Ci

AFa

b

c

d

e

f

g

h

i

a

KAHGBC

I

poabcosCi(ah

Mg

0d

Phytomedicine 19 (2011) 56– 63

Contents lists available at ScienceDirect

Phytomedicine

jou rn al hom epage: www.elsev ier .de /phymed

omparison between allicin and fluconazole in Candida albicans biofilmnhibition and in suppression of HWP1 gene expression

lireza Khodavandia, Nabil S. Harmalb,c, Fahimeh Alizadehd, Olivia J. Scullyb, Shiran M. Sidike,auziah Othmanf, Zamberi Sekawig, Kee Peng Ngh, Pei Pei Chongb,i,∗

Department of Paramedical Sciences, Gachsaran Branch, Islamic Azad University, Gachsaran, IranDepartment of Biomedical Sciences, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor, MalaysiaDepartment of Microbiology, Faculty of Medicine and Health Sciences, Sana’a University, Sana’a, YemenDepartment of Paramedical Sciences, Yasuj Branch, Islamic Azad University, Yasuj, IranDepartment of Pathology, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor, MalaysiaDepartment of Human Anatomy, Faculty of Medicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selangor, MalaysiaDepartment of Medical Microbiology and Parasitology, Faculty of Medicine and Health Sciences, University of Putra Malaysia 43400 Serdang, Selangor, MalaysiaDepartment of Medical Microbiology, University Malaya Medical Center, 59100 Kuala Lumpur, MalaysiaInstitute of Bioscience, University of Putra Malaysia 43400 Serdang, Selangor, Malaysia

r t i c l e i n f o

eywords:llicinWP1ene expressioniofilmandida albicans

a b s t r a c t

Candida albicans is an opportunistic human pathogen with the ability to differentiate and grow in fila-mentous forms and exist as biofilms. The biofilms are a barrier to treatment as they are often resistantto the antifungal drugs. In this study, we investigated the antifungal activity of allicin, an active com-pound of garlic on various isolates of C. albicans. The effect of allicin on biofilm production in C. albicansas compared to fluconazole, an antifungal drug, was investigated using the tetrazolium (XTT) reduction-

dependent growth and crystal violet assays as well as scanning electron microscopy (SEM). Allicin-treatedcells exhibited significant reduction in biofilm growth (p < 0.05) compared to fluconazole-treated and alsogrowth control cells. Moreover, observation by SEM of allicin and fluconazole-treated cells confirmed adose-dependent membrane disruption and decreased production of organisms. Finally, the expression ofselected genes involved in biofilm formation such as HWP1 was evaluated by semi-quantitative RT-PCR

PCR.

and relative real time RT-

ntroduction

Biofilms are characteristically composed of genetically andhenotypically diverse microbial populations inhabiting surfacesf tissues, catheters or surgically implanted prosthetic devices:lthough intensively investigated the clinical relevance of fungaliofilms is often uncertain. Attachment of Candida albicans to hostells of mucosal surfaces is sometimes followed by biofilm growthn catheter walls and heart valves (Chandra et al. 2001). It has beenhown that the initial step of candidal infection is adherence ofandida to host cells surfaces. Some important genes in Candida

nterfere with formation of biofilm such as agglutinin like sequence

ALS) family and hyphal cell wall protein (HWP1). Germ tubes alsore the first step indicated in conversion of planktonic form toyphal growth of C. albicans which can form stable complexes with

∗ Corresponding author at: Department of Biomedical Sciences, Faculty ofedicine and Health Sciences, University of Putra Malaysia, 43400 Serdang, Selan-

or, Malaysia. Tel.: +60 89472302; fax: +60 89436178.E-mail address: cpp@medic.upm.edu.my (P.P. Chong).

944-7113/$ – see front matter © 2011 Elsevier GmbH. All rights reserved.oi:10.1016/j.phymed.2011.08.060

Allicin was shown to down-regulate the expression of HWP1.© 2011 Elsevier GmbH. All rights reserved.

human buccal epithelial cells (HBEC). It is also demonstrated thatthe HBEC is one of the major targets of Hwp1 for formation ofthe stable complexes (Yan-Liang 2003; Nobile et al. 2006). HWP1is also shown to encode a surface mannoprotein contributing todevelopment of biofilm characterized by antifungal resistance ofC. albicans (Staab et al. 1999; Bruzual et al. 2007). Clearly, Hwp1 isexpressed during the early stages (after adherence step or yeast-form cells adhere) of biofilm formation on surfaces of germ tubes(Nobile and Mitchell 2006; Finkel and Mitchell 2010; Bujdakovaet al. 2010). Indeed, Hwp1 has a complementary role in biofilmformation; through a physical interaction with Als1 and 3 in theinitiation stage of biofilm formation (Nobile et al. 2008; Klis et al.2009). INT1 has a significant role in morphogenesis, adhesion, andfilamentous growth. In fact, interruption in the INT1 gene coulddecrease adhesion of C. albicans to epithelial cells (Kinneberg et al.1999).

Most recently antifungal drugs such as azoles have been found

to display side effects and also lead to emergence and distribu-tion of resistance (Ankri and Mirelman 1999; Bruzual et al. 2007).Therefore, new therapeutic strategies using antifungal agents thatoriginated from natural substances and also understanding the

ytome

mm

atl1Meaiwlat1lioahasi(c12

Hbs

M

F

o

Bi−Ci−flo

B

F

tICbaM79(tsf

A. Khodavandi et al. / Ph

echanisms of action of these drugs may be one way to developore effective anticandidal agents.Garlic and sulphur-containing derivatives have been defined

s medications for many infectious diseases. It is demonstratedhat the main bioactive components that originated from gar-ic is allicin showing antifungal activities (Yamada and Azuma977; Adetumbi et al. 1986; Ghannoum 1988, 1990; Ankri andirelman 1999; Harris et al. 2001; Low et al. 2008; Khodavandi

t al. 2010, 2011). It is mentioned that after damage of garlic cells,llin (precursor of allicin) could convert to allicin by allinase activ-ty. Although the mechanisms of action of garlic and allicin are not

ell understood, some investigators mentioned that blockage ofipid synthesis affecting the lipid compositions of the cell surfacend suppression of hyphae development might be the suggestedargets of garlic in C. albicans (Adetumbi et al. 1986; Ghannoum990; Davis 2005; Low et al. 2008). It has been shown that gar-

ic and some derivatives could destroy the Candida cell membranentegrity. On the other hand, its cell wall also has a high ratiof carbohydrates, which might be the other probable target ofllicin against C. albicans (Lemar et al. 2002). A previous studyas reported that garlic extract and some products such as allyllcohol and DADS (diallyl disulfide) could to increase oxidativetress and reduced glutathione in C. albicans. On the other hand,t is indicated that mitochondria might be a target for allyl alcoholLemar et al. 2005, 2007). Moreover, it is demonstrated that garlicould significantly inhibit candidal adhesion to HBEC (Ghannoum990) and reduce biofilm formation in C. albicans (Shuford et al.005).

In the present study, significant reduction in the expression ofWP1 in C. albicans treated with allicin demonstrated that inhi-ition of biofilm formation and development could be one of theignificant mechanisms of anticandidal activity of allicin.

aterials and methods

ungi and antifungal agents

C. albicans ATCC 14053 was acquired according to the proceduref our previous studies (Khodavandi et al. 2010, 2011).

Allicin was obtained from Alexis Biochemicals Co. (purity ≥ 98%,atch No. ALX-350-329, San Diego, USA) and dispersed at 1 mg/ml

n methanol/water/formic acid (60:40:0.1), then stored at −20 to80 ◦C until use. Fluconazole was purchased from Sigma Chemicalso. (St. Louis, MO, USA). The stock solution was prepared by dissolv-

ng in dimethyl sulfoxide (DMSO) at 5 mg/ml and stored frozen at70 ◦C until use. The MICs of C. albicans treated with allicin anduconazole were determined using NCCLS M27 A2 as described inur previous reports (Khodavandi et al. 2010, 2011).

iofilm formation and quantification

ormation of biofilmC. albicans ATCC 14053 was induced to form biofilm according

o the protocol by Braga et al. (2008) with slight modifications.n summary, a suspension of yeast containing 1 × 106 cells/ml ofandida [in standard RPMI 1640 medium (with 0.2% glucose anduffered to pH 7.0) with MOPS (0.165 M)] was added to 100 �l ofntifungal agents in different concentrations based on MIC (¼×IC, ½× MIC, 1× MIC and 2× MIC) using 96-well microplate (Brand

81660, Wertheim, Germany) and incubated at 35 ◦C for at least0 min (with no shaking) to complete the adhesion of yeast cells

beginning phase of biofilm formation). Subsequently, the mix-ure was incubated at 35 ◦C for 24 h (growth phase) with gentlehaking (Chandra et al. 2008; Pierce et al. 2008). The effect of anti-ungal agents on biofilm of C. albicans was quantified using 2,3-bis

dicine 19 (2011) 56– 63 57

(2-methoxy-4-nitro-5 sulfophenyl)-5-[(phenylamino) carbonyl]-2H-tetrazolium hydroxide (XTT) colorimetric and also crystal violet(CV) assays.

XTT assayIn the biofilm quantification protocol using XTT assay, 4 mg

XTT (Sigma, USA) in 10 ml prewarmed phosphate buffered saline(PBS) was dissolved and supplemented by 100 �l menadionestock solution, which contained 55 mg menadione (Sigma, USA)in 100 ml acetone. One hundred �l of the XTT/menadione solu-tion was added to all wells and incubated in the dark at 37 ◦Cfor 5 h. The contents of the wells were transferred to eppendorftubes and centrifuged at 13,000 rpm for 4 min. One hundred �l ofsupernatant from each well was transferred to a new microplateand the colorimetric changes was measured at 490 nm usingEMax® microplate reader (Peeters et al. 2008) and then one-way ANOVA was carried out to show significant reduction ofbiofilm at different concentrations of antifungals to untreated-control.

CV assayOne hundred �l of 99% methanol was added to each well for

15 min to fix the biofilm and then the supernatants were ejected.Microplates were air-dried and then 100 �l of CV solution (1:50from stock solution, Sigma) were added to wells and incubated atroom temperature for 20 min. The extra CV was washed away withtap water and then approximately 150 �l of acetic acid 33% (Sigma,USA) was added to the wells. The absorbance was measured at590 nm using EMax® microplate reader (Peeters et al. 2008). One-way ANOVA was performed using a previously described to findsignificant reduction of biofilm.

Investigation of the effect of allicin on biofilm of C. albicans viascanning electron microscopy (SEM)

The protocol of biofilm formation for SEM analysis by Braga et al.(2008) was adopted with some slight modifications. A suspensionof C. albicans ATCC 14053 containing 1 × 106 cells/ml in RPMI 1640(4 ml) (supplemented by l-glutamine) was added into 6-well cellculture plates [ThermanoxTM plastic coverslips (Nunc, Denmark)]containing 4 ml of different concentrations of antifungals based onMIC (dissolved in RPMI 1640) and incubated at 35 ◦C for 90 min(with no shaking) as described earlier and incubated again at 35 ◦Cfor 24 h with gentle shaking. Following that, the biofilms werewashed with PBS alone and fixed in 2% (v/v) glutaraldehyde inPBS (PH 7.2) and washed again with sodium cacodylate buffer.For post-fixation, samples were rinsed in 1% osmium tetroxide for2 h at 4 ◦C, washed again with sodium cacodylate buffer and thendehydrated with ascending ethanol series. Following that, sampleson cover slips were put into critical point dryer and then stuckonto the stub. The specimens were coated with gold and observedthrough a Philips XL30 (ESEM, UK) scanning electron microscope.For the number of Candida in different concentrations of antifun-gal agents scoring, cells were counted and compared to untreatedcontrol in the pictures using the UTHSCSA ImageTool version 3.0(http://ddsdx.uthscsa.edu/dig/itdesc.html).

RNA extraction and cDNA synthesisA suspension containing different concentrations of antifungal

agents and 1 × 106 cells/ml of C. albicans ATCC 14053 were pre-pared as in the sample preparation for SEM as explained above.Subsequently, the mixture was centrifuged at 3000 rpm for 10 minand the supernatant was removed. The cells were washed using

PBS by resuspending the cells with approximately 2 ml of PBS andcentrifuged at 3000 rpm for 10 min and removing the supernatant.The washing process was repeated at least three times. Accord-ing to manufacturer’s operating instructions for yeast cells in the

58 A. Khodavandi et al. / Phytomedicine 19 (2011) 56– 63

Table 1Oligonucleotide primers used for PCR.

Gene Primer Sequence Product size (bp) Reference

HWP1a Forward 5′ GGTAGACGGTCAAGGTGAAACA 3′ 283 This studyReverse 5′ AGGTGGATTGTCGCAAGGTT 3′

HWP1b Forward 5′ TCAGTTCCACTCATGCAACCA 3′ 99 Uppuluri et al. (2009)Reverse 5′ AGCACCGAAAGTCAATCTCATGT 3′

INT1a Forward 5′ AAGCTCTGATACCTACACTAGCGA 3′ 239 Lim and Li (2002)Reverse 5′ GTTAGGTCTAAAGTCGAAGTCATC 3′

ACTa Forward 5′ ACCGAAGCTCCAATGAATCCAAAATCC 3′ 516 Low et al. (2008)Reverse 5′ GTTTGGTCAATACCAGCAGCTTCCAAA 3′

ACTb Forward 5′ GAGTTGCTCCAGAAGAACATCCAG 3′ 199 Lim et al. (2009)Reverse 5′ TGAGTAACACCATCACCAGAATCC 3′

RaUcwaetbfwssusTl

R

S

soPatt(tTuAtmaq

TX

a

a Primer used in semi-quantitative RT-PCR.b Primer used in relative real time RT-PCR.

Neasy RNA extraction kit, 2 ml of sorbitol lysis buffer (1 M sorbitolnd 0.1 M EDTA pH 7.4), 50U lyticase/zymolyase (ICN Chemicals,SA) and 10 �l of �-mercaptoethanol were added to the prewashedells and incubated at 37 ◦C (100 rpm) for 30 min until spheroplastas formed. The mixture was centrifuged at 1500 rpm for 5 min

nd the supernatant was discarded. Subsequently, total RNA wasxtracted using RNeasy mini kit (Qiagen, Germany) for yeast andreated with 1U DNase I (Promega, UK). RNA quality was checkedy formaldehyde-denaturing agarose gel electrophoresis at 70 Vor 45 min and also the concentration and absorption ratio of RNAas measured for purity estimation using the Nanodrop ND-1000

pectrophotometer. According to manufacturer’s protocol, single-tranded cDNA was synthesized approximately 0.5–1 �g from RNAsing Moloney Murine Leukemia Virus (M-MuLV) reverse tran-criptase and random hexamer oligonucleotides (Fermentas, USA).he reverse transcription reactions were performed at least in trip-icates.

everse transcription polymerase chain reaction (RT-PCR)

emi-quantitative RT-PCRCandida albicans HWP1 gene was amplified from the synthe-

ized cDNA. In this study, the primers used were established byther investigators except for HWP1 gene which we designed viarimer 3 and Primer Premier 5 software (Table 1). Moreover, �-ctin was established as a house-keeping gene and internal controlo normalize the dissimilar RNA concentrations during RNA extrac-ion. Furthermore, for each sample an internal negative controlwithout M-MuLV reverse transcriptase) was performed to ensurehat the PCR products were not originated from genomic DNA.he amplification condition contained 26 cycles and PCR prod-cts were performed by gel electrophoresis and visualized via the

lphaImager HP imaging system. The PCR products were quan-

itated in terms of intensity of bands by comparing to knownolecular weight DNA markers (Fermentas, USA) using AlphaIm-

ger software. The mathematical calculation method of relativeuantification was determined as follows:

able 2TT and CV assays results for biofilm-associated C. albicans ATCC 14053 treated with anti

Concentration of antifungal agents Means absorbance at 490 nm ±using XTT assay

Allicin Fluc

2 × MIC 0.208 ± 0.050ab 0.141 × MIC 0.248 ± 0.020bc 0.16½ × MIC 0.288 ± 0.037cd 0.17¼ × MIC 0.323 ± 0.028d 0.20Untreated control 0.484 ± 0.102e

–e Means ± SD in a column with different superscript differ significantly (p < 0.005) using

Fold change in target gene expression

= Ratio of target gene expression(experiment/untreated control)Ratio of reference gene expression(experiment/untreated control)

Relative real time RT-PCRRelative real time RT-PCR reactions to confirm the significant

gene expression results obtained via semi-quantitative RT-PCRwere carried out using TMSYBR Green qPCR Master Mix (Fermentas,EU) via Bio-Rad MiniOpticonTM system (USA). The cycling condi-tions included an initial step at 50 ◦C for 2 min; holding at 95 ◦Cfor 10 min, 40 cycles of denaturation at 95 ◦C for 15 s and subse-quently annealing at 60 ◦C for 1 min. Finally, the melting reactionwas 72–99 ◦C (Uppuluri et al. 2009). Relative gene expression wasquantified by the Pfaffl method (Pfaffl 2001) as follows:

Fold change in target gene expression

= (Etarget)�Ct target(control-treated)

(Ereference)�Ct reference(control-treated)

Statistical analysisWith regards to quantification of biofilm formation via XTT and

CV assays and picture scoring the reduction of cells in biofilm bySEM, as well as relative quantification of gene expression, all datawas collected and examined in terms of normality and then one wayanalysis of variance (ANOVA) was carried out. On the other hand,independent T-test was used to compare two biofilm-associatedantifungal-treated groups. p Values of <0.05 were considered sig-nificant. Statistical analysis was performed using SPSS version 17software (SPSS Inc., Chicago, IL). All experiments were carried outin at least triplicates.

Results

The inhibitory effect of the tested antifungal agents on growthof C. albicans has been indicated to decrease the number of cellsduring a range of time.

fungal agents in different concentration based on MIC (�g/ml).

SD Means absorbance at 590 nm ± SDusing CV assay

onazole Allicin Fluconazole

7 ± 0.006a 1.523 ± 0.151a 1.340 ± 0.131a

3 ± 0.033a 1.581 ± 0.548a 1.345 ± 0.086a

1 ± 0.025a 1.640 ± 0.190a 1.432 ± 0.076a

0 ± 0.004ab 1.691 ± 0.086a 1.515 ± 0.132a

2.306 ± 0.054b

Duncan test. The results were performed in four independent experiments.

A. Khodavandi et al. / Phytomedicine 19 (2011) 56– 63 59

Fig. 1. Scanning electron microscopy pictures of growing C. albicans ATCC 14053 biofilm. (a) Untreated control, the morphology was composed by compact multilayereds e hyphae were observed, with less number of cells. (c) Treated with ½× MIC of allicin,g ajor changes in biofilm structure, reduced cell clumps with mostly yeast form observed.( amentous form. Magnification 600×.

aCCga

segstdaobarw

0

100

200

300

400

500

600

700

800

900

2 MICMIC1/2 MIC1/4 MIC0

Num

ber o

f cel

ls Allicin

Fluconazole

tructures including cells and hyphae. (b) Treated with ¼× MIC of allicin, less trureater reduction of hyphae and cells observed. (d) Treated with 1× MIC of allicin, me) Treated with 2× MIC of allicin, complete destruction of biofilm structure and fil

Table 2 shows the significant results for reduction of biofilmfter treatment with antifungal agents using XTT (p < 0.001) andV (p < 0.005) assays. Quantification of biofilms also indicated that. albicans ATCC 14053 biofilm treated with allicin was almost asood as fluconazole-treated in terms of biofilm reduction in XTTnd CV assays (p > 0.05).

Our favorable findings were visually verified by SEM. Fig. 1hows that the growing biofilms consisting of compact multilay-red structures including cells and hyphae in untreated controlroup while the majority of matrix was lost during dehydrationtage in SEM procedures (Lopez-Ribot 2005). Although it is not clearo observe, the allicin-treated biofilm was reduced in number andensity of cells and also hyphae depending on concentration ofllicin and fluconazole. Regarding the SEM pictures from biofilmf Candida-treated with antifungals at different concentrations

ased on MIC, Fig. 2 shows the distribution of C. albicans-biofilm-ssociated that is treated with antifungals indicating significanteduction in the number of cells compared to untreated controlith increasing concentration of the antifungal agents (p < 0.001).

Concentration of antifungal agents based on MIC ( μg/ml)

Fig. 2. Distribution of C. albicans-biofilm-associated at different concentrations ofantifungal-tested based on MICs (�g/ml).

60 A. Khodavandi et al. / Phytomedicine 19 (2011) 56– 63

Fig. 3. Gel electrophoresis of semi quantitative RT-PCR products of HWP1 gene from C. albicans ATCC 14053 treated with allicin (a) and fluconazole (b). M: 100 bp DNALadder, A1: Actin with 2× MIC concentration of antifungal agent, H1: HWP1 with 2× MIC concentration of antifungal agent, C1: Internal control without M-MuLV reversetranscriptase, A2: Actin with 1× MIC concentration of antifungal agent, H2: HWP1with 1× MIC concentration of antifungal agent, C2: Internal control without M-MuLV reversetranscriptase, A3: Actin with ½× MIC concentration of antifungal agent, H3: HWP1 with ½× MIC concentration of antifungal agent, C3: Internal control without M-MuLVreverse transcriptase, A4: Actin with ¼× MIC concentration of antifungal agent, H4: HWP1with ¼× MIC concentration of antifungal agent, C4: Internal control withoutM ol), H5M

Odap(t

wzpigftscfu½0fswriltb

-MuLV reverse transcriptase, A5: Actin without antifungal agent (untreated contr-MuLV reverse transcriptase, Co: Control negative for PCR.

n the other hand, it was indicated that treatment with allicin inifferent concentrations of ¼× MIC, ½× MIC and 1× MIC werelmost as good as fluconazole at levels p = 0.182, p = 0.061 and

= 0.062 respectively. While, based on results in high concentration2× MIC), differences between allicin-treated and fluconazole-reated groups were significant at level p < 0.001 (Fig. 2).

In the present study, C. albicans ATCC 14053 (1 × 106 cells/ml)as treated with different concentrations of allicin and flucona-

ole based on two-fold concentrations of MIC (�g/ml) as explainedreviously. All experiments were performed at least from three

ndependent biological samples in duplicates. The representativeel electrophoresis RT-PCR products are exhibited in Figs. 3 and 4or HWP1 and INT1 respectively. Furthermore, our finding showedhat the relative quantification of HWP1 expression displayedignificant down-regulation (p < 0.0001) compared to untreatedontrol after treatment of C. albicans with antifungal drugs in dif-erent concentrations based on MIC. Moreover, the fold changes inntreated control in terms of HWP1 expression for 2× MIC, 1× MIC,× MIC and ¼× MIC of allicin were 0.125 ± 0.005, 0.136 ± 0.006,.139 ± 0.0003 and 0.189 ± 0.005 respectively. Meanwhile, theold changes to untreated control regarding to HWP1 expres-ion for 2× MIC, 1× MIC, ½× MIC and ¼× MIC of fluconazoleere 0.335 ± 0.044, 0.407 ± 0.002, 0.420 ± 0.039 and 0.650 ± 0.020

espectively (Figs. 3 and 5). However, INT1 mRNA was not signif-

cantly down-regulated for antifungal agents-treated samples atevels p = 0.334 and p = 0.428 for allicin and fluconazole respec-ively (Figs. 4 and 5). The reliability of PCR products was confirmedy DNA sequencing method using an outsourcing sequencing

: HWP1 without antifungal agent (untreated control), C5: Internal control without

service (1st BASE, Malaysia). The sequences displayed high simi-larity analyzed via nucleotide Blast in Gene Bank and confirmed interms of homology to the related genes (data not shown).

The significant decrease of HWP1 expression was confirmedusing relative real time RT-PCR as previously explained. Findingsshowed more significant down-regulation of HWP1 expressionthan semi-quantitative RT-PCR method (p < 0.00001). Fig. 6 showsthe relative quantification of HWP1 treated with antifungal agentsusing real time RT-PCR displayed based on Log2. The fold changes interms of HWP1 expression to untreated control for 1× MIC and ½×MIC of allicin were 0.0072 ± 0.003 and 0.195 ± 0.087 respectively.While, the fold changes regarding to HWP1 expression for 1× MICand ½× MIC of fluconazole were 0.077 ± 0.020 and 0.085 ± 0.017respectively.

Discussion

Some of the important virulence attributes in Candida speciesinclude hyphae production, adhesion, phenotypic switching andformation of some extracellular hydrolytic enzymes such asproteinases (Calderone and Fonzi 2001). Colonization of Candidaon the surface of tissue is a primary step to infection. On the otherhand, biofilm is a natural obstacle to treatment with some antifun-gal agents which may result in drug resistance. It is demonstrated

that the ability to form biofilms and degree of pathogenicity couldbe collaborative (Calderone and Fonzi 2001; Yan-Liang 2003). Ithas also been suggested that biofilms of C. albicans usually could becomposed of a complicated structure including yeast cells, hyphae,

A. Khodavandi et al. / Phytomedicine 19 (2011) 56– 63 61

Fig. 4. Gel electrophoresis of semi quantitative RT-PCR products of INT1 gene from C. albicans ATCC 14053 treated with allicin (a) and fluconazole (b). M: 100 bp DNA Ladder,A1: Actin without antifungal agent (untreated control), I1: INT1 without antifungal agent (untreated control), C1: Internal control without M-MuLV reverse transcriptase, A2:Actin with 2× MIC concentration of antifungal agent, I2: INT1 with 2× MIC concentration of antifungal agent, C2: Internal control without M-MuLV reverse transcriptase, A3:Actin with 1× MIC concentration of antifungal agent, I3: INT1with 1× MIC concentration of antifungal agent, C3: Internal control without M-MuLV reverse transcriptase, A4:A ation

A ntratiC

at(b

Fam

ctin with ½× MIC concentration of antifungal agent, I4: INT1 with ½× MIC concentrctin with ¼× MIC concentration of antifungal agent, I5: HWP1with ¼× MIC conceo: Control negative for PCR.

nd pseudohyphae. Mostly, an extra cellular matrix surroundinghe complex could be observed with development of biofilmsAl-Fattani and Douglas 2004). It is demonstrated that growth ofiofilms in a dynamic environment can increase biofilms formed

ig. 5. Relative quantitation of HWP1 and INT1 gene expressions via semi-quantitative Rfter 24 h of treatment with different concentrations of antifungal agents, (*) means signifieans ratio of gene expression with standard error from three independent experiments

of antifungal agent, C4: Internal control without M-MuLV reverse transcriptase, A5:on of antifungal agent, C5: Internal control without M-MuLV reverse transcriptase,

with more matrix material (Al-Fattani and Douglas 2006; Theinet al. 2007) as we have chosen this method for biofilm formation.Importantly, Candida biofilm formation is described in severaloverlapping stages including early (0–11 h), intermediate

T-PCR (normalized to house-keeping gene, actin) in Candida albicans ATCC 14053cant reduction of gene expression to untreated control at level p < 0.0001. Data are

amplified in triplicates.

62 A. Khodavandi et al. / Phytomedicine 19 (2011) 56– 63

MIC (All icin) MIC (Fluconazol e) 1/2MIC (Alli cin) 1/2MIC (Fl uconazol e) Untreat ed control

-0.7

-0.6

-0.5

-0.4

-0.3

-0.2

-0.1

0

0.1

0.2

0.3

0.4

Fold

cha

nge

of g

ene

expr

essi

on (L

og2)

Different concentra tion of antifunga l agent s base d on MIC (µg/ml )

* * * *

Fig. 6. Relative quantitation of HWP1gene expression via real time RT-PCR (normalized to house-keeping gene, actin) calculated with Log in Candida albicans ATCC 14053a e RT-p ent e

(icpdcgm

omfCsoko

irMstCff¼eaMddrRRPdMftrcca

fter 24 h of treatment with different concentrations of antifungal agents by real tim < 0.0001. Data are means of fold changes with standard error from three independ

12–30 h), and maturation (38–72 h) phases. The early stagesnclude adhesion of yeast cells to a solid-surface, individualolonization of cells and organization of yeast cells with hyphaeroduction (Seneviratne et al. 2008). Previous investigationsemonstrated that some important genes in C. albicans couldontribute to biofilm formation. ALS family is included of severallycosylated proteins required for cell–cell recognition duringating (Calderone and Fonzi 2001; Yan-Liang 2003).The silent information regulatory gene (SIR2) is indicated as one

f the significant genes which might interfere with hyphae for-ation. Fresh garlic extract has the potential to suppress hyphae

ormation with concomitant down-regulated SIR2 expression in. albicans (Low et al. 2008). Our finding here has confirmed theignificant inhibition of biofilm in terms of its formation and devel-pment in C. albicans treated with allicin. Nonetheless, little isnown about the main targets and probable molecular mechanismsf allicin against C. albicans.

A previous report has shown a high efficacy of fluconazole tonhibit biofilm formation at 8 �g/ml which was linked to down-egulated HWP1 gene-expression in C. albicans (Bruzual et al. 2007).eanwhile, our findings have demonstrated that allicin could also

ignificantly reduce the expression of HWP1 in all concentrationsested (0.025–0.2 �g/ml) as well as fluconazole (0.25–4 �g/ml) in. albicans using semi-quantitative RT-PCR (Fig. 5). As a matter ofact, the HWP1 expression decreased 7.990, 7.378, 7.194 and 5.314olds at allicin concentrations of 2× MIC, 1× MIC, ½× MIC and× MIC, respectively. Similarly, the down-regulated mRNA lev-

ls of HWP1 were at 2.963, 2.455, 2.370 and 1.541 fold reductiont fluconazole concentrations of 2× MIC, 1× MIC, ½× MIC and ¼×IC, respectively. On the other hand, our RT-PCR results did not

emonstrate any significant decrease in INT1 expression whetherue to allicin or fluconazole (Fig. 5). Moreover, the results of relativeeal time RT-PCR which were more accurate than semi-quantitativeT-PCR also concurred with the findings of the semi-quantitativeT-PCR. These favorable results obtained via relative real time RT-CR indicated that the down-regulated mRNA expression of HWP1ecreased 138.889 and 5.132 folds at allicin concentrations of 1×IC and ½× MIC respectively, compared to 13.005 and 11.763

olds at fluconazole concentrations of 1× MIC and ½× MIC, respec-ively (Fig. 6). Interestingly, the relative real time RT-PCR results

evealed a remarkable suppression of HWP1-expression at 1× MIConcentration of allicin, at a much higher magnitude than 1× MIConcentration of fluconazole. In fact, allicin in this concentrationppeared to suppress HWP1-expression almost to the base-line

2

PCR, (*) means significant reduction of gene expression to untreated control at levelxperiments amplified in triplicates.

level (fold change of expression relative to control = 0.0072). Incontrast, the phenotypic observation of the biofilm disruptionthrough SEM, XTT and CV assays showed that both allicin andfluconazole were approximately similar in their efficacy to reducebiofilm formation. A possible explanation is that as HWP1 is onlyone of the significant genes that contribute towards biofilm for-mation and the molecular mechanism of inhibition of biofilmformation by fluconazole involves not only HWP1 but also otheryet uncharacterized genes.

As for the SEM results, it has been shown that there is nosignificant difference between allicin and fluconazole in terms ofcells-biofilm-associated reduction at ¼× MIC, ½× MIC and 1× MIC(Fig. 2) while fluconazole was more significant than allicin at 2×MIC (p < 0.0001). Therefore, it is probable that in lower concentra-tions, allicin could inhibit biofilms of C. albicans almost as well asfluconazole as a standard anticandidal drug. Most of these abilitiesof allicin may be due to SH-modifying potential because the acti-vated disulfide bond of allicin could affect thiol-containing cellularcomponents such as some proteins, for example glutathione whichis an essential metabolite in C. albicans (Ankri and Mirelman 1999;Miron et al. 2004) or in our findings Hwp1 as a hyphae-specificprotein.

In conclusion, our results demonstrated that allicin could dis-play the potential to inhibit Candida biofilms and also suppressthe expression of HWP1 as a probable target gene. These encour-aging results demonstrated that garlic and its related bioactivecompounds such as allicin could be further developed into analternative or supplementary therapeutic arsenal against Candidainfections in humans.

Acknowledgments

We thank Dr Mohammad Ali Farbodniay Jahromi, seniorresearcher of Fars Technological and Environmental Research Cen-ter, Shiraz-Iran, for helpful guidance and collaboration. Fundingwas partially provided by Science Fund (02-01-04-SF0761) fromthe Ministry of Science, Technology and Innovation of Malaysia.

References

Adetumbi, M., Javor, G.T., Lau, B.H., 1986. Allium sativum (garlic) inhibits lipid syn-thesis by Candida albicans. Antimicrob. Agents Chemother. 30, 499–501.

Al-Fattani, M.A., Douglas, L.J., 2004. Penetration of Candida biofilms by antifungalagents. Antimicrob. Agents Chemother. 48, 3291–3297.

ytome

A

A

B

B

B

C

C

C

D

F

G

G

H

K

K

K

K

L

L

A. Khodavandi et al. / Ph

l-Fattani, M.A., Douglas, L.J., 2006. Biofilm matrix of Candida albicans and Candidatropicalis: chemical composition and role in drug resistance. J. Med. Microbiol.55, 999–1008.

nkri, S., Mirelman, D., 1999. Antimicrobial properties of allicin from garlic. Microb.Infect. 2, 125–129.

raga, P.C., Culici, M., Alfieri, M., Dal Sasso, M., 2008. Thymol inhibits Candidaalbicans biofilm formation and mature biofilm. Int. J. Antimicrob. Agents 31,472–477.

ruzual, I., Riggle, P., Hadley, S., Kumamoto, C.A., 2007. Biofilm formation byfluconazole-resistant Candida albicans strains is inhibited by fluconazole. J.Antimicrob. Chemother. 59, 441–450.

ujdakova, H., Paulovicova, E., Paulovicova, L., Simova, z., 2010. Participation of theCandida albicans surface antigen in adhesion, the first phase of biofilm develop-ment. FEMS. Yeast Res. 59, 485–492.

alderone, R.A., Fonzi, W.A., 2001. Virulence factors of Candida albicans. TrendsMicrobiol. 9, 327–335.

handra, J., Kuhn, D.M., Mukherjee, P.K., Hoyer, L.L., McCormick, T., Ghannoum, M.A.,2001. Biofilm formation by the fungal pathogen Candida albicans: development,architecture, and drug resistance. J. Bacteriol. 183, 5385–5394.

handra, J., Mukherjee, P.K., Ghannoum, M.A., 2008. In vitro growth and analysis ofCandida biofilms. Nat. Protoc. 3, 1909–1924.

avis, S.R., 2005. An overview of the antifungal properties of allicin and its break-down products – the possibility of a safe and effective antifungal prophylactic.Mycoses 48, 95–100.

inkel, J.S., Mitchell, A.P., 2010. Genetic control of Candida albicans biofilm develop-ment. Nat. Rev. Microbiol. 9, 109–118.

hannoum, M., 1988. Studies on the anticandidal mode of action of Allium sativum(Garlic). J. Gen. Microbiol. 134, 2917–2924.

hannoum, M., 1990. Inhibition of Candida adhesion to buccal epithelial cells by anaqueous extract of Allium sativurn (garlic). J. Appl. Microbiol. 68, 163–169.

arris, J.C., Cottrell, S.L., Plummer, S., Lloyd, D., 2001. Antimicrobial properties ofAllium sativum (garlic). Appl. Microbiol. Biotechnol. 57, 282–286.

hodavandi, A., Alizadeh, F., Aala, F., Sekawi, Z., Chong, P.P., 2010. In vitro investiga-tion of antifungal activity of allicin alone and in combination with azoles againstCandida species. Mycopathologia 169, 287–295.

hodavandi, A., Alizadeh, F., Harmal, N.S., Sidik, S.M., Othman, F., Sekawi, Z., Farbood-niaye Jahromi, M.A., Ng, K-P., Chong, P.P., 2011. Comparison between efficacyof allicin and fluconazole against Candida albicans in vitro and in a systemiccandidiasis mouse model. FEMS Microbiol. Lett. 315, 87–93.

inneberg, K.M., Bendel, C.M., Jechorek, R.P., Cebelinski, E.A., Gale, C.A., Berman, J.G.,Erlandsen, S.L., Hostetter, M.K., Wells, C.L., 1999. Effect of INT1 gene on Candidaalbicans murine intestinal colonization. J. Surg. Res. 87, 245–251.

lis, F.M., Sosinska, G.J., de Groot, P.W.J., Brul, S., 2009. Covalently linked cell wallproteins of Candida albicans and their role in fitness and virulence. FEMS YeastRes. 9, 1013–1028.

emar, K.M., Turner, M.P., Lloyd, D., 2002. Garlic (Allium sativum) as an anti-Candida

agent: a comparison of the efficacy of fresh garlic and freeze-dried extracts. J.Appl. Microbiol. 93, 398–405.

emar, K.M., Passa, O., Aon, M.A., Cortassa, S., Muller, C.T., Plummer, S., O’Rourke,B., Lloyd, D., 2005. Allyl alcohol and garlic (Allium sativum) extract produceoxidative stress in Candida albicans. Microbiol. 151, 3257–3265.

dicine 19 (2011) 56– 63 63

Lemar, K.M., Aon, M.A., Cortassa, S., O’Rourke, B., Müller, C.T., Lloyd, D., 2007. Diallyldisulphide depletes glutathione in Candida albicans: oxidative stress-mediatedcell death studied by two-photon microscopy. Yeast 24, 695–706.

Lim, Y.H., Li, D.H., 2002. Multiplex polymerase chain reaction assay for simulta-neous detection of Candida albicans and Candida dubliniensis. J. Microbiol. 40,146–150.

Lim, C.S.Y., Wong, W.F., Rosli, R., Ng, K.P., Seow, H.F., Chong, P.P., 2009. 2-Dodecanol(decyl methyl carbinol) inhibits hyphal formation and SIR2 expression in C.albicans. J. Basic Microbiol. 49, 579–583.

Lopez-Ribot, J.L., 2005. Candida albicans biofilms: more than filamentation. Curr. Biol.15, 453–455.

Low, C.F., Chong, P.P., Yong, P.V.C., Lim, C.S.Y., Ahmad, Z., Othman, F., 2008.Inhibition of hyphae formation and SIR2 expression in Candida albicanstreated with fresh Allium sativum (garlic) extract. J. Appl. Microbiol. 105,2169–2177.

Miron, T., Bercovici, T., Rabinkov, A., Wilchek, M., Mirelman, D., 2004. [3H]Allicin:preparation and applications. Anal. Biochem. 331, 364–369.

Nobile, C.J., Mitchell, A.P., 2006. Genetics and genomics of Candida albicans biofilmformation. Cell. Microbiol. 8, 1382–1391.

Nobile, C.J., Nett, J.E., Andes, D.R., Mitchell, A.P., 2006. Function of Can-dida albicans adhesin Hwp1 in biofilm formation. Eukaryot. Cell 5,1604–1610.

Nobile, C.J., Schneider, H.A., Nett, J.E., Sheppard, D.C., Filler, S.G., Andes, D.R., Mitchell,A.P., 2008. Complementary adhesin function in C. albicans biofilm formation.Curr. Biol. 18, 1017–1024.

Peeters, E., Nelis, H.J., Coenye, T., 2008. Comparison of multiple methods for quan-tification of microbial biofilms grown in microtiter plates. J. Microbiol. Methods72, 157–165.

Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-timeRT-PCR. Nucleic Acids Res. 29, e45.

Pierce, C.G., Uppuluri, P., Tristan, A.R., Wormley Jr., F.L., Mowat, E., Ramage, G., Lopez-Ribot, J.L., 2008. A simple and reproducible 96-well plate-based method forthe formation of fungal biofilms and its application to antifungal susceptibilitytesting. Nat. Protoc. 3, 1494–1500.

Seneviratne, C.J., Jin, L., Samaranayake, L.P., 2008. Biofilm lifestyle of Candida: a minireview. Oral Dis. 14, 582–590.

Shuford, J.A., Steckelberg, J.M., Patel, R., 2005. Effects of fresh garlic extract on Can-dida albicans biofilms. Antimicrob. Agents Chemother. 49, 473.

Staab, J.F., Bradway, S.D., Fidel, P.L., Sundstrom, P., 1999. Adhesive and mammaliantransglutaminase substrate properties of Candida albicans Hwp1. Science 283,1535–1538.

Thein, Z.M., Samaranayake, Y.H., Samaranayake, L.P., 2007. In vitro biofilm forma-tion of Candida albicans and non-albicans Candida species under dynamic andanaerobic conditions. Arch. Oral Biol. 52, 761–767.

Uppuluri, P., Chaturvedi, A.K., Lopez-Ribot, J.L., 2009. Design of a simple model ofCandida albicans biofilms formed under conditions of flow: development, archi-

tecture, and drug resistance. Mycopathologia 168, 101–109.

Yamada, Y., Azuma, K., 1977. Evaluation of the in vitro antifungal activity of allicin.Antimicrob. Agents Chemother. 11, 743–749.

Yan-Liang, Y., 2003. Virulence factors of Candida species. J. Microbiol. Immunol.Infect. 36, 223–228.