Overlapping expression of Runx1(Cbfa2) and Runx2(Cbfa1) transcription factors supports cooperative...

JOURNAL OF CELLULAR PHYSIOLOGY 203:133–143 (2005)

Overlapping Expression of Runx1(Cbfa2) andRunx2(Cbfa1) Transcription Factors Supports

Cooperative Induction of Skeletal Development

NATHAN SMITH,1 YUFENG DONG,1 JANE B. LIAN,3 JITESH PRATAP,3 PAUL D. KINGSLEY,2

ANDRE J. VAN WIJNEN,3 JANET L. STEIN,3 EDWARD M. SCHWARZ,1 REGIS J. O’KEEFE,1

GARY S. STEIN,3 AND M. HICHAM DRISSI1*1The Center for Musculoskeletal Research, University of Rochester,

Rochester, New York2The Center for Stem Cell Research, University of Rochester, Rochester, New York

3Department of Cell Biology and Cancer Center, University of MassachusettsMedical School, Worcester, Massachusetts

Identifying the genetic pathways that regulate skeletal development is necessary to correct a variety of cartilage and boneabnormalities. TheRunx family of transcription factors play a fundamental role in organ development and cell differentiation. Initialstudies have shown that bothRunx1andRunx2 are expressed inpre-chondrogenicmesenchymeof thedeveloping embryo at E12.5.Abrogation of the Runx2 gene completely inhibits bone formation yet the cartilage anlagen in these mice is fully formed. In thepresent study, we hypothesized that Runx1 may compensate for the lack of Runx2 in vivo to induce the early stages of skeletalformation anddevelopment.Histologicb-gal stained sections using theRunx1þ/�-Lac-Zmice demonstrateRunx1promoter activityin pre-chondrocytic cell populations. In situ hybridization using Runx1 and Runx2 specific probes indicate that both factors areexpressed in mesenchymal stem cell progenitors during early embryonic development. During later stages of mouse skeletalformation, Runx1 is excluded from the hypertrophic cartilage while Runx2 is present in these matured chondrocyte populations.Quantification of Runx expression by real time RT-PCR andWestern blot analyses reveals that Runx1 and Runx2 are differentiallymodulated during embryogenesis suggesting a temporal role for each of these transcriptional regulators during skeletal formation.We provide evidence that haploinsufficiency results in normal appearing embryo skeletons of heterozygote Runx2 and Runx1mutant mouse models; however, a delay in bone formation was identified in the calvarium. In summary, our results support afunction for Runx1 and Runx2 during skeletal development with a possible role for Runx1 in mediating early events of endo-chondral and intramembranous bone formation, while Runx2 is a potent inducer of late stages of chondrocyte and osteoblastdifferentiation. J. Cell. Physiol. 203: 133–143, 2005. � 2004 Wiley-Liss, Inc.

Skeletal development requires mesenchymal cellcondensations to undergo patterning and differen-tiation. Migration of stem cells of mesodermal andneurodermal origin leads to their interaction andcondensation to provide the framework for skeletalelements. These genetically programmed patterningevents remain under the control of growth factors,morphogens, and transcription factors (Olsen et al.,2000; de Crombrugghe et al., 2004). While flat bones areformed through intramembranous ossification, longbones of the developing skeleton rise from endochondralbone formation (EBF) in which mesenchymal stem celldifferentiation leads to cartilaginous tissue develop-ment. This is followed by both appositional growth andendochondral maturation of chondrocytes to form agrowth plate. Cartilage matrix is then calcified for itsresorption by osteoclasts leading to vascular invasionand replacement of calcified cartilage with osteblastsand bone tissue.

Determining the transcriptional events that governskeletogenesis remains of paramount importance. Asmall family of transcription factors, Runx proteins,which are mammalian homologues of the Runt Droso-phila gene, phylogenetically contributes to organo-genesis in the developing embryo (Lutterbach et al.,2000; Kalev-Zylinska et al., 2002; Nam et al., 2002).Runx1(Cbfa2/AML1) is required for proper hemato-poiesis (Okuda et al., 1996; North et al., 1999), andRunx3(Cbfa3/AML2) has recently been established as

an anti-oncogene (Li et al., 2002), and an importantfactor for CNS development (Levanon et al., 2002).Runx2(Cbfa1/AML3) is required for bone formation andcartilage mineralization (Komori et al., 1997; Otto et al.,1997; Choi et al., 2001). However, recent reports indicateall three Runx genes can be present in different skeletalcompartments (Levanon et al., 2001a; Stricker et al.,2002; Lian et al., 2003; Yoshida et al., 2004).

Although the Runx members are encoded by differentgenes located on separate chromosomes, they shareseveral structural and functional characteristics. Asimilar exon/intron structure and transcriptional pat-tern is observed between Runx factors. Runx1, Runx2,and Runx3 genes all use alternative initiation, splicingand polyadenylation, generating multiple products withpotentially different functions (Miyoshi et al., 1991;Drissi et al., 2000; Levanon et al., 2001b). Each of thesegenes contains a distal exon that encodes for an

� 2004 WILEY-LISS, INC.

Nathan Smith and Yufeng Dong contributed equally to this work.

*Correspondence to: M. Hicham Drissi, Department of Orthope-dics, University of Rochester Medical Center, Rochester, NY14642. E-mail: Hicham_Drissi@urmc.rochester.edu

Received 2 June 2004; Accepted 20 July 2004

DOI: 10.1002/jcp.20210

extended isoform that is independently regulated by adistinct promoter region. Hence, all Runx genes containtwo transcription initiation sites under the control of twodistinct 50UTRs and a distal and a proximal promoter.Two N-termini result from these initiation sites andstart with very well conserved amino acid sequences(MASXS or MRIPV) among all three Runx proteins.Thus isoform transcription represent a potentiallyimportant regulatory step for Runx functions.

Molecular characterization of Runx2 has revealed acritical role for this gene in bone formation. The re-quirement of Runx2 for mineralized tissue developmentwas demonstrated in vivo by gene ablation experiments.Runx2 null mice, which die at birth, process a properlyordered cartilage anlagen, but lack bone tissue (Komoriet al., 1997; Otto et al., 1997). Other studies haverevealed, by in situ hybridization or using the Lac-Zreporter gene, that Runx2 is expressed in hypertrophicchondrocytes, osteogenic cell lineages and mesenchymalcell condensations during embryonic development(Ducy et al., 1997; Huang et al., 1997; D’Souza et al.,1999; Kim et al., 1999). Recently, several transgenicmice expressing Runx2 proteins under tissue specificpromoters have been described. Runx2 over-expressioninduced a lethal skeletal phenotype including dwarfismand precocious mineralization when targeted to carti-lage by the collagen type II promoter (Ueta et al., 2001).In normal embryos,Runx2 is expressed in mesenchymalcondensations and pre-figures development of theaxial and appendicular skeleton. The normal cartilageanlagen formation in absence of Runx2 indicates thatRunx2 may not be necessary for the onset of early stagesof chondrogenesis, yet it plays a crucial role in latestages of cartilage mineralization and bone formation(Komori et al., 1997; Otto et al., 1997; Kim et al., 1999;Choi et al., 2001).

Runx1/Cbfa2/AML1 was identified by cloning thet(8,21) chromosomal translocation site responsible foracute myeloid leukemia (Miyoshi et al., 1991). Runx1 ispre-dominantly expressed in T and B lymphocytes. Itsrole in mediating definitive hematopoiesis was estab-lished both in vitro and in vivo (Okuda et al., 1996; Wanget al., 1996; North et al., 1999, 2002; Tracey and Speck,2000; Speck, 2001). Runx1 deficient mice and theRunx1-Lac-Z knock-in mouse model die at E12.5 andE10.5, respectively, from hemorrhaging within thecentral nervous system and failure of hematopoiesis.The finding of Runx1 promoter activity in the Runx1-Lac-Zþ/� mouse restricted to osteoprogenitor tissuesincluding the calvarial sutures and periosteum andperichondrium postnatally, are suggestive of a key rolefor Runx1 in osteogenesis (Lian et al., 2003). However,the contribution of Runx1 in mediating developmentof non-hematopoietic tissues formed later duringembryogenesis, including the skeleton, remains to beevaluated.

We have previously shown by Lac-Z staining thatRunx1 is expressed in chondrogenic centers derivedfrom both the neural crest and the mesoderm (Lian et al.,2003). In the present study, we provide evidence forRunx1 and Runx2 overlap in mediating skeletal devel-opment in vivo. Our in situ hybridization studies showthat Runx1 and Runx2 are both expressed in mesench-ymal condensation that will later lead to skeletal units.Both Runx proteins are co-expressed by cartilageprimordia during early embryogenesis. This overlapremains in the cartilage until skeletal mineralization.Gene expression and protein levels of Runx1 and Runx2during embryonic development show a differential

regulation between these two factors suggesting a rolefor Runx1 during early mesenchymal stem cell commit-ment and cartilage formation, while Runx2 induces latestages of chondrogenesis and bone formation andmineralization.

MATERIALS AND METHODSAnimals

In this study, C57B/6 mice (Jackson Laboratories, BarHarbor, ME) were used for RNA and protein extractions whileCD-1; ICR mice (Charles River Laboratories, Wilmington, MA)were used for histological analyses and in situ hybridization.Mice were housed at the University or Rochester and theUniversity of Massachusetts animal facilities according to thestate and federal law requirements and experimental protocolsapproved by the University animal care committees. Embryoswere harvested daily from timed pregnant mothers. Timedpregnant mothers were sacrificed by cervical dislocation afterbeing anesthetized by CO2 asphyxiation. Whole embryos wereremoved from the mother and prepared for either RNA andprotein extractions, paraffin embedding, or whole embryoskeletal staining.

Histology

Whole embryos (from E13.5 to E17.5) were isolated and fixedovernight in freshly prepared 4% paraformaldehyde (Sigma,St. Louis, MO). Briefly, embryos were suspended in 10 ml of icecold in PBS–4% paraformaldehyde and mixed thoroughly byinversion. All embryos were fixed overnight at 48C beforewashing for 30 min in ice cold PBS. Samples were then placedin 5 ml of a 0.83% NaCl solution for 30 min at 48C before severalsuccessive incubations for 15 min at room temperature intothe following solutions: one time in equal volume saline:ethanol and twice in 70% ethanol. Finally, the embryos wereincubated successively in 85% ethanol, 95% ethanol, twice in100% ethanol, and twice in xylene for 30 min at 48C. Embryoswere subsequently embedded in paraffin and 3 mm sagitalsections cut as previously described for in situ hybridization(Ferguson et al., 2004). Whole embryo skeletons were preparedfor Alizarin red-Alcian blue staining to differentiate cartilageand bone tissue and assess skeletal development by standardprocedures (Lufkin et al., 1992).

Ex vivo osteoblast studies. Primary calvarial derivedosteoblasts were isolated from E17.5 wild-type (WT) andRunx2 DC homozygous mouse embryos (Choi et al., 2001).Calvarial tissue was digested with collagenase-trypsin aspreviously described (Choi et al., 2001). Cells at confluencywere harvested for RNA isolation.

In situ hybridization

Specific probes for Runx1 (kindly provided by Dr. Gronerand Dr. Levanon),Runx2 (kindly provided by Dr. Komori), andthe chondrocyte phenotypic genes Sox9, type II collagen, andtypeX collagen (kindly provided by Dr. Jill Helms) were used inthis study. One microgram of linearized antisense cRNA waslabeled for each probe, and sense probes used as negativecontrols. Transcription reactions were carried out for 2 h in thepresence of [33P] UTP (Amersham, Little Chalfont, UK) usingT3 or T7 polymerases at 378C. Radiolabled probes were thenincubated for 15 min with RNAse free DNase at 378C. Follow-ing the digestion, the labeled RNA was purified through aMicroSpin G-50 column (Amersham), and radioactivity countswere determined. One million counts per milliliter were usedfor each probe hybridization. Paraffin-embedded embryosagital sections were then dewaxed and covered with 500 mlof standard hybridization buffer as previously described(Zhang et al., 2002). Hybridization was carried out overnightat 558C. Non-specific probe hybridization was hydrolyzedusing 20 mg/ml Rnase A, and the slides were then washed at558C with 5� SSC/40 mM BME, 50% formamide/1� SSC/40 mM BME. Autoradiography was preformed using Kodak(Rochester, NY) and NTB-2 emulsion dipped slides were ex-posed for 5–14 days.

134 SMITH ET AL.

RNA extraction and real-time RT-PCR

Pregnant C57B/6 mice were sacrificed and embryos atE11.5, E13.5, E16.5, E18.5 and birth were collected and rinsedin DEPC-treated ice cold PBS. Embryos between 14.5 dpcand new born were eviscerated prior to their homogenization inTrizol reagent (Invitrogen, Carlsbad, CA) using the faxitronhomogenizer (Wheeling, IL). Total RNA was isolated fromwhole embryos using Trizol reagent according to the manu-facturer’s protocol, and 1 mg of total RNA was reversedtranscribed using advantage RT-for-PCR kit (Clontech, PaloAlto, CA) following the manufacturer’s protocol. Briefly, RNAwas denatured at 728C for 10 min then 200 U for MMLVreverse transcriptase enzyme were used in a final reaction of20 ml of cDNA. One microliter freshly reverse transcribedcNDA was used for real-time PCR using the fluorescent dyeSYBR Green I to monitor DNA synthesis (SYBR Green PCRMaster Mix, Applied Biosystems, Foster City, CA) usingspecific primers designed for Mice Runx1 MRIPV, Runx1MASDS, typeX collagen, type II collagen,AP, andOC as shownin Table 1.

The PCR was carried out using the RotorGene real-time DNA amplification system (Corbett Research, Sydney,Australia) using the following cycling protocol: a 958Cdenaturation step for 10 min followed by 45 cycles of 958Cdenaturation (20 sec), annealing (20 sec), and 608C extension(30 sec). Detection of the fluorescent product was carried out atthe end of the 608C extension period. Gene expression wasnormalized to the housekeeping gene b-actin. PCR productswere subjected to a melting curve analysis and the data wasanalyzed and quantified with the RotorGene analysis software.

Embryo nuclei isolation and protein extractions

Whole embryos were harvested as described above for RNAextraction. The eviscerated embryos were rinsed with ice coldPBS prior to their homogenization in a solution containing 2 Msucrose, 10 mM HEPES–KOH (pH 7.6), 2 M KCl, 0.5 M EDTA,and 10% glycerol in presence of a cocktail of antiproteases(Roche, Mannheim, Germany). Homogenized tissue was thensubjected to ultracentrifugation at 25,000 rpm for 1 h at 48Cusing Beckman ultraclear centrifugation tubes (Beckman,Palo Alto, CA) in a pre-chilled SW28 rotor. The supernatantwas discarded and nuclei pellets were used for nuclear proteinextraction as previously described (Drissi et al., 2002). Proteinaliquots were snap frozen and stored in �808C for furtherWestern blot analyses.

Western blot analysis

Protein concentrations of the nuclear extracts from wholeembryos were photometrically determined using the Commas-sie Plus Protein Assay kit (Pierce Chemical). Aliquots (30–50 mg) of protein exact were separated by SDS–10% PAGE andthen transferred to a PVDF transfer membrane (NEN LifeScience Products, Inc., Boston, MA). The blots were probedovernight at 48C with a Runx1 Rabbit polyclonal antibody(Oncogen, Boston, MA) at a 1:3,000 dilution, or a Runx2 rabbitmonclonal antibody at a 1:5,000 dilution kindly provided byDr. Yoshiaki Ito (Kyoto, Japan). Blots were further incubatedfor 1 h at 208C in the presence of a secondary antibody againstrabbit (Oncogen) at a dilution of 1:5,000. The immune com-plexes were detected via ECL (Amersham Pharmacia Biotech,Piscataway, NJ).

RESULTSRunx1 and Runx2 transcripts are co-expressed invarious mesenchymal condensations and skeletal

centers during embryonic development

Runx factors play key roles in organ development andcellular differentiation. Their similar gene organizationand DNA binding properties raise the possibility forredundancy of their activities in certain tissues. It is wellestablished that Runx2 is necessary for bone formationand cartilage terminal maturation. We performedskeletal analysis of the Runx1 Lac-Z mice in which b-galactosidase was inserted in the C-terminal part of theRunx1 gene locus (North et al., 1999). Frozen section ofwhole embryo showRunx1 is expressed in both the axialand appendicular skeleton with onset of skeletogenesis.At E 12.5, Runx1 is robustly expressed in the emergingcartilage anlagens and several mesenchymal conden-sations. By E 14.5 Runx1 expression is observed inthe perichondrium, periosteum (Fig. 1A) and in thesuture lines of the calvariae (Fig. 1B). These resultsindicate expression of Runx1 in early osteo-chondro-progenitor cells and suggest a role for Runx1 in mediat-ing initial events of skeletal formation independent ofRunx2.

In order to determine whether Runx1 and Runx2 mayexert cooperative anabolic effects on skeletal formation,we assessed their expression patterns in relation tophenotypic genes during the early stages of mouseembryonic development by in situ hybridization (Fig. 2).At E12.5 striking similarities in expressions of bothgenes are observed. The liver, which supports earlyhematopoiesis at this stage of development stands out asthe highest expressing tissue. The cartilage primordia,which will give rise to each vertebrae of the axialskeleton, the dorsal root ganglia as well as developingcraniofacial structures strongly express both genes.The Runx1 null mouse provided evidence for its criticalrole in definitive hematopioesis yet its early embryoniclethality renders the establishment of its potentialfunctions in other tissues impossible. Because the func-tion of Runx2 at this stage of development was notrevealed by Runx2 ablation in the mouse, the over-lapping expression of Runx1 with Runx2 suggests afunctional role in skeletal tissues.

To further address the functional relationship be-tween Runx1 and Runx2 at the onset of EBF, expressionpatterns between the two genes were examined inrelation to mRNA markers of EBF and the Runx genesat later stages of embryogenesis between E13.5 andE17.5 (Fig. 3). During embryonic development of theskeleton robust Sox9 and type II collagen expression isobserved in mesenchymal condensations (E13.5) andremain expressed throughout EBF. Type X collagenexpression starts at E14.5 corresponding to the onset ofcartilage maturation and remains strongly expressedat E16.5. After cartilage mineralization in the axial

TABLE 1. Specific primers used for RT-PCR

Genes Forward primer Reverse primer

Runx1 MASDS TGGGGGTAGAAAGAGACGTG TGAAGCACTGTGGATATGAAGGRunx1 MRIPV GTGATGCGTATCCCCGTAGA GCCAGGGTGGTCAGCTAGTARunx2 MASNS AAGTGCGGTGCAAACTTTCT TCTCGGTGGCTGGTAGTGARunx2 MRIPV TCCTGTAGATCCGAGCACCA CTGCTGCTGTTGTTGCTGTTCollagen II ACTGGTAAGTGGGGCAAGAC CCACACCAAATTCCTGTTCAAlk. Phos. TGACCTTCTCTCCTCCATCC CTTCCTGGGAGTCTCATCCTCollagen X CTTTGTGTGCCTTTCAATCG GTGAGGTACAGCCTACCAGTTTTOsteocalcin TGCTTGTGACGAGCTATCAG GAGGACAGGGAGGATCAAGT

Runx EXPRESSION DURING EMBRYONIC DEVELOPMENT IN MOUSE 135

skeleton between E16.5 and E17.5 type X collagenmRNA become less prominent. Both Runx transcriptsare present throughout embryonic development be-tween E13.5 and E17.5 in several skeletal and softtissues. As expected, Runx1 expression pattern in thefetal liver is prominent at E14.5 and E15.5 to be laterdown-regulated after definitive hemtopoiesis is estab-lished. Strong Runx1 expression is also observed in thethymus and spleen consistent with Runx1 role inhematopiesis. Runx1 expression is robust in dorsal rootganglia and mesenchymal condensations leading to riband vertebrae formation up to E14.5. By E15.5 Runx1expression in the developing ribs and vertebrae isincreased. This result mimics the expression patternobserved by b-galactosidase activity in the Runx1heterozygous mouse sections shown in Figure 1. Runx2

is also strongly expressed in mesenchymal condensa-tions forming the axial and appendicular skeleton andcontinues to increased through E17.5. Thus, Figure 3illustrates a temporal increase in Runx2 that parallelsthe increase in type X collagen reflecting the onset ofcartilage maturation and bone formation. The expres-sion of Runx1 and Runx2 at early embryonic stagescoincides with initial cartilage formation reflected bySox9 and type II collagen mRNA expression.

A key point in development where Runx1 and Runx2become selectively expressed in different tissues occursat E15.5, the onset of initial ossification for maturecartilage primordia.Runx1 is expressed in the perichon-drial surface as well as in the chondrogenic cell popu-lation that expresses type II collagen. This Runx1expression was totally excluded from the hypertophiczone of the ribs. However,Runx2expression is prominentin both the perichondrial surface and in the hyper-trophic zone of the ribs and vertebrae that express thelate marker of chondrocyte hypertrophy, type X collagen(Fig. 4A). At E17.5, a higher representation of miner-alized skeletal elements occurs in the embryo. Runx1 ishighly expressed in the neural tissue located betweenthe vertebral bodies, and weak expression is observed inthe periosteum. In contrast Runx2 is strongly expressedwithin the vertebral body and the periosteum of themineralized axial skeleton (Fig. 4B). Therefore, ourresults clearly demonstrate an overlap between Runx1andRunx2 in mesenchymal condensations and cartilageprimordia during early embryogenesis, but more selec-tive expression of the Runx genes with the onset of boneformation. These findings suggest that putative Runxfunctions in early development of the skeleton are notcompromised in the Runx2 null mouse potentially as aresult of overlapping Runx1 expression.

Runx1 and Runx2 are differentially regulatedduring embryonic development

To gain more insight into the quantitative relation-ship between Runx1 and Runx2 suggested by the insitu distribution studies we assessed their expressionlevels in the skeleton using RNA extracted from wholeeviscerated embryos as described in the materials andmethods section to selectively evaluate the skeletallevels of the Runx factors. More importantly ouranalysis included specific isoform expression as it hasbeen suggested that isoforms contribute to develop-mental regulation of targeted genes (Fagenholz et al.,2001; McAlinden et al., 2004). We examined quantita-tive differences in expression by real time PCR of thecharacterized principal isoforms of Runx1 and Runx2(Fig. 5). Chondrocyte (type II and type X collagen) andosteoblast (alkaline phosphatase and osteocalcin) phe-notypic genes were concomitantly assessed using spe-cific primers for each gene.

While the MASDS isoform of Runx1 is up-regulatedbetween E11.5 and E14.5, this isoform begins to decreasethereafter. Levels between E16.5 and E18.5 are approxi-mately 30% lower. In contrast, the MRIPV isoform ofRunx1 is significantly and continuously up-regulatedthroughout embryonic development. Total expressionof both isoforms of Runx1 tends to lead towards anincremental increase during embryonic development.This differential regulation of the two Runx1 isoformsis also observed with Runx2 (Fig. 5A). The MASNSisoform is dramatically up-regulated (by at least ten-fold) between E11.5 and E13.5. Its levels continue toincrease to E18.5 at which point levels are 30-foldgrater than at E11.5. This fold change is strikingly far

Fig. 1. Runx 1 activity in mesenchymal condensations of 12.5 dpcmouse embryos. Frozen sections of LacZ positive (A) E12.5 embryosfollowed by X-gal staining for detection of Runx1 expression. X-Galstaining of Runx1 heterozygote mice carrying the LacZ knock in isobserved in mesenchymal condensations leading skeletal unit forma-tion including the sclerotome (arrow) and neurodermal ganglia(arrowhead). B: Calvarium of new born Runx1 Lac-Z heterozygotemouse stained for b-galactosidase activity.

136 SMITH ET AL.

greater than the overall fold change observed forRunx1.On the other hand, Runx2 MRIPV levels are muchlower (1.5-fold) and down-regulated by twofold betweenE14.5 and E18.5. Total expression of both isoforms ofRunx2 increase by approximately 17-fold between

E11.5 and E18.5 (Fig. 5B). Taken together these re-sults demonstrate that the bone related MASNS iso-form of Runx2 is the most significantly regulated basedon the fold induction and exhibits the greatest modifica-tion in expression during development. Interestingly,

Fig. 2. Runx1 is expressed in early mesenchymal condensationsleading to formation of the axial skeleton: in situ hybridization usingthe Runx1 probe on a midsagittal section of mouse embryo (A) Runx1,(B) Runx2, (C) Sox 9, and (D) Col 2, probes to whole mount sections of12.5 dpc embryos. The bright field of each section is on the left and the

dark field is on the right. The dark field images show robust Runx1expression in the somites and in mesenchymal skeletal progenitors.Expression is also observed in non-skeletal tissues such the liverand brain.

Fig. 3. Runx 1 expression throughout mouse embryonic developmentby in situ hybridization. In situ hybridization of the mouse Sox 9, typeII collagen (Col 2), type X collagen (Col X), Runx 1, and Runx 2 probesto whole mount sections of 13.5 through 17.5 dpc mouse embryos. Thebright field images are on the left and the dark fields are on the right.The dark field images of Sox 9 show expression in the upper and lowervertebral column and the sternum. The dark field images of Col 2 show

expression in the upper and lower vertebral column and also thesternum, but Col 2 expression is diminished at E17.5. The dark fieldimages of Col X show expression at E14.5 through E17.5 in the upperand lower vertebral column. There is no expression at 13.5 for Col X.The dark field images for both Runx 1 and Runx 2 show expression inthe upper and lower vertebral column with Runx 1 expressiondiminishing at E17.5.

Runx EXPRESSION DURING EMBRYONIC DEVELOPMENT IN MOUSE 137

although at lower levels, the Runx1 MRIPV isoform isalso up-regulated during skeletal maturation fromE11.5 to E18.5. This reciprocal regulation of Runxisoforms aims to sustain steady levels of Runx proteinsto selectively regulate the different steps of skeletalformation.

The expression pattern of the MASDS isoform ofRunx1 follows that of the early chondrocyte phenotypicgene type II collagen while the expression of the Runx2MASNS isoform follows that of the ostecalcin and typeX collagen (Fig. 5C). These findings also suggest apotential role for Runx1 in early skeletal formation,while Runx2 mediates later stages of cartilage and boneformation.

We further addressed whether the regulation of Runxtranscripts is also linked to changes in cellular levels ofRunx proteins. Figure 6 shows that the Runx1 proteinlevels are up-regulated by eightfold from E11.5 to E15.5during embryonic development. The subsequent down-regulation of Runx1 in the new born embryo reflects itsrestrictive expression in the perichondrium and perios-teum during late stages of embryonic development.The highest level of Runx1 which is observed at E15.5correlates with the development of the axial skeletalunits expressing high levels of Runx1 by in situ hybri-dization. Similarly, the peak levels of Runx2 at E17.5coincides with the marked up-regulation of Runx2transcript in the mineralized vertebral bodies in vivo.

Fig. 4. Runx1 is expressed in mesenchymal condensations andvarious skeletal elements of the axial skeleton. A: In situ hybridiza-tion of the mouse Runx 1, Runx 2, type II collagen (Col 2), and type Xcollagen (Col X) probes to whole mount sections of 15.5 dpc mouseembryos. a, d, g, and J are dark field images at 1� magnification. b, c,e, f, h, i, k, and l are bright and dark field images at 4� magnifica-tion. Dark field image (a) shows expression of Runx 1 in the pre-hypertrophic zone of the rib. Dark field image (d) shows expression ofRunx 2 in the pre-hypertrophic zone and hypertropic zone of the rib.Dark field image (g) shows expression of Col 2 in the pre-hypertrophiczone of the rib. Dark field image (j) shows expression of Col 10 in the

hypertrophic zone of the rib. B: In situ hybridization of the mouseRunx 1, Runx 2, osteocalcin (OC), and type X collagen (Col X) probes towhole mount sections of 17.5 dpc mouse embryos. d, g, and j are darkfield images at 1� magnification. b, c, e, f, h, i, k, and l are bright anddark field images at 4� magnification. Dark field image (a) showsexpression of Runx 1 in the pre-hypertrophic zone of the vertebrae.Dark field image (d) shows expression of Col X in the pre-hypertrophiczone of the vertebrae. Dark field image (g) shows expression of Runx 2in the pre-hypertrophic and hypertrophic zone of the vertebrae. Darkfield image (j) shows expression of OC in the hypertrophic zone of thevertebrae.

138 SMITH ET AL.

In conclusion, the parallel relationship between Runxpromoter activity, mRNA levels and protein suggeststhat transcriptional control is a pre-dominant mechan-ism that is operative during development. Our resultsalso show that Runx1 proteins are expressed earlier,and its regulation is biphasic, while Runx2 protein levelsare first detected during later stages and remain up-regulated during embryonic development. Thus, thesefindings further support a model in which Runx1 may berelated to early skeletal development while Runx2is responsible for late stages of bone and cartilageformation.

Runx1 and Runx2 haploinsufficiency result in adelay of intramembranous bone formation

As both Runx1 and Runx2 are co expressed in earlymesenchymal condensation that provide a templatefor intramembranous and EBF (Fig. 2), their spatialexpression may determine possible overlapping func-tions in skeletal tissues, yet this hypothesis has not beenexamined. We investigated the contribution of Runxfactors to endochondral and intramembranous boneformation by comparing the Runx1 and Runx2 mutantmice which lack their C-terminal functional domains.

While the Runx2 DC homozygous mice die prior to birthat E18.5 due to absence of bone formation, the Runx2DCheterozygous mice at this age have a normal miner-alized skeleton formed through endochondral bone(Choi et al., 2001). However, upon closer examinationof the calvariae, Runx2 heterozygous mice display awider spacing between the parietal bones and less densesupra occipital bones of the calvarium, indicated byincreased areas of Alcian blue staining and by soft X-ray,compared to the WT mice (Fig. 7A), E18.5. Less densityis also observed in the jab bone of the Runx2DCþ/�. Thisresult suggests that haploinsufficiency of Runx2 affectsintramembranous bone formation implicating a majorrole for Runx2 in maturation of the calvarium. TheRunx1þ/� mouse shows an overall decreased in bonedensity and delay in formation of occipital bone com-pared to WT littermates. This haploinsufficiency ofRunx1 reveals a contribution of this Runx2 factor tointramembranousbone formation, consistentwithendo-genous expression ex vivo of Runx1 in osteoprogenitors(Fig. 2) and early stages of osteoblast differentiation(Lian et al., 2004).

Taken together, these findings identify a gene doserequirement for Runx factors during development of

Fig. 4. (Continued)

Runx EXPRESSION DURING EMBRYONIC DEVELOPMENT IN MOUSE 139

intramembranous bone tissue. Runx1 may promoteearly osteoprogenitor cell differentiation, while Runx2promotes maturation of the cells to form a mineralizedskeleton.

DISCUSSION

Each of the Runx family members have been shown inmouse models to have specific roles in organogenesis

Fig. 5. Expression of Runx factors and maturational markers inmouse embryos. A: Total RNA was extracted from C57/B6 embryos atthe indicated days of mouse gestation from 11.5 dpc to E18.5. mRNAlevels for both isoforms of Runx1 MASDS (part A), and MRIPV (partB), Runx2 MASNS (part D) and MRIPV (part E). Total levels of Runxisoforms are also represented (parts C, F). B: Chondrocyte phenotypic

genes, type II collagen (part A), alkaline phosphatase (part B), type Xcollagen (part C), and osteclacin (part D), were measured by real-timeRT-PCR. Relative values are standardized to b-actin and valuesnormalized to the first sample (E11.5) arbitrarily set as 1. Valuesrepresent means of three independent experiments�SD.

140 SMITH ET AL.

(Wang et al., 1996; Komori et al., 1997; Otto et al., 1997;North et al., 1999; Choi et al., 2001; Levanon et al., 2002;Li et al., 2002) yet several recent findings raise thepossibility for overlapping activities between thesefactors in tissues where they are co expressed (Levanonet al., 2001a). Stricker et al. showed that in the develop-ing skeleton both Runx2 and Runx3 are co-expressed incartilaginous condensations suggesting a cooperativerole in early chondrocyte differentiation (Stricker et al.,2002). Levanon et al. reported overlapping expression ofRunx1 and Runx3 in the hematopoietic system whiletheir expression in bone tissue is found in distinctcompartments suggesting non-redundant functions ofthese two factors during embryogenesis (Levanon et al.,2001a). The present study focussed on understandingthe temporal, spatial, and functional activities of Runx1and Runx2 during skeletal formation. Our key findingsare that (1) in mesenchymal condensations and cartilageprimordia, Runx1 and Runx2 are co-expressed; (2) asbone tissue is formed Runx1 and Runx2 expression

becomes more compartmentalized with Runx1 pre-dominating in chondro-osteoprogenitor tissues andRunx2 in the mineralized bone; (3) both Runx1 andRunx2 isoformsare regulated at specific stages of skeletaldevelopment during embryogenesis. Finally, we showthat while haploinsufficiency of Runx1 or Runx2 doesnot compromise EBF, there is a mild delay in intramem-branous bone formation. This observation suggeststhat the overlap in expression of Runx1 and Runx2 inthe skeleton during early embryogenesis may haveredundant functions, contributing to the integrity ofskeletogenesis.

The Runx gene family shares several common func-tional domains for providing compensatory control andgene regulation, yet it is endowed with proprieties forunique tissue specific activities for regulating geneexpression. A phylogenetically conserved DNA bind-ing domain of about 128 amino-acids called the runthomology domain (RHD) is highly conserved in theseproteins from Drosophila to humans. The RHD re-cognizes the same consensus sequence 50YGYGGT30

(Westendorf and Hiebert, 1999) and requires Cbfbpartner for DNA binding. Other functional domainsthat mediate enhancement or repression of theiractivities involve protein–protein interactions with co-regulatory factors (Lian et al., 2004). Runx factors aretargeted to the nucleus through an independent nuclearlocalization signal ‘‘NLS’’ to become nuclear matrixassociated, by a Runx-unique nuclear matrix-targetingsignal that directs them to the same subnucleardomains. These common features, as well as in vitrostudies on different promoters suggest that the Runxgenes have shared transcriptional activity (Javed et al.,2001; Zaidi et al., 2001; Harrington et al., 2002). A higherlevel of complexity to transcriptional regulation invol-ving Runx proteins during skeletal development is thatboth factors serve as scaffolding proteins (Harringtonet al., 2002) that engage in multiple options of protein/protein interactions along with their DNA bindingability (Zaidi et al., 2002, 2004; Lian et al., 2004).Furthermore, these factors acting as both positive andnegative regulators (Javed et al., 1999, 2000; Drissiet al., 2000), their presence makes them essential forinitiation of multiple steps of skeletal development.Finally, Runx family members carry canonical bindingmotifs for their own proteins within their respectivepromoter regions suggesting auto-regulatory but alsopositive and negative cross-regulatory effects betweenthem during development. Taken together, these obser-vations raise the possibility for pleiotropic functions ofRunx family members that extend beyond their firstdescribed roles in a tissue-related manner. Importantly,the findings of this study indicate a cooperative functionof Runx1 and Runx2 for early development of theskeleton.

Further along in bone development (E17.5) theRunx2transcript persists in the axial skeleton, while Runx1expression is down-regulated and localized to the per-iosteum and intervertebral neuronal ganglia. Thuswhile all Runx factors are initially co-expressed in earlydevelopmental structures, their segregation into speci-fic developing organs reflects unique functions.

We find regulated activity of Runx1 and Runx2 atspecific stages of phenotypic establishment of skeletalcompartments. Runx1 message and protein is inducedprior to the expression of the bone related Runx2 isoform(MASNS). Our studies clearly define an abundant andsignificant up-regulation of this isoform at two criticalstages of endochondral ossification, the formation of the

Fig. 6. Expression of Runx proteins follows that of their respectivetranscripts during mouse embryonic development. Western blotanalysis of Runx1 expression in nuclear extracts from whole embryosbetween E11.5 and birth (NB). b-Actin and a-tubulin specific antibodywas used to standardize for equal protein loading (A). Densitometricanalysis of Runx1 protein levels (B) and Runx2 (C) is also represented.

Runx EXPRESSION DURING EMBRYONIC DEVELOPMENT IN MOUSE 141

hypertrophic cartilage (E15.5) and the mineralization ofthe skeleton (E17.5). This finding during embryonicdevelopment is consistent with numerous studies thathave demonstrated regulated induction of Runx2 inex vivo models of cartilage calcification and osteoblastdifferentiation (Komori, 2002; Otto et al., 2003; Yanget al., 2003). Our results also reveal that in the Runx2heterozygote formation of mineralized bone is sensitiveto dosage levels of Runx2 as we now show delayedcraniofacial bone mineralization. The recent observa-tion that specific ablation of the MASNS isoform ofRunx2 did not result in a phenotype that included anabsence of mineralized bone formation (Xiao et al., 2004)indicates that sufficient Runx protein levels are avail-able for formation of the skeleton in their model. Oneexplanation is that the other MRIPV isoform of Runx2is sufficient to compensate for the MASNS isoformdeficiency, but more interestingly presence of Runx1and Runx3 may also be contributing to normal skeletalformation (Yoshida et al., 2004). The phenotypes ofthe Runx1 and Runx2 heterozygotes strongly supportcompensatory roles for Runx factors in early skeletaldevelopment where both essential genes have overlap-ping expression. The Runx2 null mouse develops anormal cartilage anlagen and while the Runx2 hete-rogygote mouse exhibits some bone abnormalities(missing clavicles, delayed intramembranous boneformation), the Runx1 heterozygote mice develop an ap-parently normal skeleton, except for a mild delay incalvarial bone density.

The biological relevance of Runx family membersco-expression in early mesenchymal progenitors shouldbe considered. In our study, Runx1 and Runx2 tran-scripts are both expressed in mesenchymal conden-sations at E13.5 which will lead to skeletal elements.As all Runx factors are essential to organogenesis, theexpression at such early stages may reflect a require-ment for Runx factors in specification of distinct skeletal

elements at later stages. Another possible explanation isto ensure that the pluripotent mesenchymal cellscommit to a specific phenotype at the appropriate timein development. Strong expression is observed in severalregions of cartilage primordia including the carti-laginous primordium of the ribs and Meckel’s hyalincartilage. Strong Runx1 expression is observed in thelower lumbar dorsal and cephalic root ganglia whereRunx2 is also expressed at lower levels. These gangliawill later develop into both neuronal and cartilaginoustissues. Co-expression, therefore, of Runx1 and Runx2in cartilaginous structures may aim to sustain maximallevels at the same stage of phenotypic developmentstarting with mesenchymal stem cell condensation. Thisco-expression leads to initiation of establishment of theskeleton at specific sites.

ACKNOWLEDGMENTS

The authors thank Dr. Yoram Groner and Dr. DitsaLevanon for providing the Runx1 in situ probe, Dr.Yoshiaki Ito for giving us the Runx2 monoclonal anti-body, Dr. Jill Helms for providing the chondrocytemarker’s in situ probe and Dr. Toshihisa Komori for theRunx2 in situ probe. The authors are also grateful toDr. Laura Calvi and Dr. Cristin Ferguson as well asRuth Belflower, Barbara Stroyer, and Krista Canary fortheir technical help and stimulating discussions.

LITERATURE CITED

Choi JY, Pratap J, Javed A, Zaidi SK, Xing LP, Balint E, Dalamangas S, Boyce B,Van Wijnen AJ, Lian JB, Stein JL, Jones SN, Stein GS. 2001. Subnucleartargeting of Runx/Cbfa/AML factors is essential for tissue-specific differentia-tion during embryonic development. Proc Natl Acad Sci USA 98:8650–8655.

D’Souza RN, Aberg T, Gaikwad J, Cavender A, Owen M, Karsenty G, Thesleff I.1999. Cbfa1 is required for epithelial–mesenchymal interactions regulatingtooth development in mice. Development 126:2911–2920.

de Crombrugghe B, Lefebvre V, Nakashima K. 2001. Regulatory mechanisms in thepathways of cartilage and bone formation. Curr Opin Cell Biol 13(6):721–727.

Drissi H, Luc Q, Shakoori R, Chuva De Sousa LS, Choi JY, Terry A, Hu M, JonesS, Neil JC, Lian JB, Stein JL, Van Wijnen AJ, Stein GS. 2000. Transcriptional

Fig. 7. Delay in intramembranous bone formation in Runx2DCþ/�

and Runx1þ/� mice. Calvaria were isolated (A) from E18.5 wild-type(Wt) and heterozygous littermates from Runx2DC; (B) and from Wtand Runx1þ/� mice. Upper parts show Alizarin red (bone) and Alcianblue (cartilage) stained heads and lower part shows soft X-ray analysis

(Faxitron, Wheeling, IL). In (A) less bone mineral is observed in theparietal and occipital calvarial bones and the jaw bone. In (B) lessbone density is observed in the parietal and occipital regions of theheterozygote compared to WT littermates. Arrow indicates parietalbone, * shows jaw bone, and O designates the occipital bones.

142 SMITH ET AL.

autoregulation of the bone related CBFA1/RUNX2 gene. J Cell Physiol 184:341–350.

Drissi H, Pouliot A, Koolloos C, Stein JL, Lian JB, Stein GS, Van Wijnen AJ.2002. 1,25-(OH)2-vitamin D3 suppresses the bone-related Runx2/Cbfa1 genepromoter. Exp Cell Res 274:323–333.

Ducy P, Zhang R, Geoffroy V, Ridall AL, Karsenty G. 1997. Osf2/Cbfa1: Atranscriptional activator of osteoblast differentiation. Cell 89:747–754.

Fagenholz PJ, Warren SM, Greenwald JA, Bouletreau PJ, Spector JA, CriseraFE, Longaker MT. 2001. Osteoblast gene expression is differentially regulatedby TGF-beta isoforms. J Craniofac Surg 12:183–190.

Ferguson CM, Schwarz EM, Puzas JE, Zuscik MJ, Drissi H, O’Keefe RJ. 2004.Transforming growth factor-beta1 induced alteration of skeletal morphogen-esis in vivo. J Orthop Res 22:687–696.

Harrington KS, Javed A, Drissi H, McNeil S, Lian JB, Stein JL, Van Wijnen AJ,Wang YL, Stein GS. 2002. Transcription factors RUNX1/AML1 and RUNX2/Cbfa1 dynamically associate with stationary subnuclear domains. J Cell Sci115:4167–4176.

Huang LF, Fukai N, Selby PB, Olsen BR, Mundlos S. 1997. Mouse claviculardevelopment: Analysis of wild-type and cleidocranial dysplasia mutant mice.Dev Dyn 210:33–40.

Javed A, Gutierrez S, Montecino M, Van Wijnen AJ, Stein JL, Stein GS, Lian JB.1999. Multiple Cbfa/AML sites in the rat osteocalcin promoter are required forbasal and vitamin D-responsive transcription and contribute to chromatinorganization. Mol Cell Biol 19:7491–7500.

Javed A, Guo B, Hiebert S, Choi JY, Green J, Zhao SC, Osborne MA, Stifani S,Stein JL, Lian JB, Van Wijnen AJ, Stein GS. 2000. Groucho/TLE/R-espproteins associate with the nuclear matrix and repress RUNX (CBF(alpha)/AML/PEBP2(alpha)) dependent activation of tissue-specific gene transcription.J Cell Sci 113(Pt 12):2221–2231.

Javed A, Barnes GL, Jasanya BO, Stein JL, Gerstenfeld L, Lian JB, Stein GS.2001. Runt homology domain transcription factors (Runx, Cbfa, and AML)mediate repression of the bone sialoprotein promoter: Evidence for promotercontext-dependent activity of Cbfa proteins. Mol Cell Biol 21:2891–2905.

Kalev-Zylinska ML, Horsfield JA, Flores MV, Postlethwait JH, Vitas MR, BaasAM, Crosier PS, Crosier KE. 2002. Runx1 is required for zebrafish blood andvessel development and expression of a human RUNX1-CBF2T1 transgeneadvances a model for studies of leukemogenesis. Development 129:2015–2030.

Kim IS, Otto F, Zabel B, Mundlos S. 1999. Regulation of chondrocyte differen-tiation by Cbfa1. Mech Dev 80:159–170.

Komori T. 2002. Runx2: A multifunctional transcription factor in skeletaldevelopment. J Cell Biochem 87:1–8.

Komori T, Yagi H, Nomura S, Yamaguchi A, Sasaki K, Deguchi K, Shimuzu Y,Bronson RT, Gao YH, Inada M, Sato M, Okamoto R, Kitamura Y, Yoshiki S,Kishimoto T. 1997. Targeted disruption of Cbfa1 results in a complete lack ofbone formation owing to maturational arrest of osteoblasts. Cell 89:755–764.

Levanon D, Brenner O, Negreanu V, Bettoun D, Woolf E, Eilam R, Lotem J, GatU, Otto F, Speck N, Groner Y. 2001a. Spatial and temporal expression patternof Runx3 (Aml2) and Runx1 (Aml1) indicates non-redundant functions duringmouse embryogenesis. Mech Dev 109:413–417.

Levanon D, Glusman G, Bangsow T, Ben Asher E, Male DA, Avidan N, BangsowC, Hattori M, Taylor TD, Taudien S, Blechschmidt K, Shimizu N, Rosenthal A,Sakaki Y, Lancet D, Groner Y. 2001b. Architecture and anatomy of the genomiclocus encoding the human leukemia-associated transcription factor RUNX1/AML1. Gene 262:23–33.

Levanon D, Bettoun D, Harris-Cerruti C, Woolf E, Negreanu V, Eilam R,Bernstein Y, Goldenberg D, Xiao C, Fliegauf M, Kremer E, Otto F, Brenner O,Lev-Tov A, Groner Y. 2002. The Runx3 transcription factor regulates develop-ment and survival of TrkC dorsal root ganglia neurons. EMBO J 21:3454–3463.

Li QL, To K, Akakura C, Fukamachi H, Inoue K, Chi XZ, Lee KY, Nomura S, LeeCW, Han SB, Kim HM, Kim WJ, Yamamoto H, Yamashita N, Ano T, Ikeda T,Itohara S, Inazawa J, Abe T, Hagiwara A, Yamagishi H, Ooe A, Kaneda A,Sugimura T, Ushijima T, Bae SC, Ito Y. 2002. Causal relationship between theloss of RUNX3 expression and gastric cancer. Cell 109(1):113–124.

Lian JB, Stein JL, Stein GS, Van Wijnen AJ, Montecino M, Javed A, Gutierrez S,Shen J, Zaidi SK, Drissi H. 2003. Runx2/Cbfa1 functions: Diverse regulation ofgene transcription by chromatin remodeling and co-regulatory proteininteractions. Connect Tissue Res 44(Suppl 1):141–148.

Lian JB, Javed A, Zaidi SK, Lengner C, Montecino M, Van Wijnen AJ, Stein JL,Stein GS. 2004. Regulatory controls for osteoblast growth and differentiation:Role of Runx/Cbfa/AML factors. Crit Rev Eukaryot Gene Expr 14:1–41.

Lufkin T, Mark M, Hart CP, Dolle P, LeMeur M, Chambon P. 1992. Homeotictransformation of the occipital bones of the skull by ectopic expression of ahomeobox gene. Nature 359:835–841.

Lutterbach B, Westendorf JJ, Linggi B, Isaac S, Seto E, Hiebert SW. 2000. Amechanism of repression by acute myeloid leukemia-1, the target of multiplechromosomal translocations in acute leukemia. J Biol Chem 275:651–656.

McAlinden A, Havlioglu N, Sandell LJ. 2004. Regulation of protein diversity byalternative pre-mRNA splicing with specific focus on chondrogenesis. BirthDefects Res Part C Embryo Today 72:51–68.

Miyoshi H, Shimizu K, Kozu T, Maseki N, Kaneko Y, Ohki M. 1991. T(8–21)breakpoints on chromosome-21 in acute myeloid-leukemia are clustered withina limited region of a single gene, Aml1. Proc Natl Acad Sci USA 88:10431–10434.

Nam S, Jin YH, Li QL, Lee KY, Jeong GB, Ito Y, Lee J, Bae SC. 2002. Expressionpattern, regulation, and biological role of runt domain transcription factor, run,in Caenorhabditis elegans. Mol Cell Biol 22:547–554.

North T, Gu TL, Stacy T, Wang Q, Howard L, Binder M, Marin-Padilla M, SpeckNA. 1999. Cbfa2 is required for the formation of intra-aortic hematopoieticclusters. Development 126:2563–2575.

North TE, de Bruijn MF, Stacy T, Talebian L, Lind E, Robin C, Binder M,Dzierzak E, Speck NA. 2002. Runx1 expression marks long-term repopulatinghematopoietic stem cells in the midgestation mouse embryo. Immunity 16:661–672.

Okuda T, vanDeursen J, Hiebert SW, Grosveld G, Downing JR. 1996. Geneticanalysis of AML-1 function in normal and leukemic hematopoiesis. Blood 88:1148.

Olsen BR, Reginato AM, Wang W. 2000. Bone development. Annu Rev Cell DevBiol 16:191–220.

Otto F, Thornell AP, Crompton T, Denzel A, Gilmour KC, Rosewell IR, StampGW, Beddington RS, Mundlos S, Olsen BR, Selby PB, Owen MJ. 1997. Cbfa1, acandidate gene for cleidocranial dysplasia syndrome, is essential for osteoblastdifferentiation and bone development. Cell 89(5):765–771.

Otto F, Lubbert M, Stock M. 2003. Upstream and downstream targets of RUNXproteins. J Cell Biochem 89:9–18.

Speck NA. 2001. Core binding factor and its role in normal hematopoieticdevelopment. Curr Opin Hematol 8:192–196.

Stricker S, Fundele R, Vortkamp A, Mundlos S. 2002. Role of Runx genes inchondrocyte differentiation. Dev Biol 245:95–108.

Tracey WD, Speck NA. 2000. Potential roles for RUNX1 and its orthologs indetermining hematopoietic cell fate. Semin Cell Dev Biol 11:337–342.

Ueta C, Iwamoto M, Kanatani N, Yoshida C, Liu Y, Enomoto-Iwamoto M,Ohmori T, Enomoto H, Nakata K, Takada K, Kurisu K, Komori T. 2001.Skeletal malformations caused by overexpression of Cbfa1 or its dominantnegative form in chondrocytes. J Cell Biol 153(1):87–100.

Wang Q, Stacy T, Binder M, Marin-Padilla M, Sharpe AH, Speck NA. 1996.Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the centralnervous system and blocks definitive hematopoiesis. Proc Natl Acad Sci USA93:3444–3449.

Westendorf JJ, Hiebert SW. 1999. Mammalian runt-domain proteins and theirroles in hematopoiesis, osteogenesis, and leukemia. J Cell Biochem 32–33(Suppl):51–58.

Xiao ZS, Hjelmeland AB, Quarles LD. 2004. Selective deficiency of the ‘‘bone-related’’ Runx2-II unexpectedly preserves osteoblast-mediated skeletogenesis.J Biol Chem 279:20307–20313.

Yang S, Wei D, Wang D, Phimphilai M, Krebsbach PH, Franceschi RT. 2003.In vitro and in vivo synergistic interactions between the Runx2/Cbfa1transcription factor and bone morphogenetic protein-2 in stimulating osteo-blast differentiation. J Bone Miner Res 18:705–715.

Yoshida CA, Yamamoto H, Fujita T, Furuichi T, Ito K, Inoue K, Yamana K,Zanma A, Takada K, Ito Y, Komori T. 2004. Runx2 and Runx3 are essential forchondrocyte maturation, and Runx2 regulates limb growth through inductionof Indian hedgehog. Genes Dev 18:952–963.

Zaidi SK, Javed A, Choi JY, Van Wijnen AJ, Stein JL, Lian JB, Stein GS. 2001.A specific targeting signal directs Runx2/Cbfa1 to subnuclear domains andcontributes to transactivation of the osteocalcin gene. J Cell Sci 114:3093–3102.

Zaidi SK, Sullivan AJ, Van Wijnen AJ, Stein JL, Stein GS, Lian JB. 2002.Integration of Runx and Smad regulatory signals at transcriptionally activesubnuclear sites. Proc Natl Acad Sci USA 99:8048–8053.

Zaidi SK, Sullivan AJ, Medina R, Ito Y, Van Wijnen AJ, Stein JL, Lian JB,Stein GS. 2004. Tyrosine phosphorylation controls Runx2-mediated subnucleartargeting of YAP to repress transcription. EMBO J 23:790–799.

Zhang X, Schwarz EM, Young DA, Puzas JE, Rosier RN, O’Keefe RJ. 2002.Cyclooxygenase-2 regulates mesenchymal cell differentiation into the osteo-blast lineage and is critically involved in bone repair. J Clin Invest 109:1405–1415.

Runx EXPRESSION DURING EMBRYONIC DEVELOPMENT IN MOUSE 143