ORIGINAL ARTICLE

Molecular Analysis of the Spatio-temporal Distributionof Sulfate-reducing Bacteria (SRB) in Camargue (France)Hypersaline Microbial Mat

Aude Fourçans & Anthony Ranchou-Peyruse &

Pierre Caumette & Robert Duran

Received: 16 March 2007 /Accepted: 25 September 2007 /Published online: 19 October 2007# Springer Science + Business Media, LLC 2007

Abstract The spatio-temporal distribution of sulfate-reducingbacteria (SRB) in the microbial mat of Camargue (Salins-de-Giraud, France) was investigated by molecular approachesat both microscale spatial resolution and different taxonom-ic organization levels. The vertical distribution of the SRBpopulations was correlated with oxygen and sulfide micro-gradient fluctuations. Comparisons of Terminal restrictionfragment length polymorphism (T-RFLP) fingerprintsshowed distinct locations of some operational taxonomicunits at daytime and at night (4:00 or 15:00 hours) revealingimportant differences on the structures of the bacterialcommunities. When oxygen penetrates the mat, SRBmigration was observed either downward to reach deeperanoxic zones to escape oxygen or upward to reach oxicsurface zones. When no migration was observed, bothmetabolism switches and aggregate formations were sus-pected. These behaviors allowed the aerotolerant SRB todeal with oxygen. The analysis of the Desulfococcus–Desulfonema–Desulfosarcina T-RFLP profiles revealedup-migrating populations related to both Desulfonema sp.

and Desulfosarcina variabilis. T-RFLP profiles combinedwith 16S ribosomal ribonucleic acid gene library analysisof the Desulfobacter group revealed two distinct popula-tions: a population related to the recently describedDesulfotignum genus migrating upward during the nightand a population of a new species of the Desulfobacteruniformly located throughout the mat independent of theperiod. Thus, the identification of the new oxygen-tolerantSRB will provide the basis for understanding the physio-logical adaptations to oxygen.

Introduction

Microbial mats are fine and vertically laminated structureswhere sharp environmental microgradients influence thedistribution of a few functional groups of microorganisms[48]. These ecosystems develop in habitats as diverse as hotsprings [12, 35, 39], salterns [3, 17, 19], intertidal sedi-ments [50], or alkaline lakes [13, 34, 44]. Among diversemetabolic processes coexisting in hypersaline microbialmats, dissimilatory sulfate reduction is the dominant processof anaerobic carbon mineralization independent of depth andthe presence of oxygen [2, 17, 21]. Because of the compactnature of the microbial mat, the coexistence of all thedifferent biological activities generates microgradientsinside the mat [37]. During the diel cycle, these gradientschange dramatically, exposing bacteria to extremely vari-able conditions. Sulfate-reducing bacteria (SRB) are strictanaerobes that are often found in biotopes where transientoxic conditions can exist. They have developed behavioralor molecular defense strategies to survive exposure tooxygen (for review, see [1, 9]). These behavioral strategiesinclude migration and aggregate formation allowing them

Microb Ecol (2008) 56:90–100DOI 10.1007/s00248-007-9327-x

P. Caumette :R. Duran (*)Equipe Environnement et Microbiologie—UMR IPREM 5254—IBEAS, Université de Pau et des Pays de l’Adour,avenue de l’Université, BP 1155, 64013 Pau Cedex, Francee-mail: robert.duran@univ-pau.fr

A. FourçansLaboratoire de Génomique des Archaea, Institut de Génétique etMicrobiologie, UMR CNRS 8621, Université Paris Sud XI,Bât 400, 91405 Orsay Cedex, France

A. Ranchou-PeyruseSchool of Civil and Environmental Engineering,Georgia Institute of Technology,311 Ferst Drive,Atlanta, GA 30332-0512, USA

to create favorable zones for their metabolism and theirpossible growth [11, 43]. Migrations to favorable zones arecontrolled by aerotaxis involving proteins to sense oxygenconcentration or redox potential [10]. Molecular strategiesinclude more complex biochemical mechanisms involvingenzymatic systems dedicated to the reduction and theelimination of oxygen and its reactive species [1]. Severaladaptive mechanisms aiming at tolerating the free radicalsproduced under oxic conditions were found in SRBindicating that SRB had already diverged into severalgroups before oxygen adaptations were required [16]. SRBof the genus Desulfovibrio, Desulfobulbus, and Desulfo-bacterium have turned out to be able to reduce oxygen withat least one substrate as an electron donor [7]. However,under aerobic conditions, they grew poorly indicating thatthe oxygen reduction by SRB is a protective mechanismagainst the harmful effects of oxygen rather than an energy-generating mechanism allowing growth [20, 30]. Further-more, SRB exhibit their highest rates of sulfate reductionunder oxic conditions [2], which is enhanced by hightemperature and/or supply of labile carbon from autotrophs[17]. In microbial mats, SRB have been found in oxic zoneswith a peculiar spatial distribution. Members of theDesulfococcus and Desulfovibrio groups have beendetected in the upper part of the photooxic zone inmicrobial mats from Guerrero Negro (Baja California,Mexico) [38], whereas the upper zone was dominated bymembers of the Desulfonema-like group [31, 32] inmicrobial mats from Solar lake (Egypt). The descriptionof the SRB distribution in microbial mats depending on thefluctuation of the environmental parameters is of specialinterest to reveal the relationship between the physiologiesof organisms in culture and their environmental distributionand their activities.

The Camargue microbial mat of Salins-de-Giraud hasbeen studied for 10 years [3, 14, 33, 51]. Recently, wereported a general description of bacterial communitiesfrom Camargue microbial mats [14] showing a correlationbetween the bacterial organization and the environmentalparameters at a microscale level. We also reported themigration of the phototrophic populations in response to theimportant fluctuations of environmental parameters duringa diel cycle [15]. Previous studies showed that sulfatereduction rates were significantly higher at daytime than atnight [51]. Under these oscillating conditions, furtherstudies on the sulfate-reducing community are needed tofully understand the behavior of these populations inresponse to the variations. This work aimed at determiningthe dynamic of the SRB populations to follow theircapacities of adaptation when environmental conditionsvary. For this purpose, two contrasted periods wereanalyzed, at 15:00 hours when oxygen produced bycyanobacterial photosynthesis penetrates the mat and at

4:00 hours when most part of the mat is anoxic [51]. Thepresent report describes the spatio-temporal distribution ofSRB communities within Camargue microbial mat toevaluate the impact of different biotic and abiotic param-eters on their distribution. Terminal restriction fragmentlength polymorphism (T-RFLP) [28] and 16S ribosomalribonucleic acid (rRNA) gene library analysis were com-bined to analyze the SRB communities with a special focuson Desulfococcus, Desulfonema, Desulfosarcina, andDesulfobacter genera, the related members of which arelocated at the oxic–anoxic interface [45] enduring dailyfluctuations. These molecular techniques allowed thedetermination of the distribution of the SRB at a microscalelevel according to environmental parameters. Our resultshave revealed different migration patterns of the investigat-ed SRB genera. New oxygen-tolerant SRB populationswere detected, and their migration patterns were deter-mined. In this article, we provide new insights on thebehavior of SRB species in the Camargue mat, which maybe useful to understand the physiological adaptations of thismicrobial group to cope with oxygen and their participationto the structure of the microbial mat.

Materials and Methods

General Information

This analysis was performed on the microbial mat of theSalins-de-Giraud saltern in June 2001. Over 1 year (March2000–June 2001), the physical and chemical parametersmeasured in the sampling site at 15:00 hours were generallyconstant in the water column: Temperature ranged between21 and 25°C, O2 between 17 and 20 mg L−1, salinitybetween 70 to 110 ‰ (w/v), and pH between 8.1 and 8.5.During the sampling campaign, the temperature varied from25°C at 15:00 hours to 12.5°C at 4:00 hours [51]. Inparallel, in situ microsensor measurements determined twoperiods contrasted by their physicochemical parameters(O2, H2S, pH) [51], summarized in Table 1. In theafternoon, a clear upper oxic zone of 1.5 mm was definedabove an anoxic part down to the fourth millimeter. Atnight, the oxic zone was restricted to the upper 0.5 mm ofthe mat. This zone overlapped with sulfide, whereas thezone below (0.5–4 mm) was completely anoxic.

Sampling Procedure

Microbial mats were sampled from a very large shallowpond at the saltern of Salins-de-Giraud, close to the sandbarrier and seacoast (43°27′35″N, 04°41′28″E, Camargue,France). Several samples were collected at different timesover a diel cycle from 11 to 12 June 2001 for several

SRB Spatio-temporal Distribution in Camargue Microbial Mat 9191

studies [15, 49, 51]. To study the spatio-temporal distributionof SRB, the samples recovered at both 15:00 and 4:00 hourswere analyzed.

For T-RFLP analysis, triplicate samples (15:00 and4:00 hours) of mat cores (35 mm inner diameter) weresampled with 50-mL falcon tubes. The upper 10 mm of themat core was sliced off aseptically, transferred into sterilepetri dishes, frozen in nitrogen liquid, transported in dry ice,and finally stored at −80°C until further analysis. Thesefrozen mat samples were sliced, with a cryomicrotome, atabout 100 μm thick for the first 2 mm and 200 μm thick forthe next 2 mm. Because microsensor measurements showedchemically distinct zones [51] (Table 1), the mat wasdivided into 11 horizons within the top 4 mm from thesurface. They were preferred to focus directly on SRBbehavior in each different chemical zone including the oxic,the overlapping oxygen sulfide, the anoxic–sulfidic, and theanoxic–nonsulfidic zones. Eleven slices were selected torepresent the following 11 horizons: 0–0.1, 0.3–0.4, 0.6–0.7,0.9–1, 1.2–1.3, 1.5–1.6, 1.8–1.9, 2–2.2, 2.6–2.8, 3.4–3.6,3.6–4. Three replicates from each slice were individuallyanalyzed to characterize bacterial communities.

DNA Extraction

From each mat slice, genomic deoxyribonucleic acid(DNA) was extracted with the UltraClean Soil DNAIsolation Kit (MoBio Laboratories,USA), according to therecommendations of the supplier, except for the first stepwhere 10 mM ethylenediamine tetraacetic acid were addedto avoid degradation of genomic DNA. All extractedgenomic DNA samples were stored at −20°C until furtherprocessing.

T-RFLP Analysis

The 16S rRNA genes of bacterial populations wereamplified using fluorescent-labeled primers. Different pri-mers were used to assess the structure of the bacterialcommunity of the mat (Table 2). To target the communityof the domain Bacteria, a “direct” 35 cycle polymerasechain reaction (PCR) reaction with the bacterial primer pair8f-1489r [27, 47] was performed, amplifying a large part ofthe 16S rRNA gene. To obtain fingerprints of SRBpopulations, different couples of primers (Table 2) targeting

Table 1 Summary of physicochemical data measured (averages; n=2–3) at specific times (4:00 and 15:00 hours) during the diel cycleanalyzed, from Wieland et al. 2005 [51]: in situ water variation of

temperature, salinity, downwelling scalar irradiance on the matsurface, in situ depth profiles of O2, pH, H2S, Stot (total sulfide), andsulfate reduction rate (SRR)

Depth(mm)

Temperature(°C)

Salinity(‰)

Irradiance(μmol photonsm−2 s−1)

O2 (μM) pH H2S (μM) Stot (μM) SRR (nmolcm−3 h−1)

4 h 15 h 4 h 15 h 4 h 15 h 4 h 15 h 4 h 15 h 4 h 15 h 4 h 15 h 4 h 15 h

0 12.5 25 90 80 0 1909 16 752.3 8.3 9.2 0 0 0 0 <100 <1000.5 – – – – – – 0.3 865 7.7 9.3 6.5 0 25.5 0 <100 2001 – – – – – – 0 238.5 7.3 9.4 45.3 0 105.5 0 100 6001.5 – – – – – – 0 0 7.2 9 84.9 0 168.1 0 100 8002 – – – – – – 0 0 7.1 7.3 99 63.6 187.2 185.4 200 12002.5 – – – – – – 0 0 7.1 7 <90 168.1 – 328.3 200 12003 – – – – – – 0 0 7.1 6.9 – 202.6 – 356.7 200 12003.5 – – – – – – 0 0 7.1 6.9 – – – – 100 10004 – – – – – – 0 0 7.1 6.9 – – – – 100 600

– Not determined, 0 not detected, i.e., below the analytical detection limit that corresponds to 0.1 and 0.3 μM for O2 and S compounds, respectively

Table 2 Primers sets used for 16S rRNA gene amplification. Primer names are based on E. coli sequence numbering

Primer Sequence (5′3′)a Fragment size (bp) Target group Reference

8F AGAGTTTGATCCTGGCTCAG 1,481 Bacteria [27, 47]1489R TACCTTGTTACGACTTCADCC305F GATCAGCCACACTGGRACTGACA 860 Desulfococcus–Desulfonema–Desulfosarcina [6]DCC1165R GGGGCAGTATCTTYAGAGTYCDSB127F GATAATCTGCCTTCAAGCCTGG 1,146 Desulfobacter [6]DSB1273R CYYYYYGCRRAGTCGSTGCCCT

aY=C+T, R=A+G, S=C+G

92 Fourçans et al.

a few genera of SRB were used [6]. A 35-cycle “nested”PCR amplification was performed using amplified DNA ofthe “direct” PCR (obtained with Bacteria primers) astemplate to detect SRB present in lower numbers in the4 mm of the mat. The first set (DCC305F-DCC1165R)targets specifically the 16S rRNA gene of the three generaDesulfococcus, Desulfonema, and Desulfosarcina. Thesecond pair (DSB127F-DSB1273R) was described to targetonly the genus Desulfobacter. Forward (f) primers werefluorescently labeled with TET fluorochrome (5-Tetra-chloro-fluorescein). The restriction enzyme used in T-RFLPanalysis was HaeIII (New England Biolabs, UK). Restric-tion fragments were separated by capillary electrophoresiswith an ABI Prism 310 (Applied Biosystems). Triplicatesfor each horizon were analyzed separately to avoidanalytical artifacts and assure the reproducibility of themethod. Dominant terminal restriction fragments (T-RFs)more than 100 fluorescent units in intensity and present ineach replicate sample were selected. T-RFLP profiles werenormalized by calculating relative abundances (the averageobtained from each replicate) of each T-RFs using heightfluorescence intensity. Correspondence analysis (CA) andcanonical correspondence analysis (CCA)—multivariatestatistical methods—were used to compare normalized T-RFLP profiles and correlate the microbial data with thephysicochemical parameters, respectively. CA and CCAwere performed using the MVSP v3.12d software (KovachComputing Service, Anglesey, Wales) [22]. Predictive

digestions were performed at the Ribosomal DatabaseProject (RDP) website (http://rdp.cme.msu.edu/; [29]),using the program TAP-TRFLP, to relate the different T-RFs to a certain genus or species.

Construction of Desulfobacter 16S rRNA Gene Library

To further characterize the populations related to theDesulfobacter genus, 16S rRNA gene libraries wereconstructed. Genomic DNA from mat slices was used toamplify the 16S rRNA gene with the Desulfobacter sp.primers (unlabeled) presented in Table 2. The PCR productswere cloned in Escherichia coli with the Topo TA cloningkit (Invitrogen, Paisley, UK). For each slice analyzed, denovo PCR products of the insert from 100 clones weredigested by HaeIII or Hin6I enzymes. Restriction profileswere analyzed on a 2.5% agarose gel electrophoresis with ahigh-resolution agarose (Metaphor, Tebu-bio). The compar-ison of restriction profiles allowed the assessment of majorpopulations in each slice.

16S rRNA Gene Sequence Analysis

16S rRNA gene fragments from clones were amplified byPCR using the primers TOP1 (5′-GTGTGCTGGAATTCGCCCTT-3′) and TOP2 (5′-TATCTGCAGAATTCGCCCTT-3′), which surround the cloning site. Whole sequencesof the 16S rRNA gene were determined by primer walking

Axis 2 (9%)

Axis 1 (11%)

0-0.1/15h

0.3-0.4/15h 0.6-0.7/15h

0.9-1/15h

1.2-1.3/15h

1.5-1.6/15h 1.8-1.9/15h

2-2.2/15h2.6-2.8/15h

3.4-3.6/15h

3.6-4/15h

0-0.1/4h

0.3-0.4/4h

0.6-0.7/4h 0.9-1/4h

1.2-1.3/4h

1.5-1.6/4h

1.8-1.9/4h

2-2.2/4h

2.6-2.8/4h

3.4-3.6/4h

3.6-4/4h

-0.4

-0.8

-1.2

-1.6

-1.9

0.4

0.8

1.2

1.6

-0.4-1.2 -1.6 -1.9 0.4 1.2 1.6

Fig. 1 Correspondence Analy-sis (CA) of the bacterial com-munities of the Bacteria domainof each layer of the mat at 15:00(open symbol) and 4:00 hours(close symbol). Each communitywas represented by a 5′-endT-RFLP pattern correspondingto the HaeIII digest of the16S rRNA gene. CA analyseswere performed by usingthe average values of the relativeabundance of three replicatesbecause no differences wereobserved between the replicatesin CA plots

SRB Spatio-temporal Distribution in Camargue Microbial Mat 9393

using the Big Dye Terminator v 3.1 cycle sequencing kit(Applied Biosystem, Foster City). Chimera formation in thesequences was checked at the RDP web site (http://rdp.cme.msu.edu/; [29]). All 16S rRNA gene sequences werealigned using ClustalX software [46] with 16S rRNA genesequences of type strains. This alignment was used toconstruct a phylogenetic tree with Mega v2.1 [26] by theneighbor-joining method [40]. The accession numbers ofthe sequences determined during this work are indicated onthe phylogenetic tree.

Results

Structures of the Bacterial Communities

Structures of the bacterial communities in each microbialmat zone were determined by T-RFLP analysis at night(4:00 hours) and at daytime (15:00 hours). T-RFLP finger-prints consist of a range of T-RFs of 16S rRNA genes. Eachof these is defined as an operational taxonomic unit (OTU).T-RFLP profiles (data not shown) revealed a lower numberof OTUs at 4:00 hours (mean 38 [standard deviation, SD ±2]OTUs) than at 15:00 hours (mean 50 [SD ±5] OTUs),suggesting a reorganization of the structures of the bacterialcommunities within the mat. When T-RFLP profiles werecompared by CA (Fig. 1), day samples clustered separatelyfrom night samples. This indicated that the distribution of

bacterial communities in the mat at night differed from thatobserved at daytime. The separation between the day andnight groups is explained by the first axis that represents11% of the variation. In addition, the CA showed thatwithin each group, deep and surface horizons were sep-arated along the second axis (9% of the variation). More-over, the distribution of the horizons 2 and 5 at 4:00 hoursnear the origin of the axis suggested that their bacterialcommunities had a structure similar to those observed at15:00 hours. When plotting the T-RFs, the T-RFs influenc-ing the distribution were identified (data not shown).During the night (4:00 hours) T-RFs 69, 116, and 251 bpwere dominant in the middle horizons (3, 4, and 6),whereas T-RFs 65, 225, and 322 bp were the main T-RFsin the deeper horizons. At daytime (15:00 hours), thesurface horizons were dominated by T-RFs 79, 237, and289 bp, whereas T-RFs 81 and 291 bp were the majorT-RFs in the deeper horizons. None of these T-RFs could beaffiliated precisely to bacterial species.

Structures of the Sulfate-reducing Community

The spatio-temporal distribution of SRB was analyzed byT-RFLP. Two sets of primers were used targeting specifi-cally SRB groups known for their versatile metabolisms[45]. These two groups were made of Desulfococcus–Desulfonema–Desulfosarcina genera and Desulfobactergenus, respectively.

Fig. 2 Relative abundance of the populations (T-RF) of theDesulfosarcina, Desulfococcus, and Desulfonema genera in theCamargue mat present at both 4:00 and 15:00 hours for each horizonof the mat. Data were obtained from HaeIII 5′-end T-RFLP profiles.

The left outline corresponds to schematic oxygen/sulfur profiles alongthe 4 mm of the mat, obtained from Wieland et al. [51]: oxic zone(white), oxygen sulfide-overlapped zone (bright gray), anoxic zonewithout sulfide (gray), and anoxic–sulfidic zone (black)

94 Fourçans et al.

Desulfococcus–Desulfonema–Desulfosarcina Genera

To compare the spatio-temporal structures at daytime and atnight, the distributions of OTUs found on both periods aresummarized on Fig. 2. Three OTUs (101, 122, and 127 bp)were observed in deeper layers at 15:00 than at 4:00 hours.OTUs of 101 and 127 bp were kept in anoxic zones,whereas the OTU of 122 bp was found in the oxic–sulfidicsurface layer during the night and in the deepest anoxiclayer during the day. In contrast, eight OTUs (108, 109,110, 121, 191, 194, 280, and 286 bp) were present in oxicupper layers in the afternoon, whereas they were located inanoxic zone during the night.

Microbial data were correlated with the biogeochemicalparameters using a CCA (Fig. 3). The day samples aredistributed along the first axis, which explains 11% of thevariation, whereas the night samples are separated along thesecond axis (8% of the variation). The CCA also revealedthe influence of the main parameters on the distribution ofthe OTUs. The OTUs of 109, 191, 194, and 286 bp aredistributed along the O2 axis. The OTU of 108 bp is locatedalong the H2S axis, whereas the OTU of 101 bp is situatedon the pH axis (Fig. 3). The distribution of the OTU of127 bp is influenced by both O2 and H2S. However, theCCA could not determine the factor influencing the OTUsof 110, 121, 122, and 280 bp.

As a tentative identification, predictive digestions ofthe SRB 16S rRNA sequences available in GenBankdatabase indicated that OTU of 110 bp could correspondto Desulfonema sp. and that OTU of 286 bp could berelated to Desulfosarcina variabilis. Because several dis-tinct bacterial species may have the same T-RF, T-RFLPdoes not provide a sure identification. Therefore, cloningand sequence analysis will be required for an accurateidentification.

Desulfobacter Genus

Whatever the horizon, T-RFLP fingerprints contained a lowOTU number (mean 14, SD ±4). Three of them showeddifferent distributions at daytime and at night whencomparing day and night fingerprints (Fig. 4). An OTU of157 bp was localized along the 4 mm of the mat both atnight and at daytime independently of the presence ofoxygen. However, this OTU was the dominant populationin the nonsulfidic anoxic zone during the day, whereas itdominated deeper zones at night. In contrast, an OTU of306 bp was observed specifically in the 0–1.6 mm zone at4:00 and at 15:00 hours in the 1.2–4 mm, i.e., the anoxiczone. Furthermore, the OTU of 170 bp had an interestingbehavior because it was distributed along the 4 mm of themat at 4:00 hours and found located in the oxic upper layer at

Fig. 3 Canonical Correspon-dence Analysis (CCA) betweenthe Desulfosarcina, Desulfococ-cus, and Desulfonema genera ofeach layer of the mat at 15:00(white triangles) and 4:00 hours(black triangles) and environ-mental variables measured atthese two hours: pH andconcentration of H2S andO2. Each community was repre-sented by a 5′-end T-RFLPpattern corresponding to theHaeIII digestion of the 16SrRNA gene. The T-RFs are alsoplotted; up-migrating T-RFs areindicated by gray circles anddown-migrating T-RFs by graysquares. CCA analyses wereperformed by using the averagevalues of the relative abundanceof three replicates becauseno differences were observedbetween the replicates inCCA plots

SRB Spatio-temporal Distribution in Camargue Microbial Mat 9595

15:00 hours. Predictive digestions of 16S rRNA sequencesshowed that the OTU of 157 bp could correspond to allDesulfobacter species so far described. The OTU of 306 bpwas affiliated to a species of the recently described genusDesulfotignum, closely related to the Desulfobacter genus[25]. The OTU of 170 bp could not be affiliated tosequences deposited in databanks.

Characterization of Desulfobacter Community

To further characterize the Desulfobacter community, theSRB inhabiting the first 0.1 mm and the 3.6–4-mm zone ofthe mat at 4:00 and 15:00 hours were analyzed by 16SrRNA gene libraries. Indeed, these zones were stronglycontrasted according to T-RFLP patterns. Clones weregrouped in function of their HaeIII and Hin6I restrictionpatterns. Combining both enzymes, 12 distinct RFLPpatterns were defined and named from “aa” to “ja.” The firstletter defines the profile obtained withHaeIII and the secondthat obtained with Hin6I. Figure 5a represents the distri-bution of the identified dominant groups in these twodifferent horizons. It is interesting to note that the clonescorresponding to the dominant groups are inversely distrib-uted during the two contrasted periods. Whereas the first0.1 mm was dominated by the profile type “aa” at 4:00 hours(37%) and by the profile type “ea” at 15:00 hours (50%), the3.6–4-mm zone was dominated by the profile type “ea” at4:00 hours (70%) and by the profile type “aa” at 15:00 hours

(21%). Sequences of each profile type were determined.As expected, when using specific primers targeting theDesulfobacter group, 16S rRNA sequence analysis demon-strated that all cloned sequences were affiliated to the genusDesulfobacter (Fig. 5b). The profile type “aa” was related toDesulfotignum sp. characterized by a T-RF of 306 bp (clonesA4-1-70 and A15-30-10). The profile type “ea” wascharacterized by a T-RF of 157 bp that could correspond toseveral species. Clone A4-1-6 was closely related to speciesof the genus Desulfotignum, whereas clones A15-1-2, A15-30-22 and A4-30-2 could constitute new taxa because theycould not be related to known members of Desulfotignum orDesulfobacter.

Discussion

The spatio-temporal distribution of bacterial communitiesin the Camargue mat was revealed by molecularapproaches. By increasing the analysis specificity, differentlevels of taxonomic organization have been analyzed fromthe community (Bacteria domain T-RFLP) and the popula-tion (SRB groups T-RFLP) levels to the species level(Desulfobacter 16S rRNA gene libraries). The groupcomprising Desulfococcus–Desulfonema–Desulfosarcinagenera and the Desulfobacter genus group have beenspecifically studied because their related members areimportant components of microbial mats located at the

Fig. 4 Relative abundance of the populations (T-RF) of theDesulfobacter genus in the Camargue mat present at both 4:00 and15:00 hours for each horizon of the mat. Data were obtained from the5′-end T-RFLP profiles obtained by HaeIII digestion of the 16S rRNAgene amplified with primers DSB127F–DSB1273R. The left outline

corresponds to schematic oxygen/sulfur profiles along the 4 mm of themat, obtained from Wieland et al. [51]: oxic zone (white), oxygensulfide overlap zone (bright gray), anoxic zone without sulfide (gray),and anoxic–sulfidic zone (black)

96 Fourçans et al.

oxic–anoxic interface [45]. Therefore, they are enduring thedaily fluctuations of environmental conditions. The com-parison of bacterial organization at night to that observed atdaytime provided evidence of a dynamic organizationinside the mat.

Analysis at the Bacteria domain level showed that thestructure of the bacterial communities at night weredifferent from those observed during the day (Fig. 1).Because the two periods presented different environmentalconditions, this observation suggested a reorganization ofthe bacterial communities when oxygen and light penetratethe mat. Microsensor analyses of environmental parametersmade in parallel during the sampling campaign have beenreported previously [51] (Table 1). Different bacterialbehaviors can be described when the molecular observa-tions reported here are combined with the microsensoranalysis. Indeed, often described as strictly anaerobes, SRBhave developed adaptive responses to deal with oxygen thatinclude oxygen motility, respiration, and aggregate forma-tion [11, 43].

Both the complex Bacterial domain T-RFLP profiles (i.e.,44 OTUs, SD ±4) and the simplified SRB T-RFLP profiles(i.e., 14 OTUs, SD ±4) showed that the zones in which theOTUs were located at night (4:00 hours) and at daytime(15:00 hours) were different. With the Desulfobacter 16SrRNA gene library analysis, clones presenting oppositelocations at night and at daytime were observed. Thesevertical migrations may be a consequence of adaptiveresponses to fluctuating physicochemical gradients.

The downward migration of Desulfonema, Desulfosar-cina, and Desulfococcus populations (OTUs of 101, 122,and 127 bp) observed when oxygen penetrates the matindicates that such populations are not tolerant to oxygenand therefore escape from the oxic surface. It is interestingto note that the CCA showed that these OTUs werepositively correlated with the physical/chemical parametersbut in different ways (Fig. 3). The downward migration ofthe OTU of 127 bp during the day was influenced by bothO2 and H2S, whereas the pH is the main factor influencingthe OTU of 101 bp. The CCA could not show the factor

Fig. 5 Analysis of the Desulfobacter genus by 16S rRNA gene clonelibraries in the Camargue mat, at both 4:00 and 15:00 hours, for slices0–0.1 and 3.6–4 mm. a Distribution of the major restriction profilesobtained by combining the digestions of two restriction enzymes(HaeIII and Hin6I) of each clone analyzed. The relative abundance(%) of the dominant populations is indicated. b Phylogenetic treebased on 16S rRNA gene sequence analysis showing the relationshipof Desulfobacter clones with members of the family Desulfobacter-

aceae. Clone names correspond to, respectively, hour of sampling (15for 15:00 hours and 4 for 4:00 hours), layer number (from 1 for 0–0.1 mm to 30 for 3.6–4 mm), and clone number. Bold branchescorrespond to clones from this study. Clones corresponding to theprofile type “aa” (OTU of 306 bp) are shaded, and thosecorresponding to the profile type “ea” (OTU of 157) bp are in bold.The accession numbers of the sequences are indicated. Bar represents0.02 substitutions/base. Bootstrap values are indicated at the junctions

SRB Spatio-temporal Distribution in Camargue Microbial Mat 9797

influencing the OTU of 122 bp, which suggests that otherparameters could influence its behavior.

Within the Desulfobacter group, the OTU of 306 bpshowed a similar strategy, moving from weakly oxic(~16 μM) sulfide-rich (~ 123 μM) areas to sulfidic(~359 μM) anoxic zones (Fig. 5a). Both predictive di-gestions and 16S rRNA sequence analysis affiliate thisOTU to the recently described genus Desulfotignum. Thetwo species of this genus are strict anaerobes, nonspore-forming motile bacteria [25, 42]. Thus, the observedbehavior of this OTU is consistent with the characteristicsof the genus Desulfotignum. Similarly, previous worksdemonstrated that other SRB groups such as Desulfovibrio,Desulfomicrobium, or Desulfobulbus moved away fromhigh oxygen concentrations indicating that the migrationwas oxygen dependent [41].

Within the Desulfobacter group, an interesting behaviorwas observed in the OTU of 170 bp, which was distributedalong the 4 mm of the mat at 4:00 hours and found locatedin the oxic upper layer at 15:00 hours. The fact that thisOTU was detected in a restricted area during the daysuggested an aggregate formation. In contrast, the distribu-tion of the OTU of 157 bp was slightly affected by the dielvariations of environmental conditions. It showed toleranceto oxygen because it remained located on the mat surface at15:00 hours with oxygen concentration up to 907 µM [51].This observation is not surprising because some membersof this genus have been described as aerotolerants [5, 7]because they are able to form clumps so as to tolerateoxygen. However, previous studies using in situ hybridiza-tion with phylogenetic oligonucleotide probes revealed thatSRB including members related to the Desulfobacter groupwere restricted to anoxic layers [36]. Nevertheless, authorshave not excluded the possible presence of members of thisSRB group in oxic layers because the in situ hybridizationapproach may fail to detect the target group for severalreasons. In spite of its inherent bias, the nested PCRapproach that was used for this study has the advantage todetect minority populations in complex communities.Interestingly enough, the 16S rRNA gene library analysisrevealed that the OTU of 157 bp corresponded to newspecies of the Desulfobacteraceae family. The smallabundance of this OTU and the fact that it corresponds tonot yet characterized species may explain why approachessuch as in situ hybridization cannot detect members of thisSRB group in oxic layers. Strain isolation and physiologystudies combined with molecular approaches such asquantitative reverse transcription PCR are needed tocharacterize these species and understand their behavior.

Among the up-migrating OTUs, the OTU of 110 bpcould correspond to Desulfonema species. Previous studieshave showed that the Desulfonema-like SRB are founddominant in the permanently oxic region of hypersaline

cyanobacterial mat communities [31, 32]. The analysis ofthe upper millimeters of the cyanobacterial mat of SolarLake using most probable number counts suggested thatmulticellular, gliding filaments constituted probably themost abundant fraction of SRB in the upper part of this mat[45]. Furthermore, this filamentous gliding bacterium wasfound in association with the filamentous sulfur-oxidizingbacterium Thioploca in its natural habitat resulting in aneffective sulfur cycling [18]. Its ability to survive underoxic conditions may result from its capacity to createanoxic microniches by forming aggregates. It has beendemonstrated that other members of this family includingDesulfobacterium autotrophicum strains [7, 8, 30], severalDesulfobacter species [5, 7], and a Desulfococcus multi-vorans strain [7, 8] are able to either reduce oxygen or beoxygen tolerant.

Phototrophic anoxygenic bacteria (PAB) and SRB areknown to play key roles in the general functioning ofmicrobial mats. In previous studies, we demonstrated thatthe PAB populations found favorable conditions foranoxygenic photosynthesis inside the mid-layers at daytimeand migrate to deeper zones at night where they probablyturn into a heterotrophic metabolism [15]. Therefore, thesepopulations are not tolerant to oxygen and are alwayslocated in the anoxic zones. Recently, aerotolerant SRBhave been described [23, 24, 31, 45, 51, 52], and differentstrategies to survive to oxygen have been reported (forreview, see [1, 9]) that included a metabolic switch fromsulfate reduction to active aerobic respiration, removingoxygen and preserving the anoxic zone for the developmentof obligate anaerobic bacteria [11]. Such behavior has beendescribed for Desulfovibrio spp. [11, 23, 24] and a fewDesulfobacter species [5, 7]. In the Camargue mat, thesulfate reduction rate was six times higher at 15:00 than at4:00 hours [51]. These high sulfate reduction rates werealso observed on the mat surface. Similarly, several studieshave presented evidence of sulfate reduction under oxicconditions in microbial mats [2, 20, 45, 52] and in othersystems (e.g., marine sediments) [1]. Therefore, theseobservations suggest that the switch to oxygen respirationis not the main response of SRB.

It is interesting to note that upward migration to oxiczones at daytime was observed for a few OTUs (108, 109,110, 121, 191, 194, 280, and 286 bp). The CCA showedthat OTUs of 191, 194, and 286 bp were influenced byoxygen (Fig. 3) suggesting the attraction effect of oxygenon their migration. OTUs of 108 and 109 bp were slightlyinfluenced by H2S and O2, respectively, suggesting thattheir migration is driven by an attraction effect of oxygen,whereas H2S acts as a repellent. The CCA could notdetermine the factor influencing the OTUs of 110, 121, and280 bp (Fig. 3) suggesting either a combined influence ofthe parameters or influence of other parameters on their

98 Fourçans et al.

behavior. The OTU of 286 bp could be related to D.variabilis. This upward migration may involve aerotaxisand chemotaxis mechanisms that position the cells in azone favorable to their metabolism and their possiblegrowth. Several studies demonstrated that high oxygenconcentration acts as a repellent, and therefore cells are ableto perform negative aerotaxis [11, 41]. Pure cultures ofDesulfovibrio showed migration reactions in liquid mediumforming a band of high density cells at a precise oxygenconcentration (from 50 to 30 µM) [11, 24]. This cell accu-mulation also suggests a positive aerotaxis [10]. However,the upward migration might also involve chemotaxis. It hasbeen shown that SRB might be attracted by labile com-pounds that serve as carbon sources [17]. These compoundsare produced by oxygenic phototrophs and heterotrophicbacteria indicating that sulfate reduction is coupled with theprimary production in microbial mats [4]. In previousstudies, sulfate reduction was found to be temperaturedependent [2]. Thus, as suggested by Wieland et al. [51] theelevated temperature observed during the day (25°C) mightalso explain the high sulfate reduction rates measured.

In conclusion, with the use of molecular approaches atboth microscale spatial resolution and different taxonomicorganization levels, the movement of SRB in the Camarguemicrobial mat was depicted. The use of specific primersallowed the following of the migration of SRB populationsby T-RFLP. This fingerprinting method enabled compar-isons of the structures of the bacterial communities. Incombination with multivariate statistical analyses (CA andCCA), T-RFLP allowed to correlate migrations withphysical/chemical parameters. Targeting specific popula-tions revealed a clear picture of their dynamic, which isvaluable information to understand their behavior duringthe daily fluctuations. Completing the study with libraryanalyses allowed the identification of the OTUs related tothe Desulfobacter group. Despite the fact that members ofthe Desulfotignum genus were also detected, the selectedprimers were specific enough to follow the movement ofthis group. However, the results indicate that the specificityof the primers used in molecular approaches must bechecked and updated as our knowledge evolves. For futurestudies, quantitative approaches such as real-time PCR atthe RNA level with species-specific primers would give abetter understanding of the SRB dynamic in microbialmats. Together with the in situ analyses, physiologicalstudies are needed to understand the cellular mechanismsinvolved in the bacterial behavior. During this study, newSRB populations tolerant to high oxygen concentrationwere highlighted. Further analyses that include strainisolation and characterization in combination with in situapproaches such as fluorescent in situ hybridization withspecific probes are necessary to understand their eco-physiological role.

Acknowledgments We acknowledge the financial support providedby the EC (MATBIOPOL project, grant EVK3-CT-1999-00010) andby the “Conseil Régional d’Aquitaine.” The authors are grateful to theCompany of Salins-du-midi at Salins-de-Giraud for facilitating accessto the salterns, sampling, and field experiments. AF is partly supportedby a doctoral grant from the general council of Atlantic Pyrenees. Dr.Remignon (ENSAT, Toulouse, France) is gratefully thanked for thetechnical support. Thanks also to anonymous reviewers for theirhelpful comments and suggestions. The authors are especiallyindebted to Prof. Jim Spain and C. Mroz for careful reading of theEnglish and for helpful comments on the paper.

References

1. Baumgartner LK, Reid RP, Dupraz C, Decho AW, Buckley DH,Spear JR, Przekop KM, Visscher, PT (2006) Sulfate reducingbacteria in microbial mats: changing paradigms, new discoveries.Sediment Geol 185:131–145

2. Canfield DE, Des Marais DJ (1991) Aerobic sulfate reduction inmicrobial mats. Science 251:1471–1473

3. Caumette P, Matheron R, Raymond N, Relexans JC (1994)Microbial mats in the hypersaline ponds of Mediterranean salterns(Salins-de-Giraud, France). FEMS Microbiol Ecol 13:273–286

4. Cohen Y (1984) Oxygenic photosynthesis, anoxygenic photosyn-thesis, and sulfate reduction in cyanobacterial mats. In: Klug MJ,Ready CA (eds) Current perspectives in microbial ecology.American Society for Microbiology, Washington, DC, pp 435–441

5. Cypionka H, Widdel F, Pfennig N (1985) Survival of sulfate-reducing bacteria after oxygen stress, and growth in sulfate-freeoxygen-sulfide gradients. FEMS Microbiol Lett 31:39–45

6. Daly K, Sharp RJ, McCarthy AJ (2000) Development ofoligonucleotide probes and PCR primers for detecting phyloge-netic subgroups of sulfate-reducing bacteria. Microbiology146:1693–1705

7. Dannenberg S, Kroder M, Dilling W, Cypionka H (1992)Oxidation of H2, organic compounds and inorganic sulfurcompounds coupled to reduction of O2 or nitrate by sulfatereducing-bacteria. Arch Microbiol 158:93–99

8. Dilling W, Cypionka H (1990) Aerobic respiration in sulfate-reducing bacteria. FEMS Microbiol Lett 71:123–128

9. Dolla A, Fournier M, Dermoun Z (2006) Oxygen defense insulfate-reducing bacteria. J Biotechnol 126:87–100

10. Dolla A, Fu R, Brumlik MJ, Voordouw G (1992) Nucleotidesequence of dcrA, a Desulfovibrio vulgaris Hildenboroughchemoreceptor gene and its expression in Escherichia coli. JBacteriol 174:1726–1733

11. Eschemann A, Kühl M, Cypionka H (1999) Aerotaxis inDesulfovibrio. Environ Microbiol 1:489–494

12. Ferris MJ, Ward DM (1997) Seasonal distributions of dominant16S rRNA-defined populations in a hot spring microbial matexamined by denaturing gradient gel electrophoresis. ApplEnviron Microbiol 63:1375–1381

13. Foti M, Sorokin DY, Lomans B, Mussman M, Zacharova EE,Pimenov NV, Kuenen JG, Muyzer G (2007) Diversity, activity,and abundance of sulfate-reducing bacteria in saline and hyper-saline soda lakes. Appl Environ Microbiol 73:2093–2100

14. Fourçans A, García de Oteyza T, Wieland A, Solé A, Diestra E,van Bleijswijk J, Grimalt JO, Kühl M, Esteve I, Muyzer G,Caumette P, Duran R (2004) Characterization of functionalbacterial groups in a hypersaline microbial mat community(Salins-de-Giraud, Camargue, France). FEMS Microbiol Ecol51:55–70

15. Fourçans A, Solé A, Diestra E, Ranchou-Peyruse A, Esteve I,Caumette P, Duran R (2006) Vertical migration of phototrophic

SRB Spatio-temporal Distribution in Camargue Microbial Mat 9999

bacterial populations in a hypersaline microbial mat from Salins-de-Giraud (Camargue, France). FEMS Microbiol Ecol 57:367–377

16. Fournier M, Zhang Y, Wildschut JD, Dolla A, Voordouw JK,Schriemer DC, Voordouw G (2003) Function of oxygen resistanceproteins in the anaerobic, sulfate-reducing bacterium Desulfovi-brio vulgaris Hildenborough. J Bacteriol 185:71–79

17. FründC, CohenY (1992) Diurnal cycles of sulfate reduction under oxicconditions in cyanobacterial mats. Appl Environ Microbiol 58:70–77

18. Fukui M, Teske A, Aßmus B, Muyzer G, Widdel F (1999)Physiology, phylogenetic relationships, and ecology of filamentoussulfate-reducing bacteria (genus Desulfonema). Arch Microbiol172:193–203

19. Giani D, Seeler J, Giani L, Krumbein WE (1989) Microbial matsand physicochemistry in a saltern in the Bretagne (France) and in alaboratory scale saltern model. FEMS Microbiol Ecol 62:151–162

20. Jonkers HM, Koh IO, Behrend P, Muyzer G, de Beer D (2005)Aerobic organic carbon mineralization by sulfate-reducing bacte-ria in the oxygen-saturated photic zone of a hypersaline microbialmat. Microb Ecol 49:291–300

21. Jørgensen BB (1994) Sulfate reduction and thiosulfate trans-formations in a cyanobacterial mat during a diel oxygen cycle.FEMS Microbiol Ecol 13:303–312

22. Kovach WL (1999) MVSP - a Multivariate Statistical Package forWindows. ver. 3.1. ed. Kovack Computing Services, Wales, UK

23. Krekeler D, Sigalevich P, Teske A, Cohen Y, Cypionka H (1997)A sulfate-reducing bacterium from the oxic layer of a microbialmat from Solar Lake (Sinai), Desulfovibrio oxyclinae sp. nov.Arch Microbiol 167:369–375

24. Krekeler D, Teske A, Cypionka H (1998) Strategies of sulfate-reducing bacteria to escape oxygen stress in a cyanobacterial mat.FEMS Microbiol Ecol 25:89–96

25. Kuever J, Konneke M, Galushko A, Drzyzga O (2001) Reclassi-fication of Desulfobacterium phenolicum as Desulfobacula phe-nolica comb. nov. and description of strain SaxT as Desulfotignumbalticum gen. nov., sp. nov. Int J Syst Evol Microbiol 51:171–177

26. Kumar S, Tamura K, Jakobsen IB, Nei M (2001) MEGA2: molecularevolutionary genetics analysis software. Bioinformatics 17:1244–1245

27. Lane DJ (1991) 16S/23S rRNA sequencing. In: Stachenbradt E,GoodfellowM (eds) Nucleic acid techniques in bacterial systematics.Wiley, New York, pp 115–175

28. Liu WT, Marsh TL, Cheng H, Forney LJ (1997) Characterizationof microbial diversity by determining terminal restriction fragmentlength polymorphisms of genes encoding 16S rRNA. ApplEnviron Microbiol 63:4516–4522

29. Maidak BL, Cole JR, Lilburn TG, Parker CT Jr., Saxman PR, FarrisRJ, Garrity GM, Olsen GJ, Schmidt TM, Tiedje JM (2001) TheRDP-II (Ribosomal Database Project). Nucl Acids Res 29:173–174

30. Marschall C, Frenzel C, Cypionka H (1993) Influence of oxygenon sulphate reduction and growth of sulphate-reducing bacteria.Arch Microbiol 159:168–173

31. Minz D, Fishbain S, Green SJ, Muyzer G, Cohen Y, Rittmann BE,Stahl DA (1999) Unexpected population distribution in amicrobial mat community: sulfate-reducing bacteria localized tothe highly oxic chemocline in contrast to a eukaryotic preferencefor anoxia. Appl Environ Microbiol 65:4659–4665

32. Minz D, Flax JL, Green SJ, Muyzer G, Cohen Y, Wagner M,Rittmann BE, Stahl DA (1999) Diversity of sulfate-reducingbacteria in oxic and anoxic regions of a microbial mat character-ized by comparative analysis of dissimilatory sulfite reductasegenes. Appl Environ Microbiol 65:4666–4671

33. Mouné S, Caumette P, Matheron R, Willison JC (2003) Molecularsequence analysis of prokaryotic diversity in the anoxic sedimentsunderlying cyanobacterial mats of two hypersaline ponds inMediterranean salterns. FEMS Microbiol Ecol 44:117–130

34. Namsaraev ZB, Gorlenko VM, Namsaraev BB, Buriukhaev SP,Iurkov VV (2003) The structure and biogeochemical activity of

the phototrophic communities from the Bol’sherechenskii alkalinehot spring. Mikrobiologiia 72:228–238

35. Ramsing NB, Ferris MJ, Ward DM (2000) Highly ordered verticalstructure of Synechococcus populations within the one-millimeter-thick photic zone of a hot spring cyanobacterial mat. ApplEnviron Microbiol 66:1038–1049

36. Ramsing NB, Kühl M, Jørgensen BB (1993) Distribution ofsulfate-reducing bacteria, O2, and H2S in photosynthetic biofilmsdetermined by oligonucleotide probes and microelectrodes. ApplEnviron Microbiol 59:3840–3849

37. Revsbech NP, Jorgensen BB, Blackburn TH, Cohen Y (1983)Microelectrode studies of the photosynthesis and O2, H2S and pHprofiles of a microbial mat. Limnol Oceanogr 28:1062–1074

38. Risatti JB, Capman WC, Stahl DA (1994) Community structure of amicrobial mat: the phylogenetic dimension. Proc Natl Acad Sci USA91:10173–10177

39. Ruff-Roberts AL, Kuenen JG, Ward DM (1994) Distribution ofcultivated and uncultivated cyanobacteria and Chloroflexus-likebacteria in hot spring microbial mats. Appl Environ Microbiol60:697–704

40. Saitou N, Nei M (1987) The Neighbor-joining Method: a newmethod for reconstructing phylogenetic trees. Mol Biol Evol4:406–425

41. Sass AM, Eschemann A, Kühl M, Tharb R, Sass H, Cypionka H(2002) Growth and chemosensory behavior of sulfate-reducingbacteria in oxygen–sulfide gradients. FEMSMicrobiol Ecol 40:47–54

42. Schink B, Thiemann V, Laue H, Friedrich MW (2002) Desulfo-tignum phosphitoxidans sp. nov., a new marine sulfate reducer thatoxidizes phosphite to phosphate. Arch Microbiol 177:381–391

43. Sigalevich P, Meshorer E, Helman Y, Cohen Y (2000) Transitionfrom anaerobic to aerobic growth conditions for the sulfate-reducing bacterium Desulfovibrio oxyclinae results in flocculation.Appl Environ Microbiol 66:5005–5012

44. Sorokin DI, Turova TP, Kuznetsov BB, Briantseva IA, GorlenkoVM (2000) Roseinatronobacter thiooxidans gen. nov., sp. nov., anew alkaliphilic aerobic bacteriochlorophyll-alpha-containingbacteria from a soda lake. Mikrobiologiia 69:89–97

45. Teske A, Ramsing NB, Habicht K, Fukui M, Kuver J, JørgensenBB, Cohen Y (1998) Sulfate-reducing bacteria and their activitiesin cyanobacterial mats of solar lake (Sinai, Egypt). Appl EnvironMicrobiol 64:2943–2951

46. Thompson J, Gibson T, Plewniak F, Jeanmougin F, Higgins D(1997) The CLUSTAL_X windows interface: flexible strategiesfor multiple sequence alignment aided by quality analysis tools.Nucl Acids Res 25:4876–4882

47. Weisburg, WG, Barns SM, Pelletier DA, Lane DJ (1991) 16Sribosomal DNA amplification for phylogenetic study. J Bacteriol173:697–703

48. Whale GF, Walsby AE (1984) Motility of the cyanobacteriumMicrocoleus chthonoplastes in mud. Phycol J 19:117–123

49. Wieland A, Kuhl M (2006) Regulation of photosynthesis andoxygen consumption in a hypersaline cyanobacterial mat(Camargue, France) by irradiance, temperature and salinity. FEMSMicrobiol Ecol 55:195–210

50. Wieland A, Kuhl M, McGowan L, Fourçans A, Duran R, CaumetteP, Garcia De Oteyza T, Grimalt JO, Solé A, Diestra E, Esteve I,Herbert RA (2003) Microbial mats on the Orkney islands revisited:microenvironment and microbial community composition. MicrobEcol 46:371–390

51. Wieland A, Zopfi J, Benthien M, Kühl M (2005) Biogeochemistryof an iron-rich hypersaline microbial mat (Camargue, France).Microb Ecol 49:34–49

52. Wieringa EB, Overmann J, Cypionka H (2000) Detection ofabundant sulphate-reducing bacteria in marine oxic sedimentlayers by a combined cultivation and molecular approach. EnvironMicrobiol 2:417–427

100 Fourçans et al.