uveitis onset and formed an inactive chorioretinal scarafter treatment with topical and systemic steroids.1

To our knowledge, there has been no previous report oftubulointerstitial nephritis and uveitis with multifocalchoroiditis. We suggest a complete retinal examination inall patients with tubulointerstitial nephritis and uveitis todetect any posterior uveal involvement, which may neces-sitate more aggressive immunosuppressive therapy.

REFERENCES

1. Auclin F, Bodard-Rickelman E, Vignal-Clermont C, ThomasD. Tubulo-nephrite interstitielle et uveite (Nitu syndrome). Apropos d’un cas. J Fr Ophthalmol 1989;12:307–311.

2. Segev A, Ben-Chitrit S, Orion Y, Segev F, Bernheim J,Mekori Y. Acute eosinophilic interstitial nephritis and uveitis(TINU syndrome) associated with granulomatous hepatitis.Clin Nephrol 1999;51:310–313.

3. Manjon MT, Sanchez-Burson J, Montero R, Perez-Requena J,Alonso M, Marenco JL. Two cases of acute tubulointerstitialnephritis associated with panuveitis (TINU syndrome).J Rheumatol 1999;26:234–236.

4. Rosenbaum JT. Bilateral anterior uveitis and interstitial ne-phritis. Am J Ophthalmol 1988;105:534–537.

5. Van Acker KJ, Buyssens N, Neetens A, Lequesne M, DesmetN. Acute tubulointerstitial nephritis with uveitis. Acta Pae-diatr Belg 1980;33:171–177.

Zoster Sine Herpete With BilateralOcular InvolvementMakoto Nakamura, MD, PhD,Masumi Tanabe, MD, Yuko Yamada, MD, PhD,and Atsushi Azumi, MD, PhD

PURPOSE: To report a case of zoster sine herpete withbilateral ocular involvement.METHOD: Case report.RESULTS: A 65-year-old man showed bilateral iridocycli-tis with sectoral iris atrophy and elevated intraocularpressure unresponsive to steroid treatment. No cutane-ous eruption was manifest on the forehead. A targetregion of varicella-zoster virus DNA sequence was am-plified from the aqueous sample from the left eye bypolymerase chain reaction. Bilateral iridocyclitis resolvedpromptly after initiation of systemic and topical acyclovirtreatment. Secondary glaucoma was well controlled bybilateral trabeculectomy.CONCLUSIONS: Zoster sine herpete should be consideredand polymerase chain reaction performed on an aqueoussample to detect varicella-zoster virus DNA for rapid

diagnosis whenever anterior uveitis accompanies thecharacteristic iris atrophy, even in the case of bilateralinvolvement. (Am J Ophthalmol 2000;129:809–810.© 2000 by Elsevier Science Inc. All rights reserved.)

ZOSTER SINE HERPETE IS A RARE CONDITION OF CLASSI-

cally described unilateral herpes zoster ophthalmicuswithout cutaneous eruptions.1–3 Here we report zoster sineherpete with bilateral ocular involvement.

A healthy 65-year-old man, who complained of redness,blurred vision, and photophobia in both eyes, was referredto us on August 1, 1997, with a 2-week history of bilateraliridocyclitis and secondary glaucoma unresponsive to treat-ment with topical steroid. Best-corrected visual acuitieswere 80/200 RE and 140/200 LE. Intraocular pressureswere 47 mm Hg RE and 33 mm Hg LE. There was noheadache, neuralgia, or cutaneous eruption on either sideof the forehead. Slit-lamp examination disclosed thesmooth anterior corneal surface, Descemet folds withpigmented precipitates, and moderate cells and flare in theanterior chamber of both eyes. Sectoral iris atrophy withdepigmentation, and posterior and peripheral anteriorsynechiae were noticed bilaterally (Figure 1). There wasmoderate (grade II) nuclear sclerosis in the right eye.Bilateral funduscopy showed no remarkable abnormality ofoptic disk and retina. Blood count, serologic tests, andchest x-ray were all normal.

A 100-ml aqueous sample was taken from the left eyeusing a 27-gauge needle, from which a 216 base-pairtarget sequence region encompassing a Pst I restrictionsite in open reading frame 38 of varicella-zoster virusDNA4 was amplified by polymerase chain reaction(Figure 2). Sequences of varicella-zoster virus DNA–specific oligonucleotide primers used were 59 TCAC-GAACCGTTGACAGGAC39 (sense primer) and59CCACTACTCATTGTATCCGCG39 (antisenseprimer). Polymerase chain reaction with specific primersfor herpes simplex virus type I failed to amplify thepositive bands (Figure 2). We initiated oral administra-tion of acyclovir, 200 mg five times per day, and bilateraltopical ointment of acyclovir six times daily, as well as0.1% dexamethasone eye drops, antibiotic eye drops,and 1% atropine sulfate three times daily. The iridocy-clitis completely subsided within 2 weeks and did notrecur throughout follow-up to May 1999, whereas theelevated intraocular pressures were persistent. Phaco-emulsification with posterior chamber intraocular lensinsertion combined with trabeculectomy with adjunc-tive use of mitomycin was performed on the right eye,whereas trabeculectomy only was performed on the lefteye. Surgery reduced intraocular pressures to approxi-mately 10 mm Hg bilaterally. Postoperative correctedvisual acuities were 20/20 in both eyes. Acyclovir andsteroid were tapered and discontinued after 3 months.

Accepted for publication Jan 21, 2000.From the Department of Ophthalmology, Kobe University School of

Medicine, Kobe, Japan.Inquiries to Makoto Nakamura, MD, PhD, Departments of Ophthal-

mology and Molecular and Cellular Physiology, Pennsylvania StateUniversity College of Medicine, 500 University Dr, Hershey, PA 17033;fax: (717) 531-7667; e-mail: mxn15@psu.edu

BRIEF REPORTSVOL. 129, NO. 6 809

We are unaware of previous reports of bilateral ocularinvolvement of zoster sine herpete and could find noreference to it in a computerized search using Medline.The diagnosis has been based on iridocyclitis responsiveto acyclovir treatment, development of the characteris-tic sectoral atrophy of irides, and existence of varicella-zoster virus DNA amplified by polymerase chainreaction. The sectoral iris atrophy is one of the mostimportant pathognomonic features of zoster sine her-pete.1–3 These lines of evidence, as well as other clinicalfindings and laboratory data, excluded the diagnosis ofirido-corneal-endothelial syndrome, primary closed-an-gle glaucoma, and uveitis caused by several other etiol-ogies, which are potent candidates manifestingiridocyclitis, iris atrophy, and elevated intraocular pres-sures. Polymerase chain reaction, which can exponen-tially amplify specific sequence of DNA and has beenextensively used in the ophthalmic field,1,2,5 was a veryuseful ancillary test because of its rapidity and convenience.

Zoster sine herpete should be considered and polymerasechain reaction from an aqueous sample should be performedto detect varicella-zoster virus DNA for rapid diagnosiswhenever anterior uveitis accompanies the characteristic irisatrophy, even in the case of bilateral involvement.

REFERENCES

1. Stavrou P, Mitchell SM, Fox JD, Hope-Ross MW, Murray PI.Detection of varicella-zoster virus DNA in ocular samplesfrom patients with uveitis but no cutaneous eruption. Eye1994;8:684–687.

2. Yamamoto S, Tada R, Shimomura Y, et al. Detecting varicel-la-zoster virus DNA in iridocyclitis using polymerase chainreaction: a case of zoster sine herpete. Arch Ophthalmol1995;113:1358–1359.

3. Schwab IR. Herpes zoster sine herpete. A potential cause ofiridoplegic granulomatous iridocyclitis. Ophthalmology 1997;104:1421–1425.

4. Davison AJ, Scott, JE. The complete DNA sequence ofvaricella-zoster virus. J Gen Virol 1986;67:1759–1816.

5. Nakamachi Y, Nakamura M, Fujii S, Yamamoto M, Okubo K.Oguchi disease with sectoral retinitis pigmentosa harboringadenine deletion at position 1147 in the arrestine gene. Am JOphthalmol 1998;125:249–251.

FIGURE 1. (Top) The right eye after phacoemulsification withposterior chamber intraocular lens insertion and trabeculectomywith adjunctive use of mitomycin. Arrows indicate sectoral atro-phy with depigmentation in the temporal area of iris. (Bottom)The left eye after trabeculectomy. The temporal half of the irisexhibits findings similar to those of the right eye (arrows).

FIGURE 2. Two percent agarose gel electrophoresis of poly-merase chain reaction products. Lane 1 is a size standard ofFX174/Hae III fragments. Lanes 2 to 4 are polymerase chainreaction products with varicella-zoster virus DNA–specificprimers and correspond to an aqueous sample of the presentcase, a specimen from the cutaneous lesion of another patientwith typical herpes zoster ophthalmicus (positive control), andan aqueous sample from another patient taken during cataractsurgery (negative control), respectively, and lane 5 is a poly-merase chain reaction product with an aqueous sample from thepresent case and specific primers for herpes simplex virus typeI. Lanes 2 and 3 show polymerase chain reaction products of216 base-pair length encompassing a Pst I restriction site inopen reading frame 38 of varicella-zoster virus.

AMERICAN JOURNAL OF OPHTHALMOLOGY810 JUNE 2000