Mouse Growth Hormone-ReleasingHormone: Precursor Structure andExpression in Brain and Placenta

Steven T. Suhr, Jason O. Rahal, and Kelly E. Mayo

Department of Biochemistry, Molecular Biology, and Cell BiologyNorthwestern UniversityEvanston, Illinois 60208

To pursue questions concerning the regulation ofsomatic growth in a species amenable to both ge-netics and germ-line manipulation, we have isolatedand characterized a full-length cDNA clone encodingmouse GH-releasing hormone (mGHRH). A GHRHcDNA clone isolated from a mouse placental librarycontains an open-reading frame of 309 basepairsthat predicts a 103 amino acid mouse GHRH precur-sor protein. The mature mouse GHRH is predictedto be 42 amino acids with a free carboxyl-terminus.Although the mGHRH precursor sequence is clearlyrelated to those determined for rat and human, themature mGHRH peptide differs at seven of its 42positions from all previously characterized GHRHpeptides. RNA blot analysis of mouse tissues indi-cates that the mature 750 nucleotide mGHRH mRNAis found in hypothalamus and placenta, while testiscontains a larger GHRH-related transcript. In situhybridization analysis of GHRH gene expression inthe mouse brain indicates that GHRH mRNA is lo-calized predominantly to the arcuate nucleus of thehypothalamus. In the placenta, GHRH mRNA levelsare developmentally regulated and peak on days16-17 of gestation. GHRH mRNA is localized pre-dominantly to trophoblast giant cells and to cyto-trophoblasts of the placental labyrinth. (MolecularEndocrinology 3: 1693-1700, 1989)

INTRODUCTION

Somatic growth in animals is regulated by a complexhormonal cascade that originates in the hypothalamus,where two peptides important for the appropriate con-trol of pituitary GH secretion are produced. These areGH releasing hormone (GHRH), which stimulates GHsynthesis and secretion from pituitary somatotrophs(1-3), and somatostatin, which inhibits GH secretion(4). While GH has some direct effects on cellular growth,many of its actions are believed to be mediated bysomatomedin C, or insulin-like growth factor type I,

0888-8809/89/1693-1700$02.00/0Molecular EndocrinologyCopyright© 1989 by The Endocrine Society

which is synthesized in peripheral tissues such as theliver in response to elevated GH levels (5). Somatome-din C, in turn, has negative feedback effects at boththe hypothalamic and pituitary levels (6).

The mouse has been a widely used model systemfor studying the hormonal control of somatic growth.This is due in part to the availability of mutant lines ofmice that have altered growth characteristics. For ex-ample, little is an autosomal recessive mutation thatresults in reduced GH production and decreasedgrowth and has been used as an animal model forhuman isolated GH deficiency type I (7). Mice have alsobeen widely used in studies that involve germ-line ma-nipulation to generate transgenic animals with alteredgrowth properties. Transgenic mice expressing GHRH(8, 9), somatostatin (10), GH (11, 12), and insulin-likegrowth factor-l (13) fusion genes have been produced,and both GHRH and GH transgenic mice grow to beabnormally large (8,11).

To better understand the hormonal control of growthin normal, mutant, and transgenic mice, we chose tocharacterize mouse GHRH (mGHRH). The GHRH pep-tide has been sequenced from numerous species (re-viewed in 14, 15), and the sequence of the GHRHprecursor protein has been deduced from cDNA clonesin the human and rat (16, 17). However, antibodiesraised against either human or rat GHRH (rGHRH)cross-react poorly with mGHRH (14), and we haveobserved only very weak hybridization of an rGHRHcDNA with mouse genomic DNA (unpublished data).We therefore chose to directly characterize cDNAclones encoding the mGHRH precursor protein. Tofacilitate this approach, we used an extra-hypothalamictissue source, the placenta. Immunoreactive and bio-logically active GHRH has been detected in the ratplacenta (18, 19), and recent results in our laboratoryindicate that GHRH mRNA levels are very high in thelate-gestation rat placenta (20). We report here thecharacterization of a full-length mouse GHRH cDNAclone from placenta, and present results concerning theexpression of the GHRH gene in distinct cell types ofboth the brain and the placenta.

RESULTS

A Xgt11 cDNA library constructed from gestational day-13 mouse placental mRNA (21) was screened by low-

1693

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

MOL ENDO-19891694

Vol 3 No. 11

stringency hybridization using a rGHRH cDNA probe.Two positive clones were identified and plaque purified,and the larger of the two inserts was subcloned intothe plasmid vector pGEM-4 for further analysis. Thenucleotide sequence of the insert was determined andis shown in Fig. 1. The sequence indicates that thecDNA includes an open reading frame of 309 basepairsthat would encode a 103 amino acid mGHRH precursorprotein, which is close to the size of the 104 amino acidrat GHRH precursor protein (17). The mature GHRHpeptide (underlined in Fig. 1) is predicted to be 42 aminoacids in length, and is flanked by arginine residues thatare likely to be important for its proteolytic removal fromthe precursor. The mGHRH precursor does not containa glycine residue at the carboxyl-terminus of the maturepeptide sequence, a residue thought to be important inthe carboxyl-terminal amidation of other GHRH pep-tides, such as human GHRH (16, 22). Like rGHRH,mGHRH is therefore predicted to have a free carboxyl-terminus.

The mGHRH precursor protein is structurally relatedto those previously characterized in human and rat. Thepredicted sequences of the mouse, rat, and humanGHRH precursor proteins are compared in Fig. 2. Thecarboxyl-terminus of the mGHRH precursor is similarto that of rat, which is extremely divergent from human;this appears to be due to differential RNA splicing ofthe rodent and human genes (17). The amino acidsequences of all characterized GHRH peptides arecompared in Fig. 3; interestingly, seven of the 42 aminoacid residues in mGHRH are different from those foundin all previously characterized GHRH peptides (14).

30 . 6 0ACCCTTATCTTTCCATCATTTCTTTTTCTAACAGCAAAGATCACAATGACAGAAGTGAA

90 . . 120TGATCAGAATGTAAAAATATTTGTGCAAAATTGCATTAACTGTTCTCACCATCTAATCGG

150 . . 180GGTACAACCTCAAACACAACGGCCATAATGAAGAAAAGCTACACTGGAAGTTCTAGATGT

210 . . 240CATCTGGCTCCCACAACATCACAGAGTCCCACCCAGGAGTGAAGGATGCTGCTCTGGGTG

MetLeuLeuTrpVal

270 . . 300CTCTTTGTGATCCTCATCCTCACCAGTGGCTCCCACTGCTCACTGCCCCCCTCACCTCCCLeuPheVallleLeuIleLeuThrSerGlySerHisCysSerLeuProProSerProPro

330 . . 360TTCAGGATGCAGCGACACGTAGATGCCATCTTCACCACCAACTACAGGAAACTCCTGAGCPheArqMetGlnArqHisValAspAlallePheThrThrAsnTvrArqLvsLeuLeuSer

390 . . 420CAGCTGTATGCCCGGAAAGTGATCCAGGACATCATGAACAAGCAAGGGGAGAGGATCCAGGlnLeuTvrAlaArqLvsVallleGlnAspIleMetAsnLvsGlnGlvGluArqlleGln

450 . . 480GAACAAAGGGCCAGGCTCAGCCGCCAGGAAGACAGCATGTGGACAGAGGACAAGCAGATGGluGlnArqAlaArqLeuSerArqGlnGluAspSerMetTrpThrGluAspLysGlnMet

510 . . 540ACCCTGGAGAGCATCTTGCAGGGATTCCCAAGGATGAAGCCTTCAGCGGACGCTTGAGCCThrLeuGluSerlleLeuGlnGlyPheProArgMetLysProSerAlaAspAlaEnd

570 . . 600CCCCGAGCCCCAAACACAACTGTACCCTGTTACTTCTGCTTCAGCTCTGACCTTTTCCGT

. 630CCTCTGTAAATAqA&EAA^ACCCCCATTCTCAT

Fig. 1. DNA Sequence of the mGHRH cDNA CloneThe predicted amino acid sequence of the mGHRH precur-

sor protein is shown below the nucleic acid sequence, and themature GHRH peptide is underlined. A consensus site forpolyadenylation is boxed at the 3'-end of the clone.

The insert from the mGHRH cDNA clone was usedto probe a blot of RNAs isolated from mouse placentasat various gestational stages. Figure 4 shows that thecDNA detects an abundant transcript of about 750nucleotides on each gestational day tested (days 14through 19). The abundance of this transcript is devel-opmentally regulated and peaks on gestational days16-17. We therefore chose day 16 of gestation for allsubsequent studies of GHRH expression in the pla-centa.

To determine whether this GHRH mRNA was alsoexpressed outside of the placenta, we examined RNAfrom several mouse tissues by RNA blot analysis. Asshown in Fig. 5, a transcript of approximately 750nucleotides is detected in both mouse placenta andhypothalamus, although it appears to be much moreabundant in placental RNA. Because it was previouslyreported that a GHRH-like mRNA was expressed in rattestes (23), we also examined that tissue in the mouse.As seen in Fig. 5, several large transcripts are detectedin testes, as well as in placenta and hypothalamus;these transcripts are not detected in liver or severalother control tissues. We do not know whether theseare GHRH mRNA processing intermediates, or whetherthey represent a distinct GHRH-related transcript.

We have used in situ hybridization to more preciselylocalize sites of GHRH synthesis in mouse brain andplacenta. 35S-Labeled antisense RNA probes were hy-bridized to 20-/im frozen sections of brain or placentaand hybridization was detected by liquid emulsion au-toradiography. Figure 6 contains low magnificationdarkfield photomicrographs that show hybridization ofthe mGHRH probe to these tissues. In the brain, hy-bridization was observed in the medial-basal hypothal-amus, predominantly in cells of the arcuate nucleus(Fig. 6, top panels). No hybridization was observed inother brain regions such as hippocampus or cerebralcortex (data not shown). In the placenta, hybridizationwas observed in several regions. The layer of tropho-blast giant cells that lie just inside the decidual layer onthe maternal side of the placenta express GHRH mRNAat high levels (Fig. 6, middle panels), as do cells of theplacental labyrinth (Fig. 6, bottom panels). There is nodetectable expression in the decidual layer, and only afew scattered hybridizing cells were found in the basalzone (Fig. 6). Placental morphological terminology isfollowing Davies and Glasser (24).

To more precisely examine expression at the cellularlevel, high magnification brightfield microscopy wasused to localize individual silver grains. These resultsare shown in Fig. 7. The left panels show tissueshybridized to the mGHRH antisense RNA probe; theright panels show the same tissues hybridized to thesense-strand RNA probe. In the hypothalamus, scat-tered neurons hybridized intensely to the mGHRHprobe; most of these were located in the arcuate nu-cleus, but cells lying outside this region hybridizedequally well (Fig. 7, top panels). In the placenta, stronghybridization is observed to the giant cells and to cellsof the placental labyrinth (Fig. 7, bottom panels). In the

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

Mouse GHRH 1695

Human MetProtAuTfpVaiPhePfiePheyailletcuThrlieuSerAsnSerSetHisCysSerMouse MetLeuLeuTrpValLeuphe yalileLeuileLeyThrSerGlySerHiscysSerRat MetProLeuTrpValPhePhe ValLeuLeuThrLeuThrSerGlySerHisCysSer

ProProProProLeuThrLeuXrgMetArgArgryrAlaAspAlallePheThrAsnLeuProProSerPrqLeuProProSerPrb

ProPheArgMetGlnArgHisValAspAlallePheThrThrProPheArgVa lArgArgJHisAlaAspAIallePheThrSer

Serl^rArgLysValLeuGlyplnLeuSerAlaArgLysLeuLeuGlnAspIleMetSerAsnTyrArgLysLeuLeuserGlnLe^TyrAlaArgl/ysVallleGlnAsplleMetAsnSer^rArgArglleLeuGlyGlnLeuTyrMaArgLysLeuLeuHisGluIlgMetAsn

ArgGlnGlnGlyGluSerAsnGlnGluArgGlyAlaArgAlaArgLeuGlyfArgGlnValLysGln GlyGlttArglleGlnGluGlnArgGlnGlnGlyGluArgAsnGInGluGln

ArgAlaArgLeuSerArgGlnGluArgSerArgPheAsrArgHisLeu

AspSerMetTrpAlaGruGlnllysGlnMetGluLeuGluSerlleLeuValAlaLeuLeuAspSerMetTrpThrGXuAspLysGlnMetThrLeuGluSerlleLeuGlnGlyPheAspArgValTrpAlaGluAspLysGlnMetAlaLeuGluSerlleLeuGlnGlyPhe

GlnLysHisSerArgAsnSerGlnGlyEncl 108ProArgMetLysProSerAlaAspAlaEnd 103ProArgMetLysLeuSerAlaGluAlaEn<J 104

Fig. 2. Comparison of the GHRH Precursor Proteins from Human, Mouse, and RatThe sequences are aligned for optimal homology by leaving gaps where necessary. Residues identical in all three precursor

proteins are indicated by the shading. The mature GHRH sequence is boxed.

Human

Pig

Cow

Goat

Sheep

Rat

House

5 10 15 20 25 30 35 40 44

Y A D A I F T N S U H L C n S A R K L L Q D I _ M S R O Q G _ E S N g _ E R G A R A R L-NH2

Y A D A I F T N S Y R K V L G Q L S A R K L I Q D I M S R Q Q G E S N Q E C J G A R V R L-NH2

Y A D A I F T N S Y R K V L G Q L S A R K L L O D I M N R O Q G E R N Q E Q G A K V R L-NH2

Y A 0 A I F T N S Y R K V L G Q L S A R K L L Q D I H | R Q Q G E R N O E d G A l C V R L-NH2

Y A D A I F T N S Y R K j L G Q L S A R K L L Q D I M N R Q Q G E f t N Q E O G A K V R L-NH2

| A D A I F T S S t H 1 L G 0 L | A R ( L L II C I N N « 0 Q G E H 0 E 0 ' • H R F (4-OH

H V D A I f I I II r H U S 0 I I A R K V I 0 0 I H K J 0 • G E « 1 B E J - • II A » L 8-0H

Fig. 3. Amino Acid Sequence Comparison of Characterized GHRH PeptidesAmino acid residues underlined in the human sequence are invariant. Shaded residues differ from the human sequence. Positions

with a carat in the mouse sequence are residues that are different in the mouse peptide, but are invariant in all other speciescharacterized. All but the rat and mouse peptides are carboxyl-terminally amidated. Gaps(-) have been inserted into the rat andmouse sequences to bring them into maximal alignment with the human sequence.

labyrinth, hybridization appears to be predominantlyassociated with individual cytotrophoblasts rather thanwith the syncytial layers. Other than the giant cell layerthat lies adjacent to the decidua, only a few scatteredcells of the basal zone express GHRH mRNA. Thesedo not appear to be either glycogen cells or smallbasophilic cells, but rather basophilic cells undergoingmorphological transformation into giant cells (24).

DISCUSSION

We have isolated and characterized a cDNA encodingthe mGHRH precursor protein from a novel tissuesource, the placenta. All available data suggest that theplacental GHRH characterized here is identical to thatexpressed in hypothalamus, including the observationthat there is a similarly sized mRNA in both tissues, the

finding that the placental clone hybridizes specifically toneurons in the arcuate nucleus, and the fact that thereappears to be a single GHRH gene (our unpublishedobservations). Although there is considerable diver-gence in amino acid sequence between mGHRH andthose of other species, the mouse nucleic acid se-quence is actually about 85% identical to that of rat,including extensive identity in both the 5'- and 3'-nontranslated sequences.

The basic structural motifs found in the precursorsencoding human and rGHRH are preserved in themGHRH precursor (16, 17). The mature peptide (42amino acids) resides in the center of the precursor (103amino acids) and is flanked by an amino-terminal signalsequence, and a carboxyl-terminal cryptic peptide. Thiscarboxyl-terminal peptide has no identified function, buthas been shown to be C-terminally amidated and co-secreted with GHRH in the rat (25). Like rGHRH, themouse peptide has an amino-terminal histidine,

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

MOL ENDO-19891696

Vol 3 No. 11

in

28S-

18 S-

Fig. 4. RNA Blot Analysis of GHRH mRNA in the MousePlacenta during Gestation

Each lane contains 20 nQ total RNA probed with the mGHRHcDNA insert. The positions of the ribosomal RNA bands areindicated. The top numbers represent the gestation day of theplacenta.

s tois

scoo

3

285-

18 S-

-75On

Fig. 5. RNA Blot Analysis of GHRH mRNA in Mouse TissuesRNAs from the indicated tissues were probed with the

mGHRH cDNA clone. The liver, testes, and placenta lanescontain 20 ng total RNA, while the hypothalamus lane contains5 ng poly(A)+ RNA (~five hypothalamic fragments). The posi-tions of the ribosomal RNA bands are indicated. All RNAsshown were electrophoresed on the same agarose gel, andthe top of the gel is not shown. The mature GHRH mRNAobserved in placenta and hypothalamus is approximately 750nucleotides in length.

whereas all other characterized GHRHs have a tyrosineat position 1 (3, 14). One surprising characteristic ofthe mouse precursor is the presence of a single arginineresidue preceding the amino-terminus of the matureGHRH peptide. Two basic residues are found at thisposition in both the human and rat precursors, althougha single arginine does seem to function as the proteo-lytic cleavage signal at the carboxyl-terminus of theGHRH peptide in all three species. Other examples ofpeptide hormone cleavage at a single basic residuehave been reported (26, 27).

We have shown that the clone isolated from placentadetects a GHRH mRNA in mouse hypothalamus, bothby RNA blotting techniques and by in situ hybridization.RNA blot analysis indicates that in addition to the 750nucleotide transcript that presumably represents themature GHRH mRNA, larger transcripts that might rep-resent either RNA processing intermediates or distinctGHRH-related sequences are observed in severalmouse tissues, including hypothalamus. Consistentwith previous reports on the localization of the GHRHpeptide (28-30) and mRNA (31,32) in rat brain, we findexpression limited to the hypothalamus, in particular tothe arcuate nucleus. The GHRH cDNA will allow us tofurther characterize expression of the GHRH mRNA inthe hypothalamus as a function of the growth status ofthe animal.

Although GHRH-like immunoreactivity and biological

activity have been reported in the placenta (18,19), wewere surprised at the very high levels of GHRH mRNAfound in the placenta as compared to hypothalamus.Our results both in the rat (20) and the mouse (thisstudy) suggest that GHRH expression is develop-mentally regulated during gestation and that GHRHmRNA is a very abundant placental transcript from mid-pregnancy to term. Determining the function of thisplacental GHRH will clearly be important for completelyunderstanding the role of GHRH and its induced prod-ucts in regulating growth and development. High levelsof GH are found in day-19 fetal rat plasma (33), eventhough portal capillaries in the median eminence remainlargely undeveloped at this time (34). This observationsuggests that fetal GH production might be temporarilycontrolled by an extra-hypothalamic source of GHRH,such as the placenta.

Our in situ hybridization results suggest an interestingcellular pattern of GHRH expression in the mouse pla-centa. We find that the GHRH mRNA is highly ex-pressed in trophoblast giant cells during much of ges-tation. These cells make direct contact wih the maternalMood supply (24), and also express additional hor-mones such as the placental lactogens (35) and proli-ferin (36). This suggests that GHRH might be secretedfrom the placenta during pregnancy. GHRH mRNA isalso found in the placental labyrinth, which is composed

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

IMouse GHRH 1697

Brightfield Darkfield

Arc

• '. V

Fig. 6. In Situ Hybridization Analysis of GHRH mRNA Expression in Mouse TissuesTissues were hybridized to a 35S-labeled mouse GHRH antisense RNA probe and the hybridization detected by liquid emulsion

autoradiography. The left panels are brightfield photographs that show the tissue structure; the right panels are darkfieldphotographs that show the silver grains indicative of positive hybridization. The top panel shows the hypothalamus of a malemouse; the bottom two panels show regions of the placenta on day 16 of gestation. All were photographed at 10Ox magnification.The abbreviations are: 3V, third ventricle; Arc, arcuate nucleus; Dec, decidua; GC, giant cells, BZ, basal zone; Lab, labyrinth.

largely of cytotrophoblasts and syncytiotrophoblasts(24). Several other hypothalamic releasing peptideshave been found in placenta, including CRH and GnRH(37,38). Both of these appear to be expressed predom-inantly in cytotrophoblasts of the placental labyrinth, inagreement with our observations for GHRH.

In addition to providing useful structural informationabout the mGHRH peptide, cloning of the mGHRHcDNA has allowed us to examine the pattern of GHRHgene expression in the brain and placenta of normalmice. It will also now provide a framework for askingquestions regarding the expression of the GHRH genein interesting mouse models such as mutant or trans-genic animals with altered patterns of growth and de-velopment.

MATERIALS AND METHODS

Complementary DNA Cloning and Sequencing

Plaques (106) from a Xgt11 gestational day-13 mouse placentalcDNA library were screened by hybridization using an «32P-

dCTP-labeled rGHRH probe (17). The insert from the largestclone was subcloned into the plasmid vector pGEM-4 (Pro-mega Biotech, Madison, Wl). Sequencing of the cDNA insertwas done by the dideoxy method on double-stranded plasmidDNA, essentially as described (39). Sequences were storedand analyzed using a Beckman MicroGenie (Fullerton, CA)sequence analysis program on an IBM PC-AT. Enzymes usedin recombinant DNA procedure were from either PromegaBiotech (Madison, Wl) or Bethesda Research Laboratories(Bethesda, MD) and radionucleotides were from New EnglandNuclear (Wilmington, DE).

RNA Blot Analysis

RNA was isolated from mouse tissues (C57/bl6 x SJL) byhomogenization in guanidine isothiocyanate, and extractionwith phenol as described (40). RNA concentration was deter-mined by optical density and RNAs were stored in 0.5%sodium dodecyl sulfate at -70 C until use. Poly(A)+ RNA wasisolated by column chromatography using oligo(dT)-cellulose.Total or poly(A)+ RNAs were electrophoresed on a denaturing1% agarose/formaldehyde gel, and the gel stained with acri-dine orange to check for equivalent loading of RNA samples.RNA was transferred to a nylon membrane by blotting over-night in 20x SSC, and the gel was restained to check forcomplete transfer of RNA. The membrane was baked 2 h at

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

MOL ENDO-19891698

Vol 3 No. 11

Antisense Probe Sense Probe

*•*C<D

lac

Q .

<D

ocCOb

Fig. 7. In Situ Hybridization Analysis Showing Cellular Expression of GHRH mRNA in Mouse Brain and PlacentaTissues in the left panels were hybridized to a S-labeled mGHRH antisense RNA probe; those in the right panels to a sense-

strand probe. The top panel shows cells in the hypothalamus; the two adjacent cells were in the arcuate nucleus, and the singlecell was in ventrolateral part of the ventromedial nucleus. The sense controls are from the same two regions. The bottom threepanels show regions of the placenta; giant cells, the basal zone, and the labyrinth, from top to bottom. Brain sections werephotographed at 1000x magnification; placental sections were photographed at 500x magnification.

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

Mouse GHRH 1699

80 C, and hybridized to the mGHRH cDNA insert that hadbeen labeled with «32P-dCTP by nick-translation. Autoradi-ographic exposure was for 2 days at -70 C with an intensifyingscreen.

In Situ Hybridization Analysis

Mouse tissues were removed immediately after killing theanimal and frozen on dry ice. Twenty-micrometer sectionswere cut using a Reichert 820 cryostat (Buffalo, NY), and werethaw-mounted onto microscope slides pretreated with gelatin,chromium potassium sulfate, and polylysine. Coronal brainsections were taken through the hypothalamus, while bothsagittal and transverse sections were taken from regionsthroughout the placenta. The sections were then allowed toair dry for 1 -2 h and fixed as follows: 5% paraformaldehyde,pH 7.0 (10 min), 2x SSC (5 min), H2O (rinse), 0.1 M triethanol-amine, pH 8 (rinse), 0.1 M triethanolamine with 0.25% aceticanhydride (10 min), and 2x SSC (rinse). The slides weredehydrated through an ethanol series (50%, 70%, 95%, and100%) and dried completely in a vacuum desiccator. RNAprobes were made by transcription from the SP6 promoter ofpGEM4, using ^S-UTP as the label. Constructs containing themGHRH insert in both orientations were used to make anti-sense and sense probes. Coverslipped slides were hybridizedfor 18 h at 47 C in heavy paraffin oil as previously described,using 1 x 107 cpm/ml probe (41). Oil and coverslips wereremoved and the sections treated with 10 mg/ml RNAse A for30 min at 37 C. After RNAse treatment, the slides werewashed in 0.2x SSC for 2 h at 42 C, and prepared forautoradiography using Kodak NTB-2 emulsion. Exposure wasfor 2 weeks. Brain sections were stained with cresyl violet;placental sections were stained with hemotoxylin/eosin.

Acknowledgments

We thank Dr. Daniel Linzer for providing the mouse placentalcDNA library and for comments in the manuscript, and thankDr. Michael Soares for useful discussion on placental histology.

Received June 29, 1989. Revision received July 31, 1989.Accepted July 31,1989.

Address requests for reprints to: Dr. Kelly E. Mayo, North-western University, Department of Biochemistry, MolecularBiology and Cell Biology, Evanston, Illinois 60208.

This work was supported by NIH Grant NS-24439, theSearle Scholars Program Grant 87-G-113, and the NationalScience Foundation Presidential Young Investigators ProgramGrant DCB8552977.

REFERENCES

1. Rivier J, Spiess J, Thorner M, Vale W 1982 Characteriza-tion of a growth hormone releasing factor from a pan-creatic islet tumor. Nature 300:276-278

2. Guillemin R, Brazeau P, Bohlen P, Esch F, Ling N, Weh-renberg WB 1982 Growth hormone releasing factor froma human pancreatic tumor that caused acromegaly. Sci-ence 218:585-587

3. Spiess J, Rivier J, Vale W 1983 Characterization of rathypothalamic growth hormone-releasing factor. Nature303:532-535

4. Brazeau P, Vale W, Burgus R, Ling N, Butcher M, RivierJ, Guillemin R 1973 Hypothalamic polypeptide that inhibitsthe secretion of immunoreactive pituitary growth hor-mone. Science 179:77-79

5. Hall K, Sara VR 1983 Growth and somatomedins. Vit andHorm 40:175-233

6. Berelowitz M, Szabo M, Frohman LA, Firestone S, ChuL, Hintz RL 1981 Somatomedin C mediates growth hor-mone negative feedback by effects on both the hypothal-amus and the pituitary. Science 212:1279-1281

7. Eicher EM, Beamer J 1976 Inherited ateliotic dwarfism inmice: characteristics of the mutation, little, on chromo-some 6. J Hered 67:87-91

8. Hammer RE, Brinster RL, Rosenfeld MG, Evans RM,Mayo KE 1985 Expression of human growth hormone-releasing factor in transgenic mice results in increasedsomatic growth. Nature 315:413-416

9. Mayo KE, Hammer RE, Swanson LW, Brinster RL, Ro-senfeld MG, Evans RM 1988 Dramatic pituitary hyperpla-sia in transgenic mice expressing a human growth hor-mone-releasing factor gene. Mol Endocrinol 2:606-612

10. Low MJ, Hammer RE, Goodman RH, Habener JF, Palmi-ter RD, Brinster RL 1985 Tissue-specific post-transcrip-tional processing of pre-prosomatostatin encoded by ametallothionein-somatostatin fusion gene. Cell 41:211-219

11. Palmiter RD, Brinster RL, Hammer RE, Trumbauer ME,Rosenfeld MG, Birnbirg NC, Evans RM 1982 Dramaticgrowth of mice that develop from eggs microinjected withmetallothionein-growth hormone fusion genes. Nature300:611-615

12. Palmiter RD, Norstedt G, Gelinas RE, Hammer RE, Brins-ter RL 1983 Metallothionein-human GH fusion genes stim-ulate growth of mice. Science 222:809-814

13. Palmiter RD, Brinster RL 1986 Germ-line transformationof mice. Annu Rev Genetics 20:465-499

14. Frohman LA, Jansson J 1986 Growth hormone-releasinghormone. Endocr Rev 7:223-253

15. Gelato M, Merriam G 1986 Growth hormone releasinghormone. Annu Rev Physiol 48:569-591

16. Mayo KE, Vale W, Rivier J, Rosenfeld MG, Evans RM1983 Expression-cloning and sequence of a cDNA encod-ing human growth hormone-releasing factor. Nature306:86-88

17. Mayo KE, Cerelli GM, Rosenfeld MG, Evans RM 1985Characterization of cDNA and genomic clones encodingthe precursor to rat hypothalamic growth hormone-releas-ing factor. Nature 314:464-467

18. Baird A, Wehrenberg WB, Bohlen P, Ling N 1985 Immu-noreactive and biologically active growth hormone-releas-ing factor in the rat placenta. Endocrinology 117:1598-1601

19. Meigan G, Sasaki A, Yoshinaga K 1988 Immunoreactivegrowth hormone-releasing hormone in rat placenta. En-docrinology 123:1098-1102

20. Kulik DJ, Mayo KE 1989 Growth hormone-releasing hor-mone gene is expressed in the rat placenta. J Cell Biol107(6, Pt, 3) (Abstract 486)

21. Jackson LL, Colosi P, Talamantes F, Linzer DIH 1986Molecular cloning of mouse placental lactogen cDNA.Proc Natl Acad Sci USA 83:8496-8500

22. Bradbury AF, Finnie MDA, Smyth DG 1982 Mechanismof C-terminal amide formation by pituitary enzymes. Na-ture 298:686-688

23. Berry SA, Pescovitz OA1988 Identification of a rat GHRH-like substance and its messenger RNA in rat testis. En-docrinology 123:661-663

24. Davies J, Glasser SR 1968 Histological and fine structuralobservations on the placenta of the rat. Acta Anat 69:542-608

25. Bloch B, Baird A, Ling N, Guillemin R 1986 Immunohis-tochemical evidence that growth hormone-releasing fac-tor neurons contain an amidated peptide derived fromcleavage of the carboxyl-terminal end of the GRF precur-sor. Endocrinology 118:156-162

26. Furutani Y, Morimoto, Y, Shibahara S, Noda M, TakahashiH, Hirose T, Asai M, Inayama S, Hayashida H, Miyota T,Numa S 1983 Cloning and sequence analysis of cDNAfor ovine corticotropin-releasing factor precursor. Nature301:537-540

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022

MOL ENDO-19891700

Vol 3 No. 11

27. Land H, Schutz G, Schmale H, Richter D 1982 Nucleotidesequence of a cloned cDNA encoding bovine argininevasopressin-neurophysin II precursor. Nature 295:299-303

28. Bloch B, Brazeau P, Ling N, Bohlen P, Esch F, Wehren-berg WB, Benoit R, Bloom F, Guillemin R 1983 Immuno-histochemical detection of growth hormone-releasing fac-tor in brain. Nature 301:607-608

29. Merchenthaler I, Vigh S, Schally A, Petrusz P 1984 Im-muno-cytochemical localization of growth hormone-re-leasing factor in therat hypothalamus. Endocrinology114:1082-1085

30. Sawchenko P, Swanson L, Rivier J, Vale W 1985 Thedistribution of growth hormone releasing factor (GRF)immunoreactivity in the central nervous system of the rat:an immunohistochemical study using antisera directedagainst rat hypothalamic GRF. J Comp Neurol 237:100-115

31. Mayo KE, Evans RM, Rosenfeld MG 1986 Genes Encod-ing mammalian neuroendocrine peptides: strategies to-ward their identification and analysis. Annu Rev Physiol48:431-445

32. Mayo KE 1989 Structure and expression of growth hor-mone releasing hormone (GHRH) genes. In: Muller EE,Cocchi D, Locatelli V (eds) Advances in Growth Hormoneand Growth Factors Research. Phythagora, Rome andSpringer-Verlag, Heidelberg, pp 217-230

33. Rieutort M 1974 Pituitary content and plasma levels ofgrowth hormone in foetal and weanling rats. J Endocrinol60:261-268

34. Szabo K, Csanyi K 1982 The vascular architecture of thedeveloping pituitary-median eminence complex in the rat.Cell Tissue Res 224:563-577

35. Soares MJ, Julian JA, Glasser SR 1985 Trophoblast giantcell release of placental lactogens: temporal and regionalcharacteristics. Dev Biol 107:520-526

36. Lee SJ, Talamantes F, Wilder E, Linzer DIH, Nathans D1988 Trophoblast giant cells of the mouse placenta as asite of proliferin synthesis. Endocrinology 122:1761-1768

37. Petraglia F, Sawchenko P, Rivier J, Vale W1987 Evidencefor local stimulation of ACTH secretion by corticotropin-releasing factor in human placenta. Nature 328:717-719

38. Khodr GS, Siler-Khodr T 1978 Localization of luteinizinghormone-releasing hormone in the human placenta. FertilSteril 29:523-526

39. Bartlett JA, Gaillard RK, Joklik WK 1986 Sequencingsupercoiled plasmid DNA. Biotechniques 4:208-210

40. Chomczynski P, Sacchi N 1987 Single step method ofRNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159

41. Woodruff TK, Meunier H, Jones PBC, Hsuesh AJW, MayoKE 1987 Rat inhibin: molecular cloning of a and /? subunitcDNAs and expression in the ovary. Mol Endocrinol1:561-568

Dow

nloaded from https://academ

ic.oup.com/m

end/article/3/11/1693/2713712 by guest on 24 August 2022