Transgressive segregation reveals two Arabidopsis TIR-NB-LRR resistance genes effective against Leptosphaeria maculans , causal agent of blackleg disease

Transgressive segregation reveals two ArabidopsisTIR-NB-LRR resistance genes effective against Leptosphaeriamaculans, causal agent of blackleg disease

Jens Staal*, Maria Kaliff, Svante Bohman† and Christina Dixelius

Department of Plant Biology and Forest Genetics, Swedish University of Agricultural Sciences, Dag Hammarskjolds vag 181, PO

Box 7080, 750 07 Uppsala, Sweden

Received 4 October 2005; revised 30 November 2005; accepted 8 December 2005.*For correspondence (fax þ46 18 673279; e-mail [email protected]).†Present address: Department of Medical Genetics and Pathology, Rudbeck Laboratory, Uppsala University, Dag Hammarskjolds vag 20, 751 85 Uppsala, Sweden.

Summary

In a cross between the two resistant accessions Col-0 and Ler-0, a 15:1 segregation was found in F2, suggesting

the presence of unlinked resistance loci to Leptosphaeria maculans. One hundred Col-4 · Ler-0, and 50

Ler-2 · Cvi-1 recombinant inbred lines, and seven susceptible Ler-0 · Ws-0 F2 progenies were examined to

identify the two loci. Resistance in Col-4, Ws-0 and Cvi-1 (RLM1) was mapped to the marker m305 on

chromosome 1. Col-4 · Ler-0 and Ler-2 · Cvi-1 mapping populations located RLM2Ler on the same arm of

chromosome 4. A tight physical location of RLM2 was established through near-isogenic lines. This region was

found to correspond to an ancient duplication event between the RLM1 and RLM2 loci. Two independent T-

DNA mutants in a TIR-NB-LRR R gene (At1g64070) displayed susceptibility, and L. maculans susceptible

mutant phenotypes were confirmed to be allelic for rlm1 in F1 after crosses with susceptible rlm1Lerrlm2Col

plants. Complementation of rlm1Lerrlm2Col with the genomic Col-0 sequence of At1g64070 conferred

resistance. In addition, two T-DNA mutants in a neighbouring homologous TIR-NB-LRR gene (At1g63880)

displayed moderate susceptibility to L. maculans. Sequence analysis revealed that At1g64070 was truncated

by a premature stop codon, and that At1g63880 was absent in Ler-0. RNA interference confirmed that Ler-0

resistance is dependent on genes structurally related to RLM1. Camalexin was identified as a quantitative

co-dominant resistance factor of Col-0 origin, but independent of RLM1. RLM1/RLM2 resistance was, however,

found to require RAR1 and partially HSP90.1.

Keywords: callose, camalexin, complex trait, natural variation, QTL, R gene signalling.

Introduction

In their natural environment, plants are continuously ex-

posed to various environmental cues including insects,

nematodes and an array of micro-organisms. Their survival

under such conditions is dependent on their ability to per-

ceive external signals and respond in a timely manner.

During the past decade, an increasing number of plant dis-

ease resistance (R) genes from different species have been

identified by map-based cloning, insertional mutagenesis or

various high-throughput technologies. Sequence compari-

sons among these genes have revealed a remarkable con-

servation of structural features, despite the diversity of the

pathogens with which their products interact (recently re-

viewed in Hammond-Kosack and Parker, 2003; Nimchuk

et al., 2003). A large group of R proteins have localization

and domain organization resembling that of the cytosolic

Nod receptor proteins in animal innate immunity (Inohara

and Nunez, 2003). These consist of a nucleotide-binding ol-

igomerization domain (NOD or NB) followed by a series of

leucine-rich repeats (LRR). In contrast to the animal NB-LRR

proteins, plant R proteins usually have a different N-terminal

domain. The N-terminal domain in plants may be a coiled

coil (CC) sequence or a domain that shares sequence simi-

larity with the Drosophila melanogaster TOLL and human

interleukin-1 receptor referred to as TIR. The TIR domain has

a central role in interactions with downstream signalling

components for TOLL-like receptors (TLRs) in animal innate

218 ª 2006 The AuthorsJournal compilation ª 2006 Blackwell Publishing Ltd

The Plant Journal (2006) 46, 218–230 doi: 10.1111/j.1365-313X.2006.02688.x

immunity (Janssens and Beyaert, 2002). Information ob-

tained about defence signalling thus far shows that the CC-

NB-LRR and TIR-NB-LRR R proteins have differential

requirements for downstream signalling components (Aarts

et al., 1998). A route via RAR1 (required for Mla-dependent

resistance 1) or SGT1 (suppressor of the G2 allele of SKP1)

can, however, regulate the response of both categories of R

proteins (Austin et al., 2002; Azevedo et al., 2002; Liu et al.,

2002; Tor et al., 2002). RAR1 and SGT1 interact with each

other and with diverse protein complexes, for example

HSP90 (heat shock protein 90), which most likely allows

them to have flexible functions (reviewed in Shirasu and

Schulze-Lefert, 2003). In addition, RAR1 has been shown to

possess quantitative influences on some NB-LRR class R

proteins, caused by altered R protein stability (Bieri et al.,

2004). Recent results show that the RAR1 animal homologue

CHP-1 has an interaction pattern with PP5 (protein phos-

phatase 5), HSP90 and NOD1 (NB-LRR) similar to that seen in

plants, suggesting that this is an ancient mechanism in in-

nate immunity (Hahn, 2005). Despite the constantly

expanding list of cloned plant disease resistance genes,

defence mechanisms to most plant diseases are still un-

known and many questions about the signalling machinery

remain to be answered.

The dothideomycete, Leptosphaeria maculans, is a hemi-

biotrophic fungal pathogen, causing the blackleg disease of

Brassica oil crops worldwide (West et al., 2001). The fungal

hyphae enter the host preferentially through wounds or

stomata without the aid of specialized infection structures

such as appressoria (Howlett et al., 2001). Genetic studies of

L. maculans resistance in Brassica species have been tedi-

ous, and despite confirmed gene-for-gene interactions, no

Brassica R genes or LmAvr genes have been cloned (Howl-

ett, 2004). Arabidopsis has been shown to be a suitable

model host system to develop a mechanistic understanding

of resistance against this pathogen. In a previous study, 168

Arabidopsis accessions and numerous mutants impaired in

pathways or key genes important in plant defence were

evaluated for their response to L. maculans (Bohman et al.,

2004). It was found that the resistance in Arabidopsis was

independent of salicylic acid, jasmonic acid and ethylene-

induced defences, but partly relied on the phytoalexin

camalexin. In the Arabidopsis–L. maculans pathosystem,

we also have observed a segregation ratio close to 15:1 in a

F2 population between resistant Col-0 and Ler-0, suggesting

that two independent dominant resistance traits reside in

each parental accession (Bohman et al., 2004). Similar

results were obtained from crosses between Ler-0 and Ws-

0 (Bohman, 2001). Based on this information, we utilized two

sets of recombinant inbred lines (RILs) Col-4 · Ler-0 and Ler-

2 · Cvi-1 with the aim of identifying genes that control the

defence to L. maculans. A locus responsible for resistance to

L. maculans in the Col-0 background (RLM1Col) comprising

seven structurally related TIR-NB-LRR genes was identified.

Disruption with two independent T-DNA insertions in each

of two genes found in RLM1Col results in susceptible

phenotypes. RLM1Col and RLM2Ler appear to be derived

from an ancient segmental duplication event that included

several flanking genes. It can be concluded that L. maculans

resistance relies on several layers of defence, with RLM1/

RLM2-dependent callose deposition and RLM1/RLM2-inde-

pendent camalexin induction among the major determi-

nants of this particular plant defence system.

Results

Loss of two dominant resistance loci causes susceptibility in

mapping populations

Earlier investigations by Bohman et al. (2004) revealed the

loss of two unlinked L. maculans resistance loci (RLM1 and

RLM2) in progeny of crosses between the two resistant

accessions Col-0 (RLM1Colrlm2Col) and Ler-0 (rlm1Ler

RLM2Ler) (Figure 1a,b). We used the Col-4 · Ler-0 RILs (Lister

and Dean, 1993) in a map-based approach to identify the two

resistance loci. As a positive control, a Col-0 · Ler-0 F3 line

was selected for its distinct susceptible phenotype, denoted

rlm1Lerrlm2Col throughout this paper (Figure 1c). Suscepti-

bility occurred in the same RILs, regardless of the L. macu-

lans isolate used in the screening.

Figure 1. Differential responses observed on parental Arabidopsis acces-

sions and progenies deriving from various crosses after inoculation of

L. maculans. dpi, days post-inoculation.

(a) Resistant phenotype on Col-0, 21 dpi.

(b) Resistant phenotype on Ler-0, 21 dpi.

(c) Susceptible homozygous progeny (F3) from Col-0 · Ler-0 (rlm1Lerrlm2Col)

used as positive control and as test cross parent throughout this paper, 14 dpi.

(d) Susceptible phenotype on Ler-0 · Ws-0 (rlm1Lerrlm2Ws) F2 progeny,

14 dpi.

(e) Susceptible phenotype on the Ler-2/Cvi-1 near-isogenic line LCN4-6 (Ler-

rlm2Cvi), 14 dpi.

(f) Susceptible F1 progeny deriving from a cross between rlm1Lerrlm2Col and

rlm1Lerrlm2Ws, 14 dpi.

(g) Susceptible F1 progeny between rlm1Lerrlm2Col and Ler-rlm2Cvi, 14 dpi.

(h) Resistant phenotype on F1 progeny between Col-0 and rlm1Lerrlm2Col,

21 dpi.

RLM1 resistance to Leptosphaeria maculans 219

ª 2006 The AuthorsJournal compilation ª 2006 Blackwell Publishing Ltd, The Plant Journal, (2006), 46, 218–230

Analysis of 100 Col-4 · Ler-0 RILs identified 20 susceptible

individual lines, close to the expected 3:1 segregation ratio.

A quarter of the lines are expected to be susceptible as RILs

are considered to be homozygous, compared to an expected

segregation of 6.25% susceptible plants in an F2 population

where heterozygotes are present. Susceptibility due to

transgressive segregation of the resistance genes was also

seen on Ler-0 · Ws-0 (rlm1Lerrlm2Ws) and on inbred proge-

nies from crosses between the resistant accessions Cvi-1

and Ler-2 (Ler-rlm2Cvi) (Figure 1d,e). Furthermore, F1 plants

from crosses of rlm1Lerrlm2Col with rlm1Lerrlm2Wsand with

Ler-rlm2Cvi were found to be susceptible (Figure 1f,g). This

provides further support to there being a common resist-

ance locus in Col-0, Cvi-1 and Ws-0. As a control, F1 progeny

from a cross between susceptible plants (rlm1Lerrlm2Col) and

resistant Col-0 yielded fully resistant plants (Figure 1h).

Regression analysis of the RIL screening results revealed

two significant loci (Figure 2). The genetic position on

chromosome 1 was well-characterized due to close recom-

bination events, whereas the genetic position on chromo-

some 4 was less defined. Susceptibility in the RILs between

Col-4 and Ler-0 occurred when marker m305 (RLM1) showed

the Ler genotype and marker mi198 (RLM2) displayed a Col

genotype. Thus, the gene found in Col-4 should encode a

L. maculans resistance gene located close to marker m305.

Only one RIL (N1918) exhibiting a Col-4 genotype at marker

m305 was classified as susceptible and provided important

information for a well-defined location of RLM1. A tight

association between the marker m305 and RLM1 was further

confirmed using the core set of fifty Ler-2 · Cvi-1 RILs and

seven susceptible Ler-0 · Ws-0 F2 plants that also linked

RLM1 to marker m305.

The Ler-resistance locus (RLM2Ler) was found between

Ve024 (51.93 cM, At4g14690) and mi260 (54.93 cM,

At4g16010) on chromosome 4 on the Col-4 · Ler-0 RIL

marker map. The best associations were found at marker

m198 (52.47 cM, At4g15160–At4g15180). RLM2Ler was how-

ever mapped to marker GB.750C on chromosome 4 in the

Ler-2 · Cvi-1 RI lines, which is approximately 31 cM south of

marker mi198. This discrepancy implies an inversion event

in either Col-4 or Cvi-1 compared to Ler-0 or differences

between the genetic maps. The physical location of RLM2Ler

was determined by observations of disease lesions on the

near–isogenic lines LCN4-5 and LCN4-6 that have Ler-2

background with Cvi-1 genotype only at parts of the mapped

location of RLM2 (Figure 1e). Ler-2 shows a completely

resistant phenotype identical to Ler-0. Data on the genomic

regions of Cvi-1 genotype within the Near Isogenic Lines

(NILs) (J. Keurentjes, Laboratory of Genetics, Wageningen

University, Wageningen, personal communication) define

the location of RLM2Ler between 9.9 and 11.4 Mbp, corres-

ponding to At4g17800–At4g24140, on chromosome 4.

RLM1Col resides in a complex of structurally related TIR-NB-

LRR class R genes

Data on the physical locations of RIL markers defined the

Col-resistance locus (RLM1Col) to the At1g63710–At1g64360

interval. Out of 76 genes found in the mapped locus, seven

encoded putative R genes of the TIR-NB-LRR family. The

genetically defined locus also contained defence-associated

genes such as NPR1, RbohF and a pathogen-responsive

dirigent-like lignan biosynthesis protein. To identify the

gene responsible for the rlm1Ler phenotype, T-DNA mutants

in the Col-0 background of candidate genes in the RLM1

locus were screened with L. maculans.

None of the 16 T-DNA mutant lines targeting 10 disease-

associated genes in the RLM1 locus examined showed the

same rapid lesion development as the rlm1Lerrlm2Col plants

used as a positive control. However, two independent knock-

out lines (salk_014088 and salk_014096), containing a dis-

ruption of the first exon of the gene At1g64070, displayed a

reduced resistance (Figure 3a) compared to the highly

resistant wild-type Col-0 (Figure 1a). T-DNA mutants in

At1g64070 were confirmed to be allelic for rlm1Ler by

observations of susceptibility in F1 after crosses with the

rlm1Lerrlm2Col control line. The test cross between

salk_014088 and rlm1Lerrlm2Col did show an intermediate

susceptible phenotype in F1 (Figure 3b). Disease symptoms

were more severe than found on salk_014088 but not as

obvious as on rlm1Lerrlm2Col individuals. In addition to the

phenotypes found after disruption of At1g64070, two T-DNA

mutant lines in the gene At1g63880 (salk_110395 and

salk_110393) also exhibited a reduced resistance, although

Figure 2. Graphical output from QTL cartographer, illustrating the well-

defined genetic intervals of RLM1 and RLM2 and the additive effect for the

alleles that contribute to susceptibility. RLM1 has an LOD score of 14.8 at

marker m305 (91.89 cM, At1g64170/80) and RLM2 an LOD score of 7.9 at

marker mi198 (52.47 cM, At4g15160/80). A significance of P < 0.05 corre-

sponds to an LOD score of 4.94 according to permutation tests.

220 Jens Staal et al.


more moderately (Figure 3c,d). Pycnidia developed over

large leaf areas on both rlm1Lerrlm2Col and salk_014088

plants but not on wild-type Col-0 (Figure 3e–g). The F1

progeny between salk_014088 and rlm1Lerrlm2Col displayed

successful systemic growth of L. maculans in un-inoculated

leaves (Figure 3h), which was not observed in salk_014088.

The intermediary response observed on F1 plants from a test

cross between salk_014088 and rlm1Lerrlm2Col suggests that

the remaining genetic components, when At1g64070 func-

tion is lost, quantitatively contribute to resistance. Comple-

mentation analysis with the genomic Col-0 sequence of

At1g64070 driven by its native promoter was performed in

the highly susceptible rlm1Lerrlm2Col control line back-

ground to facilitate reliable scoring of phenotype changes.

Completely restored resistance was found in eight T1 plants

(Figure 3i,j). The remaining three lines showed very weak

lesions corresponding to 3 or less on the Delwiche and

Williams (1979) scale but with no obvious mycelia growth or

pycnidia development. In conclusion, RLM1 activity is

mainly dependent on At1g64070, together with a minor

contribution from at least one additional homologous gene,

At1g63880, present in this locus.

To further understand the role of this particular gene

family, a 26-mer RNA interference (RNAi) construct was

designed to specifically target TIR-NB-LRR genes within

the RLM1Col locus (At1g64070, At1g63750, At1g63880,

At1g63870) under the simplified assumption of a require-

ment of 22 consecutive identical nucleotides for silencing.

This assumption predicted that three RLM1-related off-target

genes (At4g14370, At1g56510, At2g16870) would be affected

by the RNAi construct. A sequence analysis with the more

flexible criteria described by Du et al. (2005) showed that

only genes structurally related to RLM1 may act as off-target

genes and that two more genes (At5g18350 and At1g63740)

are possibly silenced by the RNAi construct. Twelve sus-

ceptible plants were found when 79 T1 RNAi plants of the

Ler-0 background were evaluated (Figure 3k,l). The appear-

ance of the first necrotic lesion varied however from 5 to

17 days post-inoculation. These results support our hypo-

thesis that resistance in Ler-0 is dose-dependent and

dependent on genes structurally related to those found in

RLM1Col. Consequently, RLM2Ler is a paralogue of RLM1Col.

RLM1 is a L. maculans-specific resistance gene

Leptosphaeria maculans-susceptible (rlm1Lerrlm2Col) plants

and T-DNA mutants in RLM1 candidate genes did not display

any susceptibility to Botrytis cinerea or Alternaria brassici-

cola, suggesting that RLM1 is a L. maculans-specific resist-

ance gene and that RLM1 differs from the BOS3 locus, which

has been mapped to the same cluster of genes (Veronese

et al., 2004).

The non-functional rlm1Ler locus reveals loss-of-function in

both RLM1Col genes

PCR amplification of genomic DNA and cDNA from Ler-0

did not result in any product from the sequences of the

gene At1g63880. PCR amplification of the same sequences

was successful and resulted in identical fragment lengths

from genomic DNA of the RLM1 genotypes Col-0, Col-4

and Ws-0. The gene At1g64070 was, on the other hand,

isolated from genomic Ler-0 DNA and fragment lengths

corresponded to the products obtained from Col-0 DNA.

BLAST analysis of At1g64070 against the Cereon Ler-0

sequence database (Jander et al., 2002) revealed a

1604 bp hit with 96% identity. The sequence (ATL8C33498)

revealed a G insertion at 1569 bp (coordinates based on

Figure 3. Phenotypic responses to L. maculans observed on genotypes with

genetic modifications of RLM1 or RLM2 compared to wild-type plants. dpi,

days post-inoculation.

(a) Susceptible phenotype on At1g64070 T-DNA mutant salk_014088, 19 dpi.

(b) Susceptible phenotype on F1 progeny between rlm1Lerrlm2Col and

At1g64070 T-DNA mutant salk_014088, 16 dpi.

(c) Moderately susceptible phenotype on At1g63880 T-DNA mutant

salk_110395, 21 dpi.

(d) Mycelia growth in salk_110395 visualized by tryphan blue staining, 21 dpi.

(e) Pycnidia formation on a detached leaf of rlm1Lerrlm2Col.

(f) Pycnidia formation on a detached leaf from At1g64070 T-DNA mutant

salk_014088.

(g) Lack of fungal growth on a detached leaf from resistant Col-0.

(h) Pycnidia formation on a detached leaf after systemic growth of L. mac-

ulans in F1 progeny between rlm1Lerrlm2Col and At1g64070 T-DNA mutant

salk_014088.

(i) Resistant phenotype in T1 by complementation of rlm1Lerrlm2Col with the

genomic Col-0 sequence of At1g64070 driven by the native promoter, 14 dpi.

(j) Susceptible rlm1Lerrlm2Col non-transformed control, 14 dpi.

(k) Resistant non-transformed Ler-0 control, 14 dpi.

(l) Susceptible phenotype in T2 line of Ler-0 with RNAi that targets four TNL-H

genes in the RLM1Col locus, 14 dpi.



Col-0 coding domain sequence (CDS) of At1g64070),

which caused a þ1 frameshift (rlm1-snpA) in the gene,

resulting in subsequent premature translational stop co-

dons. The same polymorphism was found in BLAST hits

from the Ler-0 sequence database (http://www.tigr.org/tdb/

e2k1/ath1/atgenome/Ler.shtml) using the Col-0 At1g64070

CDS sequence. Single nucleotide polymorphism (SNP)-

specific PCR analysis showed the Ler-0 genotype in rlm1-

snpA for all 12 rlm1Lerrlm2Col and seven susceptible

rlm1Lerrlm2Ws F2 plants tested. Furthermore, rlm1-snpA

was found to co-segregate with marker m305 in the Col-

4 · Ler-0 RILs, providing further proof that the Ler-0 se-

quence ATL8C33498 represents an allele of At1g64070. In

agreement with phenotype data, the susceptible RIL

N1918 with Col-4 genotype at marker m305 showed Ler-0

genotype at rlm1-snpA. Allele fragments of the expected

size were recovered with two independent At1g64070-

specific forward primers and the SNP-specific primer. The

Ler-0 allele of rlm1-snpA was not amplified in any of the

four RLM1 genotypes (Col-0, Col-4, Ws-0, Cvi-1), whereas

the Col-0 allele of rlm-snpA was successfully amplified.

Variation in disease progression between susceptible

Col-4 · Ler-0 RILs reveals camalexin as a quantitative

resistance factor

The genetic analysis showed that resistance to L. maculans

is mainly controlled by two different dominant loci, RLM1Col

and RLM2Ler, one from each parental accession, but the level

of disease progression and the disease phenotypes among

the susceptible Col-4 · Ler-0 RILs was highly variable (Ta-

ble S1 and Figure S1a,b). This observation demonstrates

that additional quantitative trait locus (QTLs) reside together

with the Mendelian resistance traits. The 4.2% (7 of 168)

discovery rate of susceptible individuals from Ler-0 · Ws-0

and 4.4% from Col-0 · Ler-0 F2 populations compared to the

expected 6.25% segregation (Bohman et al., 2004) suggest

that the resistance QTLs represents one recessive or several

weak multigenic resistance traits. Weak susceptible pheno-

types are usually not detected in screenings of large F2

populations, which explains the lower frequency, whereas

they are possible to characterize in homogenous RILs. The

phytoalexin camalexin has been shown to play a partial role

in the L. maculans defence system (Bohman et al., 2004).

These observations led us to further analyse the influence of

camalexin induction.

The Ler-0 accession induced approximately 30% of Col-0

levels of camalexin 48 h after L. maculans inoculation

(Figure 4a). A similar difference in camalexin induction

levels between Ler-0 and Col-0 has previously been

observed in response to A. brassicicola (Kagan and Ham-

merschmidt, 2002). However, the susceptible Col-0 · Ler-0

plants displayed a large variation in camalexin induction

(Figure 4a,b). This difference in camalexin induction

between Col-0 and Ler-0 could explain our difficulties when

attempting to rapidly identify susceptible mutants display-

ing a clear disease phenotype in the Col-0 background. For

example, disease phenotypes in mutants with the Col

backgrounds represented by the At1g64070 mutant

salk_014088 and the At1g63880 mutant salk_110395 (Fig-

ure 3a,c) need at least 19 days to develop disease symptoms

compared to the rlm1Lerrlm2Col, rlm1Lerrlm2Ws and Ler-

rlm2Cvi lines (Figure 1c–e) which only require approximately

14 days before distinct lesions are formed. The delayed

disease phenotype in the Col-0 background is characterized

by a large chlorotic halo, whereas genotypes of Ler-0

background either develop an expanding necrotic area

along the edge of the inoculation point or several expanding

lesions surrounding the sites of inoculation. Susceptible Ler-

0 genotypes will, at the time of established Col-0 suscepti-

bility, have lesions that often have developed so far that the

leaf is completely dead.

The variation of disease symptoms in plants with non-

functional RLM1 and RLM2 alleles can partially be

explained by camalexin induction, as the susceptible RILs

displayed trends of a negative correlation between cama-

lexin induction and the level of susceptibility (Figure 4b).

Similar observations to these have been found in the

Arabidopsis–B. cinerea pathosystem (Denby et al., 2004).

Many of the susceptible RILs show higher camalexin

induction when compared to the resistant Col-0 parent. A

plant lacking an R gene will have a higher degree of

pathogen-induced stress, consequently it will also induce

higher levels of camalexin (Mert-Turk et al., 2003). As

camalexin induction to some extent is indistinguishable

from disease progress, a genetic identification of a ‘cama-

lexin induction in response to L. maculans’ QTL is compli-

cated. Further analysis of F2 progenies from the cross

between rlm1Lerrlm2Col and salk_014088 revealed that the

weaker susceptible phenotype displayed by salk_014088

segregated in a 1:1 pattern when all rlm1Lerrlm2Col control

plants showed full susceptible phenotype (Figure 4c). This

segregation pattern shows that there is a co-dominant

resistance trait of Col-0 parental origin responsible for this

phenotype, and also provides evidence that At1g64070 is

the gene primarily responsible for RLM1 function. The

observation of a 15:1 segregation ratio of hyper-suscepti-

bility by F2 progenies from a cross between rlm1Lerrlm2Col

and the camalexin-deficient mutant pad3-1 together with

subsequent disease progression studies in F3 (Figure 4d)

confirms that RLM1/RLM2-dependent resistance and cama-

lexin represent two independent resistance pathways with

additive effects. No effect on the time of emergence of

disease symptoms could be observed from resistance QTLs

of Ler parental origin in an F2 population from a cross

between rlm1Lerrlm2Col and Ler-rlm2Cvi (Figure 4e). The

resistance QTLs from Ler parental origin did however

influence the disease severity (Figure 4f).



(a) (b)

(c) (d)

(e) (f)

Figure 4. Induction of camalexin and disease progression by L. maculans in different genotypes.

(a) Camalexin induction in Ler-0, Col-0 and susceptible Col-0 · Ler-0 F3 plants 48 h post-inoculation, based on at least 15 independent measurements of each

genotype.

(b) Relative camalexin induction 48 h post-inoculation in susceptible Col-4 · Ler-0 RILs in relation to the average number of days until disease severity corresponding

to 5 or higher levels, using the scale of qualitative classes ranging from 0 to 9 (Delwiche and Williams, 1979). The scale is as follows: 0, no symptoms; 1, lesion diameter

0.5–1.5 mm; 3, dark necrotic lesions 1.5–3 mm; 5, lesions 3–5 mm, occasional sporulation; 7, grey-green tissue collapse, lesions 4–8 mm, sporulation; 9, rapid tissue

collapse, accompanied by profuse sporulation in large lesions (more than 5 mm). Disease development is based on observations of between 7 and 17 plants per line.

(c) Disease development expressed as percentage of diseased plants after inoculation with PG2 isolates (PHW1245 and Leroy) in relation to time to develop a distinct

disease phenotype. No difference in disease response could be observed between the isolates. A plant was classified as susceptible when the disease lesion phenotype

had reached a level corresponding to 3 or more on the Delwiche and Williams scale. Forty-nine inoculated plants from a F2 population of salk_014088 · rlm1Lerrlm2Col

were compared to responses in 10 plants of each parental line. Differences between rlm1Lerrlm2Col (Col · Ler) and the rlm1Lerrlm2Col · salk_014088 F2 population are

interpreted to measure the contribution from a resistance QTL of Col-0 origin.

(d) Evaluation of isolate dependency (Leroy and M1) of the synergistic effects, visible as a hyper-susceptible phenotype found in a double mutant (DM) between

rlm1Lerrlm2Col and pad3-1, compared to the susceptible phenotype seen in the parental genotypes. Susceptibility is expressed as number of days post-inoculation until

disease severity corresponding to 3 or more on the Delwiche and Williams scale has been reached, based on 18–52 individual plants per line and isolate. The double

mutant was represented by progeny from two different F2 plants with the hyper-susceptible phenotype.

(e) Evaluation of an Ler-0-derived resistance QTL using rlm1Lerrlm2Col and an F2 population between rlm1Lerrlm2Col and Ler-rlm2Cvi (LCN4-6). Susceptibility is

determined as the number of days post-inoculation until disease severity corresponding to 3 or more on the Delwiche and Williams scale has been reached. The data is

based on 9–34 plants per line.

(f) Evaluation of an Ler-0-derived resistance QTL using rlm1Lerrlm2Col and an F2 population between rlm1Lerrlm2Col and Ler-rlm2Cvi at 16 days post-inoculation, and

scored according to the Delwiche and Williams scale. The data is based on 9–34 plants per line.



RLM1Col/RLM2Ler gene-mediated resistance triggers callose

deposition and is dependent of RAR1 and HSP90.1

Several R protein-dependent signalling cascades have

been revealed for different classes of R proteins by studies

of Arabidopsis mutants (Hammond-Kosack and Parker,

2003). Hence, we were interested in examining mutants

linked to TIR-NB-LRR-type R protein interactions identified

in other pathosystems. The mutants eds1-1 (Ws-0 back-

ground), eds1-2 (Ler-0 background) and pad4-1 (Col-0

background) impair the function of all previously reported

TIR-class R gene-mediated resistance responses, but do

not affect L. maculans resistance (Bohman et al., 2004). We

have, however, found a requirement for RAR1 in both

RLM1- (salk_013489, Col-0 background) and RLM2- (rpr2-4,

Ler-0 background) mediated resistance (Figure 5a,b). The

difference in the degree of susceptibility between the Ler-0

and Col-0 mutants in RAR1 is in accordance with our

observations of weaker susceptibility phenotypes with a

Col-0 background and hence higher camalexin induction.

Screening of the T-DNA mutants in a HSP90 chaperone

athsp90.1-1 and athsp90.1-2 (Col-0 background), involved

in RAR1/R gene activity, revealed, on the other hand, that

HSP90.1 possess a moderate influence on L. maculans

resistance (Figure 5c). Neither the RAR1-associated SGT1b

mutation (enhancer of tir1-1 auxin resistance, eta3, Col-0

background) nor the SGT1b-like gene SGT1a (sgt1a1-1,

Ws-0 background) exhibited any visible influence on

L. maculans resistance (Figure 5d).

Synthesis of 1,3-b-glucans (callose) has been found to be

induced by the Brassica napus–L. maculans resistance

genes LepR1 and LepR2 (Yu et al., 2005), which led us to

examine if it also is an R gene-dependent resistance

response in Arabidopsis. Aniline blue staining and compar-

ison of callose deposition 2 days post-inoculation of

(RLM1Col)pad3-1 (Figure 5e) and rlm1Lerpad3-1 revealed that

RLM1, like the B. napus LepR genes, is required for efficient

callose deposition in response to L. maculans infection

(Figure 5f). Furthermore, susceptible phenotypes to L. mac-

ulans were found both with the callose synthase mutant

pmr4-1 and the papilla mutant pen1 (Figure 5g,h).

Discussion

Exploring the natural variation of disease resistance in

Arabidopsis

Exploitation of the natural variation in Arabidopsis has re-

ceived quite some attention, especially when used to iden-

tify the genetics behind complex traits (Borevitz and

Nordborg, 2003; Koornneef et al., 2004). The evolutionary

history of Arabidopsis contains a relatively large proportion

of outbreeding, consequently a phylogeographic ‘accession

tree’ cannot be built based on polymorphism information

(Bergelson et al., 1998). Thus, different loci have developed

differently across accessions over time. Based on an

assumption of linkage disequilibrium between the marker

m305 and the RLM1 gene, we predicted that progenies be-

tween Ler-2 and Cvi-1 should provide susceptible individu-

als. The evolutionary linkage between m305 and RLM1 is

considered to be strong, as the accession Cvi-1 is more

divergent from Col-0 than any of the three other accessions

tested in this study (Schmid et al., 2003). No other SNPs with

the same accession haplotype pattern as m305 could be

Figure 5. Phenotypic responses to L. maculans on mutants involved in R

gene signalling, and aniline blue staining to assess callose induction. dpi,

days post-inoculation.

(a) Susceptible phenotype on RAR1 mutant rpr2-4 (Ler-0 background), 14 dpi.

(b) Susceptible phenotype on RAR1 T-DNA mutant salk_013489 (Col-0

background), 21 dpi.

(c) Susceptible phenotype on hsp90.1-1 (Col-0 background), 21 dpi.

(d) Resistant phenotype on the SGT1b mutant eta3 (Col-0 background),

21 dpi.

(e) Callose deposition in the camalexin-deficient genotype pad3-1 (Col-

background), 2 dpi.

(f) Callose deposition in the camalexin-free rlm1Ler double mutant pad3-

1 · rlm1Lerrlm2Col, 2 dpi.

(g) Susceptible phenotype on the callose synthase mutant pmr4-1, 17 dpi.

(h) Susceptible phenotype on the papilla formation mutant pen1, 19 dpi.



found in the MASC database within the RLM1 locus (http://

www.mpiz-koeln.mpg.de/masc/), apart from the rlm1-snpA

polymorphism that causes a premature translational stop in

the rlm1Ler gene.

The Col-4 · Ler-0 population has been used for mapping

and cloning a number of resistance genes, such as RPP5 and

RPP8 (McDowell et al., 1998; Parker et al., 1993, 1997).

Further mapping initiatives using Col-4 · Ler-0 RILs include

study of the venial necrosis in response to turnip mosaic

virus (Kaneko et al., 2004) and susceptibility to B. cinerea

(Denby et al., 2004). QTL analysis suggested the presence of

multiple and isolate-specific loci in Arabidopsis controlling

B. cinerea disease development. Other reports of a complex

genetic framework derive from work on Phytophthora

brassicae (formerly P. porri) and Xanthomonas campestris

pv. campestris (Buell and Sommerville, 1997; Roetschi et al.,

2001). The genetic mapping of X. campestris resistance

revealed a monogenic form of resistance (RXC2), but, in

addition, interacting genetic components from both parental

genotypes (RXC3Ler þ RXC4Col) resulted in a novel form of

digenic resistance. These results, together with our results

on L. maculans, imply that natural variation in pathogen

resistance often is a result of a complex genetic background.

RLM1, a resistance locus with contribution to resistance

from more than one TIR-NB-LRR R gene

In this study we have shown that RLM1, a locus with at least

two TIR-NB-LRR R genes, contributes to resistance to

L. maculans. One gene, At1g64070, was shown to play the

major role in the resistance response. A digenic requirement

for functional resistance has been observed for the RPP2

locus, which also consists of a complex of TIR-NB-LRR R

genes (Sinapidou et al., 2004). It was suggested that the two

genes responsible for RPP2 function cooperated to provide

the necessary recognition or signalling functions for Hyalo-

peronospera parasitica Cala2 resistance. Resistance could

also, in accordance to the suggested mechanism of RAR1

(Bieri et al., 2004), be R protein dose-dependent thus requi-

ring additive input from several independent R genes with

redundant function to a certain threshold level. If that is the

case, it is likely that both At1g64070 and At1g63880 are re-

quired in order to reach such a threshold level for RLM1-

derived L. maculans resistance in Col-0. The complete

resistance seen in rlm1Lerrlm2Col plants complemented with

the Col-0 version of At1g64070, in contrast to the knock-out

lines in At1g63880, indicate that the two genes have

redundant functions in L. maculans recognition, and that

complementation using our genomic At1g64070 construct

provides additional transcripts to compensate for the loss of

At1g63880. T-DNA mutant phenotypes show that RLM1 is

mainly dependent on At1g64070. Consequently, it is difficult

to resolve the precise level required to compensate for a loss

of At1g63880.

A genome-wide analysis of NB-LRR-encoding genes in

Arabidopsis (Col) has revealed a number of subclasses

within the two major groups comprised of either CC-NB-LRR

or TIR-NB-LRR proteins (Meyers et al., 2003). All the R genes

found in the mapped region of RLM1 (At1g64070,

At1g63880, At1g63870, At1g63860, At1g63750, At1g63740,

At1g63730) are members of the TIR-NB-LRR TNL-H sub-

group (Meyers et al., 2003). Twenty-four proteins were

found in TNL-H, which are homogeneous in the composition

and arrangement of their LRR motifs. TNL-H is a subgroup

that has not previously been linked to any specific disease

resistance. The seven homologous TNL-H R genes within

the mapped region of RLM1 in Col-0 are arranged in two

clusters of three R genes each (At1g63730–At1g63750 and

At1g63860–At1gg3880) (clusters 9 and 10 in Richly et al.,

2002). The gene responsible for RLM1 activity, At1g64070,

has no immediate homologous neighbours. In contrast to

other previously characterized R genes, the TNL-H genes

found in the RLM1 locus do not appear to be under positive

selection (group 1 genes in Mondragon-Palomino et al.,

2002). Despite the lack of apparent positive selection on this

group of genes, the function provided by the RLM1/RLM2

loci seems to have an evolutionary importance, as a large

proportion of Arabidopsis accessions, 167 out of 168, tested

against L. maculans display a high degree of resistance

(Bohman et al., 2004).

Chromosomal regions in the vicinity of RLM1 and RLM2

show evolutionary links

There is an over-representation of genes in close proximity

to RLM1 with a significant sequence similarity to genes in

the region on chromosome 4 mapped for RLM2. This

observation suggests that RLM1 and RLM2 share a common

evolutionary history. There is a duplication event (block

0104431800740 in http://wolfe.gen.tcd.ie/athal/index.html;

Blanc and Wolfe, 2004) between a region spanning RLM1

(At1g63830–At1g64670) and a location within the NIL-map-

ped region of rlm2Cvi (At4g23470–At4g24140). Given that

synteny within this block is maintained, we expect RLM2 to

be situated around 11.28 Mbp (between At4g23530 and

At4g23630) on chromosome 4 in Ler-0. NIL screening results

locate RLM2 between 9.9 and 11.4 Mbp on chromosome 4,

which is in agreement with the location for the duplication

block of RLM1. A corresponding gene to At1g64070 is not

found in the Col-0 sequence of the homeologous region on

chromosome 4 that corresponds to RLM2. The correspond-

ing gene responsible for RLM2 activity could possibly have

been deleted in Col-0, whereas it remains intact in Ler-0. The

concurrence between the NIL mapping results and the

possible location of RLM2, based on gene duplication data,

provides a strong indication of the physical location of

RLM2. Furthermore, the susceptible phenotype on Ler-0

plants transformed with an RNAi construct designed to



target RLM1Col provides strong evidence that RLM2Ler is

structurally related to RLM1Col. Candidate gene selection

based on common evolutionary history for R genes is

however problematic, since even apparently minor changes

can drastically change pathogen specificity, as shown in the

RPP8/HRT family (Cooley et al., 2000). The Col-4 · Ler-0 RIL

mapping results define the location of RLM2 to the

At4g14690–At4g16010 interval. This discrepancy between

the Col-4 · Ler-0 and Ler-2 · Cvi-1 results may indicate that

either Col-4 or Cvi-1 has experienced a large-scale genomic

rearrangement at this locus. Alternatively, this may be a lo-

cus with a complex composition of resistance genes, where

different components are lost in the different accession

crosses. However, we did not see any restoration of resist-

ance in F2 progenies from rlm1Lerrlm2Col and Ler-rlm2Cvi,

which would be expected if rlm2 consisted of different loci.

The data suggest that the RLM1 and RLM2 genes derive from

a common ancestor. Given that RLM1 has been found in

several accessions, whereas RLM2 has only been found in

Ler, it is likely that RLM1 is the older of the two loci. A recent

mapping attempt of the B. napus–L. maculans resistance

genes LmR1 and CLmR1 revealed that the most significantly

linked markers showed homology to sequences close to

RLM1Col on Arabidopsis chromosome 1 (Mayerhofer et al.,

2005). This could indicate that the L. maculans resistance

genes share common ancestry prior to the separation of the

Arabidopsis and the Brassica lineages.

RLM1Col / rlm1Ler comparisons

The two genes At1g64070 and At1g63880, confirmed as

important for RLM1 function, are more similar to each other

in protein sequence than to any of the other TNL-H homo-

logues present in the RLM1 locus. Analyses of the two RLM1

genes in the non-functional rlm1Ler locus showed a deletion

of At1g63880 and premature translational stops in

At1g64070. The premature translational stop of At1g64070

generates a 528 amino acid protein, containing a 130-residue

(16-146) TIR domain and a 294-residue (167-461) nucleotide

binding domain. The Col-0 version of this gene translates to

a protein of 997 residues and consists of domains that cor-

respond to the Ler-0 protein plus a region of six LRR do-

mains. At1g64070 in Ler-0 is translationally truncated almost

immediately after the NB domain, which addresses the issue

of function of the TIR-NB (TN) class proteins (Meyers et al.,

2002). Comparison of amino acid changes between Col-0

and Ler-0 shows that these two genes have experienced

considerable evolution since they diverged. However, the

changes in nucleotide sequence preceding the premature

stop codons in Ler-0 are clearly more restricted [1100/1153

(95%) sequence identity to the Col-0 sequence] than in the

sequence downstream of this event [371/509 (72%) se-

quence identity to the Col-0 sequence]. This difference in

sequence degeneration indicates that the gene At1g64070

still has retained some functions as a TN gene in Ler-0 due to

selection pressure. TN genes probably do not act as resist-

ance genes, but may be required for downstream signalling

and function of another full-length TIR-NB-LRR resistance

gene, possibly as TIR adaptor proteins such as the animal

signalling component MyD88 (Janssens and Beyaert, 2002;

Jordan et al., 2002; Zhang and Gassmann, 2003).

R gene signalling

In Arabidopsis, a range of downstream R gene signalling

components has been identified. In contrast to most previ-

ously reported TIR-NB-LRR R gene systems, resistance to

L. maculans is dependent on neither PAD4 nor EDS1 (Boh-

man et al., 2004). To date, only one reported TIR-NB-LRR

class R protein, resistance to Albugo candida (RAC1), has

been shown to require EDS1 but not PAD4 to remain func-

tional (Borhan et al., 2004). A common denominator be-

tween A. candida and L. maculans is that they both, in

contrast to all previously reported TIR-NB-LRR-dependent

resistance systems, exhibit a salicylic acid-independent

resistance, which could explain the dispensability of PAD4 in

response to these pathogens. In addition, components such

as RAR1 and SGT1 are required for both the TIR-NB-LRR and

CC-NB-LRR R gene classes. It is intriguing that one important

activity of SGT1 is in Skp1/Cullin/F-box (SCF)-mediated

ubiquitinylation (Kitagawa et al., 1999). SCF complex activity

influences the signalling of a wide array of plant hormones.

The auxin-resistant E1 ubiquitin ligase mutant axr1-24

affects, among other things, the SCFcoi1 complex for func-

tional jasmonate signalling (Tiryaki and Staswick, 2002). In

response to L. maculans, a significant induction of the

ubiquitin protein UBQ4 at 72 h post-inoculation in B. napus

plants harbouring Arabidopsis-derived L. maculans resist-

ance has been found (Bohman et al., 2002). Furthermore,

the auxin resistant mutant axr1-12, which is impaired in

SCF complex function, shows susceptibility towards

L. maculans. This result, together with the observed root

insensitivity of the lms5 mutant on auxin-containing med-

ium suggest the involvement of components in common

with auxin responses in plant defence against L. maculans

(M. Kaliff, J. Staal, C. Dixelius, unpublished data).

Taken together, we have shown in this paper that L. mac-

ulans resistance in Arabidopsis requires several compo-

nents, which most likely represent different layers of plant

defence. At least two TIR-NB-LRR class R genes, callose

deposition and camalexin induction are major determinants

of disease development. Susceptible RAR1 and HSP90

mutants, which affect R protein stability and thereby

steady-state levels, suggest that L. maculans resistance

requires a certain threshold level of recognition proteins.

Our current understanding of the function and possible

interaction of the components so far found to be important

for plant defence to L. maculans is still rudimentary. In this



respect, we foresee that the sequence information and

fungal tools such as mutants deriving from the genome

project of L. maculans will be of significant value (Rouxel

and Balesdent, 2005). However, the R genes identified in this

work will constitute key players in future work to unravel

important regulatory elements and interacting defence

proteins.

Experimental procedures

Plant material

Recombinant inbred populations of Col-4 · Ler-0 (Lister and Dean,1993) and Ler-2 · Cvi-1 (Alonso-Blanco et al., 1998) and F2 popula-tions between Ler-0 · Ws-0 and Col-0 · Ws-0 were evaluated forresponses to L. maculans. F1 and F2 progeny between susceptibleLer-0 · Ws-0 plants and susceptible Col-0 · Ler-0 plants were eval-uated for allelism. T-DNA mutants (salk_087810, salk_133795,salk_101258, salk_133759, salk_110395, salk_110393, salk_143567,salk_014088, salk_014096, salk_129756, salk_134815, salk_053084,salk_128409, salk_087551, salk_015175, salk_100157) in genes lo-cated in the mapped region for resistance in accession Col-0 (Alonsoet al., 2003) were evaluated for L. maculans susceptibility. The fol-lowing mutants were evaluated for responses to L. maculans: RAR1in both Col-0 and Ler-0 backgrounds (salk_013489, rpr2-4), SGT1b(eta3, Gray et al., 2003) and its homologue SGT1a (sgt1a-1, Austinet al., 2002) in Col-0 and Ws-0 backgrounds, respectively, and twoindependent HSP90.1 T-DNA insertion mutants in the Col-0 back-ground (hsp90.1-1 and hsp90.1-2, Takahashi et al., 2003). In order todetermine the role of callose and papilla induction in L. maculansresistance, the callose synthase mutant pmr4-1 (Vogel and Somer-ville, 2000) and papilla formation mutant pen1 (Collins et al., 2003)were assessed for L. maculans susceptibility. Susceptible homozy-gous plants (F3) deriving from a cross between Col-0 and Ler-0 werecrossed with pad3-1 (Glazebrook and Ausubel, 1994), propagatedand assessed for susceptibility, camalexin induction andinheritance pattern.

Plant growth conditions and fungal inoculations

Arabidopsis plants were cultured and inoculated as described byBohman et al. (2004) Four L. maculans isolates (Leroy, PHW1245,M1 and MD2) that are variable in all nine avirulence genes describedin B. napus interactions were used (Balesdent et al., 2005). To fur-ther confirm susceptibility, leaves were detached 1 week post-inoculation and incubated under 100% humidity in Petri dishes topromote the formation of pycnidia. Detailed growth of the funguswas monitored by lactophenol trypan blue staining (Koch and Slu-sarenko, 1990), and induced callose depositions in plants by anilineblue staining (Gressel et al., 2002). Alternaria brassicicola (isolateMUCL20297) and B. cinerea (isolate MUCL30158) inoculations(Thomma et al., 1998) were performed on T-DNA mutants of RLM1candidate genes and susceptible Col-0 · Ler-0 plants for confirma-tion of L. maculans-specific responses.

Mapping of RLM loci

One hundred recombinant inbred lines (set 1) between Ler-0 andCol-4 (Lister and Dean, 1993) were used in order to map the sus-ceptibility previously observed (Bohman et al., 2004). Markersfound to be significantly associated with susceptibility were also

evaluated on susceptible individuals deriving from a Ler-0 · Ws-0 F2

population. RLM1-linked Col-4 · Ler-0 RI map markers mi324(At1g62630), mi353 (At1g63040) and mi424 (At1g65540) were se-quenced in order to establish a physical location. Linkage disequi-librium was assumed between susceptibility and marker m305, andfound to be highly significant in the Col-4 · Ler-0 RIL mapping data.Marker m305 is polymorphic between Ler and Col/Ws/Cvi. The linkto m305 was confirmed using the basic set of 50 Ler-0 · Cvi-1recombinant inbred lines (Alonso-Blanco et al., 1998). The full set(100 lines) of Col-4 · Ler-0 RI lines was screened three times with 3–7 replicates for each line. Ambiguous phenotypes were studied indetail using a larger number of plants (>20) per line. Additionally,plants deriving from crosses of susceptible Col-0 · Ler-0 and Ler-0 · Ws-0 were assessed in F1.

Statistical analysis of RIL screening data

Marker information was obtained from NASC (http://arabidopsis.info/new_ri_map.html), and markers annotated as ‘unique’ and‘framework’ were selected to an average marker density of 1marker per 1.5 cM. Susceptible RILs were scored as ‘1’ andresistant lines were scored ‘0’ for further analysis. A pairedmarker regression was made in QTX map manager (Manly et al.,2001) under high stringency (P < 10)7). When the screening datawere more complete, the analysis was complemented withcomposite interval mapping analysis in QTL cartographer (Wanget al., 2004). The Ler-0 · Cvi-1 marker map was retrievedfrom the NATURAL-EU project (http://www.dpw.wau.nl/natural/resources/populations/CVI/). Screening results were analysedqualitatively via recombination patterns in the proximity of themost significant markers and quantitatively using QTX mapmanager as described for the Col-4 · Ler-0 RILs.

PCR and DNA sequencing

All PCR analyses were performed using 1.25 U Taq polymerase(Fermenta, St Leon-Rot, Germany) per 50 ll reaction volume, 1·PCR buffer with ammonium sulphate (Fermenta), 2 mM MgCl2,0.2 mM dNTP and 0.6 lM of each primer. The amplifications weremade with an initial denaturation at 95�C for 4 min, followed by 35cycles of 95�C for 30 sec, 55�C for 30 sec and 72�C at 1 min per kbexpected product length, followed by a final extension of 10 min at72�C. The identity of the PCR amplified fragments was either con-firmed by sequencing or by amplification by several independentprimer pairs. Sequencing was carried out on an ABI 377 automaticsequencer (ABI Prism 377, XL Upgrade; Applied Biosystems, FosterCity, CA, USA) using a Thermo Sequenase dye terminator cyclesequencing pre-mix kit (Amersham Pharmacia Biotech, Uppsala,Sweden). For each 20 ll reaction, we used 5 pM of the primers and2 lg of template DNA. Sequences were evaluated using ABI EditView and Technelysium Chromas software (Applied Biosystems).

Confirmation of RLM1 candidate T-DNA mutant

The RLM1 candidate gene was evaluated by assessing offspringfrom crosses between susceptible Col-0 · Ler-0 plants and the T-DNA mutant salk_014088. The identity and homozygosity of thesusceptible T-DNA mutants salk_014088 and salk_014096 wereconfirmed by PCR, using the gene-specific primers salk:RLM1_LP:GGAAACTTCTCAAGCCCCAC, salk:RLM1_RP: CCAGTTTAG-CAAGTGTTCGCC, and the T-DNA insertion-specific primer LBa1:TGGTTCACGTAGTGGG CCATCG. Susceptible F1 progeny between



Col-0 · Ler-0 and salk_014088 were confirmed by identification of aheterozygous insertion, using the same set of primers.

Complementation of RLM1Col

The Col-0 genomic sequence of At1g64070, including 1600 basesupstream as promoter and 400 bases downstream, was amplified inPCR with the primers attB1- CTTCTGCTATAACTCGCTTTTA-TAAACG and attB2- GAATGAGTCAAAATATGGAATTGGAGTCusing the high-fidelity enzyme Phusion (Finnzyme, Espoo, Finland).The PCR mix was used as recommended by the manufacturer andwas performed with 30 sec denaturation at 98�C, four initial cycleswith 10 sec denaturation at 98�C, 30 sec annealing at 58�C and3 min elongation at 72�C, followed by 31 cycles where the annealingtemperature was raised to 65�C. The PCR product was recombinedinto the pDONR vector via the Gateway system (Invitrogen, Carls-bad, CA, USA) for subsequent recombination into the Gateway-compatible binary vector pGWB1 (T. Nakagawa, Shimane Univer-sity, Izumo, Japan). The complementation clone was used intransformation of susceptible Col-0 · Ler-0 (rlm1Lerrlm2Col controlline) and a susceptible Ler-2 · Cvi-1 RIL (N22149). All Arabidopsistransformations were performed using the floral dip method (Des-feux et al., 2000), and seeds selected on 50 lg ml)1 kanamycin.Eleven individual plants of rlm1Lerrlm2Col background transformedwith RLM1Col (At1g64070) were evaluated in T1 for resistantphenotype.

Sequence analysis of candidate genes from rlm1Ler

Matching sequences of the two candidate genes At1g64070 andAt1g63880 were identified using BLAST against the Cereon Ler-0sequence database (http://www.arabidopsis.org/Cereon/index.jsp).BLAST hits were evaluated in the TIGR Ler-0 database (http://www.tigr.org/tdb/e2k1/ath1/atgenome/Ler.shtml) for further confir-mation. To confirm in silico results, three fragments of the geneAt1g63880 were isolated using the primers At1g63880_AF:GCTTCTCCTTCTTCTTTTTCG, At1g63880_AR: TCACAACATCTT-CCCATTCG, At1g63880_BF: TAAACAGACCTCTCCACGTCA,At1g63880_BR: AGCTCTGGCAAAGATGCGA, At1g63880_CF: AAA-AGGGGTTAATCTACGTGGCT, and At1g63880_CR: CAATCTCCG-TATTTTTCGTCTC. PCR amplification with the same primerswas also used to evaluate the presence of At1g63880 in Ws-0 andCol-4. Three genomic fragments of the gene At1g64070 were iso-lated using the primers At1g64070_AF: TTCTTCCTCTTCTTC-TGCGAGT, At1g64070_AR: TCAGAAGGAAATCCTACATAGTAGG,At1g64070_BF: TGTCAAGCAATTAGAGGCTTTAGC, At1g64070_BR:GATACAACTATCTGCAATCATCTCA, At1g64070_CF: TGGATGCCC-ACAGTTGAAAA, and At1g64070_CR: TCCGTCGCAGCTTCTTCTCT.In order to confirm a polymorphism that caused a truncation of thetranslated sequence of the Ler-0 version of At1g64070, an areasurrounding this polymorphism was isolated with PCR usingthe primers rlm1-snpAF: CAAGAAGTGTAACAGAGCTTTGTGGand rlm1-snpAR: AGTAACCTTAGGCGAGGTGGAAACT. When thepolymorphism was confirmed to exist in Ler-0, SNP-specific primers[the Col-0 allele rlm1-snpAC: ATGTCCTTGAAAATGATATAGGT(forward) and the Ler-0 allele rlm1-snpAL: CAGACACAACTCC-AGTACCCA (reverse)] were designed for comparative analysis ofother RLM1 accessions. PCR amplification with Ler-0 SNP-specificprimer was performed in the presence of rlm1-snpAF orAt1g64070_BF. For optimal reliability, PCR analyses were performedwith SNP-specific primer together with At1g64070_BF andAt1g64070_BR for observation of the presence of the allele-inde-pendent full-length band (1.7 kb), in combination with the presence

or absence of an allele-specific band for the Col-0 allele (1 kb) or theLer-0 allele (0.65 kb).

RNAi silencing of RLM1Col-like TNL-H family genes in Ler-0

An RNAi construct was designed using the sequence from a highlyconserved stretch of nucleotides from a CLUSTAL-W (Available athttp://www.ebi.ac.uk/clustalw/index.html alignment of the TNL-Hgene family genes within RLM1. The sequence was confirmed tohave possible cross-reactions to as few as possible non-targetgenes through the use of BLAST. A sense (CCAGATCTTT-CAAATGCTACAAATCT) and an anti-sense 26 bp oligonucleotidesequence with attB sites (Invitrogen) were mixed in equal amountsand set to hybridize for 3 h at 55�C. A Klenow fragments reaction(Fermenta) was performed to make the attB sites double-stranded.The double-stranded oligonucleotide was recombined into aHellsgate 2 vector (Helliwell et al., 2002). The recombination wasconfirmed by sequencing. Clones containing the Hellsgate 2 vectorwere identified by colony blot hybridization and used for transfor-mation of Ler-0, Col-0 and Ws-0. Seventy-nine individual Ler-0 RNAiT1 lines were obtained and evaluated for susceptible phenotypes.

Camalexin quantification and evaluation

Plant material (100 mg) was extracted twice in 500 ll 80% methanolat 80�C for 1 h. The resulting solution was extracted twice with100 ll chloroform, and the two chloroform extracts were pooledand concentrated. The extract was re-dissolved in 5 ll chloroform,loaded on a silica gel thin-layer chromatography (TLC) plate, anddeveloped with chloroform/methanol in the ratio 9:1. Both relativequantifications using absorbance and absolute quantificationsusing fluorescence were performed (Bohman et al., 2004). Eachdetermination was repeated with at least three independent tech-nical replicates. Camalexin was determined and compared from twoindependent inoculation events using 3–5 biological replicates ineach comparison. Synthetic camalexin was used as a referencein quantifications and during TLC analysis. The mutant genotype inPAD3 was confirmed with the primers PAD3-F: AA-CACAAGAACAGGGCAAGGA and PAD3-R: CTGACTCCAACTG-GATCATCA together with snp_PAD3: ATATACTTGAAAGATTGAAGC or snp_pad3-1: ATATACTTGAAAGATTGAAGT.

Acknowledgements

We thank Joe Ecker and Sabine Rundle for providing new infor-mation about the physical location of markers, Jonathan Jones,William Gray, Ken Shirasu, Jane Parker and Paul Schulze-Lefert formaterial to study R gene signalling, and Maarten Koornneef andJoost Keurentjes, for providing Ler/Cvi NILs for further confirmationof the RLM2 locus. We also thank Anders Falk and Ann-ChristinRonnberg-Wastljung for fruitful genetic discussions and RichardHopkins for language corrections. This research was supported bythe national graduate research schools in Genomics and Bioinfor-matics (FGB) and Interactions between Micro-Organisms and Plants(IMOP) at the Swedish University of Agricultural Sciences, and theSwedish Foundation of Strategic Research, the Plant BiotechnologyProgram.

Supplementary Material

The following supplementary material is available for this articleonline:



Figure S1. Quantitative description of disease progression insusceptible Col · Ler RI lines based on observations from 7 to 17individual plants per line.Table S1 Qualitative description of different disease phenotypesobserved on susceptible Col · Ler RI lines, based on observationsfrom 7 to 17 individual plants per lineThis material is available as part of the online article from http://www.blackwell-synergy.com

References

Aarts, N., Metz, M., Holub, E., Staskawicz, B.J., Daniels, M.J. and

Parker, J.E. (1998) Different requirements for EDS1 and NDR1 bydisease resistance genes define at least two R gene-mediatedsignaling pathways in Arabidopsis. Proc. Natl Acad. Sci. USA, 95,10306–10311.

Alonso, J.M., Stepanova, A.N., Leisse, T.J. et al. (2003) Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science,301, 653–657.

Alonso-Blanco, C., Peeters, A.J., Koornneef, M., Lister, C., Dean, C.,

van den Bosch, N., Pot, J. and Kuiper, M.T. (1998) Development ofan AFLP based linkage map of Ler, Col and Cvi Arabidopsisthaliana ecotypes and construction of a Ler/Cvi recombinantinbred line population. Plant J. 14, 259–271.

Austin, M.J., Muskett, P., Kahn, K., Feys, B.J., Jones, J.D.G. and

Parker, J. (2002) Regulatory role of SGT1 in early R gene-medi-ated plant defenses. Science, 295, 2077–2080.

Azevedo, C., Sadanandom, A., Kitagawa, K., Freialdenhoven, A.,

Shirasu, K. and Schulze-Lefert, P. (2002) The RAR1 interactorSGT1, an essential component of R gene-triggered diseaseresistance. Science, 295, 2073–2076.

Balesdent, M.H., Barbetti, M., Li, H., Sivasithamparam, K., Gout, L.

and Rouxel, T. (2005) Analysis of Leptosphaeria maculans racestructure in a worldwide collection of isolates. Phytopathology,95, 1061–1071.

Bergelson, J., Stahl, E., Dudek, S. and Kreitman, M. (1998) Geneticvariation within and among populations of Arabidopsis thaliana.Genetics, 148, 1311–1323.

Bieri, S., Mauch, S., Shen, Q. et al. (2004) RAR1 positively controlssteady state levels of barley MLA resistance proteins and enablessufficient MLA6 accumulation for effective resistance. Plant Cell,16, 3480–3495.

Blanc, G. and Wolfe, K.H. (2004) Functional divergence of duplicatedgenes formed by polyploidy during Arabidopsis evolution. PlantCell, 16, 1679–1691.

Bohman, S. (2001) Molecular studies of Arabidopsis and Brassicawith focus on resistance to Leptosphaeria maculans. PhD Thesis.Agraria 305. SLU Press, Uppsala, Sweden.

Bohman, S., Wang, M. and Dixelius, C. (2002) Arabidopsis thalianaderived resistance against Leptosphaeria maculans in a Brassicanapus genomic background. Theor. Appl. Genet. 105, 498–504.

Bohman, S., Staal, J., Thomma, B.P.H.J., Wang, M. and Dixelius, C.

(2004) Characterisation of an Arabidopsis–Leptosphaeria macu-lans pathosystem: resistance partially requires camalexin bio-synthesis and is independent of salicylic acid, ethylene andjasmonic acid signalling. Plant J. 37, 9–20.

Borevitz, J. and Nordborg, M. (2003) The impact of genomics on thestudy of natural variation in Arabidopsis. Plant Physiol. 132, 718–725.

Borhan, H.M., Holub, E.B., Beynon, J., Rozwadowski, K. and

Rimmer, R. (2004) The Arabidopsis TIR-NB-LRR gene RAC1confers resistance to Albugo candida (white rust) and isdependent on EDS1 but not on PAD4. Mol. Plant Microbe Interact.7, 711–719.

Buell, C. and Sommerville, S. (1997) Use of Arabidopsis recombin-ant inbred lines reveals a monogenic and a novel digenic resist-ance mechanism to Xanthomonas campestris pv. campestris.Plant J. 12, 21–29.

Collins, N., Thordal-Christensen, H., Lipka, V. et al. (2003) SNARE-protein-mediated disease resistance at the plant cell wall. Nature,425, 973–977.

Cooley, M.B., Pothirana, S., Wu, H.-J., Kachroo, P. and Klessig, D.F.

(2000) Members of the Arabidopsis HRT/RPP8 family of resistancegenes confer resistance to both viral and oomycete pathogens.Plant Cell, 12, 663–676.

Delwiche, P.A. and Williams, P.H. (1979) Screening for resistance toblackleg of crucifers in the seedling stage. Cruciferae Newsl. 4, 24.

Denby, K., Kumar, P. and Kliebenstein, D. (2004) Identification ofBotrytis cinerea susceptibility loci in Arabidopsis thaliana. Plant J.38, 473–486.

Desfeux, C., Clough, S.J. and Bent, A.F. (2000) Female reproductivetissues are the primary target of Agrobacterium-mediated trans-formation by the Arabidopsis floral-dip method. Plant Physiol.123, 895–904.

Du, Q., Thonberg, H., Wang, J., Whalestedt, C. and Liang, Z. (2005) Asystematic analysis of the silencing effects of an active siRNA atall single-nucleotide mismatched target sites. Nucleic Acids Res.33, 1671–1677.

Glazebrook, J. and Ausubel, F.M. (1994) Isolation of phytoalexin-deficient mutants of Arabidopsis thaliana and characterization oftheir interactions with bacterial pathogens. Proc. Natl Acad. Sci.USA, 91, 8955–8959.

Gray, W.M., Muskett, P.R., Chuang, H.-W. and Parker, J. (2003)Arabidopsis SGT1b is required for SCFTIR1-mediated auxin re-sponse. Plant Cell, 15, 1310–1319.

Gressel, J., Michaeli, D., Kampel, V., Amsellem, Z. and Warshawsky,

A. (2002) Ultralow calcium requirements of fungi facilitate use ofcalcium regulating agents to suppress host calcium-dependentdefenses, synergizing infection by a mycoherbicide. J. Agric.Food. Chem. 50, 6353–6360.

Hahn, J. (2005) Regulation of Nod1 by Hsp90 chaperone complex.FEBS Lett. 579, 4513–4519.

Hammond-Kosack, K.E. and Parker, J.E. (2003) Decipheringplant–pathogen communication: fresh perspectives formolecular resistance breeding. Curr. Opin. Biotechnol. 14, 177–193.

Helliwell, C., Varsha Wesly, S., Wielopolska, A.J. and Waterhouse,

P.M. (2002) High-throughput vectors for efficient gene silencing inplants. Funct. Plant Biol. 29, 1217–1225.

Howlett, B. (2004) Current knowledge of the interaction betweenBrassica napus and Leptosphaeria maculans. Can. J. Plant Pathol.26, 245–252.

Howlett, B., Idnurm, A. and Pedras, M.S.C. (2001) Leptosphaeriamaculans, the causal agent of blackleg disease of Brassicas.Fungal Genet. Biol. 33, 1–14.

Inohara, N. and Nunez, G. (2003) NODs: intracellular proteins in-volved in inflammation and apoptosis. Nat. Rev. Immunol. 3, 371–381.

Jander, G., Norris, S., Rounsley, S., Bush, D., Levin, I. and Last, R.

(2002) Arabidopsis map-based cloning in the post-genome era.Plant Physiol. 129, 440–450.

Janssens, S. and Beyaert, R. (2002) A universal role for MyD88 inTLR/IL-1R-mediated signaling. Trends Biochem. Sci. 27, 474–482.

Jordan, T., Schornack, S. and Lahaye, T. (2002) Alternative splicingof transcripts encoding Toll-like plant resistance proteins – what’sthe functional relevance to innate immunity? Trends Plant Sci. 7,392–398.



Kagan, I.A. and Hammerschmidt, R. (2002) Arabidopsis ecotypevariability in camalexin production and reaction to infection byAlternaria brassicicola. J. Chem. Ecol. 28, 2121–2140.

Kaneko, Y.H., Inukai, T., Suehiro, N., Natsuaki, T. and Masuta, C.

(2004) Fine genetic mapping of the TuNI locus causing systemicveinal necrosis by turnip mosaic virus infection in Arabidopsisthaliana. Theor. Appl. Genet. 110, 33–40.

Kitagawa, K., Skowyra, D., Elledge, S.J., Harper, J.W. and Hieter, P.

(1999) SGT1 encodes an essential component of the yeastkinetochore assembly pathway and a novel subunit of the SCFubiquitin ligase complex. Mol. Cell, 4, 21–23.

Koch, E. and Slusarenko, A. (1990) Arabidopsis is susceptible toinfection by a downy mildew fungus. Plant Cell, 2, 437–445.

Koornneef, M., Alonso-Blanco, C. and Vreugdenhil, D. (2004) Nat-urally occurring genetic variation in Arabidopsis thaliana. Annu.Rev. Plant Biol. 55, 142–172.

Lister, C. and Dean, C. (1993) Recombinant inbred lines for mappingRFLP and phenotypic markers in Arabidopsis thaliana. Plant J. 4,745–750.

Liu, Y., Schiff, M., Serino, G., Deng, X.W. and Dinesh-Kumar, S.P.

(2002) Role of SCF ubiquitin-ligase and the COP9 signalosome inthe N gene-mediated resistance response to tobacco mosaicvirus. Plant Cell, 14, 1483–1496.

Manly, K.F., Cudmore, R.H. and Meer, J.M. (2001) Map ManagerQTX, cross-platform software for genetic mapping. Mamm.Genome, 12, 930–932.

Mayerhofer, R., Wilde, K., Mayerhofer, M., Lydiate, D., Bansal, V.,

Good, A. and Parkin, I. (2005) Complexities of chromosomelanding in a highly duplicated genome: towards map based clo-ning of a gene controlling blackleg resistance in Brassica napus.Genetics, 171, 1977–1988.

McDowell, J.M., Dhandayham, M., Long, T., Aarts, M., Goff, S.,

Holub, E.B. and Dangl, J.L. (1998) Intragenic recombination anddiversifying selection contribute to the evolution of downy mil-dew resistance at the RPP8 locus of Arabidopsis. Plant Cell, 10,1861–1874.

Mert-Turk, F., Bennett, M.H., Mansfield, J.W. and Holub, E.B. (2003)Camalexin accumulation in Arabidopsis following abiotic elicita-tion or inoculation with virulent or avirulent Hyaloperonosporaparasitica. Physiol. Mol. Plant Pathol. 62, 137–145.

Meyers, B.C., Morgante, M. and Michelmore, R.W. (2002) TIR-X andTIR-NB proteins: two new families related to disease resistanceTIR-NB-LRR proteins encoded in Arabidopsis and other plantgenomes. Plant J. 32, 77–92.

Meyers, B.C., Kozik, A., Griego, A., Kuang, H. and Michelmore, R.W.

(2003) Genome-wide analysis of NB-LRR-encoding genes inArabidopsis. Plant Cell, 15, 809–834.

Mondragon-Palomino, M., Meyers, B.C., Michelmore, R.W. and

Gaut, B.S. (2002) Patterns of positive selection in theNBS-LRR gene family of Arabidopsis thaliana. Genome Res. 12,1305–1315.

Nimchuk, Z., Eulgem, T., Holt, B.F., III and Dangl, J.L. (2003)Recognition and response in the plant immune system. Annu.Rev. Genet. 37, 579–609.

Parker, J., Szabo, V., Staskawicz, B., Lister, C., Dean, C., Daniels,

M. and Jones, J. (1993) Phenotypic characterization andmolecular mapping of the Arabidopsis thaliana locus RPP5determining resistance to Peronospora parasitica. Plant J. 4,821–831.

Parker, J.E., Coleman, M.J., Szabo, V., Frost, L.N., Schmidt, R., van

der Biezen, E.A., Moores, T., Dean, C., Daniels, M.J. and Jones,

J.D.G. (1997) The Arabidopsis downy mildew resistance gene

RPP5 shares similarities to the Toll and Interleukin-1 receptorswith N and L6. Plant Cell, 9, 879–894.

Richly, E., Kurth, J. and Leister, D. (2002) Mode of amplification andreorganization of resistance genes during recent Arabidopsisthaliana evolution. Mol. Biol. Evol. 19, 76–84.

Roetschi, A., Azeddine, S., Lassaad, B., Mauch, F. and Mauch-Mani,

B. (2001) Characterization of an Arabidopsis–Phytophthora path-osystem: resistance requires a functional PAD2 gene and isindependent of salicylic acid, ethylene and jasmonic acid signa-ling. Plant J. 28, 293–305.

Rouxel, T. and Balesdent, M.H. (2005) The stem canker (blackleg)fungus, Leptosphaeria maculans, enters the genomic era. Mol.Plant Pathol. 6, 225–241.

Schmid, K., Rosleff Sorensen, T., Stracke, R., Torjek, O., Altmann,

T., Mitchell-Olds, T. and Weisshaar, B. (2003) Large-scale identi-fication and analysis of genome-wide single-nucleotide poly-morphisms for mapping in Arabidopsis thaliana. Genome Res.13, 1250–1257.

Shirasu, K. and Schulze-Lefert, P. (2003) Complex formation, pro-miscuity and multi-functionality: protein interactions in disease-resistance pathways. Trends Plant Sci. 8, 252–258.

Sinapidou, E., Williams, K., Nott, L., Bahkt, S., Tor, M., Crute, I.,

Bittner-Eddy, P. and Beynon, J. (2004) Two TIR:NB:LRR genes arerequired to specify resistance to Peronospora parasitica isolateCala2 in Arabidopsis. Plant J. 38, 898–909.

Takahashi, A., Casais, C., Ichimura, K. and Shirasu, K. (2003) HSP90interacts with RAR1 and SGT1 and is essential for RPS2-mediateddisease resistance in Arabidopsis. Proc. Natl Acad. Sci. USA, 100,11777–11782.

Thomma, B., Eggermont, K., Penninckx, I., Mauch-Mani, B., Vo-

gelsang, R., Cammue, B.P.A. and Broekaert, W.F. (1998) Separatejasmonate-dependent and salicylate-dependent defense-re-sponse pathways in Arabidopsis are essential for resistance todistinct microbial pathogens. Proc. Natl Acad. Sci. USA, 95,15107–15111.

Tiryaki, I. and Staswick, P. (2002) An Arabidopsis mutant defectivein jasmonate response is allelic to the auxin-signaling mutantaxr1. Plant Physiol. 130, 887–894.

Tor, M., Gordon, P., Cuzick, A., Eulgem, T., Inapidou, E., Mert-Turk,

F., Can, C., Dangl, J.L. and Holub, E.B. (2002) Arabidopsis SGT1bis required for defense signaling conferred by several downymildew resistance genes. Plant Cell, 14, 993–1003.

Veronese, P., Chen, X., Bluhm, B., Salmeron, J., Dietrich, R. and

Mengiste, T. (2004) The BOS loci of Arabidopsis are required forresistance to Botrytis cinerea infection. Plant J. 40, 558–574.

Vogel, J. and Somerville, S.C. (2000) Isolation and characterizationof powdery mildew-resistant Arabidopsis mutants. Proc. NatlAcad. Sci. USA, 97, 1897–1902.

Wang, S., Basten, C.J. and Zeng, Z.B. (2004) Windows QTL Carto-grapher 2.0. Raleigh, NC: Department of Statistics, North CarolinaState University.

West, J.S., Kharbanda, P.D., Barbetti, M.J. and Fitt, B.D.L. (2001)Epidemiology and management of Leptosphaeria maculans(Phoma stem canker) on oilseed rape in Australia, Canada andEurope. Plant Pathol. 50, 10–27.

Yu, F., Lydiate, D.J. and Rimmer, S.R. (2005) Identification of twonovel genes for blackleg resistance in Brassica napus. Theor.Appl. Genet. 110, 969–979.

Zhang, X. and Gassmann, W. (2003) RPS4-mediated diseaseresistance requires the combined presence of RPS4 transcriptswith full-length and truncated open reading frames. Plant Cell, 15,2333–2342.



Documents

Transgressive segregation reveals two Arabidopsis TIR-NB-LRR resistance genes effective against Leptosphaeria maculans , causal agent of blackleg disease