Upload
denise-sheer
View
199
Download
0
Embed Size (px)
Citation preview
Neurological disorders arising from gene expression defects
Denise Sheer
Overview
1. Basic architecture of a gene 2. Basic organisa5on of chroma5n 3. Outline of gene expression 4. Muta5ons affec5ng different stages of gene expression
can cause severe neurological disorders
Transcription
Protein
Pre-mRNA Splicing
Translation
mRNA
DNA
Basic architecture of a gene
Exon 1 Exon 2 Exon 3
Intron 1 Intron 2 Transcription start site
Poly(A) addition site
Promoter Enhancer
3’ untranslated region TATA box
Splice signals
DNA methyla<on
AAGGGCACCCTTAGCACTAAGACGGATTTGTTCATTCCCATACTCCAGCTT
Methyl group
Chroma<n: DNA + histones
DNA
Nucleosomal fibre
Core histones
Linker histone
Essen%al Cell Biology, Alberts et al, 3rd Ed.
• 146 bp DNA is wrapped around the core of 4 histones • The histone core is compact and hidden, the tails are accessible • Histone tails have covalent post-‐transla5onal modifica5ons
that are crucial regulators of chroma5n accessibility and therefore of gene expression
Chroma<n: DNA + histones
Adapted from N.Tsankova, Nat Rev Neurosc 2007
Post-‐transla<onal modifica<ons of histone tails
S.R.Bhaumik et al, Nat Struct Mol Biol 2007
ac: acetyla5on me: methyla5on ph: phosphoryla5on ub1: ubiquityla5on S: serine K: lysine T: threonine R: arginine
Open and closed chroma<n
Adapted from N.Tsankova, Nat Rev Neurosc 2007
• Ac5ve enhancer (TF binding): H3K4me1
• Ac5ve promoter (TSS): H3K4me3
• Enhancers and promoters: H3K4me2, H3/H4ac, H2AZ
• Repressive promoter: H3K27me3
• Gene body: H3K36me3, H3K79me3
• Repressive mark: H3K9me3
Histone modifica<ons
Adapted from G.Natoli et al, Ann Rev Genet 2012
H3K4me1: mono-‐methyla5on of the lysine at posi5on 4 in Histone H3
Ac<ve promoters
Ac<ve promoters Ac<ve enhancers
Histone acetylation Key regulator of chromatin accessibility
Adapted from S.R.Bhaumik et al, Nat Struct Mol Biol 2007
Histone Deacetylases (HDACs)
Histone Acetyl
Transferases (HATs) CBP p300
Histone acetylation Key regulator of chromatin accessibility
The basic eukaryo<c transcrip<onal apparatus
Three broad classes of mul<-‐subunit ensembles • RNA polymerase II core complex and associated general transcrip5on factors (TFIIA, -‐B,-‐D,-‐E,-‐F, -‐H) • Mul5-‐subunit cofactors, e.g. ARC complex (ac5vator-‐recruited cofactor), CRSP (required for Sp1 ac5va5on) • Chroma5n modifying or remodelling complexes, e.g. SWI/SNF, BAF, PBAF
TAF, TATA-‐binding protein (TBP)-‐associa<ng factor
Lavine and Tjian Nature 2003
Adapted from C.T.Ong, Nat Rev Genet 2011
Enhancer and promoter elements
CTCF: CCCTC-‐binding factor CBP: CREB-‐binding protein LCR: Locus control region TATA: 5’-‐TATAAAA-‐3’ core DNA sequence TSS: Transcrip5on start site
Enhancer-‐promoter interac<ons
Adapted from C.T.Ong, Nat Rev Genet 2011
ARC: Ac5vity-‐Regulated Cytoskeleton-‐Associated gene CREB: cyclic AMP-‐responsive element binding protein CBP: CREB-‐binding protein eRNA: enhancer RNA mRNA: messenger RNA
• Binding of CBP occurs at ~12,000 enhancers that are pre-‐marked by H3K4me1 • CBP recruits RNAPII at a subset of these enhancers to transcribe enhancer RNA
CREB: cyclic AMP-‐responsive element binding protein
Lonze and Ginty. Neuron 2002
Cri5cal roles in the developing and mature nervous system
CREB regulation by neuronal signals
West et al, Nat Rev Neurosci 2002
Elevated intracellular calcium leads to the phosphoryla5on of CREB at Ser133 and Ser142
Coffin-Lowry syndrome (CLS) • X-linked syndrome characterized by severe
psychomotor and growth retardation, facial dysmorphism, digit abnormalities, and progressive skeletal changes.
• Female carriers show variable clinical features,
which can range from short stubby digits in a woman of normal facial appearance and intelligence to quite marked facial dysmorphism with moderate retardation.
• Incidence is 1:50,000 to 1:100,000. • The causal gene RSK2 contains 22 exons which
encode a protein of 740 amino acids. • Heterogenous loss-of-function mutations of RSK2
are detected in ~50% of patients referred for mutation screening.
• ~70–80% of cases are sporadic (new mutations).
P.M.Pereira et al, Eur J Hum Genet, 2010
Coffin-Lowry syndrome (CLS) Mutations in RSK2
HK Nishimoto et al, Am J Med Genet 2014
Coffin-Lowry syndrome (CLS) Role of RSK2
• Ribosomal S6 kinase 2
• Activated by MAPK
• Modulator of craniofacial development
• Expressed in embryonic cortical precursor cells and their neuronal and glial
progeny
• Essential for differentiation of cortical radial precursors into neurons
• Loss of function prevents neural differentiation, maintaining radial precursors as
proliferating cells
• Phosphorylates key transcription factors which are important for neural
differentiation, including CREB
• Mutated RSK2 cannot phosphorylate these factors
J Xing et al, Science 1996; CB Dugani et al, Dev Biol 2010; V Laugel-Haushalter et al, PLoS One 2014
• RTS (Broad thumb-hallux syndrome/Rubinstein-Taybi syndrome) is characterized by moderate to severe learning difficulties, short stature, distinctive facial features, and broad thumbs and first toes.
• Autosomal dominant • Incidence 1:125,000 • Patients have risk of developing non-
malignant and and malignant tumours, leukaemia, and lymphoma.
• Mutations in CBP gene • Mutations in EP300 gene, encoding the
E1A binding protein p300, in a small % of cases
Rubinstein-Taybi Syndrome
R.C.Hennekam, Eur J Hum Genet 2006
Domain structure & mutations in CBP/p300
LM Valor et al, Current Pharm Design 2013; G Negri et al, Clinical Gene%cs 2014
Proteins in 5 pa5ents with Rubinstein-‐Taybi syndrome
RNA transport
RNA splicing
RNA edi<ng
RNA Stability (ncRNAs)
RNA processing pathways
ARE, AU-‐rich element; Cap, 7-‐methylguanosine; CPE, cytoplasmic polyadenyla5on element; CPEB, cytoplasmic polyadenyla5on element-‐binding protein; EJC, exon junc5on complex; LE, localiza5on element; miRNA, microRNA; mRNPs, messenger RNA-‐containing RNPs; TLC, transla5on control element.
B.J. Blencowe, Cell 2006
Genera<on of different transcripts by alterna<ve splicing
The splicing pathway
Spliceosome: a large ribonucleoprotein (RNP) complex
Q.Li et al , Nat Rev Neurosci 2007
Alterna<ve splicing in mature neurons
• Regula5on of splicing by cell excita5on • Regula5on of splicing by calcium signalling pathways • Regula5on of presynap5c and postsynap5c ac5vi5es
Q.Li et al , Nat Rev Neurosci 2007
Splicing of APOER2 exon 19 regulates reelin-‐induced enhancement of LTP
NMDAR: N‑methyl-‐D-‐aspartate receptor subunit APOER2: apolipoprotein E receptor 2 PSD95: postsynap5c density protein 95
Splicing changes that affect postsynap<c ac<vity
Q.Li et al , Nat Rev Neurosci 2007
RNA splicing defects associated with neurological disorders
• Spinal muscular atrophy (SMA)
• Frontotemporal demen5a with Parkinsonism linked to chromosome 17 (FTDP-‐17)
• Myotonic dystrophy type 1 and 2 (DM1, DM2)
• Ref syndrome (RTT)
• Sporadic AD
• Lethal congenital contracture syndrome type 1 (LCCS1)
• Lethal arthrogryposis with anterior horn cell disease (LAAHD)
• Fragile X-‐associated tremor/ataxia syndrome (FXTAS)
• Paraneoplas5c opsoclonus-‐myoclonusataxia (POMA)
• Schizophrenia
• Spinocerebellar ataxia (SCA) types 1, 2, 8, 10 and 12
Anthony and Gallo, Brain Research 2010
• Leading gene5c cause of infant death • Autosomal recessive neurodegenera5ve
disease characterised by degenera5on of spinal cord motor neurons, atrophy of skeletal muscles, and generalised weakness.
• It is caused by homozygous disrup5on of
the survival motor neuron 1 (SMN1) gene by dele5on, rearrangement or muta5on.
• A highly homologous copy gene (SMN2) is
retained in almost all SMA pa5ents but fails to generate adequate levels of SMN protein due to its defec5ve splicing pafern which excludes exon 5 &/or exon 7.
Spinal muscular atrophy
Lunn and Wang, Lancet 2008
Repeat expansion diseases
• Proteins contain poly-‐amino acid tracts caused by expansion of a repeated microsatellite sequence
• At least 22 inherited neurological disorders • Disease mechanisms:
• Loss of func5on of the relevant protein • Gain of func5on of a protein containing a
polyglutamine tract expansion • Gain of func5on of a protein containing a polyanaline
tract expansion • Gain of func5on of RNA containing an expanded CUG
tract • RNAs containing repeat expansions are toxic
Examples of expanded repeats
3’ UTR 5’ UTR
SCA12 CAGn FMR1 CGGn FMR2 GCCn
Polyglutamine diseases Hun5ngton’s disease
SCA1,2,3,6,7,17 SBMA DRPLA
CAGn
Hun5ngton’s disease Myotonic dystrophy 1
SCA8
CUGn
Fuch’s corneal dystrophy CUGn Myotonic dystrophy 2 CCUGn
SCA10 AUUCUn SCA31 UGGAAn SCA36 GGCCUGn ALS/FTD GGGGCCn
Exon 1 Exon 2
Adapted from La Spada & Taylor, Nat Rev Genet 2010; and RI Richards et al, Fron%ers in Mol Neurosci 2013
The physical features of fragile X syndrome are subtle and may not be obvious. They can include a long, thin face, and prominent ears that ojen project away from the head, and a prominent forehead. The vast majority of cases of fragile X syndrome are caused by the expansion to over 200 copies of a CGG repeat in the 5’-‐untranslated region of FMR1 that shuts off transcrip5on of the gene.
Gene5c tes5ng for this repeat expansion is diagnos5c for this syndrome, and tes5ng is appropriate in all children with developmental delay, mental retarda5on or au5sm.
Fragile X syndrome is inherited from individuals, usually females, who typically carry an unstable premuta5on allele of the CGG-‐repeat tract in FMR1.
Fragile X syndrome is a common inherited form of mental retarda5on that can be associated with features of au5sm.
Fragile X syndrome
Premuta5on carriers are themselves at risk of premature ovarian failure and the fragile X-‐associated tremor/ataxia syndrome.
K.B.Garber et al, Eur J Hum Gen, 2008
FMRP as a protein and RNA transporter
Bagni and Greenough, Nat Rev Neurosci 2005
Protein and RNA binding domains of FMRP
E.Fernandez et al, Fron%ers in Neurosci 2013
E.Fernandez et al, Fron%ers in Neurosci 2013
FMRP mRNA targets associated with Au<sm spectrum disorders, Mood disorders and Schizophrenia
Deletions, duplications, and other mutations may arise at different places in a developmental lineage.
M.J.McConnell et al, Science 2013 Macosko, and McCarroll Science 2013
Please contact me if you have any ques%ons