Sci, 2003. 60(8): p. 1647-58.

522. Ham, C., et al., ADAM15 is an adherens junction molecule whose surface expression can be driven by VE-cadherin. Exp Cell Res, 2002. 279(2): p. 239-47.

143

10. Original communications

The following copyright owners are acknowledged for the permission to reprint the original communications.

I. Academic Press. Published by Elsevier Science Ltd. Kärkkäinen I., Rybnikova E., Pelto-Huikko M., Huovila A.-P.J. Metalloprotease-disintegrin (ADAM) genes are widely and differentially expressed in the adult CNS. Mol Cell Neurosci 15 (6): 547-60, 2000

II. IBRO. Published by Elsevier Science Ltd. Rybnikova E., Kärkkäinen I., Pelto-Huikko M., Huovila A.-P.J. Developmental regulation and neuronal expression of the cellular disintegrin ADAM11 gene in mouse nervous system. Neuroscience 112 (4):921-34, 2002

III. Wiley-Liss, Inc., a subsidiary of John Wiley & Sons, Inc. for Ortiz R.M1, Kärkkäinen I1., Huovila A.-P.J. Aberrant alternative exon use and increased copy number of human metalloprotease-disintegrin ADAM15 gene in breast cancer cells. Genes Chromosomes Cancer. 41 (4):366-78, 2004

IV. Kleino I., Ortiz R.M, Huovila A.-P.J. Human ADAM15 gene structure, promoter identification, and alternative usage of modular exon at cytosolic domain. Submitted to BMC Molecular Biology 2007

V. S Karger AG, Basel for Kärkkäinen I., Karhu R., Huovila A.-P.J. Assignment of the ADAM15 gene to human chromosome band 1q21.3 by in situ hybridization. Cytogenet Cell Genet 88 (3-4):206-7, 2000