α2-Adrenoceptor-Mediated Inhibition of Catecholamine Release from the Adrenal Medulla of Spontaneously Hypertensive Rats is Preserved in the Early Stages of Hypertension

a2-Adrenoceptor-Mediated Inhibition of Catecholamine Releasefrom the Adrenal Medulla of Spontaneously Hypertensive Rats is

Preserved in the Early Stages of HypertensionEduardo Moura1,2, Carina E. Pinto1, Ana Cal�1, Maria P. Serr¼o1, Joana Afonso1 and Maria A. Vieira-Coelho1,2

1Faculty of Medicine, Institute of Pharmacology and Therapeutics, University of Porto, Porto, Portugal and 2Institute for Molecularand Cell Biology, University of Porto, Porto, Portugal

(Received 3 August 2010; Accepted 7 April 2011)

Abstract: In this study, we evaluated the effect of a2-adrenoceptor activation on catecholamine release from the adrenalmedulla of pre-hypertensive (6-week-old) and hypertensive (16-week-old) spontaneously hypertensive rats (SHR) and of age-matched normotensive control Wistar Kyoto (WKY) rats. Catecholamine overflow from isolated adrenal medullae was evokedby the nicotinic receptor agonist 1,1-dimethyl-4-phenylpiperazinium iodide (DMPP) in the absence and presence of thea2-adrenoceptor agonist medetomidine (MED). The spontaneous outflow of adrenaline was similar between age-matchedSHR and WKY rats. However, the spontaneous outflow of noradrenaline was significantly lower in SHR compared with age-matched WKY rats. DMPP (0.1–3 mM) increased the outflow of noradrenaline and adrenaline in a concentration-dependentmanner. The Emax values for adrenaline overflow were similar between strains, but the Emax values for noradrenaline overflowwere significantly lower in SHR. The EC50 values for noradrenaline and adrenaline overflow were significantly higher in SHRcompared with age-matched WKY rats. MED (0.1–300 nM) reduced the DMPP-evoked overflow (DMPP 500 lM) of nor-adrenaline and adrenaline in a concentration-dependent manner and was capable of totally inhibiting this effect. The inhibi-tory action of MED was similar between age-matched SHR and WKY rats. In the adrenals, the a2A- and a2B-adrenoceptorsubtypes had the highest mRNA expression levels; the a2C-adrenoceptor subtype had the lowest mRNA expression levels. ThemRNA levels for the three subtypes were similar between strains. In conclusion, in SHR during the development of hyperten-sion, adrenal a2-adrenoceptor inhibitory function is conserved, accompanied by reduced noradrenaline release and unchangedadrenaline release.

a2-Adrenoceptors are important target molecules for endoge-nous catecholamines and exogenous pharmacological agents.a2-Adrenoceptors consist of three genetically distinct sub-types, a2A, a2B and a2C [1]. Presynaptic a2-adrenoceptorsplay a critical role in regulating noradrenaline release fromsympathetic nerve terminals by a negative feedback mecha-nism [2,3]. Moreover, a2-adrenoceptors are solely responsiblefor autocrine feedback inhibition of noradrenaline andadrenaline secretion from the adrenal medulla [4–7].

Increased activity of the sympathetic nervous system(SNS) accompanied by increased noradrenaline spillover hasbeen implicated in the pathogenesis of essential hypertensionin humans [8–10] and in an animal model of this disorder,the spontaneous hypertensive rat (SHR) [11,12]. Impairmentof presynaptic a2-adrenoceptors by a reduced expression ofthe a2A-adrenoceptor subtype has been associated with theincreased noradrenaline release that is associated with thehypertensive phenotype in SHR [13,14].

The adrenal medulla in combination with the SNS alsoplays a role in the epigenesis of hypertension in SHR. Hyper-

tension and left ventricular hypertrophy were absent only insympathectomized SHR that were subjected to adrenal de-medullation [15,16]. Studies have also shown that the devel-opment of hypertension is attenuated in young SHRsubjected to adrenal demedullation [17,18] and that thedevelopment of hypertension is restored by chronic adrena-line supplementation [19]. However, we have previouslyshown that in SHR before (6 weeks of age) and during thedevelopment of high blood pressure (12 and 22 weeks ofage) not only are adrenal catecholamine content and synthe-sis reduced but also that adrenaline plasma levels are similarcompared with those found in the normotensive controlWistar Kyoto (WKY) rats [20]. Moreover, treatment withthe a2-adrenoceptor agonist clonidine produces a similarreduction in adrenaline plasma levels in SHR compared withWKY rats [21].

Despite the importance of a2-adrenoceptors in the controlof adrenaline release from the adrenal medulla, their role inthe control of catecholamine release from the adrenalmedulla of SHR during the development of high blood pres-sure has not been previously tested. Therefore, in this study,we evaluated adrenal a2-adrenoceptor function before(6 weeks) and after (16 weeks) the development of hyperten-sion in SHR.

Author for correspondence: Maria A. Vieira-Coelho, Faculty ofMedicine, Institute of Pharmacology and Therapeutics, University ofPorto, Alameda Prof. Hern�ni Monteiro, 4200-319 Porto, Portugal(fax +351 225516343, e-mail [email protected]).

Basic & Clinical Pharmacology & Toxicology, 109, 253–260 Doi: 10.1111/j.1742-7843.2011.00712.x

� 2011 The AuthorsBasic & Clinical Pharmacology & Toxicology � 2011 Nordic Pharmacological Society

Materials and Methods

Animals. Male SHR and WKY rats were obtained from HarlanInterfauna Ib�rica (Barcelona, Spain). The investigation conforms tothe Guide for the Care and Use of Laboratory Animals published bythe US National Institutes of Health (NIH Publication No. 85-23,revised 1996), and the experiments were performed according to thePortuguese law on animal welfare. The animals were kept under con-trolled environmental conditions (12-hr light : dark cycle and roomtemperature 22 € 2�C). All animals were fed ad libitum throughoutthe study with standard rat chow (PANLAB, Barcelona, Spain), con-taining 1.9 g ⁄ kg of sodium. Animals were selected after a 5-day per-iod of stabilization and adaptation to blood pressure measurements.Blood pressure (systolic and diastolic) and heart rate were measuredin conscious restrained animals between 7:00 and 10:00 a.m., using aphotoelectric tail-cuff pulse detector (LE 5000; Letica, Barcelona,Spain). Five determinations were made each time and the meanswere used for further calculation. We calculated mean arterial bloodpressure (MAP) as follows: MAP = DBP + [(SBP ) DBP) ⁄ 3], whereDBP and SBP are diastolic and systolic blood pressures. Havingreached the age of 6 and 16 weeks, the rats were anaesthetized withsodium pentobarbital (60 mg ⁄ kg, ip). In the experiments carried outto evaluate the release of catecholamine from the adrenal medulla,we proceeded as follows: The right and left adrenal glands were rap-idly removed through an abdominal midline incision and immedi-ately placed in a modified Krebs–Henseleit solution [6] of thefollowing composition (mM): NaCl 118, KCl 4.8, CaCl2 2.5, MgSO4

1.2, NaHCO3 25, KH2PO4 1.2, glucose 11, ascorbic acid 0.57, diso-dium ethylenediaminetetraacetic acid 0.03, oxygenated with a mix-ture of 95% O2 and 5% CO2 in the presence of a monoamineoxidase inhibitor (pargyline, 100 lM) and a catechol-O-methyltrans-ferase inhibitor (tolcapone, 1 lM). In the experiments carried out toevaluate mRNA expression, the right and left adrenal glands wererapidly removed and immediately frozen at )80�C.

Noradrenaline and adrenaline release. The adrenal medullae were iso-lated from the gland and then placed in superfusion chambers, oneper chamber, where they were superfused with Krebs–Henseleitsolution at a rate of 0.5 ml ⁄ min. at 37�C. After a 90-min. period ofstabilization, successive 5-min. samples of the superfusate werecollected into tubes containing 0.3 ml of perchloric acid (2 M), fromt = 90 to 150 min. (t = 0 min. being the start of superfusion). At theend of the experiments, the adrenal medullae were placed in 1 ml ofperchloric acid (0.2 M) and catecholamines determined in superfu-sates and tissues. A concentration–response curve for the effect ofthe nicotinic receptor agonist 1,1-dimethyl-4-phenylpiperaziniumiodide (DMPP) on catecholamine release was determined by addi-tion of either 30, 100, 300, 1000 or 3000 lM in a single 5-min. per-iod delivered at t = 125 min. The effect of a single concentration ofK+ on catecholamine release was determined by addition of a singleconcentration (100 mM) delivered at t = 125 min. In the subsequentexperiments, nicotinic stimulation consisted of a single concentrationof DMPP (500 lM) delivered at t = 125 min. Concentration–response curves for the inhibitory effect of the a2-adrenoceptor ago-nist medetomidine on catecholamine release were determined byaddition of either 0.1, 0.3, 1, 3, 10, 30, 100 or 300 nM 15 min. beforenicotinic stimulation (from t = 110 until the end of nicotinic stimula-tion). When used, the a-adrenoceptor antagonist rauwolscine was

present from t = 90 min. until the end of nicotinic stimulation. Thespontaneous outflow of noradrenaline and adrenaline was calculatedas a fraction of the noradrenaline or adrenaline content of the tissueat the onset of the respective collection period (fractional rate; permin.). The overflow elicited by nicotinic stimulation was calculatedas the difference ‘total noradrenaline or adrenaline outflow duringand after stimulation’ minus ‘basal outflow’ and was then expressedas a percentage of the noradrenaline or adrenaline content of thetissue at the onset of stimulation [22]. Overflow ratios obtained afteraddition of a drug were also calculated as a percentage of the corre-sponding ratio in controls in which no drug was added.

Catecholamine assay. The assay of the catecholamines noradrena-line and adrenaline in superfusate samples and tissues was per-formed by high-performance liquid chromatography withelectrochemical detection (HPLC-ED) as previously described [20].In brief, aliquots of 500 ll of the superfusate samples or 50 ll ofthe perchloric acid extract of tissues were placed in 5-ml conicalbase glass vials containing 50 mg of alumina, and the pH of thesamples was adjusted to 8.6 by the addition of Tris buffer.3,4-Dihydroxybenzylamine hydrobromide was used as internalstandard. The adsorbed catecholamines were then eluted from thealumina with 200 ll of 0.2 M perchloric acid on Costar Spin-Xmicrofilter tubes; 50 ll of the eluate was injected into an HPLC-ED system (Gilson Model 141; Gilson Medical Electronics,Villiers, Le Bel, France). The lower limit of detection of catechol-amines ranged from 350 to 1000 fmol.

Quantitative real-time PCR. Quantitative real-time polymerase chainreaction (qPCR) was carried out as previously described [23]. RNAfrom isolated adrenal medulla was isolated using the PureZOL RNAisolation reagent (Bio-Rad, Hercules, CA, USA). Total RNA (1 lgper sample) was DNase-treated and reverse-transcribed according tothe manufacturer’s instructions (iScriptTM cDNA Synthesis Kit;Bio-Rad). For qPCR, 50 ll of amplification mixture (iQTM SYBR�Green Supermix, Bio-Rad) was used containing 20 ng of reverse-transcribed RNA and primers (250 nM) (Sigma, St Louis, MO,USA) (table 1). Reactions were run in duplicates (20 ll) on a MJMini detector (Bio-Rad). The cycling conditions were as follows:15-min. polymerase activation at 95�C and 40 cycles at 95�C for15 sec., at 58�C for 30 sec. and at 72�C for 30 sec. Absolute copynumbers were determined using standard curves of correspondinglinear DNA fragments (seven points from 109 to 102 copies). Resultswere normalized to b-actin values.

Statistics. Concentration–response curves for the nicotinic receptoragonist DMPP and the a2-adrenoceptor agonist medetomidine wereevaluated by sigmoid curve fitting [22]. The calculation yielded theagonist EC50 and Emax values. Results are expressed as arithmeticmean € S.E.M. The significance of differences between means wasevaluated using Student’s t-test or two-way analysis of variance. Val-ues were considered statistically different when p < 0.05. n is thenumber of adrenal medullae used.

Drugs. ())-Adrenaline (+)-bitartrate salt bitartrate, L-())-noradrena-line (+)-bitartrate salt monohydrate, 3,4-dihydroxybenzylamine hyd-robromide and DMPP were obtained from Sigma ChemicalCompany. Medetomidine and rauwolscine HCl were obtained from

Table 1.Primers for each of the a2-adrenoceptor (a2ADR) subtypes and for the reference gene b-actin.

Genes Gene ID Forward primer Reverse primer Product size (bp)

a2AADR Adra2a NM_031144.2 cagcccctagcactctgaaa agtcccctccaaactgggta 65a2BADR Adra2b NM_138505.2 atatggccaaagcagactgg gagagggtagcctgcctgt 74a2CADR Adra2c NM_138506 ctctggctgcctggactt gttggtccccctatgtaccc 71b-actin Actb NM_031144.2 cccgcgagtacaaccttct cgtcatccatggcgaact 72

254 EDUARDO MOURA ET AL.

� 2011 The AuthorsBasic & Clinical Pharmacology & Toxicology � 2011 Nordic Pharmacological Society. Basic & Clinical Pharmacology & Toxicology, 109, 253–260

Tocris (Ellisville, MO, USA). All compounds were dissolved inwater.

Results

Animals.Body-weight was similar between 6-week-old SHR andWKY rats. Although there was an age-dependent increase inbody-weight in both strains, 16-week-old SHR presented alower body-weight compared with age-matched WKY rats(table 2). Tibia length increased with age in both strains andwas similar between age-matched animals (table 2).

Cardiovascular parameters.At 6 weeks of age, MAP values were similar between SHRand WKY rats (table 2). There was an age-dependentincrease in MAP values in both SHR and WKY rats, but at16 weeks of age, MAP values in SHR were significantlyhigher compared with age-matched WKY rats (table 2).Heart rate values in 6-week-old SHR were similar to age-matched WKY rats. However, in 16-week-old SHR, heart

rate values were significantly higher compared with age-matched WKY rats and 6-week-old animals (table 2).

Adrenal and heart weight.Adrenal weight was similar between age-matched SHR andWKY rats and increased significantly with age in bothstrains (table 2). Heart weight was similar between 6-week-old SHR and WKY rats and increased with age in bothstrains (table 2). This increase was more pronounced inSHR, and 16-week-old SHR presented significantly higherheart weight compared with age-matched WKY rats.

Spontaneous outflow of catecholamines.In agreement with our previous reports on catecholaminelevels in the adrenal of SHR [20,21], at the start of the collec-tion period (t = 90 min.), the content of noradrenaline andadrenaline in the adrenal gland was significantly lower inSHR compared with age-matched WKY rats in both agesstudied, and there was an age-dependent increase in adrenalcatecholamine content (fig. 1A, B). The spontaneousoutflow of noradrenaline was significantly lower in 6-week-old SHR compared with age-matched WKY rats (fig. 2A).With age, there was a significant increase in the spontaneousoutflow of noradrenaline in WKY rats but not in SHR(fig. 2A). The spontaneous outflow of adrenaline was similarbetween SHR and WKY rats and increased significantlywith age in both strains (fig. 2B).

Evoked overflow of catecholamines.The nicotinic receptor agonist DMPP produced a concentra-tion-dependent increase in the outflow of noradrenaline andadrenaline from the adrenal medulla of SHR and WKY ratsaged 6 and 16 weeks (fig. 3A–D). For the DMPP-evokedoverflow of adrenaline, in both ages studied, whereas theEmax values were similar between SHR and WKY rats, theEC50 values were significantly higher in SHR compared withage-matched WKY rats (table 3). For the DMPP-evokedoverflow of noradrenaline, the Emax values were significantlylower and the EC50 values were significantly higher in SHRcompared with age-matched WKY rats, in both ages studied

Table 2.Body-weight, tibia length, mean arterial blood pressure (MAP),heart rate and adrenal and heart body-weight in Wistar Kyoto(WKY) rats and spontaneously hypertensive rats (SHR) at 6 and16 weeks of age.

6 weeks 16 weeks

WKY SHR WKY SHR

Body-weight (g) 154 € 5 141 € 4 375 € 5 329 € 6*Tibia length (mm) 33 € 1 30 € 2 42 € 2# 39 € 1#

Mean arterial pressure(mmHg)

84 € 2 86 € 2 102 € 1# 169 € 2#*

Heart rate (b.p.m.) 317 € 5 331 € 10 320 € 6 393 € 9*#

Adrenal gland weight(mg)

13.7 € 1.0 14.1 € 0.6 21.0 € 0.4# 20.5 € 0.7#

Heart weight (mg) 675 € 35 686 € 27 1059 € 10# 1219 € 31#*

Values are presented as mean € S.E.M. (n = 6). *p < 0.05 versusage-matched WKY rats. #p < 0.05 compared to 6-week-old animals.

A

0

5

10

15

20 WKYSHR

*

*

#

#

pmol

/gla

nd

B

6 weeks 16 weeks 6 weeks 16 weeks0

20

40

60 WKYSHR #

#

*

*

pmol

/gla

nd

Fig. 1. Noradrenaline (A) and adrenaline (B) adrenal gland content (in pmol ⁄ gland) of Wistar Kyoto (WKY) rats and spontaneously hyperten-sive rats (SHR) aged 6 and 16 weeks at the start of the collection period (t = 90 min.). Columns and vertical lines represent mean € S.E.M.(n = 6). *Significantly different from age-matched WKY rats (p < 0.05). #Significantly different from 6-week-old rats (p < 0.05).

a2-ADRENOCEPTOR-MEDIATED INHIBITION OF CATECHOLAMINE RELEASE 255


(table 3). In both strains, there was an age-dependentincrease in the EC50 values for the DMPP-evoked overflowof adrenaline and noradrenaline (table 3). The Emax valuesfor the DMPP-evoked overflow of adrenaline also increasedwith age in both strains, but the Emax values for the DMPP-evoked overflow of noradrenaline increased with age only in

WKY rats (table 3). In isolated adrenal medullae obtainedfrom 6-week-old WKY rats, a single concentration of DMPP(500 lM) produced a greater increase in the evoked releaseof noradrenaline and adrenaline (0.97 € 0.25; 0.80 € 0.08 in% of adrenal noradrenaline or adrenaline content, noradren-aline and adrenaline, respectively), compared with a single

A

0.0

0.2

0.4

0.6

0.8

1.0 WKYSHR

* *

#N

orad

rena

line

outfl

ow(%

nor

adre

nalin

e ad

rena

l con

tent

/min

)

B

6 weeks 16 weeks 6 weeks 16 weeks0.0

0.2

0.4

0.6

0.8

1.0 WKYSHR # #

Adr

enal

ine

outfl

ow(%

adr

enal

ine

adre

nal c

onte

nt/m

in)

Fig. 2. Spontaneous outflow of noradrenaline (A) and adrenaline (B) from the adrenal medulla of Wistar Kyoto (WKY) rats and spontaneouslyhypertensive rats (SHR) aged 6 and 16 weeks. Results are presented as percentage of noradrenaline or adrenaline adrenal content per minute.Columns and vertical lines represent mean € S.E.M. (n = 6). *Significantly different from age-matched WKY rats (p < 0.05). #Significantly dif-ferent from 6-week-old rats (p < 0.05).

A

–4.5 –4.0 –3.5 –3.0 –2.5 –2.0 –1.5

0

1

2

3WKY 6 weeksSHR 6 weeks

**

*

log [DMPP]

Nor

adre

nalin

e ov

erflo

w(%

nor

adre

nalin

e ad

rena

l con

tent

/min

) B

–4.5 –4.0 –3.5 –3.0 –2.5 –2.0 –1.5

0

1

2


**

**

**

log [DMPP]

Nor

adre

nalin

e ov

erflo

w(%

nor

adre

nalin

e ad

rena

l con

tent

/min

)

C

–4.5 –4.0 –3.5 –3.0 –2.5 –2.0 –1.5

0

1

2


**

log [DMPP]

Adr

enal

ine

over

flow

(% a

dren

alin

e ad

rena

l con

tent

/min

)

D

–4.5 –4.0 –3.5 –3.0 –2.5 –2.0 –1.5

0

1

2


*

*

log [DMPP]

Adr

enal

ine

over

flow

(% a

dren

alin

e ad

rena

l con

tent

/min

)

Fig. 3. 1,1-Dimethyl-4-phenylpiperazinium (DMPP) iodide-evoked overflow of noradrenaline (A, B) and adrenaline (C, D) from the adrenalmedulla of Wistar Kyoto (WKY) rats and spontaneously hypertensive rats (SHR) aged 6 (6w) and 16 weeks (16w). Results are presented as per-centage of noradrenaline or adrenaline adrenal content per minute. Symbols and vertical lines represent mean € S.E.M. (n = 6–8). *Signifi-cantly different from corresponding values for WKY rats (p < 0.05).



concentration of K+ (100 mM) (0.45 € 0.25; 0.50 € 0.03 in% of adrenal noradrenaline or adrenaline content, noradren-aline and adrenaline, respectively). Based on these resultsand on our previous studies [6,7], 500 lM of DMPP wasestablished as the concentration to be used to stimulatenoradrenaline and adrenaline overflow in the subsequentexperiments.

Effect of a2-adrenoceptor activation on catecholamine release.The a2-adrenoceptor agonist medetomidine reduced in aconcentration-dependent manner the DMPP-evoked over-

flow of noradrenaline and adrenaline from the adrenalmedulla of SHR and WKY rats aged 6 and 16 weeks(fig. 4A–D) and completely inhibited this effect in bothstrains at both ages studied. Although there was an age-dependent increase in EC50 values in both strains, there wereno significant differences in EC50 values for noradrenaline(WKY: 13 € 4, 28 € 3; SHR: 16 € 5, 42 € 13 nM, 6 and16 weeks, respectively) and adrenaline (WKY: 13 € 6, 29 €5; SHR: 11 € 5, 33 € 4 nM, 6 and 16 weeks, respectively).Medetomidine alone did not alter significantly the basaloutflow of noradrenaline and adrenaline in both strains atboth ages studied (data not shown). The inhibitory effectproduced by a single concentration of medetomidine(100 nM) over the DMPP-evoked overflow noradrenalineand adrenaline was abolished by pre-incubation with a singleconcentration (300 nM) of the selective a2-adrenoceptorantagonist rauwolscine; however, the antagonist per se hadno effect on the basal outflow or the induced overflow ofeither catecholamine (data not shown).

a2-Adrenoceptor expression in adrenal medulla.To determine the expression of the three a2-adrenoceptor sub-types in the adrenal medulla, qPCR was performed. In SHRand WKY rats, the a2A-adrenoceptor subtype had the highestlevels of mRNA expression (�400 copies ⁄ 105 copies ofb-actin), followed by the a2B (�200 copies ⁄ 105 copies ofb-actin) and the a2C (�20 copies ⁄ 105 copies of b-actin). The

Table 3.EC50 (lM) and Emax (in percentage of noradrenaline or adrenalineadrenal content per minute) values for the DMPP-evoked release ofnoradrenaline (NA) and adrenaline (AD) from the adrenal medulla.

6 weeks 16 weeks

WKY SHR WKY SHR

NA EC50 463 € 49 856 € 75* 978 € 85# 1521 € 148*#

Emax 1.48 € 0.10 1.22 € 0.07* 2.50 € 0.19# 1.15 € 0.13*AD EC50 485 € 39 684 € 60* 798 € 86# 1213 € 123*#

Emax 1.13 € 0.07 1.09 € 0.06 2.63 € 0.15# 2.47 € 0.21#

DMPP, 1,1-dimethyl-4-phenylpiperazinium iodide; SHR, spontane-ously hypertensive rats; WKY, Wistar Kyoto.Values are presented as mean € S.E.M. (n = 6–8). *p < 0.05 versusage-matched WKY rats. #p < 0.05 compared to 6-week-old animals.

A

–10 –9 –8 –7 –6 –5

0

20

40

60

80

100


log [MED]

Inhi

bitio

n of

DM

PP-e

voke

dno

radr

enal

ine

over

flow

(%)

B

–10 –9 –8 –7 –6 –5

0

20

40

60

80

100


log [MED]

Inhi

bitio

n of

DM

PP-e

voke

dno

radr

enal

ine

over

flow

(%)

C

–10 –9 –8 –7 –6 –5

0

20

40

60

80

100


log [MED]

Inhi

bitio

n of

DM

PP-e

voke

dad

rena

line

over

flow

(%)

D

–10 –9 –8 –7 –6 –5

0

20

40

60

80

100


log [MED]

Inhi

bitio

n of

DM

PP-e

voke

dad

rena

line

over

flow

(%)

Fig. 4. Effect of medetomidine (MED) on the 1,1-dimethyl-4-phenylpiperazinium iodide (DMPP)-evoked overflow of noradrenaline and adren-aline from the adrenal medulla of Wistar Kyoto (WKY) rats and spontaneously hypertensive rats (SHR) aged 6 (6w) and 16 weeks (16w). Con-centration–inhibition curves were obtained by adding MED (0.1–300 nM) 15 min. before DMPP (500 lM). Results are presented as percentageof inhibition. Symbols and vertical lines represent mean € S.E.M. (n = 6–8). *Significantly different from corresponding values for WKY rats(p < 0.05).



expression of the a2-adrenoceptor subtypes was similarbetween SHR and WKY rats and did not change with age(fig. 5A–C).

Discussion

The results presented here show that in young pre-hyperten-sive (6 weeks old) and hypertensive (16 weeks old) SHR,the a2-adrenoceptor-mediated inhibitory feedback controlof noradrenaline and adrenaline release from the adrenalmedulla is similar to the normotensive WKY rats, accompa-nied by unaltered adrenaline release and decreased noradren-aline release.

To date, a2-adrenoceptors are the only receptors reportedto inhibit catecholamine secretion from chromaffin cells ofthe adrenal medulla [4–6]. In mice, all three a2-adrenoceptorsubtypes are detectable at the mRNA level and play a role inthe control of noradrenaline release from the adrenalmedulla [23], but the a2C-adrenoceptor subtype is the physio-logically predominant receptor in the control of adrenalinerelease [6]. Mice with targeted deletion of one (heterozygousknockout) or both (homozygous knockout) copies of thea2C-adrenoceptor have a parallel reduction between mRNAlevels and the inhibitory function of the receptor that resultsin increased adrenaline release from the adrenal medulla andhigher adrenaline plasma levels [6,23]. In the adrenal medullaof SHR and WKY rats, the presence of all three a2-adreno-ceptor subtypes was also detected at the mRNA level, and inagreement with what has been previously reported for the ratadrenal medulla [5,7], the a2A-adrenoceptor subtype had thehighest mRNA levels. Although it is not accurate to directlydeduce from mRNA levels which is the physiologically pre-dominant subtype, the fact that the mRNA levels for allthree a2-adrenoceptor subtypes were similar between SHRand WKY rats could be taken as first evidence that adrenala2-adrenoceptor function is unaltered in the early stages ofSHR hypertension. This statement is further supported bythe fact that the inhibitory effect of the selective a2-adreno-ceptor agonist medetomidine on catecholamine release fromthe adrenal medulla was similar between age-matched SHRand WKY rats.

Endogenous acetylcholine-induced secretion of adrenalcatecholamines is predominantly mediated by nicotinic

receptors in both SHR and WKY rats [24]. Two previousstudies have analysed nicotinic receptor function in the adre-nal medulla of hypertensive SHR. In one study, isolatedchromaffin cells were used [25], which although useful donot fully reproduce the physiological properties of the intactadrenal medulla. In the other study that used the perfusedadrenal gland as experimental model [26], an increase in theDMPP-evoked catecholamine secretion from the adrenalgland of SHR was reported. However, because no data onage or cardiovascular parameters of SHR were presentedand what is more, the adrenal gland weight was differentbetween SHR and WKY rats, it is difficult to assess (i)whether there is a correlation with the hypertensive pheno-type of the SHR and (ii) whether the higher release valuesare in fact a result of increased nicotinic response, or an arte-fact owing to the difference in gland size.

In this study, we used an experimental set-up similar tothe one previously used by our group to evaluate the effectof nicotinic receptor activation on catecholamine releasefrom the adrenal medulla of mice [6,23]. Interestingly, in pre-hypertensive and hypertensive SHR, the nicotinic-evokedoverflow of noradrenaline induced by the selective agonistDMPP was significantly reduced when compared with age-matched WKY rats. This finding is consistent with otherstudies showing that both young and aged SHR exhibitreduced nicotinic acetylcholine receptor expression comparedwith age-matched control WKY rats in a number of impor-tant brain regions including cortex, hippocampus and thala-mus [27–31]. One possible explanation for this reduced effectcould be down-regulation of nicotinic receptor function bydesensitization. It has been shown that during prolongedexposure to acetylcholine, nicotinic receptors desensitize [32].Given that SHR present increased splanchnic sympatheticnervous activity [33,34], this increased targeting of the adre-nal medulla could lead to a desensitization of adrenal nico-tinic receptors. However, the decreased function may alsoresult from changes in downstream events of the nicotinicreceptor such as changes in Ca2+ homeostasis or in voltage-gated Ca2+ channels. In this view, another explanation couldbe a2-adrenoceptor-mediated inhibition. This would occurthrough a pathway similar to the feedback mechanism thatoperates in adrenergic neurons: a2-adrenoceptors localized inthe plasma membrane activate inhibitory G-proteins (Gi ⁄ o),

A

0

200

400

600

800WKYSHR

α 2A m

RN

A(c

opie

s/10

5 β-ac

tin)

α 2B m

RN

A(c

opie

s/10

5 β-ac

tin)

α 2c m

RN

A(c

opie

s/10

5 β-ac

tin)

B

6 weeks0

100

200

300

400WKYSHR

C

0

5

10

15

20

25WKYSHR

16 weeks6 weeks 16 weeks 6 weeks 16 weeks

Fig. 5. mRNA levels for each of the of a2-adrenoceptor subtypes – a2A (A), a2B (B) and a2C (C), in the adrenal medulla of Wistar Kyoto(WKY) rats and spontaneously hypertensive rats (SHR) aged 6 and 16 weeks. Results are presented as gene copy number per 105 copies of thereference gene b-actin. Columns and vertical lines represent mean € S.E.M. (n = 6).



and the bc-subunits released from G-proteins would directlyinhibit voltage-gated Ca2+ channels. In this view, activationof adrenal a2-adrenoceptors by circulating noradrenaline,that is known to be increased in the early stages of hyperten-sion in SHR, would produce a decrease in the capacity ofthe adrenal medulla to release catecholamines in response tonicotinic stimulation. However, further studies are requiredto test whether the reduced nicotinic response is indeed aresult of desensitization and whether a2-adrenoceptors play arole in the reduced nicotinic effect.

During the development of hypertension in SHR, there isincreased noradrenaline spillover from sympathetic nerveendings [14]. Here, we show that opposite to the increasednoradrenaline release, both the spontaneous and the evokedrelease of noradrenaline from the adrenal medulla arereduced in pre-hypertensive and hypertensive SHR. However,given that over 90% of the circulating noradrenaline derivesfrom sympathetic nerves, mostly those innervating mesen-teric organs, kidneys and skeletal muscle and only about 7%derives from the adrenal medulla [35], it is unlikely thatchanges in noradrenaline derived from the adrenal would bereflected in changes in noradrenaline plasma levels. The pri-mary catecholamine secreted by the adrenal medulla isadrenaline, and although adrenaline in plasma can originatefrom heart nerve terminals [36], the cardiac intrinsic nervoussystem [37] or non-neuronal cells [38], under normal condi-tions, over 90% of circulating adrenaline derives from therelease by the adrenal medulla. We have previously shownthat SHR have similar adrenaline plasma levels comparedwith age-matched WKY rats, and that in both strains, thereis an age-dependent increase in these levels [20]. Althoughthis observation could be accounted for by changes in adren-aline metabolism, it has been shown that the activity of theprincipal enzyme responsible for adrenaline metabolism,membrane-bound catechol-O-methyltransferase [39], is simi-lar between SHR and WKY rats [40]. What is more, unpub-lished data from our group show that there are no age- orstrain-dependent differences in the adrenal tissue content orin the urine levels of metanephrine, the principal metaboliteof adrenaline produced by this enzyme. In agreement withour previous work, we have shown here that not only isadrenaline release from the adrenal medulla similar betweenSHR and WKY rats, but that there is also an age-dependentincrease in the release of adrenaline. The preserved adrenala2-adrenoceptor inhibitory feedback mechanism couldaccount for the lack of difference in adrenal adrenalinerelease and the similarity in adrenaline plasma levels betweenWKY and SHR. In fact, in SHR, in contrast to the impairedresponse of presynaptic a2A-adrenoceptors to antagonistssuch as yohimbine [41,42] and agonists such as clonidine[21], activation of adrenal a2-adrenoceptors by the agonistmedetomidine produces a reduction in catecholamine over-flow similar to normotensive rats. Moreover, clonidinereduces adrenaline plasma levels in SHR in a similar mannerto that observed in WKY rats [21].

Although the adrenal medulla has been shown to play arole in the rise in blood pressure in SHR, adrenal adrenaline

release and adrenaline plasma levels in SHR remain similarto normotensive WKY rats during the development ofhypertension. Circulating adrenaline can enhance the neuro-nal outflow of noradrenaline by stimulating presynapticneuronal facilitatory b2-adrenoceptors [43]. Indeed, inpre-hypertensive and hypertensive SHR, there is increasedfunctional b2-adrenoceptor response [44,45]. Furthermore,pre-weaning treatment of SHR with the b-blocker carvedilolreduced blood pressure during treatment and attenuated thesubsequent development of hypertension [46]. Therefore,although adrenaline plasma levels remain similar to the nor-motensive strain during the onset of hypertension, activationof presynaptic b2-adrenoceptors could cause enhanced nor-adrenaline release, a factor associated with the onset ofhypertension.

In conclusion, a2-adrenoceptor-mediated inhibitory feed-back control over adrenaline and noradrenaline release fromthe adrenal medulla of SHR is preserved in the early stagesof hypertension and could account for the lack of change inadrenaline spillover and the reduced noradrenaline release.Preserved adrenal a2-adrenoceptors in combination withreduced adrenal nicotinic receptor function could act to bal-ance out the increased SNS activity that occurs in the earlystages of hypertension.

AcknowledgementsThis work was supported by grant from FCT (‘FundaÅ¼o

para a CiÞncia e a Tecnologia’), FCOMP-01-0124-FEDER-007492.

References

1 Knaus AE, Muthig V, Schickinger S, Moura E, Beetz N, GilsbachR et al. Alpha2-adrenoceptor subtypes – unexpected functionsfor receptors and ligands derived from gene-targeted mouse mod-els. Neurochem Int 2007;51:277–81.

2 Gilsbach R, Roser C, Beetz N, Brede M, Hadamek K, HauboldM et al. Genetic dissection of alpha2-adrenoceptor functions inadrenergic versus nonadrenergic cells. Mol Pharmacol2009;75:1160–70.

3 Vieira-Coelho MA, Serrao MP, Afonso J, Pinto CE, Moura E.Catecholamine synthesis and metabolism in the central nervoussystem of mice lacking alpha-adrenoceptor subtypes. Br J Phar-macol 2009;158:726–37.

4 Brede M, Nagy G, Philipp M, Sorensen JB, Lohse MJ, Hein L.Differential control of adrenal and sympathetic catecholaminerelease by alpha 2-adrenoceptor subtypes. Mol Endocrinol2003;17:1640–6.

5 Lymperopoulos A, Rengo G, Funakoshi H, Eckhart AD, KochWJ. Adrenal GRK2 upregulation mediates sympathetic overdrivein heart failure. Nat Med 2007;13:315–23.

6 Moura E, Afonso J, Hein L, Vieira-Coelho MA. Alpha2-adreno-ceptor subtypes involved in the regulation of catecholaminerelease from the adrenal medulla of mice. Br J Pharmacol2006;149:1049–58.

7 Moura E, Pinto CE, Serrao MP, Afonso J, Vieira-Coelho MA.Adrenal alpha(2)-adrenergic receptors in the aging normotensiveand spontaneously hypertensive rat. Neurobiol Aging 2010 [Epubahead of print].

8 Anderson EA, Sinkey CA, Lawton WJ, Mark AL. Elevatedsympathetic nerve activity in borderline hypertensive humans.



Evidence from direct intraneural recordings. Hypertension 1989;14:177–83.

9 Esler M. The sympathetic system and hypertension. Am J Hyper-tens 2000;13:99S–105S.

10 Mancia G, Grassi G, Giannattasio C, Seravalle G. Sympatheticactivation in the pathogenesis of hypertension and progression oforgan damage. Hypertension 1999;34:724–8.

11 Cabassi A, Vinci S, Calzolari M, Bruschi G, Borghetti A. Regio-nal sympathetic activity in pre-hypertensive phase of spontane-ously hypertensive rats. Life Sci 1998;62:1111–8.

12 Trippodo NC, Frohlich ED. Similarities of genetic (spontaneous)hypertension man and rat. Circ Res 1981;48:309–19.

13 Reja V, Goodchild AK, Phillips JK, Pilowsky PM. Tyrosinehydroxylase gene expression in ventrolateral medulla oblongata ofWKY and SHR: a quantitative real-time polymerase chain reac-tion study. Auton Neurosci 2002;98:79–84.

14 Zugck C, Lossnitzer D, Backs J, Kristen A, Kinscherf R, HaassM. Increased cardiac norepinephrine release in spontaneouslyhypertensive rats: role of presynaptic alpha-2A adrenoceptors.J Hypertens 2003;21:1363–9.

15 Korner P, Bobik A, Oddie C, Friberg P. Sympathoadrenal systemis critical for structural changes in genetic hypertension. Hyper-tension 1993;22:243–52.

16 Lee RM, Borkowski KR, Leenen FH, Tsoporis J, Coughlin M.Combined effect of neonatal sympathectomy and adrenal deme-dullation on blood pressure and vascular changes in spontane-ously hypertensive rats. Circ Res 1991;69:714–21.

17 Borkowski KR, Quinn P. The effect of bilateral adrenal demedul-lation on vascular reactivity and blood pressure in spontaneouslyhypertensive rats. Br J Pharmacol 1983;80:429–37.

18 Borkowski KR, Quinn P. Adrenaline and the developmentof spontaneous hypertension in rats. J Auton Pharmacol1985;5:89–100.

19 Borkowski KR. Effect of adrenal demedullation and adrenalineon hypertension development and vascular reactivity inyoung spontaneously hypertensive rats. J Auton Pharmacol 1991;11:1–14.

20 Moura E, Pinho Costa PM, Moura D, Guimaraes S, Vieira-Coel-ho MA. Decreased tyrosine hydroxylase activity in the adrenalsof spontaneously hypertensive rats. Life Sci 2005;76:2953–64.

21 Moura E, Afonso J, Serrao MP, Vieira-Coelho MA. Effect of clo-nidine on tyrosine hydroxylase activity in the adrenal medullaand brain of spontaneously hypertensive rats. Basic Clin Pharma-col Toxicol 2009;104:113–21.

22 Trendelenburg AU, Sutej I, Wahl CA, Molderings GJ, Rump LC,Starke K. A re-investigation of questionable subclassifications ofpresynaptic alpha2-autoreceptors: rat vena cava, rat atria, humankidney and guinea-pig urethra. Naunyn Schmiedebergs ArchPharmacol 1997;356:721–37.

23 Gilsbach R, Brede M, Beetz N, Moura E, Muthig V, Gerstner Cet al. Heterozygous alpha 2C-adrenoceptor-deficient mice developheart failure after transverse aortic constriction. Cardiovasc Res2007;75:728–37.

24 Nagayama T, Matsumoto T, Yoshida M, Suzuki-Kusaba M, HisaH, Kimura T et al. Role of cholinergic receptors in adrenal cate-cholamine secretion in spontaneously hypertensive rats. Am JPhysiol 1999;277:R1057–62.

25 Miranda-Ferreira R, de Pascual R, de Diego AM, Caricati-NetoA, Gandia L, Jurkiewicz A et al. Single-vesicle catecholaminerelease has greater quantal content and faster kinetics in chromaf-fin cells from hypertensive, as compared with normotensive, rats.J Pharmacol Exp Therap 2008;324:685–93.

26 Lim DY, Jang SJ, Park DG. Comparison of catecholamine releasein the isolated adrenal glands of SHR and WKY rats. AutonAutacoid Pharmacol 2002;22:225–32.

27 Gattu M, Terry AV Jr, Pauly JR, Buccafusco JJ. Cognitiveimpairment in spontaneously hypertensive rats: role of centralnicotinic receptors. Part II. Brain Res 1997;771:104–14.

28 Gattu M, Pauly JR, Boss KL, Summers JB, Buccafusco JJ. Cog-nitive impairment in spontaneously hypertensive rats: role of cen-tral nicotinic receptors. I. Brain Res 1997;771:89–103.

29 Hernandez CM, Hoifodt H, Terry AV Jr. Spontaneously hyper-tensive rats: further evaluation of age-related memory perfor-mance and cholinergic marker expression. J Psychiatry Neurosci2003;28:197–209.

30 Terry AV Jr, Hernandez CM, Buccafusco JJ, Gattu M. Deficits inspatial learning and nicotinic-acetylcholine receptors in older,spontaneously hypertensive rats. Neuroscience 2000;101:357–68.

31 Hohnadel EJ, Hernandez CM, Gearhart DA, Terry AV Jr. Effectof repeated nicotine exposure on high-affinity nicotinic acetylcho-line receptor density in spontaneously hypertensive rats. NeurosciLett 2005;382:158–63.

32 Marley PD. Desensitization of the nicotinic secretory response ofadrenal chromaffin cells. Trends Pharmacol Sci 1988;9:102–7.

33 Thoren P, Ricksten SE. Recordings of renal and splanchnic sym-pathetic nervous activity in normotensive and spontaneouslyhypertensive rats. Clin Sci (Lond) 1979;57(Suppl 5):197s–9s.

34 Yamamoto J, Nakai M, Natsume T. Cardiovascular responses toacute stress in young-to-old spontaneously hypertensive rats.Hypertension 1987;9:362–70.

35 Eisenhofer G, Rundquist B, Aneman A, Friberg P, Dakak N,Kopin IJ et al. Regional release and removal of catecholaminesand extraneuronal metabolism to metanephrines. J Clin Endocri-nol Metab 1995;80:3009–17.

36 Esler M, Kaye D, Thompson J, Jennings G, Cox H, Turner Aet al. Effects of aging on epinephrine secretion and regionalrelease of epinephrine from the human heart. J Clin EndocrinolMetab 1995;80:435–42.

37 Armour JA. The role of peripheral autonomic neurons in cardiacregulation. In: Ardell JL, Armour JA (eds). Neurocardiology.Oxford University Press, New York, 1994;219–44.

38 Huang MH, Friend DS, Sunday ME, Singh K, Haley K, AustenKF et al. An intrinsic adrenergic system in mammalian heart.J Clin Invest 1996;98:1298–303.

39 Eisenhofer G, Kopin IJ, Goldstein DS. Catecholamine metabo-lism: a contemporary view with implications for physiology andmedicine. Pharmacol Rev 2004;56:331–49.

40 Tsunoda M, Imai K. An assay for determination of rat adrenalcatechol-O-methyltransferase activity: comparison of spontane-ously hypertensive rats and Wistar-Kyoto rats. Anal BioanalChem 2004;380:887–90.

41 Tsuda K, Kusuyama Y, Hano T, Kuchii M, Nishio I, Masuyama Y.Alteration of presynaptic alpha 2-mediated inhibition of norepi-nephrine release in perfused mesenteric arteries of young and adultspontaneously hypertensive rats. J Hypertens Suppl 1984;2:S95–7.

42 Tsuda K, Kuchii M, Nishio I, Masuyama Y. Presynaptic alpha2-adrenoceptor mediated regulation of norepinephrine release inperfused mesenteric vasculatures in young and adult spontane-ously hypertensive rats. Jpn Circ J 1987;51:25–32.

43 Guimaraes S, Moura D. Vascular adrenoceptors: an update.Pharmacol Rev 2001;53:319–56.

44 Doggrell SA. Functional beta1- and beta2-adrenoceptors in theleft and right atrium of pre-hypertensive rats. J Pharmacy Phar-macol 2002;54:1407–12.

45 Doggrell SA, Surman AJ. Functional beta-adrenoceptors in theleft atrium of normotensive and hypertensive rats. J Auton Phar-macol 1994;14:425–36.

46 Boesen EI, Lambert GW, Anderson WP, Kett MM. Pre-weaningcarvedilol treatment in spontaneously hypertensive rats. Eur JPharmacol 2004;486:183–8.



Documents

α2-Adrenoceptor-Mediated Inhibition of Catecholamine Release from the Adrenal Medulla of Spontaneously Hypertensive Rats is Preserved in the Early Stages of Hypertension