Transcript
Page 1: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

3. Systematic Gene Inactivation

3.1. Transposon insertion populations

3.2. T-DNA insertion populations

3.3. EMS mutant populations (TILLING)

→ by Mutagenesis

(→ by RNAi, overexpression of regulatory elements)

Page 2: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

source:

http://www.genomics.arizona.edu/553/documents/lectures/9_12F-RGeneticsHO.pdf

Page 3: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Forward Genetics

introduce mutations into population

screen for a phenotype

map locus through crosses

isolate gene

limitations:

• phenotypic screening slow and laborious

• recessive mutations undetectable

• rare mutations or phenotypes might be missed

Reverse Genetics

select candidate gene

disrupt or modify candidate gene by mutations or insertions

screen for modified genotypes

identify phenotype through crosses

limitations:

• appropriate candidate gene information must be available

• need for efficient screening system

• unspecific background effects must be eliminated

Page 4: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Forward Genetics

Identify

mutants

with trait of

interest

Relate phenotype to genotype

4,6g seeds 0,6g Seeds

Page 5: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Reverse Genetics

Identify

mutants in

candidate

genes

Test for phenotypic effect of mutant genotype

4,6g seeds 0,6g Seeds

Page 6: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

mutagenesis advantages disadvantages

insertional

T-DNA flanking sequence tags (FST) genetically modified organism (GMO)*

transposons FST, rapid local saturation (e.g. two

component system Ac/Ds)

GMO, preferential integration

“islands”

retrotransposons FST, preferentially targeting gene

space, non-GMO

**TOS17, only system demonstrated in

Oryza sativa

chemical chromosome & point mutations random anonymous mutations, dose

related, hazardous

physical chromosome & point mutations,

safe, easy to use, high-throughput random anonymous mutations

*GMO: green- and screen-house,

public acceptance

**activated through in vitro culture

and γ-rays (S.Nielen, 2000)

Systematic gene inactivation by mutagenesis:

comparison of methods

Quelle: FAO, IAEA

Page 7: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

3.1. Transposon insertion populations

Page 8: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Transposons

(T. Schmidt 1998) (Miniature Inverted Transposable Elements)

Transposon family Terminal repeats or

repeats

Intermediate Excision

Class I: retrotransposons

Ty-1 copia

Ty-1 gypsy

Non-LTR

Yes (LTR)

Yes (LTR)

No

RNA

RNA

RNA

No

No

No

Class II: transposons

AcDs

CACTA

Mu

Yes (11bp)

Yes (13 bp)

Yes (200 bp)

DNA

DNA

DNA

Yes

Yes

Yes

Unclassified Transposons

(MITE)

Yes (11-14 bp) DNA (?) ?

2001:

Transposon family Terminal repeats or

repeats

Intermediate Excision

Helitrons no DNA yes

(Barbagia et al., Genetics 190, 965 (2012)

Page 9: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Transposition mechanisms

http://www.pharmazie.uni-frankfurt.de/PharmBiol/Winckler_Pub/DAZ_Abb1.jpg

Page 10: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Observations of Barbara McClintock (1948)

in Maize

At certain chromosome positions, so called

Dissociation elements (Ds), regularly chromosomal breakage occurs

the occurrence of these chromosomal breakages is related to the

presence of an Activator element (Ac) at any other position in the

genome

Ds elements and Ac elements spontaneously change their position on

the chromosome (Transposition).

Page 11: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Ac/Ds

Ac

1.

2.

Ac

activates translocates

Ac

1.

2.

translocates

Page 12: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Mutation caused by Ac/Ds

Ac

kernel

backmutation by Ac

activates

color gene Ds

1

2

kernel

kernel

stabile mutation without Ac

translocates

Page 13: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

• transposase needs TIR sequences

• En/Spm-Transposons (Enhancer/Supressor of Mutation)

• Ac/Ds (Activator, Dissociation)

• Mu (Mutator)

transposons: autonomous

• „cut & paste“ mechanism (enzymatic) of the same copy transposition:

• transposase also recognizes deleted copies

structure:

• target site duplications („footprints“) after cutting

Transposase gene

TIR

(Terminal Inverted Repeat)

TIR

(Terminal Inverted Repeat)

4,9 kb - >10 kb

TDS TDS

TIR

(Terminal Inverted Repeat)

TIR

(Terminal Inverted Repeat)

TDS TDS

Thomas Schmidt

DNA transposons

(class II transposable elements)

(Target duplication site)

Page 14: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Mutation by Ac/Ds

http://barleyworld.org

Page 15: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

mutagenesis by transposition:

Gene Promotor G ene Promotor Transposon

mutated gene

(insertion) wildtype

examplel: pigmentation of a maize mutant

transposon in chalconsynthase,

dark dots: transposon jumped out of the gene

selection of mutants:

isolation of the gene:

G ene Promotor Transposon

hybridization with

transposon-specific probe

analysis of gene

Transposons as tools of genome analysis

Page 16: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

3.2. T-DNA insertion populations

Page 17: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

T-DNA mutagenesis

Agrobacterium – a plant pathogen

• 1897 Agrobacterium vitis was identified as source of „crown gall" in grapevine (Vitis

vinifera)

• 1974 virulence of Agrobacterium tumefaciens is based on a tumor-inducing plasmid

(Ti)

• 1977 T-DNA in Ti plasmid discovered in plant tumor cells

• 1983 first Agrobacterium mediated transformation with a recombinant gene

Gene

T-DNA insertion mutagenesis integration of T-DNA into the plant genome as:

• full lenght T-DNA

• truncated T-DNA

• multiple T-DNA

T DNA RB

LB T DNA RB

LB

Page 18: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

LB T DNA RB

Agrobacterium tumefaciens culture

Susanne Lemcke

Transformation and selection

Page 19: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

LB T DNA RB

marker for selection:

antibiotics resistance

herbicide resistance

Susanne Lemcke

Transformation und Selektion

Page 20: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Identification of T-DNA flanking regions

Methods:

• inverse PCR

• "TAIL-PCR"(Thermal Asymmetric Interlaced PCR)

Susanne Lemcke

Page 21: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Inverse PCR

T- DNA

T- DNA

EcoRI EcoRI

T-DNA

Susanne Lemcke

restriction

ligation

Inverse PCR

cloning und sequencing of PCR product

Page 22: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

"TAIL-PCR"(Thermal Asymmetric Interlaced

PCR)

T-DNA

P1 P2 P3 AD

3 specific primers

1. primary PCR with primers P1 & DP

2. secundary PCR with primers P2 & DP

3. tertiary PCR with primers P3 & DP

-

P2 DP

DP DP

P1 DP

DP DP

P3 DP

DP DP

cloning und sequencing of PCR product

short arbitrary degenerate primer

yield

→combination of high, middle and low stringency cycles

Page 23: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Applications of T-DNA

insertion mutagenesis (loss-of-function)

insertion libraries = gene targeted mutation

activation tagging (gain-of-function)*

enhancer-, promotor-trap screening*

expression of transgenes

* add 35S or other promoters or enhancers to T-DNA borders

Page 24: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

3.3. EMS mutant populations (TILLING)

→ Systematic screening of complex genomes for

point mutations

Page 25: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Targeting Induced Local Lesions IN Genomes

(TILLING)

AGTTTGCTCGATCTGCT

EMS mutagenesis AGTTTGCTCGATCTGCT AGTTTGCTAGATCTGCT

no mutation in target gene mutation in target gene

heteroduplex analysis

Page 26: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

complete or partial

inactivation of a

gene (undirected

mutagenesis)

Chemical mutagenesis I

advantage: high efficiency of mutagenesis

problem: needs efficient methods to identify the mutations

method of choice: TILLING

plant genome

mutation in gene X

most plants

without mutation:

how to identify

mutants?

Page 27: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Chemical mutagenesis II

methylnitroso-urea (MNU)

ethylnitroso-urea (ENU):

ethylmethanesulfonate (EMS):

Page 28: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Mutagenesis with ethylmethanesulfonate (EMS) I

Sega (1984)

Mode of action:

ethylation

Targets in nucleic acids:

phosphate-backbone

purine/pyrimidine bases

Effects:

double strand breakage (chromosomal breakage)

deletions

depurination/depyrimidation (unspecific base exchange)

G/C → A/T transitions

Page 29: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

point mutation:

G/C → A/T exchange (transition)

Mutagenesis with ethylmethanesulfonate (EMS) II

1

3

7 1 3

6

N N

7

Page 30: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

List of possible triplett changes

# STOP #

#

#

#

96 out of 192 (64x3) ...

Page 31: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

can be applied on all organisms (independant of transposon systems or transformation

efficiencies, regardless of genotype and species

effect is a function of concentration: application in ranges with lethalities <50% and M1

fertilities >50% leading to mutation frequencies of 10,000-100,000 transitions/plant

possible direct integration of mutant genotypes in standard breeding programs (no

transgenic approach)

broad spectrum of allelic mutations with effects on gene function:

- complete loss-of-function (stop-, splice site-, regulatory mutants)

- partial loss-of-function (reduced enzyme activity)

- changed function (modified substrate specificity)

- gain-of-function (modified effector or subtrate binding, promoter activation,

repressor inactivation)

Advantages of EMS mutagenesis

Page 32: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

I. Reverse Genetics

- requires high level of information beforehand:

complete genomic and coding sequence, copy number, expression

data

II. Forward or Reverse Genetics

- most mutations are recessive → phenotype only in homozygous

plants (selfing required, no detection in a Forward approach)

- background mutations (up to 100,000/plant!) must be eliminated by

repeated backcrossing (5 to 10 times) with elite breeding material

(problem in selection of desired phenotype by cumulative effects of

background mutations)

Disadvantages of EMS mutagenesis

Page 33: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Detection of mutation in selected genes

AGGTCCTAGGTCATAGCATAGGATAGACATAG

AGGTCCTAGGTCATGGCATAGGATAGACATAG

amplification of defined sequences

mutagenesis

Detection of SNP by gel electrophoresis

wildtype:

mutant:

population size:

3000-5000 plants

Page 34: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

TILLING technique Till et al. 2006, Nature Protocols 1, 2465

Page 35: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Application in Winter Rapeseed

Oil seed rape:

70-85 % of phenolics are

sinapic acid metabolites

Sinapine (sinapoylcholine):

• phenolic with unpleasant bitter taste

• conventional seeds contain up to

12 mg/g seeds

• transgenic approach (inactivation of

sinapine sythesis genes): reduction

below 2 mg/g

• classical selection in breeding

programs: down to 5 mg/g

• breeders‘ aim: 1-2 mg/g

unter 50

50 bis unter 70

70 bis unter 75

75 und mehr

Landwirtschaftsfläche in %

Statistisches Amt für Hamburg und Schleswig Holstein

2008/2009: Canola

Area: 115.000 ha

Harvest: 520.000 t

Page 36: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Rapeseed meal as chicken feed

Rapeseed meal (after oil extraction) is rich in valuable proteins,

minerals und vitamins, but also contains antinutritive compounds

(sinapic acid esters, glucosinolates)

Page 37: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Problem and Solution

Aim: use of rapeseed meal for feed and food

Problem: high sinapine content

Approach:

- inactivation of sinapine synthesis genes (GMO)

- use of low sinapine mutants (TILLING)

Method: selection of low sinapine mutants

Page 38: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

candidate genes

aim: selection of mutants with reduced enzyme activity

Sinapine metabolism in Brassicaceae

Page 39: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Rapeseed is an allotetraploid crop plant

U‘s Triangle, 1935

1 gene copy in A. th.

~2-6 gene copies in B. napus

Page 40: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

EMS mutagenesis (seeds)

LD50

buffer control

12 8 24 h 0

EMS (0.5%) buffer

EMS (0.5%) buffer

EMS (0.5%)

EMS (1%) buffer

EMS (1%) buffer

EMS (1%)

determination of survival rate

soaking

EMS

treatment

washing step

germination

cultivation

chlorotic chimeras

level of mutagenesis

viability fertility

optimization

Page 41: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Basic Genotype: YN01-429, canadian yellow seeded spring type (Dr. G. Rakow)

EMS treatment (0.8% - 1.2% EMS), 7,400 seeds

5,980 M1 plants in the greenhouse and in the field

5,980 bag isolations

Seeds harvested from 3,200 M1 plants

8,100 M2 plants grown in the field

5,867 M2 plants germinate

Select 2,700 M2 families

Seeds harvested from 5,567 M2 plants

DNA extracted from 5,860 plants (TILLING population)

>50 seeds/plant

M1

M2

M3

Rapeseed TILLING population YN01-429

Page 42: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Mutation breeding in Brassica napus

mutagenesis in seeds

phenotyping of mutant plants

Page 43: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

controls

mutant plants

Phenotypic variation in the M2 generation I: leaf morphology

Page 44: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

4,6 g seeds 0,6 g seeds no seeds

Phenotypic variation in the M2 generation II:

flower morphology and seed set

Page 45: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

High throughput TILLING

............... ............... ............... ............... ............... ............... ............... ...............

............... ............... ............... ............... ............... ............... ............... ...............

............... ............... ............... ............... ............... ............... ............... ...............

............... ............... ............... ............... ............... ............... ............... ...............

............... ............... ............... ............... ............... ............... ............... ...............

............... ............... ............... ............... ............... ............... ............... ...............

DNA

DNA pools endonuclease digest

denature

gel electrophoresis

denature

renature

PCR with gene

specific primers

IRD700

IRD800

Analyse individual plants to

identify mutant

TILLING database Seed bank

(after Till 2006)

Page 46: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

A 96 lane Li-Cor DNA

sequencer examining

the top strand (left) and

bottom strand (right) of

a PCR product

heteroduplex by CEL I

mutation detection.

Each lane has the DNA

of five plants, total 480

plants (5x pools).

Signals on left have

corresponding signals

on right.

Mutation detection on a LiCor gel IRD700 channel IRD800 channel

Page 47: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

2D 8x Pooling strategy

Page 48: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

2D mutant identification

1211 bp

621 bp 553 bp

519.3 / 553 bp 519.3: 553 bp

518.2: 622 bp

533.3: 1220 bp

column pools row pools

Page 49: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Wildtyp Mutant Heteroduplex Homoduplex

Mutation detection platforms

• PAGE (LICOR)

[polyacrylamide gel electrophoresis]

• DHPLC (WAVE)

[denaturing high performance liquid chromatography]

• Fluorescent Capillary electrophoresis (FCE)

LICOR website

• High Resolution Melting Analysis (HRM)

• Next Generation Sequencing (NGS: 454 Sequencing)

Page 50: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Principle of DHPLC

similar:

Conformation Sensitive Capillary Electrophoresis

(Gady et al. 2009, Plant Methods 5:13)

Page 51: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Use of Next Generation Sequencing

Discovery of Rare Mutations in Populations:

TILLING by Sequencing

(Tsai et al. 2011: Plant Physiology156,1257–1268)

3D pooling

PCR of superpools (1.5 kb amplicons)

barcoded adapters for libraries

Illumina sequencing

(for example 40 Mio reads of 40 bp length,

2500x coverage)

Page 52: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel 52

Mutation frequency:

Mutation density:

𝐷 [𝑚𝑢𝑡𝑎𝑡𝑖𝑜𝑛𝑠

𝑝𝑙𝑎𝑛𝑡] = (mutation frequency F x genome size x G/C correction factor)

(B. napus: average G/C content = 36%; genome size = 2258 Mbp/2n;

G/C correction factor = (average %) / (% in candidate gene))

Calculation formulas

Page 53: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

TILLING Reference list

* methyl nitroso-urea (MNU) as mutagen

Species ProjectMutation frequency

[1/kb]Reference

Arabidopsis ATP 170-300 Greene et al. Genetics 2003, 164: 731-740

GABI-TILL 100-150http://www.gabi-till.de/project/project/gabi-till-

project.html

Barley SCIR 1000 Caldwell et al., Plant Journal 2004, 40: 143-150

GABI-TILL 600http://www.gabi-till.de/project/project/gabi-till-

project.html 

TILLMORE 374* Talame et al. Plant Biotechnol J. 2008, 6: 477-485

Brassica napus GABI-TILL 12-60 Harloff et al. Theor Appl Genet 2012, 124, 957-69

42-130 Wang et al. New Phytol. 2008, 180: 751-765

CAN-TILL 100 http://www3.botany.ubc.ca/can-till/

Brassica oleracea CAN-TILL 447 Himelblau et al. TAG 2009, 118: 953-961

Brassica rapa 30 Stephenson et al. BMC Plant Biol 2010, 10

Lotus GENPOP 154 Perry et al. Plant Physiol 2009, 151: 1281-1291

Maize MTP 608-2548 Weil et al. Crop Science 2007, 47: S60-S67

Medicago GLIP 485 Le Signor Plant Biotechnol J. 2009, 7: 430-441

Pea PETILL 200 Dalmais et al. Genome Biol. 2008, 9: R43

Rice 135* Suzuki et al. Mol Genet Genom 2008, 279: 213-223

Rice RICETILL 294/264* Till et al. BMC Plant Biol 2007, 7

Sorghum USDA-ARS 526 Xin et al. BMC Plant Biol 2008, 8: 103

Soybean SMP 140-550 Cooper et al. BMC Plant Biol 2008, 8: 9

Sugar beet GABI-TILL 280-700http://www.gabi-till.de/project/project/gabi-till-

project.html

322-577 Minoia et al. BMC Res Notes 2010, 3: 69

1337 Rigola et al. PLOS One 2009, 4: e4761

737 Gady et al. Plant Methods 2010, 5: 13

Wheat (4x/6x)) 40/24 Slade et al. Nature Biotechnol 2005, 23: 78-81

Oat CropTailor AB 20-40 Chawade et al. BMC Plant Biol 2010, 10

Tomato

Page 54: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

• identification of mutations in selected genes

• applicable on all organisms

• great variance of induced gene modifications

• direct use of favorable alleles in breeding programs (if <4

functional gene copies)

• alternative to GMO

• exploit natural variability by screening of natural populations:

Eco-TILLING (without artificial mutagenesis)

TILLING summary

Page 55: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Transgene mediated mutagenesis

Page 56: 3. Systematic Gene Inactivation - Molekulare …...Dissociation elements (Ds), regularly chromosomal breakage occurs the occurrence of these chromosomal breakages is related to the

Prof. Dr. C. Jung, Lehrstuhl für Pflanzenzüchtung, Universität Kiel

Transgene mediated mutagenesis

• Overexpression of truncated (non-functional) OsPMS1 leads to

suppression of intrinsic functional OsPMS1

• in segregating T2 mutant families the mutation rate is

wildtype allel < heterozygous allel ≈ homozygous allel, showing that the

mutation load increases from generation to generation

• Transgene is eliminated by isolating plants with wildtype allel from

segregating mutant families or by backcrossing with non-transgenic

wildtype plant

• Mostly G/C→A/T in rice but less than in TILLING (60 instead of 70 %)


Recommended