APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY

Novel and tightly regulated resorcinol and cumate-inducibleexpression systems for Streptomyces and other actinobacteria

Liliya Horbal & Victor Fedorenko & Andriy Luzhetskyy

Received: 8 May 2014 /Revised: 24 June 2014 /Accepted: 25 June 2014 /Published online: 12 July 2014# Springer-Verlag Berlin Heidelberg 2014

Abstract Inducible expression is a versatile genetic tool forcontrolling gene transcription, determining gene functions andother uses. Herein, we describe our attempts to create severalinducible systems based on a cumate or a resorcinol switch, ahammerhead ribozyme, the LacI repressor, and isopropylβ-d-thiogalactopyranoside (IPTG). We successfully developed anew cumate (p-isopropylbenzoic acid)-inducible gene switchin actinobacteria that is based on the CymR regulator, theoperator sequence (cmt) from the Pseudomonas putidacumate degradation operon and P21 synthetic promoter.Resorcinol-inducible expression system is also functionaland is composed of the RolR regulator and the PA3 promoterfused with the operator (rolO) from the Corynebacteriumglutamicum resorcinol catabolic operon. Using the gusA (β-glucuronidase) gene as a reporter, we showed that the newlygenerated expression systems are tightly regulated and hyper-inducible. The activity of the uninduced promoters is negligi-ble in both cases. Whereas the induction factor reaches 45 forStreptomyces albus in the case of cumate switch and 33 in thecase of resorcinol toggle. The systems are also dose-dependent, which allows the modulation of gene expressioneven from a single promoter. In addition, the cumate system isversatile, given that it is functional in different actinomycetes.Finally, these systems are nontoxic and inexpensive, as theseare characteristics of cumate and resorcinol, and they are easy

to use because inducers are water-soluble and easily penetratecells. Therefore, the P21-cmt-CymR and PA3-rolO-RolR sys-tems are powerful tools for engineering actinobacteria.

Keywords Inducible systems . Cumate switch . Resorcinolswitch . Strong inducible promoter . Ribozyme

Introduction

Synthetic biology tends to apply known genetic engineeringapproaches to construct new organisms with desired proper-ties. Currently, a plethora of synthetic genetic modules arebeing developed, such as promoters, ribosomal binding sites(RBSs), terminators, transfer RNAs (tRNAs), riboswitches,and ribozymes (Salis et al. 2009; Lucks et al. 2011; Egbert andKlavins 2012; Keasling 2012; Siegl et al. 2013; Rudolph et al.2013). Combining these synthetic “BioBricks” allows thedirected evolution of biological systems with the goal ofadapting existing components for novel functions. This strat-egy enables researchers to create programmable regulatorynetworks under temporal and spatial control (Medema et al.2011; Boyle and Silver 2012; Berla et al. 2013; Wang et al.2013). Many logic gates have been constructed based oninducible transcriptional control elements. More complexgene circuits have also been generated based on elementarylogic gate functions. However, most of the existing synthetic“BioBricks” and logic gates have been constructed for modelorganisms, such as Escherichia coli and Saccharomycescerevisiae (Blount et al. 2012; Davidson et al. 2012; Blazeckand Alper 2013). Therefore, there is a scarcity of the afore-mentioned tools for less studied but industrially importantbacteria such as actinobacteria.

Actinobacteria are Gram-positive bacteria that are well-known producers of immense quantities of diverse biological-ly active compounds including herbicides, antibiotics, and

Electronic supplementary material The online version of this article(doi:10.1007/s00253-014-5918-x) contains supplementary material,which is available to authorized users.

L. Horbal :A. Luzhetskyy (*)Helmholtz Institute for Pharmaceutical Research Saarland, SaarlandUniversity Campus, Building C2 3, 66123 Saarbrücken, Germanye-mail: Andriy.Luzhetskyy@helmholtz-hzi.de

L. Horbal :V. FedorenkoIvan Franko National University of Lviv, Hrushevskogo 4,79005 Lviv, Ukraine

Appl Microbiol Biotechnol (2014) 98:8641–8655DOI 10.1007/s00253-014-5918-x

anticancer drugs (Butler et al. 2013). However, whereasdozens of secondary metabolites clusters are present in thegenomes of these bacteria (Bentley et al. 2002; Ikeda et al.2003; Ohnishi et al. 2008), most are silent under traditionalscreening conditions. Therefore, most potential compoundsremain unknown. Another feature of actinobacteria is that inmost cases, wild-type strains produce very small amounts ofsecondary metabolites, indicating that tight regulatory net-works are involved in the control of secondary metaboliteproduction. A large number of global, pleiotropic, and path-way regulators control natural product biosynthesis inactinobacteria (Bibb 2005; van Wezel and McDowall 2011;Ostash et al. 2013). Different metabolic engineering ap-proaches have been developed and used to circumvent regu-latory barriers to metabolite production (van wezel et al. 2009;Bibb and Hesketh 2009; Pickens et al. 2011; Gust 2009; Ochiand Hosaka 2013). One of the approaches to induce or en-hance the expression of cryptic or poorly expressed pathwaysis based on substituting the native promoters in a cluster withwell-defined strong promoters. Therefore, there is an urgentneed for promoters that are not restricted to the availableregulatory machinery of the host strain. Recently, libraries ofsynthetic promoters that initiate transcription in actinobacteriahave been constructed (Seghezzi et al. 2011; Siegl et al. 2013).However, because a metabolite of interest or its intermediatesmight be toxic to a microbial cell, there is significant value inthe ability to switch on a biosynthetic pathway at a desiredpoint in the production process and repress it during biomassaccumulation. For these purposes, there is a strong need forefficient inducible expression systems. Such a system shouldpossess several features: it should be tightly regulated andhighly inducible, be responsive to a nontoxic and inexpensiveinducer, be simple to use, and be dose-dependent, to allow themodulation of gene expression even from a single promoter. Alibrary of inducible promoters of various strengths is neces-sary to simultaneously fine-tune the transcription of manygenes.

Several inducible expression systems have been describedfor mycelial actinobacteria (Holmes et al. 1993; Herai et al.2004; Rodríguez-García et al. 2005; Rudolph et al. 2013),although most have certain pitfalls and limitations, such aslow levels of induction, leakage of promoter regulation undernon-inducing conditions, host limitations, and expensive ortoxic inducers. Consequently, novel tightly tunable syntheticswitches are still needed to expand the existing repertoire.Furthermore, the development of complex circuits requires acomprehensive set of controllable expression elements thatcan be induced by different small molecules.

In this report, the attempts to create inducible systemsbased on the LacI repressor and isopropyl β-d-thiogalactopyranoside (IPTG), a hammerhead ribozyme, res-orcinol, and cumate switches are described. The first twosystems appeared to be extremely inefficient in Streptomyces,

whereas designed resorcinol- and cumate-inducible geneswitches work perfectly. Integration of the operator from theCorynebacterium glutamicum resorcinol catabolic operon un-der the control of the PA3 synthetic promoter (Siegl et al.2013) resulted in a new inducible promoter and a resorcinolgene switch. Fusing the P21 synthetic promoter (Siegl et al.2013) to the operator from the Pseudomonas putida F1cumate degradation operon (Choi et al. 2003) allowed us toobtain a novel strongly inducible cumate expression system.We demonstrate that both designed switches are characterizedby a negligible basal level of expression (similar to noisystochastic gene expression) in the absence of the inducersand a robust and high level of induction in Streptomycesalbus strain, that is one of the most widely used heterologoushosts for the production of bioactive natural compounds(Zaburannyi et al. 2014). Newly generated cumate expressionsystem is demonstrated to function in various actinobacteria.

Materials and methods

Bacterial strains and growth conditions

The bacterial strains used in this study are listed in Table 1.E. coli strains were grown in Luria–Bertani (LB) broth medi-um. When required, antibiotics (Sigma, USA; Roth, Germa-ny) were added to cultures at the following concentrations:65 μg ml−1 ampicillin, 50 μg ml−1 kanamycin, or 50 μg ml−1

apramycin.For conjugation, Streptomyces albus, Streptomyces

l i v i d a n s , Ac t i n o p l a n e s t e i c h omy c e t i c u s , a n dSaccharopolyspora erythraea strains were grown on oatmealor mannitol soy (MS) agar (Kieser et al. 2000) for sporulation.For glucuronidase activity measurement strains were grown inliquid tryptic soy broth (TSB).

Recombinant DNA techniques

Chromosomal DNA from Streptomyces strains and plasmidDNA from E. coli were isolated using standard protocols(Kieser et al. 2000; Sambrook and Russell 2001). Restrictionenzymes and molecular biology reagents were used accordingto the recommendations of the supplier (Thermo Scientific,Germany).

Construction of the IPTG gene switch

A codon-optimized version of the lacI gene (accession num-ber KJ775863) was synthesized by GenScript (USA) andcloned into the EcoRV site of pUC57, yielding pUClacI.The plasmid pUClacI was digested with XbaI/KpnI, and a1.2-kb fragment containing the lacI gene was retrieved. Thisfragment was cloned into the respective sites of pGUS

8642 Appl Microbiol Biotechnol (2014) 98:8641–8655

(Table 1), yielding pGUSlacI. A 1.2-kb DNA fragment carry-ing the ampicillin resistance gene and the PA3 syntheticpromoter (Siegl et al. 2013) fused to the lacI operator O1

was amplified from the plasmid pUC19 using the primer pairLacIrepressorOForw and LacO1PA3Rev (Table 2). The PCRproduct was digested with KpnI/SpeI, whose recognition siteswere introduced into the primers, and cloned into the respec-tive sites of pGUSlacI and pGUS, yielding pGUSlacIPA3O1and pGUSPA3O1, respectively.

The synthetic construct containing the PA3 synthetic pro-moter surrounded by three lacI operators was synthesized by

GenScript and cloned into the EcoRV site of pUC57, yieldingpUCThreeoperators. A 0.6-kb DNA fragment containing thePA3 promoter fused to three lacI operators was retrieved frompUCThreeoperators after digestion with KpnI/SpeI. This frag-ment was cloned into the respective sites of pGUSlacI andpGUS , y i e l d i n g pGUS l a c I PA3 t h r e e o p e r a n dpGUSPA3threeoper, respectively.

A 1.2-kb DNA fragment containing the PA3 promoterfused to an ampicillin resistance gene was amplified fromthe pUC19 plasmid using the primers LacIrepressorOForwand PA3AmpRev (Table 2), digested with KpnI/SpeI, and

Table 1 Strains and plasmids used in this work

Bacterial strains and plasmids Description Source orreference

Streptomyces albus J1074 Isoleucine and valine auxotrophic derivative of S. albus G (DSM 40313) lacking SalI-restrictionactivity

Salas J., Oviedo,Spain

S. lividans TK24 Derivative of S. lividans TK21 that contains mutation in the rpsL gene and is resistant tospectinomycin

Kieser et al.(2000)

Saccharopolyspora erythraeaDSM-40517

Producer of erythromycin Chng et al. (2008)

Actinoplanes teichomyceticusNRRL-B16726

Producer of teicoplanin Li et al. (2004)

Escherichia coli DH5α Routine cloning MBI Fermentas

E. coli ET12567 (pUZ8002) Conjugative transfer of DNA Kieser et al.(2000)

pUC57 Apr, general cloning vector Thermo Scientific

pUC19 Apr, general cloning vector Thermo Scientific

pSET152 Amr; φC31-based integrative vector Kieser et al.(2000)

pGUS Promoter probe vector containing promoterless gusA Myronovskyiet al. (2011)

pUClacI Derivative of pUC57 containing codon-optimized lacI gene This work

pGUSlacI Derivative of pGUS containing the lacI gene This work

pGUSlacIPA3O1 Derivative of pGUSlacI containing the lacI gene and the gusA gene fused with the PA3 syntheticpromoter and the O1 operator

This work

pGUSPA3O1 Derivative of pGUS containing gusA gene fused with PA3 synthetic promoter and O1 operator This work

pUCThreeoperators Derivative of pUC57 containing PA3 synthetic promoter surrounded with three lacI operators This work

pGUSlacIPA3threeoper Derivative of pGUSlacI containing the lacI gene and the gusA gene fused with the PA3 syntheticpromoter surrounded with three lacI operators

This work

pGUSPA3threeoper Derivative of pGUS containing the gusA gene fused with the PA3 synthetic promoter surroundedwith three lacI operators

This work

pGUSPA3Amp Derivative of pGUS containing PA3 promoter fused with ampicillin resistance gene This work

pGUSlacIPA3Amp Derivative of pGUSlacI containing PA3 promoter fused with ampicillin resistance gene This work

pUCRibozyme Derivative of pUC57 containing HHR gene This work

pGUSbezRBS Derivative of pGUS containing gusA gene without RBS This work

pGUSPA3Ribozyme Derivative of pGUSbezRBS containing gusA gene fused with HHR and PA3 synthetic promoter This work

pJETCymR Derivative of pJET1.2 containing codon-optimized cymR gene This work

pGUSP21Oper Derivative of pGUS containing CymR operator fused with P21 promoter This work

pGCymRP21 Derivative of pGUSP21Oper containing cymR gene This work

pUCRolR Derivative of pUC57 containing codon-optimized rolR gene This work

pGUSPA3oper Derivative of pGUS containing RolR operator fused with PA3 promoter This work

pGUSRolRPA3 Derivative of pGUSPA3Roper containing rolR gene This work

Appl Microbiol Biotechnol (2014) 98:8641–8655 8643

cloned into the respective sites of pGUS and pGUSlacI,p r o d u c i n g t h e p l a sm i d s pGUSPA3Amp a n dpGUSlacIPA3Amp, respectively.

Theophylline gene switch

A 1.8-kb DNA fragment containing the gusA genewithout RBS was amplified from pGUS (Table 1) usingthe primers XbagusAForw and EVgusARev (Table 2),digested with XbaI/EcoRV and cloned into the respec-tive sites of pGUS, yielding pGUSbezRBS. The absenceof RBS upstream of the gusA gene in the obtainedplasmid was confirmed by sequencing.

A hammerhead ribozyme (HHR) gene placed under thecontrol of the PA3 synthetic promoter (Siegl et al. 2013) wassynthesized by GenScript and cloned into the EcoRV site ofpUC57, yielding pUCRibozyme. The plasmid pUCRibozymewas digested with XbaI/NdeI, and the 0.2-kb fragment con-taining the HHR gene was retrieved. This fragment wascloned into the respective sites of pGUSbezRBS, yieldingpGUSPA3Ribozyme.

Resorcinol gene switch

The operator sequence of the rol gene cluster fromC. glutamicum was introduced downstream of the PA3 syn-thetic promoter (Siegl et al. 2013) by PCR using the primer

pair RolRRrepresOpForw and RolRoperatorRev (Table 2).The amplified 1.2-kb fragment was digested with KpnI/SpeIand cloned into the respective sites of pGUS (Table 1), yield-ing pGUSPA3oper.

A codon-optimized version of the rolR gene (accessionnumber KJ775861) under the control of P21 promoter (Sieglet al. 2013) was synthesized by GenScript and cloned into theEcoRV site of pUC57, yielding pUCRolR. The plasmidpUCRolR was digested with XbaI/KpnI, and a 0.8-kb frag-ment containing the rolR gene was retrieved. This fragmentwas cloned into the respective sites of pGUSPA3oper (Ta-ble 1), yielding pGUSRolRPA3.

Cumate gene switch

The operator sequence of the cmt operon from P. putida F1was introduced downstream of the P21 synthetic promoter(Siegl et al. 2013) by PCR using the primer pairCymRrepressorOForw and CymRoperatorRev (Table 2).The amplified 1.2-kb fragment was digested with KpnI/SpeIand cloned into the respective sites of pGUS (Table 1), yield-ing pGUSP21Oper.

A codon-optimized version of the cymR gene (accessionnumber KJ775862) was synthesized by GenScript and clonedinto the EcoRV site of pJET1.2, yielding pJETCymR. ThecymR gene was amplified from pJETCymR using the primersCymRPForw and CymRPRev (Table 2). The fragment

Table 2 Primers used in this work

Primers Sequence 5′-3′ Purpose

LacIrepressorOForw TTTTGGTACCTATATGAGTAAACTTGGTCTGACAG Fusion PA3 promoter with O1 and gusA

LacO1PA3Rev TTTTACTAGTAATTGTTATCCGCTCACAATTCATCTGATCCT

ACATCAGGCGTTAGTTTTGGAGCCCTGCTAGACGAAAGGG

CCTCGTGATA

PA3AmpRev TTTTTACTAGTCATCTGATCCTACATCAGGCGTTA Cloning PA3 synthetic promoter

GTTTTGGAGCCCTGCTAGACGAAAGGGCCTCGTGATA

XbagusAForw AAAATCTAGATACGCATATGCTGCGGCCCGTCGAAACC Cloning gusA gene without RBS

EVgusARev AAAAGATATCTGCTTCCCGCCCTGCTGCGG

CymRPForw AGGGAGAGCGGCCGCCAGATCTTCC Cloning cymR gene

CymRPRev TTTTTACTAGTGGAAGAGCGCCCAATACGCA

CymRrepressorOForw TTTTGGTACCTATATGAGTAAACTTGGTCTGACAG Cloning cmt operator and P21 promoter

CymRoperatorRev TTTTACTAGTATAATACAAACAGACCAGATTGT

CTGTTTGTTTTGCTCATCCTACCATACTAGGACGTGTT

AGAGCCCGCACAGACGAAAGGGCCTCGTGATA

RolRRrepresOpForw TTTTGGTACCTATATGAGTAAACTTGGTCTGACAG Cloning rol operator and PA3 promoter

RolRoperatorRev TTTTACTAGTTGAATCATGATTCATAAATGAACAAGGGTT

CACATCTGATCCTACATCAGGCGTTAGTTTTGGAGCCCTG

CTAGACGAAAGGGCCTCGTGATA

8644 Appl Microbiol Biotechnol (2014) 98:8641–8655

obtained was digested with SpeI/KpnI, whose recognitionsites were introduced into the primers, and cloned into theXbaI/KpnI sites of pGUSP21Oper, yielding pGCymRP21.

Spectrophotometric measurement of glucuronidase activity(GUS assay)

For direct detection of glucuronidase activity, 1- to 5-dayplates were flooded with 5-bromo-4-chloro-3-indolyl glucu-ronide (X-Gluc) solution and incubated at 28 °C for 1–4 h.The 1 M X-Gluc stock solution was prepared in dimethylsulfoxide. The end concentration of the X-Gluc dilution usedfor flooding plates was 20 or 200 mM.

For the quantitative measurement of GusA activity,1 ml of 24-h seed cultures of the S. albus J100 recombi-nant strains was inoculated into 25 ml of TSB. The cellswere grown for 1 or 2 days. A 5-ml aliquot of the culturewas harvested by centrifugation (6,000×g for 10 min) andresuspended in lysis buffer (50 mM phosphate buffer[pH 7.0], 5 mM dithiothreitol [DTT], 0.1 % TritonX-100, and 2 mg ml−1 lysozyme). Lysis was performedat 37 °C for 35 min. The lysates were centrifuged at6,000×g for 10 min. Then, 0.1 ml of lysate was mixedwith 0.1 ml of dilution buffer (50 mM phosphate buffer[pH 7.0], 5 mM DTT, and 0.1 % Triton X-100) supple-mented with 0.1 μl of 0.2 M p-nitrophenyl-d-glucuronide.The optical density at 415 nm (OD415nm) was measuredevery minute for a total of 20 min of incubation at 37 °Cor at room temperature. As a control, a 1:1 mixture oflysate and dilution buffer was used. Obtained results wereused to build diagrams. The decline of the resulting ab-sorption curve was used to count out the enzymatic activ-ity in units per gram dry weight. One unit is defined asthe amount of an enzyme that can convert 1 μmol ofsubstrate in 1 min. To determine the dry weight, a 2-mlaliquot of the culture was harvested by centrifugation(13,500×g for 10 min) and evaporated at 75 °C for48 h. Afterwards, dry samples were weighted. To calculatethe enzymatic activity the following equation was used: U/g=20A/14tM, where A equals absorption at 415 nm, tequals time in minutes, and M equals the dry weight ingrams of the original sample size (2 ml). All measure-ments were normalized to weight and present results ofthree independent experiments. Microsoft Excel was usedfor statistical analysis.

GUS assays for different actinomycete strains

For S. lividansTK24 and Sacch. erythraeamutants containingthe plasmid pGCymRP21, a 2-ml sample of seed culture wasinoculated into 25 ml of TSB medium and grown for 48 h at28 °C in shaking flasks. A 2-ml sample was pelleted in aFalcon tube and dried at 37 °C for 72 h. Another 5-ml sample

was used for the GUS assay. Pellets were washed once withwater, and lysis was performed in 5 ml of lysis buffer(2 mg ml−1 lysozyme). The samples were subsequently dilut-ed to 50 ml with dilution buffer. Then, 2 ml of lysate wassupplemented with 2 μl of 0.2 M p-nitrophenyl-d-glucuronideand measured as described above at 25 °C or at roomtemperature.

Results

Investigation of the LacI-IPTG expression systemin Streptomyces

To examine whether the LacI-IPTG-inducible system, whichis widely used in E. coli and other bacteria (Yansura andHenner 1984; Sørensen and Mortensen 2005; Liew et al.2011), would be functional in S. albus, we constructed twoplasmids: pGUSlacIPA3O1 and pGUSPA3O1 (Fig. 1a). In thepGUSlacIPA3O1 plasmid, the expression of the lacI gene(accession number KJ775863) is constitutive and is drivenfrom the P21 synthetic promoter (Siegl et al. 2013), and thePA3 promoter was fused to the lac operator (O1; Oehler et al.1990) and cloned upstream of a gusA reporter gene; therefore,the expression of the reporter gene should be under the controlof LacI. A similar construct without the lacI gene(pGUSPA3O1) was used as a control. Both plasmids weretransferred into S. albus by means of conjugation. As a result,two recombinant strains were obtained. We performed quan-titative analyses of GusA activity in liquid TSB in the pres-ence of different concentrations of IPTG or lactose and did notobserve any repression of the promoter by the LacI/LacOinteraction pair (Fig. 1b). We also noticed that the glucuron-idase activity in the strain with the LacI repressor was approx-imately two times higher than in the strain without it, becauseof unknown reasons (Fig. 1b).

These findings suggest that repression is poor because ofthe presence of only one lac operator in the constructs. Be-cause the E. coli lac operon contains three repressor bindingsites and because there are examples where two or threeoperators had to be introduced into expression vectors forthe proper functioning of the LacI-IPTG expression systemin heterologous hosts (Grespi et al. 2011; Becker et al. 2013),we made two cons t ruc t s wi th th ree opera tor s :pGUSlacIPA3threeoper and pGUSPA3threeoper (Fig. 2a).The pGUSPA3threeoper plasmid, which did not contain lacI,was used as a control. These plasmids were transferred intoS. albus and S. lividans TK24, to create four recombinantstrains. We assessed GusA activity in the resulting strains inthe presence and absence of IPTG or lactose. Based on ourdata, we conclude that some concentrations of both IPTG andlactose have a negative effect on GusA activity in both strains

Appl Microbiol Biotechnol (2014) 98:8641–8655 8645

(Fig. 2b, 2c). As shown in Fig. 2b, the activity of the GusAprotein in the presence of 0.5 mM IPTG in the S. lividansTK24 pGUSlacIPA3threeoper+ strain is approximately thesame as for the control strain containing no lacI gene. There-fore, activation reaches a high level, but repression is only20 % lower than activation. Despite cloning three operatorsinto the expression vector, repression remained poor.

The results obtained for S. albus were markedlydifferent from those for the TK24 strains. As shown inFig. 2c, LacI does not repress gusA expression, andlactose, and IPTG have a negative effect on GusAactivity; therefore, there is no activation. However, asshown in Fig. 1b and Fig. 2c, the activity of GusA inthe presence of LacI is, on average, twofold to fourfoldhigher, respectively, than that of the control strain. Thiseffect is specific to S. albus and is not observed forS. lividans. These findings suggest that LacI is requiredfor the activation of gusA gene expression in theS. albus system.

To investigate this assumption and whether the lacOoperators are important for this effect, we constructedtwo plasmids: pGUSPA3Amp and pGUSlacIPA3Amp(Fig. S1a). pGUSPA3Amp, which contains a transcrip-tional fusion of the PA3 promoter to the gusA gene, wasused as a control. pGUSlacIPA3Amp contains the lacIgene and PA3 promoter cloned upstream of gusA. Nei-ther construct contained a lac operator. The plasmidswere transformed into S. albus, and glucuronidase ac-tivity was evaluated. The results are shown in Fig. S1b.

There was no difference in GusA activity in the recom-binant strains in the absence of the lacO operators inthe constructs. This observation allows us to concludethat lacO operators are important for the activation ofgusA in the presence of LacI in S. albus.

Investigation of the expression system basedon the hammerhead ribozyme in Streptomyces

There are several reports describing the utility ofribozymes for the conditional control of gene expressionin E. coli (Ogawa and Maeda 2008; Wieland and Hartig2008; Yen et al. 2006). To elucidate whether a similarmechanism of gene control might be used forStreptomyces, we chose a hammerhead ribozyme(HHR) that comprises the tertiary contacts of stems Iand II to enable rapid cleavage kinetics and that isinduced by theophylline (Wieland and Hartig 2008).To construct an HHR-based gene expression switch,we fused HHR to the PA3 synthetic promoter andcloned it upstream of the gusA reporter gene (Fig. 3a)in pGUS (Myronovskyi et al. 2011). A plasmid contain-ing gusA fused to the PA3 promoter was used as acontrol. Transformation of S. albus with these plasmidsyielded two recombinant strains. We determined theeffect of the theophylline concentration on glucuroni-dase activity in the reported strains (Fig. S2). We didnot observe basal expression of the gusA gene in thestrain carrying HHR even after 3 days of growth on a

a

b

0

20

40

60

80

100

120

no ind

+ 1

mM

IPTG

+ 2

% lacto

se

+ 4

% lacto

se

no ind

+ 1

mM

IPTG

+ 2

% lacto

se

+ 4

% lacto

se

O1PA3 gusAP21lacI ApR

O1PA3 gusAApR

with lacI without lacI

glu

curo

nid

ase

acti

vity

, un

its/

g

S. albus

Fig. 1 a Schematicrepresentation of the lacI-IPTG-inducible expression system:gusA reporter gene, PA3 and P21synthetic promoters, O1 lacIoperator, lacI gene coding for therepressor, ApR ampicillinresistance gene. b Glucuronidaseactivity in cell lysates ofrecombinant Streptomyces albusstrains containing gusA under thecontrol of a PA3 promoter fusedto the O1 operator in the presenceor absence of LacI. The strainswere grown in TSB medium for2 days. Error bars indicate thestandard deviations of triplicateexperiments

8646 Appl Microbiol Biotechnol (2014) 98:8641–8655

plate without inducer (data not shown). Therefore, therepression of gene expression in the presence of HHRworks well in Streptomyces. However, as it is evident inFig. 3b, activation was poor. GusA activity barelyreached 2 units g−1, whereas the activity of the reportergene from the PA3 promoter in the absence of HHRwas approximately 120±15 units g−1 (Fig. 3c). Thesefindings suggest that the repression of translation byHHR works well but activation does not. We alsoassessed the activity of the HHR-based expression sys-tem in two other actinomycete strains, S. lividans andA. teichomyceticus (Li et al. 2004; Horbal et al. 2013),but the results were the same as for S. albus (data notshown).

Development of the resorcinol-inducible expression systemin S. albus

RolR is a TetR-type repressor that controls expressionof its own gene and a group of genes (rol) that areresponsible for the degradation of resorcinol in

C. glutamicum. Resorcinol and hydroxyquinol causedissociation of RolR from the rolO operator and releasethe expression of the rol genes (Huang et al. 2006; Liet al. 2012). To examine whether the RolR regulatorand resorcinol might be used as an inducible system inS. albus, we performed construction of the plasmidpGUSRolRPA3 (Fig. 4, Fig. S3a). To this end, we fusedPA3 synthetic promoter with the rolO operator sequenceand, as a consequence, obtained a new hybrid promoterPA3-rolO. Then the cloning of the newly generatedhybrid promoter upstream of the gusA gene in theintegrative reporter vector pGUS (Myronovskyi et al.2011) was carried out that gave the pGUSPA3operplasmid. In this plasmid, the expression of gusA isunder the control of the PA3-rolO promoter. Cloningof the codon-optimized copy of the rolR gene (acces-s i on numbe r KJ775861 ; F i g . S3b ) i n t o t h epGUSPA3oper plasmid gave us pGUSRolRPA3. In thisconstruct, rolR is constitutively expressed from the P21promoter and expression of the gusA reporter gene isunder the control of the PA3-rolO promoter and RolR.

a

b

0

10

20

30

40

50

60

no ind

+ 2

% lact

+ 4

% lact

+ 0

,5m

M IPTG

+ 1

mM

IPTG

+ 1

0m

M IPTG

no ind

+ 2

% lact

+ 4

% lact

+ 0

,5m

M IPTG

+ 1

mM

IPTG

+ 1

0m

M IPTG

S. lividans TK24

c

OPPA3 gusAO1P21lacI OP

OPPA3 gusAO1OP

without lacI with lacI

0

20

40

60

80

100

120

no ind

+ 2

% lact

+ 4

% lact

+ 0

,5m

M IPTG

+ 1

mM

IPTG

+ 1

0m

M IPTG

no ind

+ 2

% lact

+ 4

% lact

+ 0

,5m

M IPTG

+ 1

mM

IPTG

+ 1

0m

M IPTG

S. albus

without lacI with lacI

glu

curo

nid

ase

acti

vity

,u

nit

s/g

glu

curo

nid

ase

acti

vity

un

its/

g

Fig. 2 a Schematicrepresentation of the PA3promoter fusion to three operatorsand the lacI gene: O1 lacIoperator, OP a perfectlysymmetrical lacI operator. bGlucuronidase activity in celllysates of recombinantStreptomyces lividans strainscontaining gusA under the controlof the PA3 promoter fused to threelac operators in the presence orabsence of LacI. c Glucuronidaseactivity in lysates of recombinantS. albus strains containing gusAunder the control of the PA3promoter fused to three lacoperators in the presence orabsence of LacI. The strains weregrown in TSBmedium for 2 days.Error bars indicate the standarddeviations of three independentexperiments

Appl Microbiol Biotechnol (2014) 98:8641–8655 8647

The plasmid pGUSPA3oper that did not contain theRolR repressor was used as a control. Both plasmidswere transferred into the S. albus strain by means ofconjugation with E. coli. As a result, two recombinantstrains were obtained. The pGUSPA3oper+ andpGUSRolRPA3+ transconjugants were grown on MSagar plates supplemented with 0, 50, or 200 μM resor-cinol or 1,2,4-benzenetriol (hydroxyquinol) for 3–4 days.Lawns were flooded with 5-bromo-4-chloro-3-indolyl-β-d-glucuronide (X-Gluc) solution. After application of X-Gluc, the lawns of the strain that contained RolR re-pressor, grown on MS-agar supplemented with 1,2,4-benzenetriol or without it, did not differ from each otherin color. In contrast, a lawn of S. albus pGUSRolRPA3+

grown in the presence of resorcinol turned dark blue in1 h. Thus, 1,2,4-benzenetriol cannot release the RolR

repression under the tested conditions in S. albus.Therefore, we performed quantitative analyses of GusAactivity in liquid TSB in the presence of different con-centrations of resorcinol. As it is visible from theFig. 5, in the strain containing pGUSRolRPA3, slightbasal expression of gusA was observed in the absence ofthe inducer. The addition of 400 nM resorcinol resultedin a visible increase in gusA expression, whereas thepresence of 40 μM inducer enhanced reporter geneexpression to levels comparable to those of the non-repressed PA3-rolO promoter (Fig. 5). Resorcinol con-centrations in the range of 100 μM and higher havenegative effect on gusA expression and led to decreaseof its activity (Fig. 5). In addition, we noticed thatresorcinol in the concentration of 100 μM and higherhad negat ive effect and led to retardat ion of

c

0

20

40

60

80

100

120

140

160

180

no ind 4 mM Theo

S. albus

glu

curo

nid

ase

acti

vity

, un

its/

gg

lucu

ron

idas

e ac

tivi

ty, u

nit

s/g

a

b

0

0,5

1

1,5

2

2,5

no Theo 800 μM 4 mM 10 mM

S. albus

gusARBS

Theo

aptamer

anti-

RBS

(HHR) Ribozyme

PA3

Fig. 3 a Genetic organization ofthe HHR expression systemdeveloped: PA3 syntheticpromoter, gusA reporter gene,HHR hammerhead ribozyme. bGlucuronidase activity in celllysates of recombinant S. albusstrains containing gusA under thecontrol of the PA3 promoter andHHR. c Glucuronidase activity incell lysates of recombinantS. albus strains containing gusAunder the control of the PA3promoter. The strains were grownin TSB medium for 2 days. Errorbars indicate the standarddeviations of triplicateexperiments

8648 Appl Microbiol Biotechnol (2014) 98:8641–8655

morphological differentiation of S. albus strains grownon agar plates. Therefore, we do not recommend to usethis inducer in such concentrations for S. albus. Basedon these results, we postulate that resorcinol inductionsystem is dose-dependent and reaches maximum level ofexpression in the presence of 40 μM inducer.

Development of the cumate-inducible expression systemin S. albus and S. lividans

CymR is a TetR-type regulator that is involved in the controlof cumate and cymene degradation operons in P. putida F1(Choi et al. 2003). Several effective inducible systems based

a

gusArolOApR PA3P21RolR

SpeI EcoRV

gusArolOPA3P21

b

5’ -TTCGTCTAGCAGGGCTCCAAAACTAACGCCTGATGTAGGATCAGATG

TGAACCCTTGTTCATTTATGAATCATGATTCAACTAGTCGAGCAAC

RBS

GGAGGTACGGACATG-3’

gusA

rolO operator SpeI

PA3 promoter

*

Fig. 4 a Schematic representation of the rolR-resorcinol-inducible ex-pression system: gusA reporter gene, PA3 and P21 synthetic promoters,rolO operator, rolR gene coding for the repressor, ApR ampicillin resis-tance gene. b Sequence of the promoter region of the plasmid

pGUSRolRPA3 located upstream of the gusA reporter gene. The PA3promoter sequence is boxed in dark grey and that of the rol operator inlight grey. Ribosome-binding site (RBS) is underlined, site for SpeI isdenoted in bold, and start codon of gusA is marked with asterisk

a

S. albus pGUSRolRPA3+

0

5

10

15

20

25

30

35

40

no ind 400 nM 1µM 40 µM 100 µM 200 µM

+

b

S. albus pGUSPA3oper+

0

5

10

15

20

25

30

35

40

no ind 40 µM 100 µM

glu

curo

nid

ase

acti

vity

, un

its/

gg

lucu

ron

idas

e ac

tivi

ty, u

nit

s/g

Fig. 5 a Glucuronidase activityin cell lysates of recombinantS. albus strains containing gusAunder the control of the PA3promoter fused to the rolOoperator in the presence of RolR.b Glucuronidase activity in celllysates of recombinant S. albusstrains containing gusA under thecontrol of the PA3-rolO promoter.The strains were grown in TSBmedium for 2 days in the presenceor absence of resorcinol. Errorbars indicate the standarddeviations of three independentexperiments

Appl Microbiol Biotechnol (2014) 98:8641–8655 8649

on CymR have been created for the inducible control of geneexpression in E. coli (Choi et al. 2010), Methylobacteriumextorquens (Choi et al. 2006), and mammalian cells (Mullic

et al. 2006). To investigate whether the CymR regulator isfunctional in S. albus, we constructed the plasmidpGCymRP21 (Table 1), which incorporates all of the

gusAcmtApR P21P21CymR

SpeI EcoRV

gusAcmtP21P21

b

5’ - TATCACGAGGCCCTTTCGTCTGTGCGGGCTCTAACACGTCCTAGTAT

GGTAGGATGAGCAAAACAAACAGACAATCTGGTCTGTTTGTATTAT

ACTAGTCGAGCAACGGAGGTACGGACATG- 3’SpeI

gusARBS

cmt operator

P21 promoter

*

a

Fig. 6 a Schematic representation of the CymR-cumate expression sys-tem: cymR gene coding for the TetR repressor, cmt operator sequence ofthe cumate degradation operon, P21 synthetic promoter, gusA reportergene, ApR ampicillin resistance genes. b Sequence of the promoter region

of the plasmid pGCymRP21 located upstream of the gusA reporter gene.The P21 promoter sequence is boxed in dark grey and that of the cmtoperator in light grey. Ribosome-binding site (RBS) is underlined, site forSpeI is denoted in bold, and start codon of gusA is marked with asterisk

Fig. 7 a Glucuronidase activityin cell lysates of recombinantS. albus strains containing gusAunder the control of the P21promoter fused to the cmtoperator in the presence orabsence of CymR. bGlucuronidase activity in celllysates of recombinant S. lividansstrains containing gusA under thecontrol of the P21 promoter fusedto the cmt operator in the presenceor absence of CymR. The strainswere grown in TSB medium for2 days. Error bars indicate thestandard deviations of threeindependent experiments

8650 Appl Microbiol Biotechnol (2014) 98:8641–8655

necessary regulatory elements. For this purpose, a codon-optimized version of the cymR gene (accession numberKJ775862; Fig. S4) from P. putida was synthesized andplaced under the control of the P21 synthetic promoter, whichallows constitutive expression of the cymR gene inStreptomyces. For this expression system, we constructed ahybrid promoter, P21-cmt, which consists of the cmt operatorsequence placed downstream of the P21 promoter that is, onaverage, two times stronger than above mentioned PA3 (Sieglet al. 2013). We then performed a transcriptional fusion of thenovel promoter to the gusA reporter gene in the pGUS inte-grative vector (Myronovskyi et al. 2011). As a result theplasmid pGUSP21Oper was obtained. Cloning of the codon-optimized copy of the cymR gene into the pGUSP21Operplasmid gave us pGCymRP21 (Fig. 6, Fig. S4a), in whichgusA expression is under the control of the P21-cmt promoterand CymR. The plasmid pGUSP21Oper without the cymRrepressor was used as a control. These plasmids were trans-formed into S. albus and S. lividans TK24 by means ofconjugation to yield four recombinant strains. For quantitativemeasurements of glucuronidase activity, the strains weregrown in liquid TSB medium with or without cumate. In bothstrains containing pGCymRP21, negligible basal expressionof gusAwas observed in the absence of the inducer (Fig. 7).The addition of 50 μM cumate resulted in an increase in gusAexpression to levels comparable to those of the non-repressedP21-cmt promoter (Fig. 7). As it is visible from the Fig. 7, the

activity of the glucuronidase is, on average, two times higherin S. albus strain than in S. lividans. This difference is causedby the presence of two attB-like sites for the integration ofvectors using the φC31 system in the genome of S. albus(Bilyk and Luzhetskyy 2014), and as a result, two copies ofthe pGCymRP21 plasmid are present in its chromosome,whereas S. lividans contains only one such site and one copyof the plasmid.

Effect of an inducer on the cumate expression system

We determined the effect of the concentration of the inducercumate on induction levels in the cumate expression system.For this purpose, S. albus strains were grown as a preculturefor 24 h in the absence of cumate. A 2-ml aliquot of seedculture was transferred into fresh TSB medium containingdifferent concentrations of cumate ranging from 50 nM to100 μM and was grown for 20 h. As shown in Fig. 8, glucu-ronidase activity increased with increasing concentrations ofcumate. The inducibility of the system is approximately linearfrom 1 to 10 μM. Based on these results (Fig. 8, Table S1), weconclude that this novel expression system is dose-dependentand reaches maximum expression in the presence of 30–100 μM cumate. We also observed that cumate did not influ-ence S. albus cell growth in liquid culture, as no decrease ofcell dry weight per milliliter was detected (data not shown), oron agar plates at any of the concentrations used in the study.

0

50

100

150

200

250

300

0 h 4 h 6 h 12 h 16 h 20 h 48 h

time of induction

glu

curo

nid

ase

acti

vity

, un

its/

g

Fig. 9 Time-dependent inductionof cumate switch in S. albus. Thestrain was grown in liquid TSBmedium in the presence of 50 μMcumate for 48 h

0

100

200

300

400

500

600

700

800

900

1000

0 0,05 0,1 0,2 0,3 0,5 0,75 1,5 2 2,5 3 3,5 4 4,5 5 10 20 30 40 50 100g/stinu,ytiv itca

esa dino ruculg

Cumate concentration (µM)

Fig. 8 Modulation of gusA geneexpression in S. albus using thecumate gene switch. The strainwas grown in liquid TSBmediumfor 20 h. Error bars indicate thestandard deviations of the threeindependent experiments

Appl Microbiol Biotechnol (2014) 98:8641–8655 8651

We also investigated the kinetics of cumate induction. TheS. albus pGCymRP21+ strain was grown without inducer inTSB medium. After 48 h, when biomass had accumulated,50 μM cumate was added, and the cells continued to grow.Increased glucuronidase activity was observed after 4 h ofgrowth in the presence of cumate, whereas the highest induc-tion is between 6 and 12 h (Fig. 9). Maximum expression wasreached after 20 h of induction.

We elucidated also the reversibility of cumate induction.After 48-h growth in the inducer-containing medium, the cellswere harvested, washed, and transferred into fresh mediumwithout the inducer. The glucuronidase activity was reducedapproximately 50 % in 9 h after the removal of cumate(Fig. S5). After 24 h, the activity was ~30 % of the maximumthat can be obtained in the induced culture. In 24 h, our systemdid not reach the values observed in non-induced culture.However, we have to mention that this is most likely causedby the remarkable stability of glucuronidase (Weinmann et al.1994; Kavita and Burma 2008).

Applicability of the cumate switch to different actinomycetehosts

To assess the applicability of the cumate switch to non-streptomycetes actinobacteria, the plasmid pGCymRP21 wastransformed into Sacch. erythraea strain via conjugation. Theexconjugants were grown onmannitol-soy plates supplement-ed with or without 20 μM cumate for 3 days. GusA activitywas directly visualized by flooding with the chromogenicsubstrate X-Gluc (20 mM). The lawn turned dark blue after1 h of incubation, indicating GusA expression (data notshown). Quantitative analyses of GusA activity was per-formed for the recombinant strain grown in liquid TSB. To-gether, the data presented in Fig. 7 and Fig. 10 provides

evidence of the applicability of the cumate switch to a widerange of actinomycetes. However, the induction levels andglucuronidase activity depend on the strain used in the anal-ysis. The induction ratio in Sacch. erythraea (Fig. 10) aver-aged 33. No effects of cumate on the growth of theactinobacteria tested (Streptomyces and Saccharopolyspora)were detected.

Discussion

In this article, we have presented several approaches forgenerating inducible expression systems in actinobacteria,including LacI-IPTG, a hammerhead ribozyme, RolR-resorcinol, and CymR-cumate. Furthermore, two successfulattempts clearly demonstrated that different TetR repressors,the operator sequences they bind with, and signal moleculesthey respond on are a minimal molecular tool kit for theconstruction of functional inducible expression systems inStreptomyces.

We failed to construct a LacI-IPTG-inducible system. Al-though IPTG-inducible promoters are widely used in differentbacteria, they were not functional in Streptomyces. Based onour results, we conclude that LacI behavior in S. lividans isdifferent from that in S. albus. We did show that in S. albus,the LacI protein activates the promoters carrying the lacOoperator sequences. At the same time, LacI acts as a weakrepressor of lacO-carrying promoters in S. lividans. Suchconflicting results render the LacI-based system unfit forreliable gene expression in actinobacteria. The hammerheadribozyme-based system was weakly inducible inStreptomyces. Whereas repression was strong, decreasing bas-al expression to zero, the activation ratio was negligible. Onepossible explanation for this observation is that inStreptomyces, the mRNA adopted a secondary structure thatdid not allow it to be cleaved or to interact with the inducertheophylline. However, this hypothesis requires additionalinvestigation.

For the first time, we demonstrated that resorcinol, theoperator rolO and RolR repressor from C. glutamicum mightbe used for the efficient control of gene expression inStreptomyces. Only a few abovementioned elements andPA3 promoter are required for the newly generated resorcinolswitch that is cheap, simple to use, and dose-dependent. It hasvery low basal expression level and induction ratio thatreaches 33 in S. albus. No obvious influence of resorcinol inthe range of concentrations that do not exceed 50 μM ongrowth of S. albus under the tested conditions was detected.

One more versatile, highly inducible, and tightly regulatedexpression system, named cumate switch, which can be usedfor fine-tuning gene transcription in various actinobacteria,was constructed. This newly generated inducible system also

0

10

20

30

40

50

60

no induction 10 µM 20 µM 50 µM

Sacch. erythraea

glu

curo

nid

ase

acti

vity

, un

its/

g

Fig. 10 Glucuronidase activity in cell lysates of recombinantSaccharopolyspora erythraea strain containing gusA under the controlof the P21 promoter fused to the cmt operator in the presence of CymRand different concentrations of inducer. The strain was grown in liquidmedium for 2 days. Error bars indicate the standard deviations of threeindependent experiments

8652 Appl Microbiol Biotechnol (2014) 98:8641–8655

employs only a few simple components: the P21 promoter, thecmt operator, CymR, and cumate as an inducer. All of thecomponents, as in the case of resorcinol switch, are placed onone integrative vector; therefore, both switches do not requireany additional trans-acting elements and are genetically stablewithout selection. In general, the cumate regulatory system ischaracterized by negligible stochastic basal gusA expressionand a high induction ratio that reaches approximately 45 inS. albus. Because of tight repression, both the cumate and theresorcinol switches can be used to successfully control theexpression of genes encoding site-specific recombinases,transposases, and meganucleases, which are highly activeeven at low concentrations. The actinobacteria genome-engineering portfolio will be strongly improved by the abilityto control these genetic instruments. Both inducible expres-sion systems are highly specific, since structurally very similarto resorcinol compound, 1,2,4-benzenetriol, and to cumate–cymene (data not shown), were not able to activate geneexpression. The reliability of the resorcinol- and cumate-inducible system will enable the construction of controllablesynthetic genetic circuits. The novel synthetic promoters PA3-rolO and P21-cmt exhibited dose-dependent expression withresorcinol or cumate, respectively, which are inexpensive andeasily penetrate the cell. This feature of the systems allowsmodulation of gene transcription using the same promoter anddifferent inducer concentrations. Therefore, the resorcinol andthe cumate regulatory systems could be used for the controlledexpression of both toxic and nondetrimental proteins andcompounds. All of these features of the resorcinol and thecumate expression systems make them very promising formetabolic engineering and biotechnology. Because cumateand resorcinol do not undergo metabolic conversion in strep-tomycetes, it should be possible to overcome existing intra-cellular regulatory networks and overexpress or improve thetranscription of genes that constitute bottlenecks in biosyn-thetic pathways.

The synthetic promoter P21 used in this study contains theconsensus regions of the native ermEp1 promoter (Siegl et al.2013).We previously showed that the activity of this promoteris highly similar in different actinomycete strains, which indi-cates that P21 is not subject to intracellular regulation (Sieglet al. 2013).We have not observed any effects of CymR on themorphology or growth of S. albus and S. lividans on MSplates or in liquid TSB medium. To investigate whether ourcumate system is versatile and functional in otheractinobacteria, we tested non-streptomycetes actinobacteriaSacch. erythraea, the producer of erythromycin (Chng et al.2008). The fact that the cumate expression system functionsperfectly in S. albus, S. lividans, and Sacch. erythraea sup-ports its versatility and applicability to differentactinobacteria. We suppose that the differences that we seein the level of inducibility and glucuronidase activity in thetested strains might be related partially to the quantity of attB

sites in the genomes of these strains, since constructed plasmidpGCymRP21 uses the φC31 system for the integration, andtherefore one or several copies of it might be present in thechromosome. The differences in the cumate uptake by thestrains from distinct genera also have some impact on theactivity of the system. At the same time, we cannot excludethat there might be some “off-target” effects of cumate onsome other genes in the genomes of the tested strains. Nodoubt that all together these facts will influence the inducibil-ity of the cumate system and glucuronidase activity in differ-ent strains. These facts will be the objects of our future in-depth studies.

In conclusion, two efficient inducible expression systemsthat respond to different small molecules contain promoters ofdifferent strength and are highly sensitive, tightly regulated,and dose-dependent were developed. Both systems are func-tional in S. albus that has a potential to be a versatile chassisfor the heterologous production of secondary metabolites. Inaddition, cumate system was shown to be applicable to vari-ous actinobacteria. We anticipate that these resorcinol andcumate switches will be widely applicable in actinobacterialgenetics.

Acknowledgements This work was supported by the European Com-mission under the 7th Framework Program through the “CollaborativeProject” action, “STREPSYNTH” grant No. 613877, and through theEuropean Research Council (ERC) starting grant EXPLOGEN No.281623 to AL.

References

Becker NA, Peters JP, Maher LJ 3rd, Lioberger TA (2013) Mechanism ofpromoter repression by Lac repressor-DNA loops. Nucleic AcidsRes 41(1):156–166

Bentley SD, Chater KF, Cerdeno-Tarraga AM, Challis GL, ThomsonNR,James KD, Harris DE, Quail MA, Kieser H, Harper D, Bateman A,Brown S, Chandra G, Chen CW, Collins M, Cronin A, Fraser A,Goble A, Hidalgo J, Hornsby T, Howarth S, Huang CH, Kieser T,Larke L, Murphy L, Oliver K, O’Neil S, Rabbinowitsch E,Rajandream MA, Rutherford K, Rutter S, Seeger K, Saunders D,Sharp S, Squares R, Squares S, Taylor K, Warren T, Wietzorrek A,Woodward J, Barrell BG, Parkhill J, HopwoodDA (2002) Completegenome sequence of the model actinomycete Streptomycescoelicolor A3(2). Nature 417:141–147

Berla BM, Saha R, Immethun CM, Maranas CD, Moon TS, Pakrasi HB(2013) Synthetic biology of cyanobateria: unique challenges andopportunities. Front Microbiol 4:246. doi:10.3389/fmicb.2013.00246

Bibb MJ (2005) Regulation of secondary metabolism in streptomycetes.Curr Opin Microbiol 8:208–215

Bibb M, Hesketh A (2009) Analyzing the regulation of antibiotic pro-duction in streptomycetes. Methods Enzymol 458:93–116

Bilyk B, Luzhetskyy A (2014) Unusual site-specific DNA integrationinto the highly active pseudo-attB of the Streptomyces albus J1074genome. Appl Microbiol Biotechnol 98(11):5095–5104

Appl Microbiol Biotechnol (2014) 98:8641–8655 8653

Blazeck J, Alper HS (2013) Promoter engineering: recent advances incontrolling transcription at the most fundamental level. Biotechnol J8(1):46–58

Blount BA, Weenink T, Ellis T (2012) Construction of synthetic regula-tory networks in yeast. FEBS Lett 586(15):2112–2121

Boyle PM, Silver PA (2012) Parts plus pipes: synthetic biology ap-proaches to metabolic engineering. Metab Eng 14:223–232

Butler MS, Blaskovich MA, Cooper MA (2013) Antibiotics in theclinical pipeline in 2013. J Antibiot (Tokyo) 66(10):571–591

Chng C, Lum AM, Vroom JA, Kao CM (2008) A key developmentalregulator controls the synthesis of the antibiotic erythromycin inSaccharopolyspora erythraea. Proc Natl Acad Sci U S A 105(32):11346–11351

Choi EN, Cho MC, Kim Y, Kim CK, Lee K (2003) Expansion of growthsubstrate range in Pseudomonas putida F1 by mutations in bothcymR and todS, which recruit a ring-fission hydrolase CmtE andinduce the tod catabolic operon, respectively. Microbiology 149(Pt3):795–805

Choi YJ, Morel L, Bourque D, Mullick A, Massie B, Míguez CB (2006)Bestowing inducibility on the cloned methanol dehydrogenase pro-moter (PmxaF) of Methylobacterium extorquens by applying regu-latory elements of Pseudomonas putida F1. Appl EnvironMicrobiol72:7723–7729

Choi YJ, Morel L, Le François T, Bourque D, Bourget L, Groleau D,Massie B, Míguez CB (2010) Novel, versatile and tightly regulatedexpression system for Escherichia coli strains. Appl EnvironMicrobiol 76(15):5058–5066

Davidson EA,Windram OP, Bayer TS (2012) Building synthetic systemsto learn nature’s design principles. Adv Exp Med Biol 751:411–429

Egbert RG, Klavins E (2012) Fine-tuning gene networks using simplesequence repeats. Proc Natl Acad Sci U S A 109(42):16817–16822

Grespi F, Ottina E, Yannoutsos N, Geley S, Villunger A (2011)Generation and evaluation of an IPTG-regulated version of Vavgene promoter for mouse transgenesis. PLoS One 6(3):e18051

Gust B (2009) Cloning and analysis of natural product pathways.Methods Enzymol 458:159–180

Herai S, Hashimoto Y, Higashibata H, Maseda H, Ikeda H, Omura S,Kobayashi M (2004) Hyper-inducible expression system forstreptomycetes. Proc Natl Acad Sci U S A 101(39):14031–14035

Holmes DJ, Caso JL, Thompson CJ (1993) Autogenous transcriptionalactivation of a thiostrepton induced gene in Streptomyces lividans.EMBO J 12(8):3183–3191

Horbal L, Kobylyanskyy A, Yushchuk O, Zaburannyi N, Luzhetskyy A,Ostash B, Marinelli F, Fedorenko V (2013) Evaluation of heterolo-gous promoters for genetic analysis of Actinoplanesteichomyceticus—producer of teicoplanin, drug of last defense. JBiotechnol 168(4):367–372

HuangY, Zhao K-X, Shen X-H, ChaudhryMT, Jiang C-Y, Liu S-J (2006)Genetic characterization of the resorcinol catabolic pathway inCorynebacterium glutamicum. Appl Environ Microbiol 72(11):7238–7245

Ikeda H, Ishikawa J, Hanamoto A, Shinose M, Kikuchi H, Shiba T,Sakaki Y, Hattori M, Omura S (2003) Complete genome sequenceand comparative analysis of the industrial microorganismStreptomyces avermitilis. Nat Biotechnol 21:526–531

Kavita P, Burma PK (2008) A comparative analysis of green fluorescentprotein and β-glucuronidase protein-encoding genes as a reportersystem for studying the temporal expression profiles of promoters. JBiosci 33(3):337–343

Keasling JD (2012) Synthetic biology and the development of tools formetabolic engineering. Metab Eng 14:189–195

Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA (2000)Practical Streptomyces genetics. The John Innes Foundation,Norwich, UK

Li TL, Huang F, Haydock SF, Mironenko T, Leadlay PF, Spencer JB(2004) Biosynthetic gene cluster of the glycopeptide antibiotic

teicoplanin: characterization of two glycosyltransferases and thekey acyltransferase. Chem Biol 11:107–119

Li T, ZhaoK, HuangY, Li D, JiangC-Y, ZhouN, Fan Z, Liu S-J (2012) TheTetR-type transcriptional repressor RolR from Corynebacteriumglutamicum regulates resorcinol catabolism by binding to a uniqueoperator, rolO. Appl Environ Microbiol 78(17):6009–6016

LiewAT, Theis T, Jensen SO, Garcia-Lara J, Foster SJ, Firth N, Lewis PJ,Harry EJ (2011) A simple plasmid based system that allows rapidgeneration of tightly controlled gene expression in Staphylococcusaureus. Microbiology 157:666–676

Lucks JB, Qi L, Mutalik VK, Wang D, Arkin AP (2011) Versatile RNA-sensing transcriptional regulators for engineering genetic networks.Proc Natl Acad Sci U S A 108(21):8617–8622

Medema MH, Alam MT, Breitling R, Takano E (2011) The future ofindustrial antibiotic production: from random mutagenesis to syn-thetic biology. Bioeng Bugs 2(4):230–233

Mullic A, Xu Y, Warren R, Koutroumanis M, Guilbault C,Broussau S, Malenfant F, Bourget L, Lamoureux L, Lo R,Caron AW, Pilotte A, Massie B (2006) The cumate gene-switch: a system for regulated expression in mammaliancells. BMC Biotechnol 6:43

Myronovskyi M, Welle E, Fedorenko V, Luzhetskyy A (2011) Beta-glucuronidase as a sensitive and versatile reporter in actinomycetes.Appl Environ Microbiol 77(15):5370–5383

Ochi K, Hosaka T (2013) New strategies for drug discovery: activation ofsilent andweakly expressedmicrobial gene clusters. Appl MicrobiolBiotechnol 97(1):87–98

Oehler S, Eismann ER, Kämer H, Müller-Hill B (1990) The free operatorsof the lac operon cooperate in repression. EMBO J 9(4):973–979

Ogawa A, Maeda M (2008) An artificial aptazyme basedr i bosw i t ch and i t s c a sc ad i ng sys t em in E. co l i .Chembiochem 9(2):206–209

Ohnishi Y, Ishikawa J, Hara H, Suzuki H, IkenoyaM, IkedaH,YamashitaA, Hattori M, Horinouchi S (2008) Genome sequence of thestreptomycin-producing microorganism Streptomyces griseus IFO13350. J Bacteriol 190:4050–4060

Ostash B, Ostash I, Horbal L, Fedorenko V (2013) Exploring andexploiting gene networks that regulate natural products biosynthesisin actinobacteria. Nat Prod J 3:189–198

Pickens LB, Tang Y, Chooi YH (2011) Metabolic engineering for theproduction of natural products. Annu Rev Chem Biomol Eng 2:211–236

Rodríguez-García A, Combes P, Pérez-Redondo R, Smith MC, SmithMC (2005) Natural and synthetic tetracycline-inducible promotersfor use in the antibiotic producing bacteria Streptomyces. NucleicAcids Res 33(9):e87

Rudolph MM, Vockenhuber MP, Suess B (2013) Synthetic riboswitchesfor the conditional control of gene expression in Streptomycescoelicolor. Microbiology 159:1416–1422

Salis HM, Mirsky EA, Voigt CA (2009) Automated design of syntheticribosome binding sites to control protein expression. Nat Biotechnol27(10):946–950

Sambrook J, Russell D (2001) Molecular cloning: a laboratory manual,3rd edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,NY

Seghezzi N, Amar P, Koebmann B, Jensen PR, Virolle MJ (2011) Theconstruction of a library of synthetic promoters revealed somespecific features of strong Streptomyces promoters. ApplMicrobiol Biotechnol 90:615–623

Siegl T, Tokovenko B, Myronovkyi M, Luzhetskyy A (2013)Design, construction and characterisation of a synthetic pro-moter library for fine-tuned gene expression in actinomy-cetes. Metab Eng 19:98–106

Sørensen HP, Mortensen KK (2005) Advanced genetic strategies forrecombinant protein expression in Escherichia coli. J Biotechnol115(2):113–128

8654 Appl Microbiol Biotechnol (2014) 98:8641–8655

van Wezel GP, McDowall KJ (2011) The regulation of the secondarymetabolism of Streptomyces: new links and experimental advances.Nat Prod Rep 28(7):1311–1133

van Wezel GP, McKenzie NL, Nodwell JR (2009) Applying thegenetics of secondary metabolism in model actinomycetes tothe discovery of new antibiotics. Methods Enzymol 458:117–141

Wang YH, Wei KY, Smolke CD (2013) Synthetic biology: advancing thedesign of diverse genetic systems. Annu Rev Chem Biomol Eng 4:69–106

Weinmann P, Gossen M, Hillen W, Bujard H, Gatz C (1994) A chimerictransactivator allows tetracycline-responsive gene expression inwhole plants. Plant J 5:559–569

Wieland M, Hartig JS (2008) Improved aptazyme design and in vivoscreening enable riboswitching in bacteria. Angew Chem Int EdEngl 47(14):2604–2607

Yansura DG, Henner DJ (1984) Use of the Escherichia coli lac repressorand operator to control gene expression in Bacillus subtilis. ProcNatl Acad Sci U S A 81:439–443

Yen L, Magnier M, Weissleder R, Stockwell BR, Mulligan RC (2006)Identification of inhibitors of ribozyme self cleavage in mammaliancells via high throughput screening of chemical libraries. RNA 12:797–806

Zaburannyi N, Rabyk M, Ostash B, Fedorenko V, Luzhetskyy A (2014)Insights into naturally minimized Streptomyces albus J1074 ge-nome. BMC Genomics 15:97. doi:10.1186/1471-2164-15-97

Appl Microbiol Biotechnol (2014) 98:8641–8655 8655