Upload
shona-sutton
View
227
Download
0
Embed Size (px)
DESCRIPTION
Challenges with Fragment Assembly Sequencing errors ~1-2% of bases are wrong Repeats Computation: ~ O( N 2 ) where N = # reads false overlap due to repeat Bacterial genomes:5% Mammals:50%
Citation preview
Whole Genome Sequencing
(Lecture for CS498-CXZ Algorithms in Bioinformatics)
Sept. 13, 2005
ChengXiang Zhai
Department of Computer ScienceUniversity of Illinois, Urbana-Champaign
Most slides are taken/adapted from Serafim Batzoglou’s lectures
Outline
• Practical challenges in genome sequencing
• Whole genome sequencing strategies
• Sequencing coverage (Lander-Waterman model)
• Overlap-Layout-Consensus approach
Challenges with Fragment Assembly• Sequencing errors
~1-2% of bases are wrong
• Repeats
• Computation: ~ O( N2 ) where N = # reads
false overlap due to repeat
Bacterial genomes: 5%Mammals: 50%
Repeat Types• Low-Complexity DNA (e.g. ATATATATACATA…)
• Microsatellite repeats (a1…ak)N where k ~ 3-6(e.g. CAGCAGTAGCAGCACCAG)
• Transposons/retrotransposons – SINE Short Interspersed Nuclear Elements(e.g., Alu: ~300 bp long, 106 copies)
– LINE Long Interspersed Nuclear Elements~500 - 5,000 bp long, 200,000 copies
– LTR retroposons Long Terminal Repeats (~700 bp) at each end• Gene Families genes duplicate & then diverge
• Segmental duplications ~very long, very similar copies
The sequencing errors, repeats, and the complexity of genomes make it necessary to
use many heuristics in practice…
The Shortest Superstring formulation is an over-simplification of the problem
Strategies for whole-genome sequencing
1. Hierarchical – Clone-by-clone yeast, worm, humani. Break genome into many long fragmentsii. Map each long fragment onto the genomeiii. Sequence each fragment with shotgun
2. Online version of (1) – Walking rice genomei. Break genome into many long fragmentsii. Start sequencing each fragment with shotguniii. Construct map as you go
3. Whole Genome Shotgun fly, human, mouse, rat, fugu
One large shotgun pass on the whole genome
Hierarchical Sequencing vs. Whole Genome Shotgun
• Hierarchical Sequencing– Advantages: Easy assembly– Disadvantages:
• Build library & physical map; • Redundant sequencing
• Whole Genome Shotgun (WGS)– Advantages: No mapping, no redundant sequencing– Disadvantages: Difficult to assemble and resolve repeats
Whole Genome Shotgun appears to get more popular…
Whole Genome Shotgun Sequencing
cut many times at random
genome
forward-reverse paired readsknown dist
~500 bp~500 bp
Fragment Assembly
Cover region with ~7-fold redundancyOverlap reads and extend to
reconstruct the original genomic region
reads
Read Coverage
Length of genomic segment: GNumber of reads: NLength of each read: L
Definition: Coverage C = NL/ G
C
Enough CoverageHow much coverage is enough?
According to the Lander-Waterman model:
Assuming uniform distribution of reads, C=7 results in 1 gap per 1,000 nucleotides
Lander-Waterman Model
• Major Assumptions– Reads are randomly distributed in the genome– The number of times a base is sequenced follows a Poisson
distribution
• Implications– G= genome length, L=read length, N = # reads– Mean of Poisson: =LN/G (coverage)– % bases not sequenced: p(X=0) =0.0009 = 0.09%– Total gap length: p(X=0)*G– Total number of gaps: p(X=0)*N
( )!
xep X xx
Average times
This model was used to plan the Human Genome Project…
Repeats, Errors, and Read lengths• Repeats shorter than read length are OK
• Repeats with more base pair diffs than sequencing error rate are OK
• To make a smaller portion of the genome appear repetitive, try to:– Increase read length– Decrease sequencing error rate
Role of error correction:
Discards ~90% of single-letter sequencing errors
decreases error rate decreases effective repeat content
However, we have only limited read length.
Many heuristics have been introduced to handle repeats…
Overlap-Layout-Consensus Assemblers: ARACHNE, PHRAP, CAP, TIGR, CELERA
Overlap: find potentially overlapping reads
Layout: merge reads into contigs and contigs into supercontigs
Consensus: derive the DNA sequence and correct read errors ..ACGATTACAATAGGTT..
Overlap
• Find the best match between the suffix of one read and the prefix of another
• Due to sequencing errors, need to use dynamic programming to find the optimal overlap alignment
• Apply a filtration method to filter out pairs of fragments that do not share a significantly long common substring
Overlapping Reads
TAGATTACACAGATTAC
TAGATTACACAGATTAC|||||||||||||||||
• Sort all k-mers in reads (k ~ 24)
• Find pairs of reads sharing a k-mer• Extend to full alignment – throw away
if not >95% similar
T GA
TAGA| ||
TACA
TAGT||
Overlapping Reads and Repeats
• A k-mer that appears N times, initiates N2 comparisons
• For an Alu that appears 106 times 1012 comparisons – too much
• Solution:
Discard all k-mers that appear more than t Coverage, (t ~ 10)
Finding Overlapping Reads
Create local multiple alignments from the overlapping reads
TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGA
Finding Overlapping Reads (cont’d)
• Correct errors using multiple alignment
TAGATTACACAGATTACTGATAGATTACACAGATTACTGATAG TTACACAGATTATTGATAGATTACACAGATTACTGATAGATTACACAGATTACTGA
C: 20C: 35T: 30C: 35C: 40
C: 20C: 35C: 0C: 35C: 40
• Score alignments
• Accept alignments with good scores
A: 15A: 25A: 40A: 25-
A: 15A: 25A: 40A: 25A: 0
Multiple alignments will be covered later in the course…
Layout
• Repeats are a major challenge
• Do two aligned fragments really overlap, or are they from two copies of a repeat?
Merge Reads into Contigs
Merge reads up to potential repeat boundaries
repeat region
Merge Reads into Contigs (cont’d)
• Ignore non-maximal reads
• Merge only maximal reads into contigs
repeat region
Merge Reads into Contigs (cont’d)
• Ignore “hanging” reads, when detecting repeat boundaries
sequencing errorrepeat boundary???
ba
Merge Reads into Contigs (cont’d)
?????
Unambiguous
• Insert non-maximal reads whenever unambiguous
Link Contigs into Supercontigs
Too dense: Overcollapsed?
(Myers et al. 2000)
Inconsistent links: Overcollapsed?
Normal density
Link Contigs into Supercontigs (cont’d)
Find all links between unique contigs
Connect contigs incrementally, if 2 links
Link Contigs into Supercontigs (cont’d)
Fill gaps in supercontigs with paths of overcollapsed contigs
Link Contigs into Supercontigs (cont’d)
Define G = ( V, E )V := contigs
E := ( A, B ) such that d( A, B ) < C
Reason to do so: Efficiency; full shortest paths cannot be computed
d ( A, B )Contig A
Contig B
Link Contigs into Supercontigs (cont’d)
Contig A Contig B
Define T: contigs linked to either A or BFill gap between A and B if there is a path in G passing only from contigs in T
Consensus
• A consensus sequence is derived from a profile of the assembled fragments
• A sufficient number of reads is required to ensure a statistically significant consensus
• Reading errors are corrected
Derive Consensus Sequence
Derive multiple alignment from pairwise read alignments
TAGATTACACAGATTACTGA TTGATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGCGTAAACTATAG TTACACAGATTATTGACTTCATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGCGTAA CTATAGATTACACAGATTACTGACTTGATGGGGTAA CTA
TAGATTACACAGATTACTGACTTGATGGCGTAA CTA
Derive each consensus base by weighted voting
What You Should Know
• The challenges in assembling fragments for whole genome shotgun sequencing
• Lander-Waterman model
• Main heuristics used in Overlap-Layout-Consensus