Why? – Examples Speaking Computer-ise – How – What – Environment (windows) Basic Instructions – Declare – Conditional – Loop – Input Write a quiz game

CODING!

Background for the bioinformatic perspective

Samantha SanfordWill Foran

Overview• Why?

– Examples• Speaking Computer-ise

– How– What– Environment (windows)

• Basic Instructions– Declare– Conditional– Loop– Input

• Write a quiz game• Programming in bioinformatics

– Transcription– Gene Structure– Blast

Why bother?

• Computers do tedious work without complaining

• Computers don’t make arithmetic errors (but they can make a rounding error)

• We want to be lazy• Its fun!

Things computers are good at

• Declare a variable• Define a data structure• Test a condition• Iterate through a loop • Get input

The usefulness of programming• Calculating huge equations accurately – projectile tables– Discrete models

• Searching– Quickest route– Matches to a database– faces in a picture

• Examples?

The usefulness of programming• Calculating huge equations accurately – projectile tables– Discrete models

• Searching– Quickest route– Matches to a database– faces in a picture

• Examples?

Examples in biology

• Make Diagnoses– Identify mutations– Organize and decode test results

(fMRI)• Develop treatments

– Create and parse connected graphs• Research

– Simulating an environment or reaction (protein folding)

– Deriving probabilities of dependent states

What we are going to do

• Transcribe DNA• Identify genomic positions• Parse a BLAST report

Ways to speak

• Piano Roll, Sewing loom punch cards (1800)• FORTRAN (1940s)• C++, PERL (1980s)• Ruby, Python (1990s)• Go, C#, Clojure (2000s)

How to communicate

Write Code

Computer Interprets

ProgrammedResults

What we need for today

• A text editor to store commands (code) in a text (source) file – We will use notepad ++

• A command line to talk to the computer (execute code)– We’ll use cygwin to call Perl on our code

Cygwin Perl

Notepad++

Process• Edit source file• Save

• Execute source file(run)

• View results• Repeat




Notepad++




Notepad++

Cygwin Perl




Notepad++

Cygwin Perl

Launch Cygwin1. Launch Cygwin from the desktop2. Type (all on one line):

hyphen q big o hyphen

wget -qO- http://euler.phys.cmu.edu/wforan1/sams/get.sh | bash

This will retrieve all the code and launch notepad++

http://euler.phys.cmu.edu/wforan1/sams/get.sh

Get Organized• Use “hot corners” to organize the command line

and the text editor

Change directory and playIn Cygwin

Change directory to code cd code

List Files ls Execute 00_start_here.pl perl 00_start_here.pl

OR try “tab completion”perl 0push tab button

In notepad Edit file edit between the “ and ”

Save file File->Save OR Ctrl+S

Re-Run perl 00_start_here.pl OR perl 0push tab

Looks like








Looks like















Run Edit and Save Run

Cygwin Notepad++ Cygwin

perl 00_start_here.pl Ctrl+S perl 00_start_here.pl

Important things to remember

• SAVE your changes before RUNNINGevery time you edit your file and want to run it save or the new code will not run (it’s not saved!)

• In a string of text always remember to close your quotation marks: “ bioinformatics” “ ” , ( ) , and { } should exist in pairs

• Always remember the ; semicolon at the end of each command.

Reverse program

• In notepad++, replace the first (and only) line with:print scalar reverse (“TTGAGC”);

•

• What happened?• Why is this not the reverse complement?

Edit and Save Run

Notepad++ Cygwin

Ctrl+S perl 00_start_here.pl

Proper Perl

• We’ve only looked at executing one line code

• We need a bit more “fluff” for more complicated programs

• Lets check out how Perl code usually start

Proper Perl• Open file boiler.pl

Open

Notepad++

Ctrl+O OR File->OpenSelect boiler.pl


Open

Notepad++



• #! is a “shebang” or “hashbang”– It directs the computer to the interpreter (PERL)

• use tells Perl to use a package. – warnings and strict help report errors

• Statements are ended with ; • anything after a “#” is not seen by the computer (called a comment)

Open

Notepad++


• We’re ready to look at some examples of

– Variables my $variable

– Conditionals if( ){ } else{ }

– Input capture <STDIN>

• Try to determine the output of the follow code

Coding Examples

Variables: code/variable.pl

What is the output?

Run Open Edit and Save Run

Cygwin Notepad++ Notepad++ Cygwin

perl variable.pl OR perl vpush tab

Ctrl+O OR File->Open

Select variable.pl

Ctrl+S perl variable.pl OR push ↑ (up arrow)

Were you right?





Select variable.pl


Were you right?

wforan1@ug142 ~/code$ perl variable.plPyrimidine contains 2 nitrogen atoms on its ring(s)





Select variable.pl


Change it up





Select variable.pl


Change it up

wforan1@ug142 ~/code$ perl variable.plPyrimidine contains 2 nitrogen atoms on its ring(s)wforan1@ug142 ~/code$ perl variable.plPurine contains 4 nitrogen atoms on its ring(s)

Variables: code/length.plWhat is the output?

Run Open Edit and Save RunCygwin Notepad++ Notepad++ Cygwinperl length.pl Ctrl+O length.pl Ctrl+S perl length.pl or ↑

Conditional: code/conditional.pl

Run Open Edit and Save RunCygwin Notepad++ Notepad++ Cygwinperl variable.pl Ctrl+O conditional.pl Ctrl+S perl conditional.pl or ↑

Loops: code/loop2.pl

Run Open Edit and Save RunCygwin Notepad++ Notepad++ Cygwinperl loop2.pl Ctrl+O loop2.pl Ctrl+S perl loop2.pl or ↑

Input: code/in1.pl

Run Open Edit and Save RunCygwin Notepad++ Notepad++ Cygwinperl in1.pl Ctrl+O in1.pl Ctrl+S perl in1.pl or ↑

Exercise 1 – Transcription: DNA→ RNA

• We are going to transcribe DNA to RNA

• This will require – changing the directory in cygwin– Opening a file in a new directory with notepad++– And exploring unknown code

• Listen to the instructions first, then proceed– Visit the URL for more precise directions

http://malaria.phys.cmu.edu/ sams/exercise/3-1.html

http://malaria.phys.cmu.edu/%20outreach/exercise/3-1.html



Exercise 1 – Transcription: DNA→ RNA1. Run exercise

(go to home directory)– cd ~(go to exercise dir)

– cd exercise/code/dna2rna/ (list files, check for dna2rna.pl)– ls(run exercise1 program)– perl dna2rna.pl

(use this sequence file)• enter sequence.txt










2. Open exercise file in notepad++• Ctrl+o (file->open);

• Go back one directory,• then click on exercises• then code• then dna2rna• Open dna2rna.pl









2. Open exercise file in notepad++• Ctrl+o (file->open);

• Go back one directory,• then click on exercises• then code• then dna2rna• Open dna2rna.pl

3. Look for unfamiliar code1. What is unfamiliar2. What does it do




Exercise 2: Gene Structure

• Background– Remember gene structure? (intron, exon, intergenic)

– We will use human X chromosome. • What is significant about this chromosome?

• Requires “print” and using defined variablesmy $variable = “badfadfy9osudlfj”; print “my variable is $variable,”;

http://malaria.phys.cmu.edu/ outreach/exercise/3-2.html


Exercise 2: Gene Structurehttp://malaria.phys.cmu.edu/ outreach/exercise/3-2.html

• Open http://malaria.phys.cmu.edu/ outreach/exercise/3-2.html

• Steps 1 and 2 are already completed for you (chrX has been downloaded)






Step 3-4: cd and run






Step 5: open and edit the help messageStep 3-4: cd and run






Steps 6: get position status







Steps 6: get position status


Step 7: modify output



Exercise 3: Blast• We are going to parse a BLAST report• First, we need to save a BLAST search for

ATATGCGTGCTAGTGCAGTGGGTGGTAGCGTGAATGC to C:\cygwin\home\[username]\exercise\code\blast as blast_report

• Now we can code!

http://malaria.phys.cmu.edu/ outreach/exercise/3-3.html


Exercise 3: Blasthttp://malaria.phys.cmu.edu/ outreach/exercise/3-3.html

3. cd 4. run

5. Print all less than 100%

6. Modify the output to display something different


Write a quiz• Declare variables

– my $numRight = 0; my $userIn;• Print question

– print “What is my favorite color? “;• Get input

– $userIn = <STDIN>; chomp($userIn);• Count correct answers

– if($userIn eq “pink”){ $numRight+=1}• Tell the player how many they got right

– print “You got $numRight correct\n”;• BONUS: Give percent right

– print $numRight/3; • BONUS: Count the number wrong Run Open Edit and Save RunCygwin Notepad++ Notepad++ Cygwinperl quiz.pl Ctrl+O quiz.pl

OR ctrl+N (file->new)Ctrl+S perl quiz.pl or ↑

Documents

Why? – Examples Speaking Computer-ise – How – What – Environment (windows) Basic Instructions – Declare – Conditional – Loop – Input Write a quiz game