J. gen. Virol. (1986), 67, 221 228. Printed in Great Britain

Key words: IB V/RNA/leader sequence/homology region

Cloning and Sequencing of 5' Terminal Sequences from Avian Infectious Bronchitis Virus Genomic RNA

By T. D. K. B R O W N , * M. E. G. B O U R S N E L L , M. M. B I N N S AND F. M; T O M L E Y

Houghton Poultry Research Station, Houghton, Huntingdon, Cambs. PE17 2DA, U.K.

(Accepted 22 October 1985)

SUMMARY

The subgenomic RNAs of the fowl coronavirus infectious bronchitis virus (IBV) form a 3' co-terminal or 'nested' set. The presence of non-contiguous (leader) sequences fused to the 5' termini of murine hepatitis virus mRNAs has been demonstrated using RNase T 1 oligonucleotide mapping and sequencing. The presence of a leader sequence on IBV mRNA A has been demonstrated previously. In this paper the presence of a leader identical to that present on the 5' terminus of IBV mRNA A is demonstrated to be present on the 5' terminus of IBV genomic RNA. This has been achieved by sequencing of primer extension products and cDNA clones containing the genomic leader. Analysis of these clones has revealed the presence of a sequence at the leader/genome-length RNA junction which is closely related to regions of homology identified previously within the genomic RNA sequence at the leader/body junctions of subgenomic RNAs. The implications of this finding for mechanisms of coronavirus RNA synthesis are discussed.

INTRODUCTION

Infectious bronchitis virus (IBV) is a coronavirus which infects the fowl. IBV virions, which are enveloped and pleomorphic, contain three major virus-coded protein structures, the surface projection glycoprotein, the membrane glycoprotein and the nucleocapsid protein (Cavanagh, 1981; Stern et al., 1982). The viral genome is a positive-stranded RNA molecule of approximately 20 kilobases (Stern & Kennedy, 1980b). Six major polyadenylated viral RNA species (A to F) have been detected in infected cells. RNA A is the smallest and RNA F is of genome length (Stern & Kennedy, 1980 b). These R NAs form a so-called nested or 3' co-terminal set (Fig. 1 a) (Stern & Kennedy, 1980a, b); in vitro translation studies have demonstrated that three of the RNAs function as messengers coding for virion polypeptides and suggest that each mRNA is translated to give a single major polypeptide. Thus, mRNA A codes for the nucleocapsid polypeptide, mRNA C for the membrane polypeptide and mRNA E for the precursor of the surface projection polypeptides (Stern et al., 1982; Stern & Sefton, 1982, 1984).

It was initially believed on the basis of the coding potential of the subgenomic RNAs and the sizes of their translation products that in each case the coding region would lie entirely within those 5' 'unique' terminal sequences of the RNA which were not present in the next smallest RNA. The open reading frames (ORFs) coding for these structural polypeptides have been sequenced (Boursnell et al., 1984, 1985 a; Binns et al., 1985 a). These data demonstrate that while the membrane polypeptide ORF lies within the 5' terminal sequences of mRNA C which are not present in the next smallest RNA, RNA B, the spike polypeptide ORF ofIBV Beaudette does in fact overlap to a modest extent the likely 5' terminus of the body of RNA D. The potential for overlap of ORFs also exists in the cases of the mRNAs for putative non-structural polypeptides (B and D). However, no translation products have yet been identified for RNAs B and D (Boursnell & Brown, 1984; Boursnell et al., 1985 b). The observation that purified genomic RNA is infectious (Lomniczi, 1977; Schochetman et al., 1977) demonstrates that it too can function as an mRNA and it is likely that it encodes the viral RNA-dependent RNA polymerase.

0000-6847 © 1986 SGM

222 T. D. K. B R O W N AND OTHERS

2O I

10 , / / , 9 8 7 6 5 4 3 I I I I t I I

0 kb i

J t J I Regions of homology

Leader

0 // 0 / /

0

U

11

0

~ , ~ Genome

m R N A F

m R N A E

m R N A D

m R N A C

m R N A B

m R N A A

Fig. 1. Sequence organization of IBV R N A s showing the 3' co-terminal set, locations of regions of homology and possible locations of leader sequences.

The origins of the 5' terminal sequences of coronavirus subgenomic RNAs have been investigated in recent years. RNase T1 oligonucleotide mapping studies of murine hepatitis virus (MHV) mRNAs and genomic RNA had indicated the presence of leader sequences derived from the 5' terminus of the genomic RNA on the 5' termini of the subgenomic RNAs (Spaan et al., 1982; Lai et al., 1983). Cloning and sequencing work with both IBV and MHV has subsequently provided a more direct demonstration of the fusion of a leader to the body sequences of the subgenomic RNAs (Brown et al., 1984; Spaan et al., 1983). Leaders of approximately 60 bases on the 5' end of IBV mRNA A and of approximately 70 bases on MHV mRNA 7 have been found. The fusion to the body sequences occurs at positions expected from the 3' co-terminal set model. The presence of tfie leader sequence at the 5' end of the genome has been confirmed for MHV using primer extension (Lai et al., 1984).

Regions of homology present in the genomic RNA at fusion sites accurately located by S1 mapping have been detected in the sequences o f cD NA clones ofIBV genomic RNA (Brown & Boursnell, 1984). Further regions of homology have been detected at fusion sites predicted from mRNA length measurements and from identification of the ORFs for the membrane and spike polypeptides (Boursnell et al., 1984; Binns et al., 1985 a). Regions of homology of this type have also been detected at predicted fusion sites in MHV genomic RNA (Budzilowicz et al., 1985; Skinner et al., I985; Skinner & Siddell, 1985).

Various models have been proposed for coronavirus RNA synthesis based on both sequencing data and studies of the replicative intermediate (RI) (Baric et al., 1983), but considerably more information of a variety of kinds is required to discriminate between the possibilities. In this paper, we demonstrate the presence of the leader sequence, found previously on mRNA A, at the 5' terminus of the genomic RNA and describe the isolation and characterization of cDNA clones from the 5' terminus. These data further illuminate features of coronavirus RNA synthesis.

M E T H ODS

£~olation oflBVgenomic RNA. IBV strains Beaudette and M41 were grown in l 1-day-old embryonated eggs. Virions were isolated from allantoic fluid and purified by isopycnic centrifugation on sucrose gradients. Viral R N A was purified as described previously (Brown & Boursnell, 1984)~

Primer extension on genomic and cytoplasmic RNA. Primer extension with a synthetic oligonucleotide primer was carried out as follows. The 15-base oligonucleotide primer (5' A T C T A G C G C A A G G C T 3') complementary to the 3' region of the leader sequence of IBV m R N A A was Y-labelled with [~,-3zP]ATP using polynucleotide kinase and

I B V R N A s : 5' terminal sequences 223

purified as described previously (Brown et al., 1984). The labelled primer was used to prime reverse transcription of approximately 10 ~tg of IBV genomic RNA in a volume of 50 ~tl containing 50 mM-KC1, 50 mM-Tris HCI (pH 8.3 at 42 ~C), 10 mi-MgCl2, 10 mi-dithiothreitol, 1 mi-dNTPs and 100 units of avian myeloblastosis virus reverse transcriptase. The reaction mixture was incubated at 42 °C for 30 min. An equal volume of deionized formamide containing 0.03 o/~ xylene cyanol FF, 0.03 °. o bromophenol blue and 20 mM-disodium EDTA was added and the sample heated to 100 °C for 3 min. It was immediately loaded onto a 6°o polyacrylamide sequencing gel and electrophoresed until the xylene cyanol FF was approximately half-way down the gel. The gel was exposed to X-ray film and the single labelled band corresponding to the extended primer was cut from the gel (see Fig. 2). The extension of the labelled primer on total cytoplasmic RNA from infected cells was carried out as described above except that the RNA was prepared as described previously (Brown et al., 1984).

Sequencing o['the primer extension product. The labelled fragment was eluted from the gel using essentially the technique of Maxam & Gilbert (1980), except that the elution buffer contained no magnesium acetate, and sequenced as described previously (Brown & Boursnell, 1984).

Production and screening of eDNA clones Jrom IBV genomie RNA Using random priming. A 'library' of cDNA clones was produced from IBV genomic RNA using random

priming with calf thymus DNA oligonucleotides (Binns et al., 1985b). The oligonucleotides were produced as described by Maniatis et al. (1982). cDNA synthesis was carried out using the method of Gubler & Hoffman (1983). Approximately 20 ~g of virion RNA and 100 lag of calf thymus DNA oligonucleotides were used for first strand synthesis in a volume of 50 gl. The cDNA was homopolymer-tailed with dC, annealed with dG-tailed PstI- digested pBR322 and used to transform Eseherichia coli strain LE392 (Maniatis et al., 1982) using the procedure of Hanahan (1983). Approximately 900 tetracycline-resistant colonies were screened for leader sequences using the oligonucleotide described above as a probe. Colonies were transferred to nitrocellulose filters and probed with the oligonucleotide using a modification of the procedure of Grunstein & Hogness (1975). Two-hundred ng of the oligonucleotide were 5'-labelled with [7-32p]ATP using polynucleotide kinase (Brown et al., 1984). The filters were prehybridized for 2 h at 55 °C in 0.9 M-NaC1, 6 mN-EDTA, 90 mM-Tris-HC1 pH 7.5, 0.5°.o NP40 and 100 gg/ml sonicated, denatured herring sperm DNA. The probe was added and hybridization carried out overnight at 25 c C. The filters were then washed twice at room temperature and twice at 37 °C in 6 x SSC and exposed to flashed Fuji RX X-ray film.

Using oligo(dT) priming. These clones were isolated as described previously (Brown & Boursnell, 1984). Sequencing ofcDNA clones. PvulI and PstI digests of DNA isolated from putative leader sequence clones were

recloned into Sinai-cut, phosphatase-treated M 13rap 10 and PstI-digested M 13mp I 1 respectively. Dideoxy chain termination sequencing (Sanger et al., 1977) was carried out using a 'universal' primer. [~-3sS]dATP was used to label the reactions and the reaction products were analysed on buffer gradient gels (Biggin et al., 1983). A sonic digitizer (Graf/Bar, Science Accessories Corporation) was used to read sequence data into a BBC model B micro- computer; these data were subsequently analysed on a DEC VAX ! 1/750 using the programs of Staden (1982, 1984).

RESULTS

Demonstrat ion o f a leader sequence at the 5' terminus o f l B V Beaudet te genomic R N A

T h e p resence of a l eader sequence on m R N A A of IBV has b e e n d e m o n s t r a t e d p rev ious ly ( B r o w n et al., 1984). T h e p re sence of th i s or a re la ted sequence a t the 5' t e r m i n u s of the g e n o m i c R N A has no t h o w e v e r b e e n repor ted . W e h a v e the re fo re s tud ied the ex t ens ion on g e n o m i c R N A of a 5 ' - label led o l igonuc leo t ide c o m p l e m e n t a r y to a reg ion close to the 3' end of the l eader p r e sen t on m R N A A. A single ex tens ion p r o d u c t of a p p r o x i m a t e l y 50 bases was o b s e r v e d on a u t o r a d i o g r a p h s of u r e a / p o l y a c r y l a m i d e s e q u e n c i n g gels (Fig. 2). In o rde r to con f i rm the iden t i ty of the p r oduc t it was ex t rac ted f rom the gel a n d s e q u e n c e d us ing the c h e m i c a l d e g r a d a t i o n m e t h o d of M a x a m & G i l b e r t (1980) (Fig. 2). T h e sequence o b t a i n e d in th i s way is p r e sen t ed in Fig. 3. T he d a t a d e m o n s t r a t e the p r e sence of a l eade r s equence on the g e n o m i c R N A w h i c h is iden t ica l ove r the s equenced reg ion to t h a t p r e s e n t on m R N A A. T h e d a t a p r e s e n t e d in Fig. 2 also d e m o n s t r a t e the p re sence of the l eade r s equence o n R N A s p r e s e n t in a to ta l cy top lasmic R N A p r e p a r a t i o n f rom I B V - i n f e c t e d c h i c k k i d n e y cells. T h e p r e d o m i n a n t IBV R N A species p r e s en t in such p r e p a r a t i o n s are the s u b g e n o m i c m R N A s (T. D. K. Brown,

u n p u b l i s h e d ; S tern & K e n n e d y , 1980a). In th i s case, as in the case of the p r i m e r ex t ens ion o n g e n o m i c R N A , the ex tens ion p roduc t s were essent ia l ly h o m o g e n e o u s in l e n g t h a n d sequence . I t is, however , fo rmal ly poss ible t h a t IBV s u b g e n o m i c R N A s o t h e r t h a n m R N A A lack the sequence c o m p l e m e n t a r y to the p r i m e r o l igonuc leo t ide s equence a n d thus do no t give rise to ex tens ion products .

224 T. D. K. BROWN AND OTHERS

Approx. 50

bases

(a) Genomic RNA mRNA

(b) Oenomic RNA mRNA

T I f

G G

Fig. 2. (a) Autoradiographs of primer extension reactions with IBV Beaudette genomic and cytoplasmic RNA preparations analysed on 6~'o urea/polyacrylamide sequencing gels. (b) Maxam & Gilbert sequence analysis of the 50-base extension products extracted from the sequencing gels.

Sequence of genomic RNA leader

NNCTTAAGATAGATATTAATATATATCTATTACACTAGCCTT

NNCTTAAGATAGATATTAATATATATCTATTACACTAGCCTTGCGCTAGATTTTTAACTTAACAAA . . . . . . . . . . . . . . . . . . . . . . .

Priming site Region of homology

Sequence of mRNA A leader

Fig. 3. Partial sequence of the IBV Beaudette genomic and subgenomic leaders obtained by Maxam & Gilbert sequencing of the 50-base extension product primed from genomic and cytoplasmic RNA preparations. The previously determined sequence extending 5'-wards from the CTTAACAA region of homology of IBV Beaudette mRNA A is included for comparison. The position of the sequence complementary to the primer is marked.

3'

IBV RNAs : 5' terminal sequences

(a)

ACTTAAGATAGATATTAATATATATCTATCACACTAGCCTTGCGCTAGATTTCCAACTTAACAA I0 20 30 40 50 60

225

(b) T TT

ACTTAAGATAGATATTAATATATATCTATCACACTAGCCTTGCGCTAGATTTCCAACTTAACAAAACGGA I0 20 30 40 50 60 70

CTTAAATACCTACAGCTGGTCCTCATAGGTGTTCCATTGCAGTGCACTTTAGTGCCCTGGATGGCACCTG 80 90 i00 110 120 130 140

GCCACCTGTCAGGTTTTTGTTATTAAAATCTTATTGTTGCTGGTATCACTGCTTGTTTTGCCGTGTCTCA 150 160 170 180 190 200 210

T G T CTTTATACATCCGTTGCTTGGGCTACCTAGTATCCAGCGTCCTACGGGCGCCGTGGCTGGTTCG

220 230 240 250 260 270

Fig. 4.5' terminal sequences of the genomic RNAs of IBV strains M41 and Beaudette and of IBV M41 mRNA A leader obtained by dideoxy chain termination sequencing of cloned cDNAs. (a) M41 mRNA leader sequence; (b) M41 genomic RNA 5' terminal sequence. Differences found in the equivalent Beaudette genomic RNA sequence are marked above the M41 sequence. The core regions of homology are underlined.

Isolation of cDNA clones containing leader sequences

The oligonucleotide used in the primer extension experiment described above was used to probe a library o fcDNA clones obtained using random priming of an IBV M41 genomic RNA preparation. Four colonies giving a positive hybridization signal were identified and characterized further. These clones were designated pM41. L1, pM41. L2, pM41. L3, pM41. L4. Plasmid DN As isolated from cultures of the four colonies were digested with PstI and the digests analysed on a 1.5 ~ agarose gel. The gel was blotted onto nitrocellulose and the filter probed with the oligonucleotide. Hybridization of the oligonucleotide with the insert band confirmed the presence of leader sequences in all four clones. A clone pB.L1 hybridizing with the leader oligonucleotide was isolated from an IBV Beaudette cDNA library in the same way. The isolation of clones containing sequences homologous to the leader present on IBV mRNA A from a cDNA library obtained from a genomic RNA preparation suggests that the clones should contain sequences from the genomic leader sequence demonstrated by the primer extension experiment described above. However, it does not provide definitive evidence of their origin, as clones containing IBV subgenomic mRNA sequences can be isolated at low frequency from cDNA produced from genomic RNA preparations (Binns et al., 1985b). The origin of the contaminating subgenomic RNAs is unclear. The possibility that the leader-containing clones were derived from subgenomic RNAs was initially eliminated by probing of Southern blots of leader sequence clones with cloned genomic sequences spanning the positions of the 5' termini of the subgenomic RNA bodies. The failure of the leader clones to hybridize with genomic sequences from the A/B, B/C, D/E and E/F junctions indicated that they were indeed derived from the 5' terminus of the genomic RNA. The presence of genomic leader sequences in these clones is confirmed by the sequence data described below.

Sequencing of cDNA clones containing leader sequences

Dideoxy chain termination sequencing of PvuII and PstI digests of the putative genomic leader clones recloned in M 13 vectors was carried out. Sequence data derived from the four IBV M41 leader clones and the IBV Beaudette leader clone are shown in Fig. 4. Also presented is the sequence of the mRNA A leader of IBV M41 obtained by shotgun sequencing of clone M41. 146. The data obtained for the individual clones demonstrated that all of the clones M41. L1, M41. L2, M41. L3, M41. L4 and B. L1 contain leader sequences. Clone L4 appears to

226 Z. D.

TGC GCTAGATTTCCA,a CTTAACAA

GTTGTTAATTTGAAAACTGAACAA

GATAACGATGTGGTAACTGAACAA

TACATATGGTAGAAAA CTTAACAA

TATAAGAGGTGTTTTACTTAACAA

AGATTGTGTTTACTTTCTTAACAA

K. BROWN AND OTHERS

AACGGAGTTAAATACC 3'

AAGACAGACTTAGTCT

TACAGACCTAAAAAGT

TCCGGAATTAGAAGCA

AAACTTAACAAATACG

AGCAGGACAAGCAGAG

Genome

mRNA E

mRNA D

mRNA C

mRNA B

mRNA A

Fig. 5. Regions of homology and flanking sequences in IBV Beaudette genomic RNA. These regions have been identified at the putative leader/body junctions for all major IBV RNA species. The core regions of homology are boxed.

contain the complete or almost complete leader. The sequence 5'-wards of the CT(T/G)AACAA core homology region (Brown & Boursnell, 1984: Boursnell et al., 1984; Binns et al., 1985a) is identical to that present on IBV M41 mRNA A. It is of interest that this sequence differs slightly from that present on IBV Beaudette mRNA A (Fig. 3) (Brown et al., 1984). Comparison of the sequence 3"-wards from the homology region shows no signficant homology with sequences previously demonstrated to lie T-wards of the homology regions of the IBV subgenomic mRNAs A, B, C, D and E (Brown & Boursnell, 1984; Boursnell et al., 1984, 1985b; Binns et al., 1985a). This confirms that the clones are indeed derived from sequences present at the 5' terminus of the genomic RNA. The presence of the core homology region in these clones is therefore of particular interest.

DISCUSSION

The data presented above demonstrate the presence of a leader sequence at the 5' terminus of IBV genomic RNA. The sequence of the genomic leader was found to be the same as that of the mRNA A leader. A genomic RNA leader sequence has previously been demonstrated for MHV by both RNase T1 oligonucleotide analysis (Lai et al., 1983) and by primer extension techniques (Lai et aL, 1984). However, our data for IBV did not show the heterogeneity in genomic lcader primer extension products seen with MHV. In particular there was no evidence of bands of a length greater than that of the major extension product characterized as having the same sequence as the mRNA A leader. This homogeneity was also observed in the primer extension products obtained when the leader oligonucleotide was extended on total cytoplasmic RNA from IBV-infected chick kidney cells. The significance of this difference is unclear.

It has been suggestcd on the basis of limited $1 mapping data that part of the homology region from MHV mRNAs 6 and 7 is present at the 3' end of the MHV genomic RNA leader sequence (Baric et aL, 1985). The data presented here show directly that there is a core region of homology (CTTAACAA) at the 3' end of the gcnomic leader sequence of IBV; this information is important in relation to coronavirus replication in that it demonstrates definitively for the first time that a free leader could contain all or part of this sequence and would thus be capable of base-pairing with the complementary sequences of the intergenic regions of homology found in the negative strand replicative/transcriptional intermediate. This represents a plausible element of a mechanism for specific leader/body fusion. Consideration of the sequences of the regions of homology suggests that differences in base-pairing between the leader homology region and the subgenomic homology regions could not alone account for the differences in abundance of the subgenomic RNAs (assuming that their abundance reflects rate of synthesis) (Fig. 5). If however the free leader does not contain the region of homology it is unlikely that base-pairing is an important element in the fusion mechanism as there is only a low degree of homology between the leader sequence Y-wards of the genomic region of homology and the intergcnic sequences 5'- wards of the subgenomic regions of homology. In this case the regions of core homology and their flanking sequences might be recognition sites for binding of a leader/polymerase complex.

I B V RNAs: 5' terminal sequences 227

The finding of the homology region at the 3' end of the genomic leader sequence is consistent with the possibility that the genomic length RNA may be synthesized by a mechanism similar to that for subgenomic RNA synthesis.

The sequence data presented for the 5' termini of both IBV Beaudette and IBV M41 genomic RNAs contain a single, extremely short ORF potentially capable of coding for an 11-amino acid peptide. The ORF has a codon usage similar to that of the IBV surface projection glycoprotein coding region and the sequence context of the putative initiator codon suggests that it could be functional (Kozak, 1983). It is however clear, given the infectivity of purified IBV RNA, that the genomic RNA must be translated to give an RNA-dependent R N A polymerase and it may well be that this small ORF identified in the 5' terminal sequences is not functional.

We are grateful to Phi l l ip Green and Bridget te Bri t ton for excel lent technica l ass is tance. Th is research was

carr ied out under Research Con t rac t No. GBI-2-011-UK of the Biomolecular Eng inee r ing P r o g r a m m e of the

Commiss ion of the European Communi t i e s .

R E F E R E N C E S

BARIC, R. S., STOHLMAN, S. A. & LAI, M. M. C. (1983). Cha rac t e r i za t i on of rep l ica t ive in t e rmed ia t e R N A of mouse hepat i t i s virus: presence of leader R N A sequences on nascen t chains. Journal of Virology 48, 633-640.

BARIC, R. S,, STO~LMAN, S. k., RAZAVI, M. K. & LgI, M. M. C. (1985). Cha rac t e r i s a t i on of leader-re la ted smal l R N A s in coronavirus- infected cells : fur ther ev idence for l eader -pr imed m e c h a n i s m of t ranscr ip t ion . Virus Research 3, 19-33.

BIGGIN, M. D., GIBSON, T. J. & HONG, G. F. (1983). Buffer g rad ien t gels and 35S label as an aid to rap id D N A sequence de te rmina t ion . Proceedings o/' the National Academy of Sciences, U.S.A. 80, 3963-3965~

BINNS, M. M., BOURSNELL, M. E. G., CAVANAGH, D., PAPPIN, D. J. C. & BROWN, T. D. K. (1985a). C lon ing and sequenc ing of the gene encoding the spike prote in of the coronavi rus IBV. Journal of General Virology 66, 719-726.

B]NNS, M. M., BOURSNELL, M. E. G., FOULDS, I. J. & BROWN, T. D. K. (1985b). The use of a r andom p r i m i n g procedure to generate c D N A l ibrar ies of infect ious bronchi t i s virus, a large R N A viru s. Journal of Virological Methods 11, 265-269.

BOURSNELL, M. E. G. & BROWN, T. D. K. (1984)• Sequencing of coronav i rus IBV genomic R N A : a 195-base open reading f rame encoded by m R N A B. Gene 29, 87-92.

BOURSNELL, M. E. G., BROWN, T. D. K. & BINNS, M. M. (1984). Sequence of the m e m b r a n e pro te in gene from av ian coronavi rus IBV. Virus Research 1, 303-313.

• BOURSNELL, M. E. G., B1NNS, M. M., FOULDS, I. J. & BROWN, T. D. K. (1985a). Sequences of the nuc leocaps id genes f rom two s t ra ins of av ian infect ious bronchi t i s virus. Journal of General Virology 66, 573-580.

BOURSNELL, M. E. G., BINNS, M. M. & BROWN, T. D. K. (1985b), Sequenc ing of coronav i rus IBV genomic R N A : three open reading f rames in the 5' "unique" region of m R N A D. Journal of General Virology 66, 2253-2258•

BROWN, T. D. K. & BOURSNELL, M. E. O. (1984). A v i a n infect ious bronchi t i s virus genomic R N A con ta ins sequence homologies at the in te rgenic boundar ies . Virus Research 1, 15-24.

BROWN, T. D. K., BOURSNELL, M. E. G. & BINNS, M. M. (1984). A leader sequence is present on m R N A A of av ian infect ious bronchi t i s virus. Journal o['General Virology 65, 1437-1442.

BUDZILOWICZ, C. J., WILCZYNSKL S. P. & WEISS, S. R. (1985). Three in te rgenic regions of coronav i rus mouse hepat i t i s virus s t ra in A59 genome R N A conta in a c o m m o n nucleot ide sequence tha t is homologous to the 3' end of the viral m R N A leader sequence. Journal of Virology 53, 834-840.

CAVANAOrl, D. (19813. Structural po lypept ides of coronav i rus IBV. Journal of General Virology 53, 93-103. GRUNSTEIN, M. & HOGNESS, D. S. (1975). Colony hybr id i sa t ion : a me thod for the isola t ion of c loned D N A s tha t

conta in a specific gene. Proceedings of the National Academy of Sciences. U.S.A. 72, 3961-3965. GUBLER, U. & HOFFMAN, B. J~ (19833. A s imple and efficient me thod for gene ra t ing c D N A libraries• Gene 25, 263-

269. HANAHAN, D. (19833. Studies on t r ans fo rmat ion of Escherichia coil with p lasmids . JournalofMoleeular Biology 166,

557 580. KOZAK, M. (1983). Compar i son of in i t ia t ion of prote in synthes is in procaryotes , eucaryotes and organel les .

Microbiological Reviews 47, 1 45. LAI, M. M. C., PATTON, C. D., BARIC, R. S. & STOHLMAN, S. (1983). Presence of leader sequences in the m R N A of mouse

hepat i t i s virus. Journal of Virology 46, 1027-1033. LAI, M. M. C., BARIC, R. S., BRAYTON, P. R.& STOHLMAN, S. A. (19843. Cha rac t e r i s a t i on of leader R N A sequences on the

vir ion and m R N A s of mouse hepat i t i s virus, a cy top lasmic R N A virus• Proceedings of the National Academy of Sciences, U.S.A. 81, 3626-3630.

LOMNICZL B. (19773. Biological proper t ies of av ian coronavi rus R N A . Journal qfGeneral Virology 36, 53t 533. MAN1ATIS, T., FRITSCH, E. F. & SAMBROOK, J. (19823. Molecular Clon#tg: A Laboratory Manual. New York : Cold

Spring Harbo r Laboratory. MAXAM, A. ~a. & GILBERT, W. (1980). Sequencing end- labeled D N A wi th base-specif ic chemica l cleavages~ Methods

in Enzymology 65, 499-560.

228 T . D . K . B R O W N AND OTHERS

SANGER, r., NICKLEN, S. & COULSON, A. R. (1977). D N A sequencing with chain-terminating inhibitors. Proceedings of the National Academy ol'Sciences, U.S.A. 74, 5463-5467.

SCHOCHETMAN, G., STEVENS, R. H. & SIMPSON, R. W. (1977). Presence of infectious polyadenylated RNA in the coronavirus avian bronchitis virus. Virology 77, 772-782.

SKINNER, M. A. & SIDDELL, S. G. (1985). Coding sequence of coronavirus MHV-JHM m R N A 4. Journal of General Virology 66, 593-596.

SKINNER, M. A., EBNER, D. & SIDDELL, S. G. (1985). Coronavirus M H V - J H M m R N A 5 has a sequence arrangement which potentially allows translation of a second, downstream open reading frame. Journal of General Virology 66, 581-592.

SPAAN, W. J. M., ROTTIER, P. J. M., HORZINEK, M. C. & VAN DER ZEIJST, B. A. M. (1982). Sequence relationships between the genome and the intracellular R N A species 1, 3, 6 and 7 of mouse hepatitis virus strain A59. Journal of Virology 42, 432-439.

SPAAN, W., DELIUS, H., SKINNER, M., ARMSTRONG, J., ROTTIER, P., SMEEKENS, S., VAN DER ZEIJST, B. A. M. & SIDDELL, s. G. (1983). Coronavirus m R N A synthesis involves fusion of non-contiguous sequences. EMBO Journal 2, 1839-1844.

STADEN, g. (1982). Automation of the computer handling of gel reading data produced by the shotgun method of D N A sequencing. Nucleic Acids Research 10, 4731-4751.

STADEN, R. (1984). Graphic methods to determine the functions of nucleic acids. Nucleic Acids Research 12, 521- 538.

STERN, D. F. & KENNEDY, S. I. T. (1980 a). Coronavirus multiplication strategy. I. Identification and characterisation of virus-specified RNA. Journal of Virology 34, 665-674.

STERN, D. F. & KENNEDY, S. 1. T. (1980b). Coronavirus multiplication strategy. II. Mapping the avian infectious bronchitis virus intracellular R N A species to the genome. Journal of Virology 36, 440-449.

STERN, D. F. & SEFTON, B. M. (1982). Coronavirus proteins: biogenesis of avian infectious bronchitis virus virion proteins. Journal of Virology 44, 794-803.

STERN, D. F. & SEETON, B. M. (1984). Coronavirus multiplication : location of genes for virion proteins on the avian infectious bronchitis virus genome. Journal of Virology 50, 22-29.

STERN, D. r., BURGESS, L. & SEFTON, B. M. (1982). Structural analysis of virion proteins of the avian coronavirus infectious bronchitis virus. Journal of Virology 42, 208-219.

(Received 27 August 1985)