Download doc - Editing example 1

Transcript
Page 1: Editing example 1

Human Telomerase Reverse Transcriptase (hTERT) Transfection Reduces Apoptosis in Human

Corpus Cavernosum Smooth Muscle Cells Apoptosis and Slows Ddown the Cellular Aging

Abstract

Aims: To explore effects of hTERT gene transfection on biological behaviors of human corporal smooth

muscle cells.

Methods: Human corporal smooth muscle cells were grown in primary cultured; . aA fluorescent

eukaryotic expression vector, named hTERT-IRES2-EGFP, of carrying the hTERT gene was constructed

and; for the first time, the sense recombinant plasmid hTERT-IRES2-EGFP was transfected into human

corporal smooth muscle cells  with using Lipofectin reagent.; the correctness of transfection was

identified, as well astThe telomerase activity, mitotic index, cell apoptosis, cell growth curves of

transfected smooth muscle cells were determined;, and whether the potential formation of malignant

phenotypes occurred in these transfected cells were determinedwas investigated.

Results: We successfully constructed fluorescent a eukaryotic expression vectors of human sensecarrying

hTERT and EGFP genes and correctly transfected human corporal smooth muscle cells. Telomerase

activity, mitotic index, and cell growth curves of the hTERT-transfected cells were significantly higher

than those of non-transfected cells and of cells transfected with vacant the empty EGFP vector EGFP-

transfected cells, , whileereas cell apoptosis rates of the former were lowest inr hTERT-transfected

cellsthan the latter. No changes in cell morphology, chromosome number, and The hTERT-transfected

cells still had 23 pairs of chromosomes and all were normal diploid cells. No tumorigenicity in nude mice

wereas foundobserved between hTERT-transfected cells and control cells.

Conclusion: In this study, for the first time, the sense hTERT gene was transfected into human corporal

smooth muscle cells, which helped increased telomerase activity in cells, reduced cell apoptosis and

slowed down cell aging. No malignant phenotypes were found in the hTERT-transfected smooth muscle

1

Aks, 06/14/11,
Please check with the target journal. Some journals do not allow abbreviation in the title
Heiko, 06/14/11,
Is such a list with separations by semicolons according to Journal style? If not, I suggest to change to full sentences.
Page 2: Editing example 1

cells.

2

Heiko, 06/14/11,
There is no conclusion here! This part repeats essentially in a condensed for m the Results summary above. I suggest to change this part.
Page 3: Editing example 1

Introduction

Erectile dysfunction (ED) is one of the most common diseases in Male Urology that greatly affects

the quality of life in aging men. Due to accelerated As aging of global population accelerates, the number

of patients with ED have beenis increasing year byeach year, which greatly affects quality of life of aging

males. Senescence has been generally recognized as a high-risk factor for ED [1]. Relaxation of corpus

cavernosum smooth muscle is the key to penile erection. Although one PED5I, a phosphodiesterase V

inhibitor (PED5I), has been used toyielded good results in the treatment of ED, achieving good results,

but its has poor efficacy in patients with for organic ED was poor [2]. At present, the mechanism of organic

changes in ED is not yet known. Our research and related foreign literature and others have found a

decrease inthat in the process of aging and the occurrence of organic ED, smooth muscle cells (SMCs) in

penile tissues decreased, an increase in collagen fibers increased, and a decrease in erectile tissue

compliance in the process of aging and with the occurrence of organic EDdecreased. There is currently no

ideal way to reverse the above changes yet [3]. Current evidence Most of viewpoints supports the

viewpoint that a the decrease inof SMCs in penile tissues of patients with ED is due to the transformation

from SMCs to fibroblasts. However, injection of antisense TGFβ to inhibit smooth muscle fibrosis has

poor effects.

An increase or a decrease in the number of cells depends on the speed rate of cellular aging. In

recent years, theWith the progress in genetics, of aging have made new progress, in which one very

important thing is the discovery of telomeres and telomerase have been implicated in the regulation of

aging. Iwana et al. x have confirmed that telomere shortening acts as the molecular clock that triggers

senescence. Telomerase can catalyze and replicate telomeres, and thereby extend cellular life-span.

Among the three known subunits of comprising human telomerase, only the human telomerase protein

catalytic subunit (hTERT), an important rate-limiting component of human telomerase, is consistent

associated with telomerase activity [4]. Due to the lack of telomerase activity in human penile tissues,

3

Heiko, 06/14/11,
Telomerase catalyzes the lengthening of telomeres. I suggest to change this part of the sentence.
Aks, 06/14/11,
Please provide year of publication.
Heiko, 06/14/11,
Sorry, but telomeres and telomerase were not discovered in recent years (it’s nearly 30 years now).
Heiko, 06/14/11,
Add “oligonucleotides”? Again, such a statement requires a reference.
Heiko, 06/14/11,
References are missing for this statement at the end of the sentence.
Heiko, 06/14/11,
Cannot be written like this. ‘Research’ cannot make a finding, only people. The term‘foreign literature’ is not used in science.
Heiko, 06/14/11,
I don’t think that “organic changes” is correct. Thus, it is unclear what authors refer to in this sentence. Alternatively, The mechanisms underlying (organic) ED are not fully understood.
Heiko, 06/14/11,
Alternatively, limited
Page 4: Editing example 1

telomeres in SMCs gradually shorten along with increasing cycles of mitosis. The lLife-span of SMCs

with a certain level of telomerase activity may, therefore, be extended. However, Nno related research has

currently been reported till date.

In the present This study, we targeteds primary cultured human corporal smooth muscle cells. The

fluorescentAn eukaryotic expression vector, named hTERT-IRES2-EGFP, carrying theof hTERT gene

and the gene encoding enhanced green fluorescent protein (EGFP) was constructed and identified; for the

first time, the sense recombinant plasmid hTERT-IRES2-EGFP was transfected into human corporal

smooth muscle cells.; We then evaluated thethe correctness of efficiency of transfection was identified

and determined, as well as telomerase activity, mitotic index, and cell apoptosis, as well as measured cell

growth curves of transfected smooth muscle cells. In addition, we examined, and whether malignant

phenotypes occurred in these transfected cells were determined.

Materials and Methods

Primary culture and identification of human corporal smooth muscle cells

The human penile corpus cavernosum was obtained during hypospadias surgery. The cavernosal

tissue was cut into small pieces (~approx. 1-3 mm each), and then placed for 10 min in PBS solution

containing 100 U/ml penicillin and 100 μg/ml streptomycin for 10 minutes. The tissue pieces were

thereafter placed at 0.5 cm intervals into 25 ml sterile culture bottles coated with 20% fetal calf serum

(FCS) and fixed. Then, 1.5 ml prepared Dulbecco's Modified Eagle's Medium (DMEM) containing 20%

FCS, 100 U/ml penicillin and 100 μug/ml streptomycin was then added to each bottle, and thereafter

theythe culture bottles were placed incubated at 37o C in aunder 5% CO2 incubator at 37 ℃. After 3-5

days of incubation, we observed the tissue pieces under an inverted microscope. When a few cells were

found to be non-adherentswim out of the plant, we added more medium, as well as recorded and observed

the cell morphology and growth. When the cells reached 90% confluence, they were mixed with 0.5%

4

Heiko, 06/14/11,
Ok?
Heiko, 06/14/11,
I suggest to add how the pieces were fixed.
Page 5: Editing example 1

trypsin and 0.04% EDTA (1:1), and were then passaged after the digestion.

Construction and identification of sense fluorescent eukaryotic expression vector hTERT-IRES2-

EGFP

The full-length sequence of hTERT cDNA was located between two EcoRIⅠ restriction sites inof

plasmid pGRN145 (a kind gift from Geron Inc., USA). After digestioned from plasmid pGRN145 and

purifiedpurification, the fragment containing hTERT was cloned into the EcoRI Ⅰsites of the fluorescent

eukaryotic expression vector pIRES2-EGFP. Plasmids with the desired oOrientation of the insert

wereconnection was determined by the digestion with Not I restriction endonuclease followed by agarose

gel analysis.

The hTERT gene Ttransfection of hTERT gene into SMCs

The Lipofectin kit (Gibco) was used for this transfection. One day before transfection, the cells were

passaged to 24 cm2 flasks to make theseso that cells reached around 50% confluence the next day.

Lipofection complexes were prepared as follows: 100 μl of medium containing 13 μl of Lipofectin was

placed at room temperature for 45 minutes, and was then mixed with 100 μl of medium containing 2.2 μg

of plasmid DNA. The mixture was placed incubated at room temperature for 15 minutes. The cells to be

transfected were then added to this mixture, and the transfection mixturereafter were putwas incubated at

37o C under in a 5% CO2 incubator at 37 ℃. Twenty-four hours after the incubationlater, we changed the

medium was changed and then maintained the culture was maintained for another 48 hours. Then, G418

was added and selection continued to screen until colonies formed.

Detection of EGFP expression in cells by confocal laser scanning microscopy

Normal SMCs transfected with the vector hTERT-IRES2-EGFP , SMC-hTERT and SMC-EGFP

5

Heiko, 06/14/11,
I suggest to add which other plasmids were used for transfection besides hTERT-IRES2-EGFP. There must have been some controls, correct? pIRES2-EGFP ?
Heiko, 06/14/11,
Ok? I suggest to add that the correct sequence of the plasmid was verified by DNA sequencing.
Heiko, 06/14/11,
I suggest to add the source of the vector (Clontech?).
Heiko, 06/14/11,
I suggest to provide more details (DNA extraction from an agarose gel?)
Aks, 06/14/11,
I suggest to use either “sense fluorescent eukaryotic expression vector” or “hTERT-IRES2-EGFP “to shorten the heading as both symbolizes the same.
Page 6: Editing example 1

were respectivelywere observed under a Leica TCL-NT confocal laser scanning microscope to detect

examine whether fluorescence fluorescent protein expression and morphological changes occurred in

cells. As controls, untransfected SMCs and SMCs transfected with xx and yy were used.

Detection of integration of exogenous NeoR gene in cells by PCR

This The detection was conducted using the xx kit according to the kit instructions provided by the

supplier and th. The following upstream of NeoR gene-specific primers: was 5'-

CAAGATGGAATTGCACGCAGG-3' (forward) and downstream 5'-CCGCTCAGAAAGAACTCGTC-3'

(reverse).

Detection of expression of hTERT mRNA levels expression by RT-PCR

This The detection was carried out using the xx kit according to the kit instructions provided and.

The upstream ofthe following hTERT gene-specific primers was : 5'CGGAAGAGTGTCTGGAGCAA3'

(forward) and downstream 5'GGATGAAGCGGAGTCTGGA3' (reverse).

Detection of exogenous hTERT protein expression in transfected SMCs by Western blot

When normal untransfected or transfected SMCs, pIRES2-hTERT-SMC and EGFP-hTERT-SMC

reached 90% confluence, total cellular protein was isolated using M-PERTM (Pierce), a mammalian

protein extraction reagent (Pierce), was respectively administered at these cells to collect total cellular

protein. After protein quantification by using BCA protein assaymethod, samples were separated by SDS-

PAGE, electrotransferred electrically onto a nylon membrane,s and incubated with anti-hTERT immune

antibody responses were performed. EventuallySubsequently, enhanced chemiluminescence (ECL) was

used to visualize protein bands.

6

Heiko, 06/14/11,
Add details regarding antibody and company from which the antibody was purchased.
Heiko, 06/14/11,
Add time and temperature of incubation.
Heiko, 06/14/11,
Again, please add the name. Otherwise, the reader will not know which kit was used.
Heiko, 06/14/11,
Were mRNA levels measured quantitatively by real-time PCR? If yes, I suggest to change to “Detection and quantification”
Heiko, 06/14/11,
Add here the name of the kit.
Heiko, 06/14/11,
In publications, generally more details are provided (e.g., regarding image acquisition and analysis).
Heiko, 06/14/11,
See comment above. Add the respective control vectors.
Page 7: Editing example 1

Quantitative detection of telomerase activity by TRAP-ELISA

This detection was performed according to the instructions.

Detection of changes in the number of SMC proliferation by mitotic index

The mitotic index of SMCs was calculated by staining cells and counting the number of cells in

mitosis, respectively, at different time points.

Detection of absorbance changes in SMC proliferation by MTT assrray

This detection was conducted in a conventional mannerusing standard procedures. One multi-well

plate was colored each day for a total of 6six days, then 20 l of 5 mg/ml MTT was added to each well,

and then plates were incubated at 37 ℃ for 4four hours at 37o C. After the incubation, 150 ul of dimethyl

sulfoxide (DMSO) was added to each well and then plates were shaken for 10 minutes to make crystals

fully dissolve crystalsd. The absorbance of each well Plates were readwas then measured at 490 nm

usingwith an enzyme-linked immunosorbent assay (ELISA plate) reader (490nm) to measure the ab-

sorbance of each well. Cells growth curves were determined by plotted with time as x-axis anding optical

density (OD) values as y-axisa function of time.

Detection of SMC apoptosis using TUNEL staining methodassay

This detection was carried out according to the kit instructions.

Karyotype aAnalysis of chromosome karyotype

Colchicine was added A bottle of to SMC-hTERT cells grownup to the logarithmic phase was added

by colchicine., and Followingsubsequently incubated incubation for 2 hours at 37o C ℃ for 2 hours, and

then the cells were collected as well asand treated with hypotonic solution. ThereafterSubsequently, the

7

Heiko, 06/14/11,
Ok?
Heiko, 06/14/11,
Same as above. Change accordingly providing the name of the kit.
Heiko, 06/14/11,
ELISA is well-known abbreviation ; no need to give full name.
Susan, 06/14/11,
Numbers below 10 is generally written in words in the text.
Heiko, 06/14/11,
I can’t edit “was colored” as I don’t know what was done. Definitely, this phrase needs to be changed. Were cells at different dilutions added to each well and incubated?
Heiko, 06/14/11,
Add reagent.
Heiko, 06/14/11,
Cannot be written like this. What instructions? Again from a kit? Change as done above.
Page 8: Editing example 1

cells were prefixed with ice-cold methanol / acetic acid (3:1) solution for 5 minutes, deposited by

centrifuged centrifugationdeposit, and fixed again. FinallyNext, they were made into a single cell

suspension. The single cell suspension, was dropped onto a pre-cooled glass slide, stained with Giemsa

stain for 10 -15 min,utes and then observed under the an optical microscope.

Experiment of Ttumorigenicity in nude mice

Six nude mice of either sex, raised under specific pathogen-free (SPF) conditions, were randomly

divided into 3 three groups (2 two mice per group), raised under specific pathogen free (SPF) conditions.

All groups of nudeEach mice mouse were was inoculated subcutaneously with the liver cancer cell line

HepG2 into the left backs hind legas a control., The different groups then receivedwhereas with the same

amount of untransfected SMCs or SMCs transfected with -hTERT or , SMC-EGFP and SMC into the

right hind legbacks. Subsequently,The tumor formation was observed and meanwhile tumor size was

measured every 7 seven days for successive 8 eight consecutive weeks.

Statistical analysis

Experimental data were analyzed using SPSS 13.0 software and represented as mean ± SDsd (x ±

s). When the means of several groups were compared, single-factor analysis of variance was used for

homogeneity of variance. The q-test was used for the comparison of two means. The A non-parametric

test was performed for heterogeneity of variance. A P value less than <0.05 was considered statistically

significant. , while a value A P<less than 0 .01 was considered highly significant.

Results

Primary culture and identification results of human corporal smooth muscle cells

On the 4th day of primary culture, a few spindle cells grew out of the tissue edge and; on on the 5th

8

Heiko, 06/14/11,
Of what?
Heiko, 06/14/11,
Is this correct? I assume it should be Student’s t-test here.
Heiko, 06/14/11,
Ok?
Heiko, 06/14/11,
Ok?
Page 9: Editing example 1

to 7th days, an increase in the number of the cells increased in the number and beganand the to appearance

of a directional arrangement was observed. After around 2 two weeks of culture, a dense monolayer of

cells formed in the flask and cells were passaged. After the passage, some cells were spindle-shaped and

showed directional arrangement (Fig. 1). The cultured cells were proven to be SMCs by

immunohistochemical staining with a monoclonal antibody against α-actin. Both Sspindle-shaped SMCs

with a pale yellow cytoplasm and actin stained dark yellow staining of actin in cells were both observed

under the microscope (Fig. 2).

Construction and identification results of sense and antisense hTERT eukaryotic expression vector

Digestion Identification of Plasmid 1pGRN145 and IRES2-EGFP 

The plasmid pGRN145 containing 3.5-kb hTERT cDNA between the two EcoRIⅠ restriction sites of

pBBS212 was is 14-kb long. The plasmid pGRN145 should form two fragments (11.5 and 3.5 kb) after

digestion with EcoRI Ⅰ. The vector IRES2-EGFP produced a 5.3-kb linear fragment after digested

digestion withby EcoRI, Ⅰand formed two fragments (4.0 and 1.3 kb) after double digestion with EcoRIⅠ

and NotIⅠ. The experimental results were completely consistent with theoretical values. (sSee Fig. 3 and

Fig. 4).

Digestion identification of the recombinant plasmid hTERT-IRES2-EGFP

In this experiment, Bbased on cloning into an EcoRIⅠ restriction site, the inserted fragment carrying

hTERT cDNA can be forward or reversely connectedoriented in two directions to the fluorescentin

the eukaryotic expression vector., so Hence, the Not I restriction endonuclease digestion was further used

for to identification identify theof the connection orientation of the insert in different clones. The sense

plasmid was found with two bands of 1.4 and 7.4 kb, whereas the antisense plasmid has two bands of

with 4.8 and 4.0 kb, respectively (. The two bands were consistent with theoretical calculations. (See Fig.

9

Heiko, 06/14/11,
I recommend to delete this sentence and the similar sentence below.
Heiko, 06/14/11,
By all respect, but these are not experimental results. The construction of plasmids belongs to the Methods section. The construction described here is extremely simple and a standard procedure performed in any molecular biology lab. Thus, I strongly recommend to shorten the description and to delete Figures 3-5.
Aks, 06/14/11,
Figure and tables are missing. Please provide all figures and tables.
Page 10: Editing example 1

5).

The Transfection of sense recombinant plasmid hTERT-IRES2-EGFP transfection into human

corporal smooth muscle cells

By using the cationic liposome Lipofectin, the sense recombinant plasmid and vacant empty vector

were transfected into cultured SMCs; the corresponding cells were, named as SMC-hTERT and SMC-

EGFP, respectively.

Identification of Ttransfection results

● Observations results underby fluorescence microscopye

Forty-eight hours after transfection, the positive expression of EGFP was observed under

inverted fluorescence microscope. The entire cell appeared green, and nucleus-based (Fig. 6). No change

in and its cell morphology was consistent with that ofas compared to non-transfected SMCs was

observed. The entire cell appeared green, and nucleus-based. (See Fig. 6)

● Reporter gene assay

Our results showed that both SMC-hTERT and SMC-EGFP were observed to respectively

produced a specific PCR amplicon band of 790 bp, while SMC had no amplified bands. This suggested

that the sense plasmid hTERT-IRES2-EGFP and vacant vector had already beenwere successfully

transferred into SMCs (. (See Fig.7).

● Identification of the hTERT transcriptional level expression

The expression of the hTERT gene in transfected SMCstranscription products was detected by RT-

PCR assay.  Our results showed that SMC-hTERT as well as SMC and SMC-EGFP all had

expressionexpressed this genes, but that the level of hTERT mRNAexpression was significantly higher in

SMC-hTERT was significantly higher than that in SMC or in SMC-EGFP. This result indicated that

primary cultured SMC endogenously expressed had hTERT at a low level, and that transcription but

10

Heiko, 06/14/11,
What does it mean here “nucleus-based”? Change to: “Evenly distributed and strong fluorescence was observed in the entire cell”?
Heiko, 06/14/11,
Names were already used above. I suggest to move this part up.
Aks, 06/14/11,
Suggest to either use this or hTERT-IRES2-EGFP
Page 11: Editing example 1

exogenous transfected hTERT gene transfection could significantly increase its the transcription of this

gene in SMCs. (See Fig. 8).

● Identification of protein level

The level of hTERT protein expression in hTERT-transfected cells was significantly higher in

hTERT-transfected cells than that in non-transfected cells. This result suggested suggests that the

increased level of hTERT mRNA in hTERT-transfected cells exogenous hTERT gene can becorrelates

with the level of translated protein in human corporal smooth muscle cells (. (See Fig. 9).

Quantitative detection measurement of telomerase activity

Telomerase activity in hTERT-transfected cells was significantly higher than that in non-transfected

cells or in vacant vector EGFP-transfected cells transfected with the empty x vector (0.270 ± 0.40 vs.

0.120 ± 0.011, 0.092 ± 0.026, P < 0.01). This data indicated that exogenous hTERT

transfection into SMCs can significantly increase the telomerase activity. 

Detection of changes in the number of SMC proliferation by mitotic index

After the hematoxylin staining, lamellae-crawling SMCs were counted for cells in mitosis under the

light microscope, and the percentage of the cells in mitosis was calculated. (sSee Table 1 and Fig. 10).

Detection of changes in absorbance of SMC proliferation by MTT assrray

After 7 days of culture, the OD value of SMC-hTERT was significantly higher than that of SMC-

EGFP or that of SMC, whereas no significant difference in OD value was found between SMC-EGFP and

SMC in the OD value. (sSee Table 2 and Fig. 11).

Detection results of SMC apoptosis by TUNEL staining

11

Heiko, 06/14/11,
Please check.
Aks, 06/14/11,
EGFP?
Heiko, 06/14/11,
Ok?
Page 12: Editing example 1

After the logarithmic growth phase of a cell (5 five days), the occurrence of apoptosis was

determined in SMC-hTERT, SMC-EGFP, and SMC could be detected occurrence of apoptosis., T and the

apoptosis in SMC-hTERT was significantly less in SMC-hTERT than that in either SMC-EGFP or

SMC (2.80 ± 0.04 vs. 6.33 ± 0.01, 6.53 ± 0.17, P <0.01).

KAnalysis of chromosome karyotype analysis

After long-term passages in vitro, each SMC-hTERT had 46 chromosomes, the same number as a

normal somatic cell has.

TExperiment of tumorigenicity in nude mice

Eight weeks after inoculatjectioned with 4×106 HepG2 cellseach, the left sides of all nude mice

injected with HepG2 cells formed tumors (i.e., 100%, with the tumor formation rate of 100%;). By

contrast, whereas their right subcutaneous tissues that were injected with either SMC, SMC-EGFP and or

SMC-hTERT had did not form zero any tumors formation rate.

Discussion

HThe human telomerase is at least composed of human telomerase RNA (hTR), telomerase-

associated protein 1 (TP1), and the telomerase protein catalytic subunit, human telomerase reverse

transcriptase hTRT (or also termed hTERT or, hEST2). The component hTR in telomerase may mainly

act as a template. The subunit TP1 also widely exists in all tissues, and it is, therefore, not unlikely to

functions as an important regulator of telomerase. In 1997, Meyerson and co-workers [5] and Nakamura [6]

et al. [6] independently in different laboratories  cloned respectively another protein subunit of telomerase--

the telomerase protein catalytic subunit hTERT at the same time. The hTERT gene iwas located as a

single copy at 5p15. 33, and its full-length cDNA iwas 4027 bp long in size, with a full-length open

12

Heiko, 06/14/11,
Statements that are generally true are written in present tense.
Heiko, 06/14/11,
Already introduced above.
Page 13: Editing example 1

reading frame of 3399 bp, encoding 1132 amino acids. The hTERT containing contains 7seven small

functional domains and is a memberone of the reverse transcriptase family members with reverse

transcriptase activity. Some Several studies have shown that different from the genes hTR and TP1, the

hTERT gene is only expressed in tumor cells, immortal cells, and germ cells/stem cells, but not

in telomerase-negative normal tissues, which has a veryin agreement good consistency withwith data

regarding telomerase activity [7-8]. The hTERT and hTR were reconstructed in vitro, and the artificially

constructed telomerase also had the function of telomere repeat synthesis. Inducers of tTumor cell

differentiation inducer can decrease telomerase activity by downregulating hTERT gene expression, while

the expression of either hTR or TP1 remained unchanged. The above studies suggest that the hTERT gene

is a major rate-limiting component of telomerase.

Normal somatic cells do not express hTERT, and are telomerase negative. The telomeres in those

cells gradually shorten along with increasing cycles of mitosis, thus leading to cell aging and its finalcell

death. Research has shown that the introduction or activation of the hTERT gene can activate telomerase

in somatic cells, and thereby maintaining telomere length or slow downdelaying loss of telomere losss [9-

11]. Bodnar et al. x used vectors encoding human telomerase catalytic subunit to transfect two types of

normal human somatic cells without telomerase activity, retinal pigment epithelial cells and foreskin

fibroblasts. It wasThey found that the transfected cells restored telomere activity, that the length of the

sequence repeats TTAGGG repeat tract at chromosome ends rapidly increased, and that DNA cells with

artificially elongated telomeres had significant changes in growth potential. In their experiments, normal

somatic cells as a control started aging along with telomere shortening after limited cell divisions,

whereas telomerase-expressing clones lost normal senescence and continued dividing vigorously. The

life-span of many clones reached was at least as 20 times longer as than that of normal cells. More

importantly, the transfected cells did not have malignant phenotypes of tumor cells, owned possessed the

exactly the same chromosome karyotype as that of normal cells, had no tumorigenicity in nude mice, and

possessed a variety of differentiation functions comparable to those of normal cells had[12].

13

Aks, 06/14/11,
Please provide year of publication.
Page 14: Editing example 1

The plasmid pIRES2-EGFP also contains IRES and EGFP in addition to the necessary components

for a eukaryotic expression vector. The The EGFP gene, a commonly used reporter gene, is a green

fluorescent encodes a protein composed of 238 amino acids that exhibits a bright green fluorescence after

excitation by UV. It is commonly used as a fluorescent reporter This can make researchersto rapidly

assess the transfection efficiency by monitoringdetecting EGFP expression in cells. The component

IRES can start initiate the expression of respectively two or more proteins expressions of

the polycistronic transcription unit in eukaryotic cells at the same time, and the

proteins function independently of each other. Therefore, in this study, we chose pIRES2-EGFP as a

vector for, the inserted insertion of the hTERT cDNA fragments into multiple cloning sites of the plasmid

pIRES2-EGFP by genetic recombination, and successfully constructed the recombinant eukaryotic

expression vector pIRES2-EGFP-hTERT. In this study, we successfully primary cultured human corporal

smooth muscle cells using the tissue block method, and, for the first time, transfected the pIRES2-EGFP-

hTERT was transfected hTERT gene into human corporal smooth muscle cells using cationic liposome

methods. Meanwhile,Transfection and target protein expression were verified by detecting more a strong

fluorescent signalsubstances in the transfected cells were observed underusing a fluorescence microscope,

and by Western blot and telomerase activity assaysconfirming that the target gene products were

expressed after transfection. Using RT-PCR and Western blot assaysanalyses furthermore showed, we

found that non-transfected SMC and SMC-EGFP did not haved a very low level of hTERT

mRNA expression, but while SMC-hTERT steadily had the expressioned hTERT. This result

demonstrated that the exogenous hTERT gene could be steadily transcribed and expressed in SMCs.

Reconstruction of telomerase activity in normal somatic cells can delay cell aging; however,, but its

overexpression is an important factor to in causinge unlimited proliferation of tumor cells [13]. Therefore, it

appears to be extremely important forin clinical applications to study whether exogenous hTERT gene

transfection will lead to potential malignant transformation in normal human somatic cells. Karyotype

aAnalysis of chromosome karyotype showed that each hTERT-transfected cell still had 46 chromosomes,

14

Heiko, 06/14/11,
This contradicts your statement above: “This indicated that primary cultured SMC had hTERT transcription” (before editing).
Heiko, 06/14/11,
Otherwise it’s too specific. The original sentence could still mean that other researchers used another construct to transfect the hTERT gene into SMCs.
Heiko, 06/14/11,
Change to “from polycistronic mRNA”?
Page 15: Editing example 1

consistent with the number a in a normal somatic cell has. In the experiments of subcutaneous inoculation

in nude mice, the left sides of all nude mice injected with HepG2 cells grew solid tumor masses, while the

right sides injected with SMC and transfected SMCscells were not observeddid not grow any nodules

or masses, suggesting that telomerase activated by the hTERT gene will not cause infinite cell

proliferation. Tumor formation is simultaneously accompanied by changes in the expression of other

genes, and introduction of hTERT gene into normal somatic cells alone cannot cause malignant

transformation of cells.  

Telomerase activity of sensein hTERT-transfected SMCs was significantly increased as compared to

control SMCs. The mitotic index and cell growth curves suggested that SMC-hTERT had stronger higher

cellular growth and proliferation capabilities, as well as a lower incidence of apoptosis than SMC-EGFP

and SMC. This Our data shows that the sense hTERT gene transfection can make humanconfers SMCs

with have a telomerase activity, so that cell proliferation can beis enhanced and cell life-span can be

extended, which is of potential clinical value in the prevention and treatment of organic ED.

15

Heiko, 06/14/11,
Written as if this is a well-known fact. If this is the case, reviewers may wonder why you examined whether malignancies occurred.