2 transferase from Nodularia spumigena NSOR10 3 4 …jb.asm.org/content/early/2007/02/16/JB.01850-06.full.pdf · 53 PPT was capable of modifying carrier proteins from both heterocyst

1

Characterisation of NsPPT, a cyanobacterial phosphopantetheinyl 1

transferase from Nodularia spumigena NSOR10 2

3

Running title: Characterisation of the Nodularia spumigena NSOR10 PPT 4

5

Copp, JN1,2

, Roberts, AA1, Marahiel, MA

3 and Neilan, BA

1* 6

7

1 Biotechnology and Biomolecular Sciences, University of New South Wales, Kensington 8

2052, Sydney, Australia 9

2 Present address: Biological Sciences, Victoria University of Wellington, P.O. Box 600, 10

Wellington, New Zealand 11

3 Fachbereich Chemie, Philipps-Universität, Marburg, Germany 12

13

* to whom correspondence should be addressed 14

School of Biotechnology and Biomolecular Sciences, The University of New South 15

Wales, Kensington NSW 2052, Sydney, Australia 16

Tel: +612 9385 3151 17

Fax: +612 9385 1591 18

Email: [email protected] 19

20

21

ACCEPTED

Copyright © 2007, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.01850-06 JB Accepts, published online ahead of print on 16 February 2007

on June 16, 2018 by guesthttp://jb.asm

.org/D

ownloaded from

http://jb.asm.org/

2

Keywords: Phosphopantetheinyl Transferase, Heterocyst, Polyketide Synthase, Non-22

ribosomal Peptide Synthetase, Cyanobacteria 23

24

Abbreviations: aa, amino acids; ACP, acyl carrier protein; AcpS, acyl carrier protein 25

synthase; ArCP, aryl carrier protein; CoA, co-enzyme A; CP, carrier protein; DTT, 26

dithiothreitol; FAS, fatty acid synthesis; IPTG, isopropyl-beta-D-thiogalactopyranoside; 27

NsPPT, Nodularia spumigena NSOR10 (heterocyst associated) phosphopantetheinyl 28

transferase; NRPS, non-ribosomal peptide synthetase; PCP, peptidyl carrier protein; PKS, 29

polyketide synthase; PPT, phosphopantetheinyl transferase; SDS-PAGE, sodium dodecyl 30

sulphate polyacrylamide gel electrophoresis; Sfp, a phosphopantetheinyl transferase 31

associated with biosynthesis of the siderophore surfactin in Bacillus subtilis. 32

33

Acknowledgements: The Australian Research Council (ARC) and Diagnostic 34

Technology P/L financially supported this work. JNC was also supported by the Adrian 35

Lee Travel Scholarship, UNSW. 36 ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

3

Abstract 37

Phosphopantetheinyl transferases (PPTs) are a superfamily of essential enzymes required 38

for the synthesis of a wide range of compounds including fatty acids, polyketides and 39

non-ribosomal peptide metabolites. These enzymes activate carrier proteins within 40

specific biosynthetic pathways by the transfer of a phosphopantetheinyl moiety. The 41

diverse superfamily of phosphopantetheinyl transferases (PPTs) can be divided into two 42

families according to specificity and conserved sequence motifs. The first family is 43

typified by the Escherichia coli acyl carrier protein synthase (AcpS), which acts in fatty 44

acid synthesis (FAS). The prototype of the second family is the broad substrate range 45

PPT Sfp, required for surfactin biosynthesis in Bacillus subtilis. Most cyanobacteria do 46

not encode an AcpS-like PPT and furthermore, some of their Sfp-like PPTs occupy a 47

unique phylogenetic subgroup defined by the PPTs involved in heterocyst differentiation. 48

Here, we present the first functional characterisation of a cyanobacterial PPT by 49

structural and subsequent functional analysis of the Nodularia spumigena NSOR10 PPT. 50

Southern hybridisations suggested this may be the only PPT encoded within the N. 51

spumigena NSOR10 genome. Expression and enzyme characterisation showed that this 52

PPT was capable of modifying carrier proteins from both heterocyst glycoplipid and 53

nodularin toxin synthesis. Cyanobacteria present a unique and vast source of bioactive 54

metabolites, therefore an understanding of cyanobacterial PPTs is important in order to 55

harness the biotechnological potential of cyanobacterial natural products. 56

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

4

Introduction 57

Phosphopantetheinyl transferases (PPTs) are enzymes required for the activation of 58

carrier proteins within the synthesis pathways of fatty acids and a wide range of diverse 59

metabolites including non-ribosomal peptides and polyketides (24). The PPT superfamily 60

can be separated into two families of enzymes based on sequence and substrate 61

specificity. The first family include the acyl carrier protein synthase (AcpS) type PPTs 62

(120 aa) which are involved in activating carrier proteins from primary metabolism 63

including those from fatty acid synthesis (FAS). The majority of microorganisms harbour 64

an AcpS type PPT, which typically show a limited range of specificity for carrier proteins 65

from secondary metabolism. The second group of PPTs is the Sfp-like family (230 aa) 66

which have similarity to the Bacillus subtilis PPT, Sfp, responsible for the activation of 67

carrier proteins within the biosynthetic pathway for surfactin (24, 34). Microorganisms 68

which require activation of carrier proteins from secondary metabolism pathways, such as 69

those in non-ribosomal peptide synthetases (NRPSs) or polyketide synthases (PKSs), 70

require the action of an Sfp-like PPT. Some members of the Sfp-like family, which can 71

be further delineated into the W/KEA and F/KES subfamilies (11), display a wide range 72

of activity against non-cognate carrier proteins. This activity has been harnessed in 73

diverse applications, including the Sfp-labelling of carrier proteins (40). In species such 74

as Pseudomonas aeruginosa PAO1 (13), Haemophilus influenzae and Synechocystis sp. 75

PCC 6803, an Sfp-like PPT acts in both primary and secondary metabolism due to the 76

absence of an AcpS type PPT in their genomes. Biosynthetic gene clusters often have a 77

co-localised Sfp-like PPT, as seen in the gene cluster responsible for the synthesis of the 78

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

5

telomerase inhibitor griseorhodin A in Streptomyces sp. JP95 (25). However, the majority 79

of cyanobacterial biosynthetic clusters do not have a proximally associated PPT. 80

Cyanobacteria have been recognised as a useful and vast source of secondary metabolites 81

with important pharmaceutical functions (3). These include the dolastatin family of 82

antitumour compounds, several derivatives of which are currently in phase I and II trials 83

(26, 27) and the cancer cell toxin curacin A, now in preclinical cancer trials (9). However, 84

the production of cyanobacterial compounds in sustainable, easily manipulated 85

heterologous hosts remains elusive. The requirement of PPTs to activate carrier proteins 86

within biosynthetic pathways is critical for successful host selection. 87

Despite the plethora of screening approaches and promising natural product leads from 88

cyanobacteria, few synthesis pathways have been characterised, and the majority of these 89

are involved in toxin production. These include microcystin from Microcystis aeruginosa 90

PCC 7806 (41), Anabaena sp. 90 (38) and Planktothrix agardhii CYA 126 (10), 91

nostocyclopeptide (20) identified in Nostoc sp. GSV 224, and nostopeptolide identified in 92

Nostoc sp. ATCC 53789 (1). 93

Bioinformatic analyses have revealed the absence of AcpS enzymes in almost all 94

cyanobacterial genomes available for analysis (11). Therefore it is likely that Sfp-like 95

PPTs, typically responsible for the activation of secondary metabolite carrier proteins, 96

also act in FAS. Recent phylogenetic analysis has placed all cyanobacterial PPTs within 97

the diverse W/KEA subfamily. Within this subfamily a specific, heterocyst-type of PPT 98

is associated with synthesis of the heterocyst glycolipids (11). Heterocysts are specialised 99

nitrogen fixation cells (29) with glycolipid membranes that are made up of complex lipid 100

and carbohydrate residues. The glycolipid membrane prevents the entry of oxygen to the 101

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

6

cell which would otherwise inhibit the nitrogenase enzyme. Several heterocyst genetic 102

loci have been identified, one of which is the hetMNI locus associated with heterocyst 103

glycolipid synthesis (7). The hetMNI loci can be examined in the published genome of 104

Nostoc punctiforme ATCC 29133 and the publicly available Nostoc sp. PCC 7120, 105

N. spumigena CCY 9414 and Anabaena variabilis ATCC 29413 genomes. A PPT (HetI) 106

falls within this locus, which also encodes an aryl carrier protein (ArCP) within an 107

iterative polyketide synthase (HetM) (7) and an oxidoreductase (HetN) (6). Nodularia 108

spumigena NSOR10 is also able to form heterocysts, however the hetMNI loci has not 109

been previously characterised in this species. 110

Algal blooms of N. spumigena mainly occur in the estuaries and coastal waters of 111

Southern Australia (18), and have been reported in the Baltic Sea (38), New Zealand (8) 112

and in North America (28). Many blooms are highly toxic due to the non-ribosomal 113

production of the protein phosphatase-inhibiting hepatotoxin nodularin. The biosynthesis 114

of nodularin has been characterised and the gene cluster sequenced (30). This large 115

hybrid NRPS/PKS biosynthetic gene cluster encodes four acyl carrier proteins (ACPs) 116

and five peptidyl carrier proteins (PCPs). The carrier proteins require a PPT for activity, 117

which is not located within or adjacent to the biosynthetic cluster. A 220 bp fragment of a 118

PPT from N. spumigena NSOR10 was recently identified through degenerate PCR based 119

screening (11). This PPT has been designated as NsPPT (N. spumigena 120

phosphopantetheinyl transferase) for the purposes of this study. 121

Due to the association of NsPPT within the heterocyst cluster, it was hypothesised that 122

this PPT would act to phosphopantetheinylate the HetM ArCP. Furthermore, due to the 123

general absence of multiple PPTs within cyanobacterial genomes, it was likely that this 124

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

7

PPT may also act in the biosynthesis of the hepatotoxin, nodularin. In this study, our aim 125

was to express and characterise the cyanobacterial PPT, NsPPT from N. spumigena 126

NSOR10, thereby identifying this enzyme’s potential role in both glycolipid and 127

nodularin synthesis. 128

129

Materials and Methods 130

Media and Culturing. N. spumigena NSOR10 was cultured at room temperature on a 12 131

h light/dark cycle in ASM media supplemented with 1.5% NaCl (33). DNA was extracted 132

as previously described (4). 133

134

DNA Amplification, Sequencing and Analysis. PCR and sequencing reactions were 135

carried out as previously published (11). Panhandle-based gene walking by adaptor-136

mediated and specific primers (Table 1) (30) was utilised to amplify the unknown 137

genomic regions flanking the N. spumigena PPT fragment. The output from BLAST 138

(Basic Local Alignment Search Tool), Pileup from GCG and the multiple-sequence 139

alignment tool from CLUSTAL X (12) were utilised for the analysis and alignment of 140

sequences. Automated sequencing was performed using the PRISM Big Dye cycle 141

sequencing system and a model 373 sequencer (Applied Biosystems) at the Automated 142

DNA Analysis Facility, UNSW. Sequence analysis was performed using Applied 143

Biosystems Autoassembler software. 144

145

Southern Hybridisation. Pure genomic DNA samples (~10 µg) were digested overnight 146

with XbaI or XmnI as per manufacturers recommendations (Promega, Australia). Digests 147

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

8

and positive controls (0.5-1.0 ng of linearised plasmid) were separated on 0.8% agarose 148

gels at 60 mV for approximately 2.5 h and vacuum-blotted to a nylon membrane 149

(Amersham). The DIG-High Prime DNA labelling kit (Roche, Australia) was utilised for 150

Southern hybridisations. Specific PPT probes were created by amplification with specific 151

primers. The primer pair slrup (5'-TGTTTAAACTCACCTGTG-3') and slrdn (5'-152

CCCAAGGTAACGAAACGA-3') was used to amplify slr0495 from Synechocystis sp. 153

PCC 6803. The primer pair npunf (5'-GGATCCGCGATCGCCAGTCTGAGTTC-3') and 154

npunr (5'-GAGCTCTTTGTGTAGTAGCGAATTATC-3') was utilised to amplify a PPT 155

from N. punctiforme ATCC 29133. The primer pair npptf (5'-156

CATGAAAGATATCACGGCGCTT-3') and npptr (5'-157

GAAGATAACAAGCTTGTATTGCC-3') was used to amplify the full-length ORF 158

NsPPT. Probes were labelled by PCR with digoxigenin (DIG) and tested for efficiency 159

from 100 ƒg to 10 ng. Hybridisations were performed overnight at 40°C, stringency 160

washes were performed with 0.5% SSC, 0.1% SDS at 65°C and signals were analysed by 161

chemiluminescent detection with CPSD by a LAS-3000 (FUJIFILM). 162

163

Creation of Expression Plasmids. The N. spumigena NSOR10 NsPPT (AY836561) was 164

amplified by the primer pair npptf and npptr. The 720 bp PCR-amplified product was 165

cloned into pET30 (Novagen) to yield the expression plasmid pNsPPT. The Nostoc 166

punctiforme ATCC 29133 hetM was amplified from the heterocyst hetMNI locus 167

encoding the ArCP/ketoreductase HetM (ZP_00107100). The primer pair hetmf (5'-168

GCCATGGCTATAAAACAGTCTTTC-3') and hetmr (5'-169

GGGATCCGAGATTCAAGAAACC-3') were used to amplify a 1.7 kb fragment, which 170

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

9

was cloned into pET30 to created pHetM. The N. punctiforme ATCC 29133 pArCP 171

vector for expression of NpArCP was constructed in a similar manner utilising the 172

primers hetmf and arcpr (5'-TAGCTCGAGAACCATCTTGCAC-3'), to amplify and 173

clone the 260 bp ArCP domain of HetM and create pArCP. 174

The N. spumigena NSOR10 PCP and ACP (hereby called NsPCP and NsACP) sequences 175

were amplified from the hybrid NRPS/PKS ndaC (AAO64404) of the ndaS gene cluster 176

responsible for production of the hepatotoxin nodularin (30). The primer pairs nspcpf (5'-177

CTCGAGCAGCCTCTACAACTGCA-3') and nspcpr (5'-178

GGATCCGCCAGGAGAACGGCGG-3'), and nsacpf (5'-179

GGAGCTCTTTTCCAAACATTCT-3') and nsacpr (5'-180

GGGATCCTCTAAGCATTCCATCAGTC-3') were utilised. The resulting fragments 181

were manipulated as described above to yield pNsACP and pNsPCP, respectively. 182

The M. aeruginosa PCP sequence was amplified from the hybrid NRPS/PKS mcyG 183

(AAX73195) of the mcyS gene cluster responsible for production of the hepatotoxin 184

microcystin (41). The PCP primers mpcpf (5'-GGATCCTGAACAGGGA-3') and mpcpr 185

(5'-CTCGAGATGGCGACGGCTCC-3') were used to construct the expression vector, 186

pMPCP, as outlined above. 187

The PKS ACP, designated NpACP, was amplified from NosB of the putative 188

nostopeptolide gene cluster from N. punctiforme ATCC 29133. This species has been 189

shown to produce nostopeptolide (21) and the gene cluster is similar to the characterised 190

nostopeptolide gene cluster in Nostoc sp. GSV224 (20). NosB (ZP_00110898) is a 191

modular type 1 PKS within this cluster. The C-terminal NosB ACP was amplified 192

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

10

utilising the primer pair npacpbf (5'-GGATCCTAAAATCTAGGCTAG-3') npacpsr (5'-193

GAGCTCAAATTGTTATTTCTT-3') and cloned as above to yield pNpACP. 194

195

Protein Expression, Purification and Enzyme Activity Analysis. The plasmids, 196

pNsPPT, pArCP and pMPCP were utilised for expression at 30°C for 4 h with 0.2 mM 197

IPTG for induction. NpACP was expressed at 22-24°C with 0.1 mM IPTG for 6 h. HetM 198

was expressed at 18°C, overnight with 0.1 mM IPTG. NpArCP was expressed at 37°C for 199

2 h with 1 mM IPTG. After expression, cells were pelleted at 4,000 x g and frozen at -200

80°C overnight. Pellets were thawed on ice, resuspended in 5 ml 50 mM Hepes (Sigma), 201

150 mM NaCl pH 7.4 and either subjected to 3 passages through a cooled French 202

pressure cell at 1,000 psi or sonicated at 4°C, 30% amplitude, for 25 s with a 0.5 s pulse. 203

The soluble fraction was collected after centrifugation at 20,000 x g for 30 min at 4°C. A 204

HiTrap chelating column (Amersham) was utilised for purification of the recombinant 205

proteins. Fractions containing the desired protein, as determined by SDS-PAGE, were 206

pooled, desalted and snap frozen in 50mM Hepes, 150mM NaCl, 8% glycerol pH 7.4, for 207

storage at –80°C. Protein concentration was determined using the calculated extinction 208

co-efficient of each protein; NsPPT 37,650 cm-1

M-1

, HetM 67,430 cm-1

M-1

, NpArCP 209

8,250 cm-1

M-1

, MPCP 6,970 cm-1

M-1

and NpACP 13,940 cm-1

M-1

. 210

PPT assays were carried out as previously published (13). In brief, a 100-400 µL reaction 211

comprising of 5 mM Tris-HCl pH 7.4, 12.5 mM MgCl2, 0.5 mM CoA, 2 µM DTT, 10-212

100 µM of the respective carrier proteins (CPs) and PPT to a final concentration of 300 213

nM, was incubated at 37°C for 30 min. Reactions were terminated by the addition of 1 ml 214

of 10% TCA. Assays were precipitated overnight at -20°C before centrifugation at 4°C 215

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

11

for 15 min at 16,000 x g. Protein pellets were analysed by electrospray ionisation mass 216

spectrometry (ESI-MS). Spectra were acquired using an API QStar Pulsar i hybrid 217

tandem mass spectrometer (Applied Biosystems). Samples (~200-400 ƒmol) were 218

dissolved in water:acetonitrile:formic acid (50:49:1), loaded (1 µl) into nanospray needles 219

(Proxeon) and the tip positioned ~10 mm from the orifice. Nitrogen was used as curtain 220

gas and a potential of 900 V applied to the needle. A time of flight (TOF-MS) scan was 221

acquired (m/z 550-2000, 1 s) and accumulated for ~1 min into a single file. Spectra were 222

deconvoluted using the Bayesian reconstruction method contained within the Analyst QS 223

software. 224

225

Results 226

Sequencing and Analysis of the hetMNI Locus from N. spumigena NSOR10. 227

Flanking regions of the partial PPT gene fragment were amplified to allow sequencing of 228

3,450 bp of the N. spumigena NSOR10 hetMNI locus (AY836561). Sequence analysis 229

revealed the 240-residue NsPPT PPT, a 27,555 Da protein with an isoelectric point (pI) 230

of 6.1. NsPPT displayed similarity to HetI from Nostoc sp. PCC 7120 (81%), and to Sfp 231

from B. subtilis (55%). NsPPT is encoded in reverse orientation in relation to the hetM 232

and hetN genes, as observed in the hetMNI locus of the heterocyst-forming cyanobacteria 233

N. punctiforme ATCC 29133 (Figure 1), Nostoc sp. PCC 7120 and A. variabilis ATCC 234

29413. 235

The predicted protein products of the genes downstream of NsPPT in N. spumigena 236

NSOR10 were analysed and compared to homologous proteins. The protein product of 237

hetN is 126 amino acids in length and has 83% similarity to the C-terminal half of the 238

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

12

corresponding protein in A. variabilis ATCC 29413. The partial hetM product, encoding 239

an iterative PKS in N. spumigena, showed 90% similarity to the homologous protein in N. 240

punctiforme ATCC 29133, hetM (also called hglB). No ORFs were detected in the 241

sequenced region extending 900 bp upstream of NsPPT. 242

243

Southern Hybridisation. Southern analysis was utilised to ascertain the number of PPTs 244

encoded within the N. spumigena NS0R10 genome. Probes were constructed from a 245

diverse range of cyanobacterial PPTs including NsPPT, Sppt from Synechocystis sp. PCC 246

6803 (BAA10326) and a PPT from N. punctiforme ATCC 29133 (ZP_00110892) 247

designated Nppt3. These PPTs are from distinct cyanobacterial phylogenetic clades (11). 248

Hybridisations performed with the NsPPT probe revealed a single band from 249

N. spumigena NSOR10 (Figure 2) and no hybridisation was detected with the Sppt or 250

Nppt3 specific probes. Taken together, these results suggest that NsPPT may be the only 251

genomically encoded PPT in N. spumigena NSOR10. However, the single band detected 252

by Southern analysis does not exclude the slight possibility of two PPTs residing within 253

this single digested genomic fragment. The possibility of a more divergent PPT that was 254

not detected by the specific Southern hybridisation probes also cannot be excluded. 255

256

Expression and Purification of Recombinant Proteins. In order to confirm the 257

phosphopantetheinyl transferase activity of NsPPT, the enzyme was expressed as a 32.7 258

kDa His-tagged, soluble protein. Production of NsACP and NsPCP from N. spumigena 259

NSOR10 was not successful. Attempts to resolve this problem included variations in 260

expression time (2-24 h), temperature (18-37°C), IPTG induction concentration (0.1-1 261

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

13

mM), growth media (Luria Broth and Tryptone Phosphate) and helper plasmids (pRARE 262

and pLysE, Novagen). As the partial hetM in N. spumigena NSOR10 does not encode an 263

ArCP domain, the 90% similar protein, hetM, in N. punctiforme ATCC 29133 264

(designated NpArCP) was selected for expression and in vitro activation analysis. 265

Although soluble HetM expression was achieved, analysis of HetM via nanospray ion 266

trap mass spectrometry could not be performed due to low yields. The expression plasmid 267

encoding only the ArCP domain of hetM was therefore utilised and the 15.6 kDa NpArCP 268

was subsequently expressed with suitable yields. MPCP and NpACP were expressed as 269

22.0 kDa and 20.8 kDa proteins, respectively. No phosphopantetheinylation of the 270

cyanobacterial carrier proteins was seen after expression in E. coli (Figure 3)(Table 2). 271

272

NsPPT Activity. Activity was detected by ionisation mass spectrometry via the mass 273

addition of 340 Da. This mass relates to the incorporation of the phosphopantetheinyl arm 274

of CoA transferred by the PPT to the carrier protein (Figure 3). Mass spectra of 275

phosphopantetheinylated carrier proteins were analysed alongside controls (with no PPT) 276

to verify phosphopantetheinylation by NsPPT. 277

NsPPT phosphopantetheinyl activity was confirmed by employing the HetM ArCP from 278

the hetMNI gene cluster in N. punctiforme ATCC 29133 (NpArCP). The conversion of 279

apo-NpArCP (15.75 kDa) to holo-NpArCP (16.09 kDa, Figure 3), revealed that NsPPT 280

can phosphopantetheinylate the HetM carrier protein which is involved in heterocyst 281

glycolipid synthesis (Table 2). 282

Enzymatic analysis of NsPPT activity in PKS and NRPS secondary metabolism (ACPs 283

and PCPs) were subsequently tested utilising NpACP and MPCP (Table 2). Mass 284

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

14

spectrometry analyses also showed the 340 Da addition of the phosphopantetheinyl 285

moiety from CoA to each of these respective carrier proteins. Control reactions were 286

performed without the addition of NsPPT (Figure 3). 287

288

Discussion 289

This study presents the first enzymatic analysis of a cyanobacterial PPT. After incubation 290

of NsPPT with apo-NpArCP, complete conversion to the holo-NpArCP was observed. No 291

phosphopantetheinylation of the HetM NpArCP was seen after heterologous expression 292

in E. coli. Therefore the PPTs of E. coli were not capable of phosphopantetheinylating 293

the HetM ArCP from N. punctiforme ATCC 29133. The specificity of E. coli PPTs has 294

previously been reported, with negligible phosphopantetheinylation of the P. aeruginosa 295

PAO1 ArCP observed after heterologous expression in E. coli (13). 296

Although not conclusive, Southern hybridisation suggests that there may only be one PPT 297

within the N. spumigena NSOR10 genome. This is supported by the presence of only one 298

PPT in the recently available N. spumigena CCY 9414 genome. However, further 299

phosphopatentheinylation assays are required to determine whether NsPPT is able to 300

activate the ACP from FAS. The possibility of NsPPT as the only PPT present within the 301

genome of N. spumigena NSOR10 led to the hypothesis that NsPPT could also 302

phosphopantetheinylate the PKS/NRPS carrier proteins, such as those within the hybrid 303

PKS/NRPS multienzyme responsible for nodularin production in N. spumigena NSOR10 304

(30). However, expression of the N. spumigena NSOR10 nodularin carrier proteins was 305

not successful. Similar results of problematic carrier protein expression have also been 306

reported, including the failure to express a P. aeruginosa PAO1 NRPS PCP (13) or the 307

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

15

Streptomyces glaucescens NRPS PCP in E. coli (39). Successful expression of a PKS 308

ACP from the N. punctiforme ATCC 29133 nostopeptolide A (nosB) biosynthetic gene 309

cluster and a M. aeruginosa PCC 7806 NRPS PCP from the microcystin (mcyG) 310

biosynthetic gene cluster afforded the analysis of NsPPT phosphopantetheinylation in 311

secondary metabolism. Phosphopantetheinylation of both carrier proteins was achieved in 312

a 30 min assay, suggesting that NsPPT could also act as an efficient cofactor for the 313

synthesis of NRPSs and PKSs in N. spumigena NSOR10. 314

Although the NRPS PCP used here is encoded by a unicellular cyanobacterial species, 315

M. aeruginosa PCC 7806, phosphopantetheinylation by a PPT from a filamentous, 316

heterocyst-forming cyanobacterial species was not surprising. This PCP was from a 317

domain within McyG, which is encoded by the M. aeruginosa PCC 7806 microcystin 318

biosynthetic gene cluster. This 300 kDa protein is 70% identical to the corresponding 319

NdaC within the nodularin biosynthetic gene cluster in N. spumigena NSOR10. A 320

common evolutionary path has been proposed for these two hepatotoxins, with 321

transposition and a NRPS module deletion thought to be responsible for the variation in 322

structure between the two cyclic peptides (30, 35). McyG is putatively involved in the 323

activation of phenylpropanoids, which is the first step in the biosynthesis of the highly 324

modified amino acid Adda (19). The unusual and complex biosynthesis of this amino 325

acid, which occurs only in cyanobacteria, involves a hybrid NRPS/PKS. 326

NpACP was also phosphopantetheinylated, indicating that NsPPT can activate carrier 327

proteins from biosynthetic pathways that are not present in N. spumigena NSOR10, such 328

as those involved in nostopeptolide biosynthesis. The incomplete conversion 329

(approximately 65% conversion to holo-NpACP) indicated that there was reduced 330

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

16

specificity for non-cognate carrier proteins. The terminal 100 amino acids (incorporating 331

the ACP) of the putative NosB from N. punctiforme ATCC 29133 display 60% similarity 332

to the corresponding amino acids of the NdaC PKS ACP. 333

A similar scenario of a singular PPT participating in multiple metabolic pathways is 334

typified by PcpS in Pseudomonas aeruginosa PAO1 (13). This PPT was catalytically 335

characterised to show that it is most efficient towards the ACPs of FAS. It was suggested 336

that a small reduction in the efficiency of this PPT would lead to the failure of PcpS to 337

phosphopantetheinylate carrier proteins of secondary metabolism. In cyanobacteria, 338

where the majority of species harbour a single PPT, genetic mutations could potentially 339

prevent toxin production by inhibiting the ability of the PPT to activate carrier proteins 340

within secondary metabolism biosynthetic pathways. 341

Cyanobacterial species associated with slow growth, and complicated or unattainable 342

culturing requirements often include those strains that harbour the gene clusters for the 343

synthesis of pharmaceutically interesting compounds (14, 17, 37). Molecular methods 344

may yield the genetic information (5, 30) but would not allow the isolation and 345

production of novel compounds without recombinant expression (2). The PPT Sfp has 346

been used to overcome problems associated with carrier protein modification in E. coli 347

heterologous hosts (23, 32), however modification is often incomplete (15). Alternative 348

expression hosts are under investigation, including Pseudomonas sp. (16) and 349

Streptomyces spp. (22, 36), for the heterologous expression and biochemical 350

characterisation of secondary metabolite gene clusters from cyanobacteria. 351

NsPPT is capable of phosphopantetheinylating a broad range of carrier protein substrates 352

which, based on the evidence presented here, may be a common characteristic of all 353

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

17

cyanobacterial PPTs. If so, the occurrence of multiple PPTs in heterocyst-forming 354

species, such as the three PPTs of N. punctiforme ATCC 29133, would be superfluous to 355

the phosphopantetheinylation needs of the organism. An alternative scenario could 356

hypothesise that this broad range activity is common only to cyanobacterial species with 357

multiple phosphopantetheinylation pathways (FAS, NRPS, PKS) that harbour a single 358

Sfp-like PPT. If so, the multiple PPTs encoded by the genome of N. punctiforme 359

ATCC 29133 would be expected to show dedication toward a single 360

phosphopantetheinylation pathway. 361

The ability of NsPPT to activate non-cognate secondary metabolite carrier proteins has 362

great potential for application in biotechnology. Phosphopantetheinylation of 363

non-cognate carrier proteins from alternative pathways, such as those in microcystin or 364

nostopeptolide biosynthesis has demonstrated the potential application of this PPT to 365

harness the potential of cyanobacterial biosynthetic pathways in heterologous hosts. 366

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

18

References 367 368

1. Becker, J. E., R. E. Moore, and B. S. Moore. 2004. Cloning, sequencing, and 369

biochemical characterization of the nostocyclopeptide biosynthetic gene cluster: 370

molecular basis for imine macrocyclization. Gene 325:35-42. 371

2. Brady, S. F., C. J. Chao, J. Handelsman, and J. Clardy. 2001. Cloning and 372

heterologous expression of a natural product biosynthetic gene cluster from 373

eDNA. Org. Lett. 3:1981-1984. 374

3. Burja, A. M., B. Banaigs, E. Abou-Mansour, J. G. Burgess, and P. C. Wright. 375

2001. Marine cyanobacteria - a prolific source of natural products. Tetrahedron 376

57:9347-9377. 377

4. Burns, B. P., M. L. Saker, M. C. Moffitt, and B. A. Neilan. 2004. Molecular 378

detection of genes responsible for cyanobacterial toxin production in the genera 379

Microcystis, Nodularia and Cylindrospermopsis. Methods. Mol. Biol. 268:213-380

222. 381

5. Burns, B. P., A. Seifert, F. Goh, A. D. Jungblut, A. Serhat, and B. A. Neilan. 382

2005. Genetic potential for secondary metabolite production in stromatolite 383

communities. FEMS Microbiol. Lett. 243:293-301. 384

6. Callahan, S. M., and W. J. Buikema. 2001. The role of HetN in maintenance of 385

the heterocyst pattern in Anabaena sp. PCC 7120. Mol. Microbiol. 40:941-950. 386

7. Campbell, E. L., M. F. Cohen, and J. C. Meeks. 1997. A polyketide-synthase-387

like gene is involved in the synthesis of heterocyst glycolipids in Nostoc 388

punctiforme strain ATCC 29133. Arch. Microbiol. V167:251-258. 389

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

19

8. Carmichael, W. W., J. T. Eschedor, G. M. Patterson, and R. E. Moore. 1988. 390

Toxicity and partial structure of a hepatotoxic peptide produced by the 391

cyanobacterium Nodularia spumigena Mertens emend. L575 from New Zealand. 392

Appl. Environ. Microbiol. 54:2257-2263. 393

9. Chang, Z., P. Flatt, W. H. Gerwick, V.-A. Nguyen, C. L. Willis, and D. H. 394

Sherman. 2002. The barbamide biosynthetic gene cluster: a novel marine 395

cyanobacterial system of mixed polyketide synthase (PKS)-non-ribosomal peptide 396

synthetase (NRPS) origin involving an unusual trichloroleucyl starter unit. Gene 397

296:235-247. 398

10. Christiansen, G., J. Fastner, M. Erhard, T. Borner, and E. Dittmann. 2003. 399

Microcystin biosynthesis in Planktothrix: genes, evolution, and manipulation. J. 400

Bacteriol. 185:564-572. 401

11. Copp, J. N., and B. A. Neilan. 2006. The phosphopantetheinyl transferase 402

superfamily: phylogenetic analysis and functional implications in cyanobacteria. 403


12. Felsenstein, J. 1981. Evolutionary trees from DNA sequences: a maximum 405

likelihood approach. J. Mol. Evol. 17:368-376. 406

13. Finking, R., J. Solsbacher, D. Konz, M. Schobert, A. Schafer, D. Jahn, and 407

M. A. Marahiel. 2002. Characterization of a new type of phosphopantetheinyl 408

transferase for fatty acid and siderophore synthesis in Pseudomonas aeruginosa. J 409

Biol Chem 277:50293-302. 410

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

20

14. Fortman, J. L., and D. H. Sherman. 2005. Utilizing the power of microbial 411

genetics to bridge the gap between the promise and the application of marine 412

natural products. ChemBioChem 6:960-978. 413

15. Gokhale, R. S., S. Y. Tsuji, D. E. Cane, and C. Khosla. 1999. Dissecting and 414

exploiting intermodular communication in polyketide synthases. Science 415

284:482-485. 416

16. Gross, F., D. Gottschalk, and R. Müller. 2005. Posttranslational modification of 417

myxobacterial carrier protein domains in Pseudomonas sp. by an intrinsic 418

phosphopantetheinyl transferase. Appl. Microbiol. Biot. V68:66-74. 419

17. Handelsman, J., M. R. Rondon, S. F. Brady, J. Clardy, and R. M. Goodman. 420

1998. Molecular biological access to the chemistry of unknown soil microbes: a 421

new frontier for natural products. Chem. Biol. 5:R245-R249. 422

18. Heresztyn, T., and B. C. Nicholson. 1997. Nodularin concentrations in Lakes 423

Alexandrina and Albert, South Australia, during a bloom of the cyanobacterium 424

(blue-green alga) Nodularia spumigena and degradation of the toxin. Environ. 425

Toxic. Water. 12:273-282. 426

19. Hicks, L. M., M. C. Moffitt, L. L. Beer, B. S. Moore, and N. L. Kelleher. 427

2006. Structural characterization of in vitro and in vivo intermediates on the 428

loading module of microcystin synthetase. ACS Chem. Biol. 1:93–102. 429

20. Hoffmann, D., J. M. Hevel, R. E. Moore, and B. S. Moore. 2003. Sequence 430

analysis and biochemical characterization of the nostopeptolide A biosynthetic 431

gene cluster from Nostoc sp. GSV224. Gene 311:171-180. 432

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

21

21. Hunsucker, S. W., K. Klage, S. M. Slaughter, M. Potts, and R. F. Helm. 2004. 433

A preliminary investigation of the Nostoc punctiforme proteome. Biochem. 434

Bioph. Res. Co. 317:1121-1127. 435

22. Kalaitzis, J. A., and B. S. Moore. 2004. Heterologous biosynthesis of truncated 436

hexaketides derived from the actinorhodin polyketide synthase. J. Nat. Prod. 437

67:1419-1422. 438

23. Kealey, J. T., L. Liu, D. V. Santi, M. C. Betlach, and P. J. Barr. 1998. 439

Production of a polyketide natural product in nonpolyketide-producing 440

prokaryotic and eukaryotic hosts. PNAS. 95:505-509. 441

24. Lambalot, R. H., A. M. Gehring, R. S. Flugel, P. Zuber, M. LaCelle, M. A. 442

Marahiel, R. Reid, C. Khosla, and C. T. Walsh. 1996. A new enzyme 443

superfamily - the phosphopantetheinyl transferases. Chem. Biol. 3:923-936. 444

25. Li, A., and J. Piel. 2002. A Gene Cluster from a Marine Streptomyces Encoding 445

the Biosynthesis of the Aromatic Spiroketal Polyketide Griseorhodin A. 446

Chemistry & Biology 9:1017-1026. 447

26. Luesch, H., G. G. Harrigan, G. Goetz, and F. D. Horgen. 2002. The 448

cyanobacterial origin of potent anticancer agents originally isolated from sea 449

hares. Curr. Med. Chem. 9:1791-1806. 450

27. Luesch, H., R. E. Moore, V. J. Paul, S. L. Mooberry, and T. H. Corbett. 2001. 451

Isolation of dolastatin 10 from the marine cyanobacterium Symploca species 452

VP642 and total stereochemistry and biological evaluation of its analogue 453

symplostatin 1. J. Nat. Prod. 64:907-910. 454

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

22

28. MacGregor, B. J., B. Van Mooy, B. J. Baker, M. Mellon, P. H. Moisander, H. 455

W. Paerl, J. Zehr, D. Hollander, and D. A. Stahl. 2001. Microbiological, 456

molecular biological and stable isotopic evidence for nitrogen fixation in the open 457

waters of Lake Michigan. Environ. Microbiol. 3:205-219. 458

29. Meeks, J., C. , E. Campbell, L. , M. Summers, L. , and F. Wong, C. . 2002. 459

Cellular differentiation in the cyanobacterium Nostoc punctiforme. Arch. 460

Microbiol. V178:395-403. 461

30. Moffitt, M. C., and B. A. Neilan. 2004. Characterization of the nodularin 462

synthetase gene cluster and proposed theory of the evolution of cyanobacterial 463

hepatotoxins. Appl. Environ. Microbiol. 70:6353-6362. 464

31. Mofid, M. R., R. Finking, and M. A. Marahiel. 2002. Recognition of hybrid 465

peptidyl carrier proteins/acyl carrier proteins in nonribosomal peptide synthetase 466

modules by the 4'-phophopantetheinyl transferases AcpS and Sfp. J. Biol. Chem. 467

277:17023-17031. 468

32. Mootz, H. D., K. Schorgendorfer, and M. A. Marahiel. 2002. Functional 469

characterization of 4'-phosphopantetheinyl transferase genes of bacterial and 470

fungal origin by complementation of Saccharomyces cerevisiae lys5. FEMS 471

Microbiol. Lett. 213:51-57. 472

33. Provasoli, L., J. J. McLaughlin, and M. R. Droop. 1957. The development of 473

artificial media for marine algae. Arch Mikrobiol 25:392-428. 474

34. Quadri, L. E. N., P. H. Weinreb, M. Lei, M. M. Nakano, P. Zuber, and C. T. 475

Walsh. 1998. Characterization of Sfp, a Bacillus subtilis phosphopantetheinyl 476

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

23

transferase for peptidyl carrier protein domains in peptide synthetases. 477

Biochemistry 37:1585-1595. 478

35. Rantala, A., D. P. Fewer, M. Hisbergues, L. Rouhiainen, J. Vaitomaa, T. 479

Borner, and K. Sivonen. 2004. Phylogenetic evidence for the early evolution of 480

microcystin synthesis. PNAS. 101:568-573. 481

36. Rodriguez, E., S. Ward, H. Fu, W. P. Revill, R. McDaniel, and L. Katz. 2004. 482

Engineered biosynthesis of 16-membered macrolides that require 483

methoxymalonyl-ACP precursors in Streptomyces fradiae. Appl. Microbiol. Biot. 484

V66:85-91. 485

37. Rondon, M. R., P. R. August, A. D. Bettermann, S. F. Brady, T. H. 486

Grossman, M. R. Liles, K. A. Loiacono, B. A. Lynch, I. A. MacNeil, C. 487

Minor, C. L. Tiong, M. Gilman, M. S. Osburne, J. Clardy, J. Handelsman, 488

and R. M. Goodman. 2000. Cloning the soil metagenome: a strategy for 489

accessing the genetic and functional diversity of uncultured microorganisms. 490


38. Rouhiainen, L., T. Vakkilainen, B. L. Siemer, W. Buikema, R. Haselkorn, 492

and K. Sivonen. 2004. Genes coding for hepatotoxic heptapeptides 493

(microcystins) in the cyanobacterium Anabaena strain 90. Appl. Environ. 494

Microbiol. 70:686-692. 495

39. Sanchez, C., L. Du, D. J. Edwards, M. D. Toney, and B. Shen. 2001. Cloning 496

and characterization of a phosphopantetheinyl transferase from Streptomyces 497

verticillus ATCC15003, the producer of the hybrid peptide-polyketide antitumor 498

drug bleomycin. Chem. Biol. 8:725-738. 499

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

24

40. Sieber, S. A., C. T. Walsh, and M. A. Marahiel. 2003. Loading peptidyl-500

coenzyme A onto peptidyl carrier proteins: a novel approach in characterizing 501

macrocyclization by thioesterase domains. J. Am. Chem. Soc. 125:10862-10866. 502

41. Tillett, D., E. Dittmann, M. Erhard, H. von Dohren, T. Borner, and B. A. 503

Neilan. 2000. Structural organization of microcystin biosynthesis in Microcystis 504

aeruginosa PCC7806: an integrated peptide-polyketide synthetase system. Chem. 505

Biol. 7:753-764. 506

507

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

25

Table 1: Primers used to amplify the unknown genomic region surrounding NsPPT. 508

509

Table 2: Phosphopantetheinylation of carrier proteins (CPs) by NsPPT, detected by the 510

addition of a phosphopantetheinyl moiety (340 Da) by mass spectrometry. The 511

percentage of holo-CP was estimated by comparison of holo- and apo-CP abundance in 512

mass spectra as previously described (31). 513

514

Figure 1: (A) A boxshade alignment of PPT representatives. NsPPT from N. spumigena 515

NSOR10 was aligned with HetI from Nostoc sp. PCC 7120 (P37695), Sppt from 516

Synechocystis sp. PCC 6803 (BAA10326) and Sfp from B. subtilis (P39135). NsPPT 517

numbering is shown and percentage similarity to NsPPT is displayed in brackets. PPT 518

motifs 1, 2 and 3 are boxed and numbered. (B) Comparison of the hetMNI loci from 519

N. punctiforme ATCC 29133 and N. spumigena NSOR10. A partial segment of the 520

1520 bp hetM sequence is depicted by the broken arrow. The arrows indicate the 521

direction of gene transcription. 522

523

Figure 2: Southern hybridisation of PPT gene probes to digested N. spumigena NSOR10 524

genomic DNA. A “+” indicates a band was detected by chemiluminescence, the “-” 525

indicates no bands were visible. Positive controls utilised linearised plasmid DNA. 526

Numbering in brackets refers to lanes in the figure. Sppt refers to the PPT (BAA10326) 527

from Synechocystis sp. PCC 6803, Nppt2 (ZP_00110892) refers to a PPT from N. 528

punctiforme ATCC 29133, while NsPPT is the PPT found in N. spumigena NSOR10. 529

530

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

26

Figure 3: Mass spectrometry of ArCP, PCP and ACP phosphopantetheinylation. A) Mass 531

spectrum of NpArCP. B) Mass spectrum of phosphopantetheinylated NpArCP after 532

incubation with NsPPT. C) Mass spectrum of MPCP D) Mass spectrum of MPCP 533

phosphopantetheinylated after incubation with NsPPT E) Mass spectrum of NpACP. F) 534

Mass spectrum of phosphopantetheinylated NpACP after incubation with NsPPT. 535

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

27

Table 1 536

Primer Primer Sequence (5'-3')

Panhandle Roko1 gtggtaaaccagtattagcgg

Panhandle Roko2 gtctagtccacaaggctttaag

Panhandle Roko3 ccattgttattcctggtc

Panhandle Roko4 cattaaggccgcataaccgat

Panhandle Roko5 gcatcgtgaatcacagtgcc

Panhandle Roko6 caatagtagtggcgtggcaa

Panhandle Roko7 ctaaatggccagcataagca

Panhandle Roko8 gcttatgctggccatttag

Panhandle Roko9 gatgaatagccgggtcaag

Panhandle Roko10 gcgtgatgctgtaaatgc

Panhandle Roko11 cttgacccggctattcatc

Panhandle Thorne1 gtgataattcccggcacacagagc

Panhandle Thorne 2 ccgttattgcacttgtaaagagg

T7P Adapter cccctatccacccttacacctatc

T7Pr2 Adapter ccttacacctatccctccgtaatac

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

28

Table 2 537

Carrier Protein (CP) PPT Expected

mass

(Da)

Observed

mass

(Da)

Observed mass of

pantetheinylated CP

(Da)

holo-CP

(%)

NpArCP

(glycolipid

biosynthesis)

NsPPT 15,751 15,749 16,089 100

MPCP

(Microcystin

biosynthesis, NRPS)

NsPPT 21,978 21,980 22,320 100

NpACP

(Nostopeptolide

biosynthesis, PKS)

NsPPT 20,812 20,812 21,153 69

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

29

538

539

540

541

Figure 1542

A

B

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

30

543

544

545

546

547

Probe Positive control

(plasmid)

N. spumigena

NSOR10

Sppt

+ (Lane 1) – (Lane 2)

Nppt3

+ (Lane 3) – (Lane 4)

NsPPT + (Lane 5) + (Lane 6)

548

Figure 2 549

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

31

550

Figure 3 551

ACCEPTED


.org/D

ownloaded from

http://jb.asm.org/

Documents

2 transferase from Nodularia spumigena NSOR10 3 4 …jb.asm.org/content/early/2007/02/16/JB.01850-06.full.pdf · 53 PPT was capable of modifying carrier proteins from both heterocyst