document

http://immunol.nature.com • february 2001 • volume 2 no 2 • nature immunology

Jianfei Yang, Hong Zhu,Theresa L. Murphy,Wenjun Ouyang and Kenneth M. Murphy

Interleukin-12 (IL-12) and IL-18 induce synergistic transcription of interferon γ (IFN-γ) that is T cellreceptor (TCR)-independent, not inhibited by cyclosporin A and requires new protein synthesis. Tocharacterize this pathway, we screened for genes that are induced in IL-12– and IL-18–treated T helpertype 1 cells. GADD45β, which activates mitogen-activated protein kinase (MAPK)-extracellular signal-regulated kinase kinase 4 (MEKK4), was induced by IL-18 and augmented by IL-12. GADD45βexpression in naïve CD4+ T cells activated p38 MAPK and selectively increased cytokine-induced, butnot TCR-induced, IFN-γ production. Kinase-inactive MEKK4 and inhibition of the p38 MAPK pathwayboth selectively inhibit cytokine-induced, but not TCR-induced, IFN-γ production. Thus, the synergybetween IL-12 and IL-18 may involve GADD45β induction, which can maintain the MEKK4 and p38MAPK activation that is necessary for cytokine-induced, but not TCR-induced, IFN-γ production.

Department of Pathology and Immunology, Howard Hughes Medical Institute,Washington University School of Medicine, 660 South Euclid Ave., St. Louis, MO 63110, USA.Correspondence should be addressed to K. M. M. ([email protected]).

IL-18–stimulated GADD45β required incytokine-induced, but not TCR-induced,

IFN-γ production

Production of interferon γ (IFN-γ) is a critical step in promoting resis-tance to many pathogens1. Important sources of IFN-γ include naturalkiller (NK) cells and T helper type 1 (TH1) CD4+ T cells2–4. In TH1 cells,at least two distinct receptor-mediated pathways can induce IFN-γ pro-duction5. TCR-induced transcription of IFN-γ is inhibited by cyclosporinA (CsA)6, which is consistent with induction by latent transcription fac-tors such as the nuclear factor of activated T cells (NFAT)7,8. T cell recep-tor (TCR)-induced IFN-γ production is antigen-specific and a part of theadaptive immune response. Differentiated TH1 cells, which have acquiredexpression of both interleukin 12 (IL-12) and IL-18 receptors, can alsoproduce IFN-γ directly in response to these cytokines. This alternativepathway allows TH1 cells to participate in non-antigen–specific respons-es as a result of their previous antigen-induced differentiation. IL-12–and IL-18–induced IFN-γ transcription is not inhibited by CsA but doesappear to require new protein synthesis6,9. These results suggest thatcytokine-induced IFN-γ transcription requires more than simply thedirect action of signal transducers and activators of transcription 4(STAT4)10 and NF-κB5 on the IFN-γ promoter but requires the synthesisof other factors induced by IL-12 or IL-18.

Despite numerous studies, the transcriptional regulation of expres-sion of the gene encoding IFN-γ is only partly understood11. A proxi-mal promoter element has been described that has homology to theNF–IL-2A region of the IL-2 promoter and that also binds ATF1 andCREB7,12. A distal element that is capable of binding Fos, Jun andGATA-3 has also been described12,13. It is thought that the transcriptionfactors NFAT and NF-κB regulate IFN-γ promoter activity8,14–16 at dis-tinct sites. Potential binding sites for STAT4 have been identified inboth the first intron of the gene encoding IFN-γ and upstream promot-er regions17. Additionally, a role for the p38 mitogen-activated proteinkinase (MAPK) pathway in IFN-γ expression has been proposed,based on the finding that dominant-negative p38 selectively diminish-

es TH1 responses18. In support of this, MAPK kinase 3 (MKK3)-defi-cient mice19 exhibited diminished TH1 responses, although this mayhave been due to decreased IL-12 production rather than the directeffects of the p38 pathway on transcription factors acting at the IFN-γpromoter.

IL-18 was initially identified as a factor that strongly augmentedIFN-γ production by TH1 cells20,21. Later it was shown that IL-18 doesnot drive naïve cell development into TH1 cells5 but, rather, augmentsdevelopment that is induced by IL-12. Unexpectedly, together, IL-12and IL-18 were found to induce IFN-γ production independently ofTCR-signaling5, an induction that was resistant to inhibition by CsA6,9.IL-18 signaling activates NF-κB5,6,22 through interleukin 1receptor–associated kinase (IRAK) and tumor necrosis factor (TNF)receptor–associated factor 6 (TRAF6)5,23,24. It may also augment AP-1–dependent transcription25 and activate the p42 (also called ERK2)MAPK pathway26. NF-κB activation by IL-18 was expected because ofthe similarities between the IL-18 and IL-1 receptors and the estab-lished link between TRAF signaling and NF-κB23,27–29. However, westill lack a molecular basis to explain how IL-18 signaling activates theMAPK pathway or induces IFN-γ.

Because both the TCR and cytokines can induce IFN-γ transcription,it is possible that the profile of the IFN-γ promoter that has been assem-bled from reporter analysis may not place factors in their appropriatephysiological pathways. Indeed, the use of chemical activators in trans-formed cell lines may potentially bypass normal barriers to activation,inappropriately including certain transcription factors in responses thatdo not occur under physiological conditions. To address the question ofhow IL-18 signaling augments IFN-γ production, we used a system ofnontransformed, antigen-specific T cells that can be examined duringthe development of naïve cells into differentiated subsets30. We exclud-ed chemical activation by restricting activation to signaling through the

ARTICLES

157

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co

m© 2001 Nature Publishing Group http://immunol.nature.com

nature immunology • volume 2 no 2 • february 2001 • http://immunol.nature.com

ARTICLES

TCR or cytokine receptors and further evaluated pathways by retrovi-rally transducing expression of factors into naïve T cells.

We found that IL-18 signaling induces expression of a protein factor,GADD45β, that can bind MAPK–extracellular signal-regulated kinase(ERK) kinase 4 (MEKK4)31. GADD45β activated p38 MAPK in CD4+

T cells, which was required for cytokine-induced IFN-γ transcription.Further, we showed that p38 MAPK activation is a requirement forIFN-γ transcription only in the cytokine-induced pathway and thatTCR-induced IFN-γ transcription could occur without p38 MAPK acti-vation. This study identifies a signaling mechanism that links IL-18with p38 MAPK activation and IFN-γ expression. It also distinguishesbetween the different requirements for the p38 MAPK pathway inTCR-induced and cytokine-induced IFN-γ activation.

ResultsProtein synthesis and cytokine-induced IFN-γ productionIL-12– and IL-18–induced IFN-γ transcription requires new proteinsynthesis6. In addition, IFN-γ production by TH1 cells is significantlyprolonged by IL-12+IL-18, compared to TCR signaling or eithercytokine alone (Fig. 1a). Therefore, to more fully define this proteinsynthesis requirement, we analyzed IFN-γ transcription induced bycytokine signals delivered in a sequential order with and without block-ade of protein synthesis by cyclohexamide (CHX) (Fig. 1b). As con-trols, we showed that neither IL-12 nor IL-18 alone was sufficient toinduce IFN-γmRNA and that inhibition of protein synthesis induced byIL-12 + IL-18 inhibits IFN-γ transcription, as described6. We also foundthat the sequential delivery of cytokine signals could induce IFN-γ tran-scription, although in amounts that were somewhat reduced from thoseinduced by concurrent cytokine treatment.

This result shows that IL-12 and IL-18 need not be present simulta-neously to induce IFN-γ and provokes the question: which signal islargely responsible for inducing the synthesis of required protein fac-tors? We found that when IL-18 signaling was delivered first, and onlyIL-12–induced protein synthesis was blocked (Fig. 1b), IFN-γ mRNAwas induced in amounts that were similar to those induced by the con-trol without CHX. In contrast, when IL-12 signaling was deliveredfirst, and only IL-18–induced protein synthesis was blocked, IFN-γtranscription was significantly decreased relative to the control (com-pare lanes 8 and 9). These data suggest that IL-18 signaling is largelyresponsible for inducing the synthesis of a protein factor that is requiredfor cytokine-induced IFN-γ transcription in CD4+ T cells.

Identification of IL-12– and IL-18–induced factorsAs a screen for IL-12– and IL-18–induced factors, we hybridized high-density oligonucleotide arrays32,33 with cRNA prepared from untreatedor IL-12– and IL-18–treated TH1 cells derived from wild-type andSTAT1-deficient mice (Fig. 2). STAT1-deficient T cells were includedto restrict our search to genes that could be induced by IL-12 throughSTAT4. Genes that we expected would be induced, such as thoseencoding IFN-γ, TNF-β and granulocyte macrophage colony-stimulat-ing factor (GM-CSF), were identified in this screen, which provided aninternal positive control (data not shown). We also found that the twogenes that showed some of the highest induction were those encodingGADD45β and GADD45γ (Fig. 2). GADD45β, identified initially asMyD11834, and GADD45γ were recently described as related membersof a family of proteins that activate MAPK kinase kinases (MAPKKK),specifically MEKK431.

As measured by oligonucleotide-array hybridization, IL-12 + IL-18increased the expression of GADD45β and GADD45γ by 20- to 25-fold, whereas a third family member, GADD45α, was not induced(Fig. 2a). We next confirmed IL-12 + IL-18 induction of these genesusing quantitative reverse transcription–polymerase chain reaction (RT-PCR) and northern analysis (Fig. 2b,c). With RT-PCR, GADD45β wasinduced approximately 20-fold (Fig. 2b). Induction of transcriptionwas not blocked by CHX treatment, which suggests that cytokine treat-ment can directly activate GADD45β transcription without intermedi-ate protein synthesis. In fact, CXH treatment enhanced cytokine-induced GADD45β transcription. Superinduction caused by CHX hasbeen reported for NF-κB–dependent transcription of COX-2, whichacts by blockade of IκB synthesis 35. This suggested to us that perhapsIL-18 induces GADD45β through NF-κB. With northern analysis, wealso observed that IL-12 + IL-18 treatment strongly induces expressionof both GADD45β and GADD45γ, although induction was not seenwith IL-12 signaling alone (Fig. 2d). However, IL-18 treatment alonecould partially induce expression of GADD45β, but not GADD45γ,and IL-18–induced GADD45β expression was augmented several-foldby additional IL-12 signaling (Fig. 2d).

GADD45β selectively augments cytokine-induced IFN-γBecause IL-18–dependent protein synthesis was required for IFN-γ pro-duction and IL-18 could induce GADD45β expression, we wonderedwhether GADD45β could augment cytokine-induced IFN-γ. To test this,we expressed GADD45β in naïve primary CD4+ DO11.10 T cells by

158

Figure 1. IL-18–dependentprotein synthesis is requiredfor cytokine-induced IFN-γtranscription. (a) DO11.10 Tcells were activated under TH1conditions for 7 days and restimu-lated with OVA, IL-12 or IL-18.Supernatants were collected onthe indicated days and IFN-γ pro-duction determined by enzyme-linked immunosorbent assay(ELISA). (b) Naïve DO11.10 T cellswere activated under TH1 condi-tions for 7 days and collected toevaluate the requirement for pro-tein synthesis in IL-12 and IL-18induction of IFN-γ mRNA. RestingTH1 cells were stimulated with IL-12 (10 U/ml), IL-18 (10 ng/ml) and CHX (10 µg/ml) in a series of three treatments in which the order of stimulation was systematicallyexamined. Firstly (1o),TH1 cells were either left untreated (–) or were stimulated (+) with either IL-12 or IL-18 for 4 h. Secondly (2o), cells were washed to remove cytokineand were either left untreated (–) or were treated with CHX (+) for 30 min to inhibit subsequent protein synthesis. Finally (3o), cells were either left untreated (–) or werestimulated (+) with IL-12 and/or IL-18 for 4 h.Total RNA was extracted, electrophoresed, transferred to Zeta Probe membrane and hybridized with IFN-γ cDNA probe65.Ethidium bromide (EtBr) staining is shown to indicate equivalent sample loading.

0

500

1000

1500

2000

2500

3000

3500

0.5 1 2 3 4 6

IL-12–IL-18OVA

OVAIL-12–OVAIL-18–OVA

IFN

-γ (

ng/m

l)

Time (days)

a b

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co


ARTICLES


retroviral transfection and analyzed the effect on IFN-γ productioninduced either by cytokines or TCR signaling (Fig. 3). We used two vec-tors to express GADD45β: a green fluorescent protein (GFP)-taggedbicistronic retrovirus (GFP-RV), described previously36, and a new vec-tor that drives cDNA expression from the cytomegalovirus (CMV) pro-moter (CMVp-RV) (Fig. 3a). Naïve T cells were activated in theabsence of added IL-12 and IL-18 to prevent induction of endogenousGADD45, infected with GADD45β−expressing or control retrovirusesand purified by cell sorting.

We compared IL-12 + IL-18–induced and TCR-induced IFN-γ pro-duction in purified GADD45β-expressing or control T cells. T cellsinfected with GADD45β virus exhibited enhanced cytokine-inducedIFN-γ production compared to T cells infected with the empty retro-virus (Fig. 3b). Retroviral expression of GADD45β in T cells thatwere developing under nonpolarizing conditions caused augmentationof cytokine-induced IFN-γ production to a much greater extent thanTCR-induced IFN-γ production. Overexpression of GADD45β did notcause constitutive production of IFN-γ in the absence of IL-12 + IL-18

(data not shown). Both IL-12 and IL-18 were still required to induceIFN-γ secretion, which was augmented in T cells that were overex-pressing GADD45β. This effect was likely due to the fact that in thenonpolarizing conditions used (that is, in the absence of IL-12 andIFN-γ), expression of endogenous GADD45β is low and so accumula-tion of GADD45β protein is low. Thus, retroviral expression ofGADD45β in T cells under these conditions provides them with con-stitutive p38 activation, which allows greater and more rapid IFN-γproduction.

In separate experiments, a similar pattern of effects was seen whenGADD45β was expressed under the control of the CMV promoter ratherthan the retroviral long terminal repeat (LTR) (Fig. 3b). GADD45βexpression did not cause constitutive production of IFN-γ, which wasconsistent with the observed need for concurrent IL-12 signaling incytokine-driven IFN-γ transcription (Fig. 1b). Taken together, theseresults suggest that expression of GADD45β selectively augmentscytokine-induced IFN-γ production but does not significantly augmentTCR-induced IFN-γ production.

159

Figure 2. IL-12 + IL-18 induces expression of GADD45β and GADD45γmRNA in TH1 cells. (a) The comparison analysis algorithm was used to determineexpression within the probe sets of GADD45α, GADD45β, GADD45γ transcriptsin IL-12 + IL-18–treated (+) or untreated (–) TH1 cells from wild-type (DO11.10 TH1cells) or STAT1-deficient (STAT1–/–, DO11.10 TH1 cells). For details of derivation ofTH1 cells and comparison analysis see Methods. (b,c) TH1 cells from wild-typeDO11.10 T cells were untreated (No stimulation), treated with CHX for 30 minthen IL-12 + IL-18 for 2 h (CHX–IL-12–IL-18) or treated with IL-12 + IL-18 alonefor 2 h (IL-12–IL-18).Total RNA was extracted and expression of GADD45β mRNAwas analyzed by quantitative RT-PCR. Data are shown as the relative fluorescenceversus cycle number (b) and as relative fold induction (c) of samples normalized byβ-actin mRNA expression. (d) Northern analysis of GADD45β was carried out onTH1 cells that were either untreated (lane 1) or treated with IL-12 (lane 2), IL-18(lane 3) or both IL-12 + IL-18 (lane 4) for 2 h.Total RNA was extracted and north-ern analysis done with full-length cDNA probes fromGADD45β and GADD45γ,as above, and a GAPDHprobe as described55.

IL-12–IL-18

Fold induction of GADD45 mRNA

GADD45α

GADD45γ

GADD45β

+

+

+

-

-

-

0 5 10 15 20 25

DO11.10 TH1 cells

0 5 10 15 20 25 30

STAT1-/-, DO11.10 TH1 cells

a

1.73

0.270.40

0.60

0.80

1.00

1.20

1.40

1.60

2811 12 1314 15 16 1718 19 20 2122 2324 25 26 27

No st

imul

atio

n

IL-1

2–IL

-18

CHX–IL-

12–I

L-18

Rel

ativ

e flu

ores

cenc

e

Cycle

No stimulation

IL-12–IL-18

Fold induction of GADD45β mRNA

CHX–IL-12–IL-18

0 20 25010

b d

GADD45β-GFP-RV

GFP-RV 5'LTR 3'LTRIRES GFP

CMVp-GADD45β-RV pAGFP 3'LTRGADD45β5'LTR CMVp

GADD45β GFP 3'LTR5'LTR IRES

0 200 400 600 800 1000 1200

0 1000 2000 3000 4000 5000 6000

Stimulation

Anti-CD3

Infection

GADD45β-GFP-RV

GFP-RV

CMVp-GADD45β-RV

GADD45β-GFP-RV

GFP-RV

CMVp-GADD45β-RV

GFP-RV

GFP-RV

IFN-γ (ng/ml)

Anti-CD3

IL-12–IL-18

IL-12–IL-18

Anti-CD3

Anti-CD3

IL-12–IL-18

IL-12–IL-18

Figure 3. GADD45β selectively augments cytokine-induced, but not TCR-induced, IFN-γ. (a) GADD45β expression was achieved in two ways: either by using thestandard vector (GFP-RV), as in GADD45β-GFP-RV, or under control of the CMV pro-moter, as in CMVp-GADD45β-RV. (b) Retrovirally infected DO11.10 T cells were activat-ed in neutral conditions (in the presence of 3 µg/ml of anti–IL-12 and 10 µg/ml of anti–IL-4) and infected on day 2 with the indicated retroviruses.T cells were purified by cell sort-ing for expression of GFP and murine CD4 on day 7, stimulated with OVA-conjugated anti-gen presenting cells and expanded. Resting T cells were later activated with IL-12 + IL-18or by plate-bound anti-CD3 for cells expressing either empty vector or GADD45β undercontrol of the retroviral LTR (upper panel) or by the CMV promoter (lower panel) andIFN-γ measured by ELISA at 24 h. Nonstimulated T cells that were not treated with anti-CD3 or IL-12 + IL-18 produced undetectable amounts of IFN-γ (not shown).

a b

c

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co



ARTICLES

GADD45β activated MEKK4, an upstream activator of the p38MAPK pathway31. To test whether GADD45β actually affected p38MAPK activity in T cells, we prepared whole cell extracts from puri-fied resting T cells that had been infected with empty retrovirus orGADD45β-expressing retrovirus and performed immunoblotting(western blotting) analysis with an antibody to phosphorylated p38MAPK (Fig. 4). GADD45β significantly increased phosphorylated p38MAPK compared to the control (Fig. 4a), whereas total p38 contentwas unchanged, which indicated a selective increase in activated p38 byGADD45β. Similarly, we found that treatment of resting TH1 cells withIL-12 + IL-18 led to activation of p38 MAPK as measured by specificphosphorylation (Fig. 4b). Phosphorylated p38 was detected after 2 hof treatment with IL-12 + IL-18 and could be sustained to 24 h of treat-ment, consistent with prolonged cytokine-induced IFN-γ productiondescribed above and previously6. Thus, both IL-12 and IL-18 signalingand GADD45β expression augment activation of p38 MAPK.

MEKK4 and IFN-γ productionGADD45 interacts with the region of MEKK4 between amino acids147 and 25031. To test whether this interaction is required for cytokine-induced IFN-γ transcription, we generated two mutants of MEKK4 thatretain this GADD45β-interacting region but lack a downstream kinasedomain (Fig. 5a). MEKK4∆N1 and MEKK4∆N2 were expressed by

retrovirus in primary CD4+ DO11.10 T cells, which were then driven toTH1 development, and effects on cytokine-induced and TCR-inducedIFN-γ production were examined (Fig. 5b). Both MEKK4∆N1 andMEKK4∆N2 inhibited cytokine-induced IFN-γ production by compar-ison to the empty retroviral controls. This inhibition was selectivebecause expression of these mutants did not inhibit TCR-induced IFN-γ production. These results suggest that preventing the GADD45-med-itated activation of native MEKK4 selectively inhibits cytokine-induced IFN-γ. In addition, the MEKK4-p38 pathway may not berequired for TCR-induced IFN-γ production because these mutantscaused no reduction in TCR-induced IFN-γ.

We confirmed these results in another system of IL-18–induced IFN-γ production (Fig. 5c). To isolate IL-18–induced responses from STATsignaling, we took advantage of the observation that IFN-γ productioncan be induced by suboptimal CD3 stimulation in the presence of IL-1837. In this system, CD3-induced IFN-γproduction is increased approx-imately fourfold by addition of IL-18 signaling (Fig. 5c). As expected,the empty retrovirus control did not inhibit IL-18–induced IFN-γ pro-duction in this system. Next we examined both MEKK4 mutants in thissystem. Consistently, both MEKK4∆N1 and MEKK4∆N2 inhibited theIL-18–induced component of IFN-γ production (Fig. 5c).

Because CHX caused superinduction of GADD45β (Fig. 2b), wewondered whether IL-18 signaling might induce GADD45β through

160

Figure 5. Dominant-negative MEKK4 selectively inhibits cytokine-induced, but not TCR-induced, IFN-γ. (a) MEKK4∆ N1-RV and MEKK4∆N2-RV express a mutant MEKK4 that lacks the active kinase domain but retainsthe GADD45β-binding domain. IκB∆N-RV expresses an IκB that lacks aminoacids 1–36 so that Ser32 and Ser36, which are required for inducible IκB degrada-tion, are deleted, which prevents NF-κB activation. (b) Naïve DO11.10 T cellsactivated in TH1 conditions were infected on day 2 with empty retrovirus (GFP-RV) or retrovirus expressing MEKK4∆ N1 (MEKK4∆ N1-RV) or MEKK4∆ N2(MEKK4∆ N2-RV) and purified by cell sorting on day 7 for GFP and murine CD4expression.At 2 weeks, cells were stimulated with either plate-bound anti-CD3(2 µg/ml) or with IL-12 (10 U/ml) + IL18 (1 ng/ml) for 24 h. IFN-γ production wasmeasured by ELISA. (c) Cells infected with the empty retrovirus control,MEKK4∆ N1-RV, MEKK4∆ N2-RV or IκBα-RV (as in b) were stimulated withanti-CD3 (0.5 µg/ml) in the presence (+) or absence (–) of IL-18 (1 ng/ml) for 24h. IFN-γ production was measured by ELISA.

GFP-RV

MEKK4∆ N1-RV

MEKK4∆ N2-RV

MEKK4

GADD45β-binding domain

Kinase domain

IkBα aa37-317IkB∆ N-RV

MEKK4 aa1-329

5'LTR 3'LTRIRES GFP

∆ N insert

MEKK4 aa1-645

IkBα

Ser32-Ser36

0 200 400 6000 10 20 30 40 50

Anti-CD3 IL-12–IL-18

IFN-γ (ng/ml)

GFP-RV

MEKK4∆ N2-RV

MEKK4∆ N1-RV

IL-18IFN-γ (ng/ml)

GFP-RV

MEKK4∆ N1-RV

MEKK4∆ N2-RV

0 500 1000 1500 2000

IkB∆ N-RV

+-

+-

+-

+-

a b

c

Figure 4. GADD45β induces constitutive p38 MAPK phosphorylation inCD4+T cells. (a) T cells infected with the empty retrovirus (lane 1) or GADD45β-expressing retrovirus (lane 2) were purified by cell sorting.Whole cell extracts wereprepared from resting cells and were analyzed for phoshpo-p38 and p38 expressionby immunoblotting (see Methods). (b) DO11.10 TH1 cells were collected on day 7after primary stimulation. Resting cells were either left untreated (lane 1)or stimu-lated with IL-12 + IL-18 for: lane 2, 2 h; lane 3, 4 h; lane 4, 8 h; and lane 5, 24 h.Wholecell extracts were prepared and analyzed by immunoblotting for phospho-p38 andp38 activity as described (see Methods).

a b

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co


ARTICLES


NF-κB, as seen with COX-2 transcription35. Thus, we expressed a dom-inant-negative IκB mutant to block NF-κB–dependent transcriptionand measured the effect on IL-18–induced IFN-γ (Fig. 5c). We used adominant-negative IκB mutant IκB ∆N, which lacks amino acids 1–36that are required for inducible IκB degradation and prevents induciblerelease of active NF-κB38. Expression of IκB ∆N significantly inhibit-ed IL-18–induced IFN-γ production but did not alter the amount ofTCR-induced background IFN-γ (Fig. 5c). Together, these results areconsistent with IL-18 induction of GADD45β by NF-κB and a require-ment for GADD45 interaction with MEKK4 in the downstream induc-tion of IFN-γ.

p38 MAPK activation and IFN-γ productionIFN-γ production involves p38 MAPK18,19,39,40 but whether p38 is selec-tively involved in either TCR-induced or cytokine-induced pathwaysfor IFN-γ has not been examined. To test this, we compared TCR- andcytokine-stimulated IFN-γ production for sensitivity to a series ofselective pharmacological inhibitors (Fig. 6). As expected, CsA fullyinhibited anti-CD3–induced, but not IL-12 + IL-18–induced, IFN-γproduction (Fig. 6a), consistent with previous results6. In contrast, aselective p38 MAPK inhibitor, SB203580, fully inhibited IL-12 + IL-18–induced IFN-γ production but did not inhibit anti-CD3–inducedIFN-γ production. As negative controls, vehicle and Tyrophostin A1inhibited neither anti-CD3–induced nor IL-12 + IL-18–induced IFN-γproduction. Further, this selective inhibition was dose-dependent ineach case and occurred in the range of concentration appropriate foreach inhibitor (Fig. 6b). These results directly indicate that p38 MAPKactivity is required only for cytokine-induced, but not TCR-induced,IFN-γ production.

DiscussionAt least two physiological stimuli can induce transcription of the geneencoding IFN-γ: signaling through the TCR and signaling induced bycertain cytokines, IL-12 and IL-18 in particular. Numerous transcrip-tion factors may regulate transcription of the gene encoding IFN-γincluding NFAT8,15,41, NF-κB16,42, cRel14, AP-17,25,43, CREB7, GATA-312,ATF-1 and ATF27, T-bet44, YY-145 and STAT410,46,47. In addition, MAPKpathways, including the p38 MAPK pathway18, can regulate IFN-γ pro-duction either directly or indirectly39,40. However, for most of these fac-tors, it is unclear whether they participate in the TCR, the cytokine orboth pathways for inducible IFN-γ expression.

IL-18 is an important activator of IFN-γ production, although its pre-

cise mechanism is not completely understood5,20,21,48,49. One notablestudy showed that IL-18, unlike IL-12, did not induce TH1 developmentbut rather augmented the effects of IL-125. Unexpectedly, combined IL-12 and IL-18 signaling induced IFN-γ production by a newly identifiedpathway that is TCR-independent. This synergy between IL-12 and IL-18 has been difficult to explain. Some reports have suggested that syn-ergy results from induction of IL-18 receptors by IL-1250 but otherssuggest that it results from induction of IL-12 receptors by IL-1851.However, TH1 cells that functionally express both IL-12 and IL-18receptors still require combined IL-12 and IL-18 signaling for induc-tion of IFN-γ6. This suggests that synergy is not simply due to receptorinduction but involves interactions in pathways that are downstream ofboth receptors that directly regulate IFN-γ transcription.

This study proposes one mechanism to link IL-18 signaling withregulation of the gene encoding IFN-γ and provides a basis for syn-ergy between IL-12 and IL-18 (Fig. 7). One feature of cytokine-induced IFN-γ production is its relatively prolonged duration com-pared to TCR-induced IFN-γ. We show that together IL-12 and IL-18strongly induce expression of GADD45β, an activator of MEKK4,which leads to p38 MAPK activation, previously linked to IFN-γproduction18. We have not identified the specific transcription factorsdownstream of p38 MAPK that regulate IFN-γ but we show that acti-vation of this pathway by GADD45β strongly augments cytokine-induced, but not TCR-induced, IFN-γ production.

Expression of GADD45β activated p38 MAPK but did not induceconstitutive IFN-γ production. This indicates that transcription factor(s)that are activated by p38 MAPK alone are not sufficient to induce IFN-γ transcription but require interactions with additional cytokine-activat-ed factors such as STAT4, and perhaps NF-κB, consistent with theobserved synergy between IL-12 and IL-18. This situation is similar tothe effects reported for T-bet44, where T-bet overexpression did notcause constitutive IFN-γ production but augmented IFN-γ productionafter T cell activation with phorbol 12-myristate 13-acetate (PMA) andionomycin. Similarly, we found that GADD45β overexpression selec-tively augmented cytokine-induced IFN-γ production but did notinduce constitutive production. Other reports have suggested that eitherIL-12 or TCR signaling alone can activate p38 MAPK52,53. However,IL-12–induced p38 MAPK activation, analyzed by ATF2 phosphoryla-tion in vitro, was very transient, peaking at 10 min and absent by 30min after IL-12 treatment52. Likewise, TCR-induced p38 activationpeaked at 20 min and was largely diminished by 2 h. In contrast, wehave shown that IL-12 + IL-18–induced p38 MAPK activation in T

161

Figure 6. Selective requirement of p38 MAPK for cytokine-induced, but not TCR-induced, IFN-γ production. (a) TH1 cells were incubated with the indicated inhibitor for30 min and transferred to either monoclonal anti-CD3–coated plates or plates containing IL-12 + IL-18, each containing the indicated inhibitors.All plates were centrifuged briefly to pro-mote cell contact with anti-CD3–coated surfaces. Cells were stimulated for 8 h only to min-imize the possibility that differences in cytokine production could result from differences inproliferation. After 8 h, supernatants were collected and IFN-γ determined by ELISA. (b)Resting TH1 cells were incubated with the indicated concentrations of SB 203580 or CsA for30 min and stimulated with anti-CD3 or IL-12 + IL-18 for 8 h as described above.

Tyrphostin A1

DMSO

SB 203580

IFN-γ (ng/ml)

Anti-CD3IL-12–IL-18

Cyclosporin A

0 500 1000 1500 2000 0 200 400 600 800

SB 203580(µM)

0

20

40

60

80

100

120

140

0

50

100

150

200

250

300

Cyclosporin A (ng/ml)

IL-12–IL-18

Anti-CD3

0

50

100

150

200

250

0

50

100

150

200

250

300

IFN

-γ (

ng/m

l)

IL-12–IL-18

Anti-CD3

0.16

0.08

0.32

0.63

10.0

1.25

2.50

5.00

0.02

0.04

100

6.25

12.5

25.0

50.0

3.13

a b

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co



ARTICLES

cells can be sustained for significantly longer times. Likewise,GADD45β expression led to constitutive p38 phosphorylation even inresting T cells. The fact that these distinct signals may independentlyconverge on p38 activation, although each with a different kinetic pat-tern, means that it will be important, although difficult, to analyze theirseparate kinetic profiles. Mice made selectively deficient in GADD45βand GADD45γ could be of great use in pursuing this aim as well as foranalysis of the in vivo roles of these pathways. We propose thatGADD45β expression, induced by IL-12 and IL-18 together, is respon-sible for sustaining p38 activation and prolonging the duration of IFN-γ production. We identified GADD45β in a screen of genes that can beinduced by IL-12 and IL-18 together. GADD45β induction was notblocked by CHX treatment, which implies that latent transcription fac-tors activated by IL-12 and IL-18 directly regulate GADD45β expres-sion. Because GADD45β induction also occurred in STAT1-deficientcells, IL-12 may be able to use STAT4 to augment its expression. Inaddition, it is possible that IL-18 uses NF-κB to induce GADD45βbecause a dominant-negative NF-κB blocked IL-18–induced IFN-γproduction. Also, GADD45β was superinduced by CHX, in a mannersimilar to CHX superinduction of NF-κB–dependent COX-2 expres-sion35, as a result of prevention of IκB regeneration.

A study of GADD45 proteins found that each member activatedMEKK431. Because GADD45α was not induced in T cells, we did notevaluate its activity in overexpression studies. GADD45γ inductionrequired combined IL-12 and IL-18 signaling, which suggests that itwas not the IL-18 signaling–induced factor that is required for IFN-γtranscription. GADD45γ overexpression did not augment cytokine-induced IFN-γ production as strongly as GADD45β did (data notshown). Murine GADD45β and GADD45γ share a 52% amino acididentity overall and the region between residues 42 and 95 shows a 72%identity. Residues 24–147 of GADD45γ conferred MEKK4 binding, asassessed by yeast two hybrid analysis31, which implies that the centralregion of GADD45 may mediate MEKK4 binding. The greatestsequence divergence is in the first 40 amino acids, in which there isonly 37% identity. Thus, it is possible that GADD45β and GADD45γ

do not exert identical effects in all cell types. For example, a proapop-totic effect for GADD45 overexpression in HeLa cells has beendescribed31. However, we did not observe discernable proapoptoticeffects in this study of GADD45β expression in CD4+ T cells. Indeed,we were able to derive purified CD4+ T cell lines with stable GADD45βexpression and constitutive activation of p38 MAPK. It is worth notingthat p38 MAPK activation produces an apoptotic effect in CD8+ T cellsbut not CD4+ T cells54. This is consistent with our finding thatGADD45β expression activated p38 MAPK but did not prevent growthof CD4+ T cell lines.

The in vivo physiological role of cytokine-induced IFN-γ is cur-rently unclear. IL-12 and IL-18 receptors are not expressed by naïveCD4+ T cells but are selectively induced during TH1, but not TH2,development50,55,56. This allows TH1 cells to produce IFN-γ inresponse to cytokines as well as antigens and confers a sort of innate-immune system status. This pathway might participate in hostresponses to pathogens to ensure rapid responses to inflammatorystimuli even before adequate antigen is released during infection. Italso may be involved in bystander tissue injury in autoimmune dis-eases. For example, discrete stages of disease development in atransgenic model of diabetes have been defined57. Progression fromperi-insulitis to islet destruction and diabetes occurred by stepwiseactivation of IL-12, IL-18 and TNF-α, produced by cells within theislet, followed 1 day later by induction of IL-1β, IL-6 and IFN-γ57.Possibly, IL-18 and IL-12 produced by cells within the islet inducesIFN-γ production by TH1 cells in the peri-islet region by thisbystander pathway we examined here. This cytokine-induced path-way for IFN-γ production is blocked only by p38 MAPK inhibitorsand not by CsA, which implies that distinct targets need to be con-sidered for IFN-γ inhibition of induced by differing physiologicalstimuli. Because this study is the first to show participation ofGADD45 proteins in cytokine signaling and IFN-γ production, thesenow may be potential therapeutic targets for manipulating TH1-medi-ated immune responses.

MethodsReagents and antibodies. DO11.10 αβ TCR transgenic mice on wild-type and STAT1-deficient backgrounds were as described58. CsA and CHX were from Sigma (St. Louis,MO); SB203580 and Tyrophostin A1 were from Calbiochem (San Diego, CA); recombinant(r) human IL-2 was provided by Takeda (Osaka, Japan); murine rIL-12 was from GeneticsInstitute (Cambridge, MA); murine rIFN-γ was from Genentech (San Francisco, CA); andmurine rIL-18 was from Research Diagnostics, Inc. (Flanders, NJ). Murine rIL-4,anti–mIFN-γ (H22, provided by R. D. Schreiber), monoclonal anti–IL-4 (11B11)59, anti–IL-12 (Tosh)60 and anti-CD3 (500A2, provided by J. Allison, Berkeley CA) were as described58.

Cell culture. Splenic T cells from DO11.10 TCR-transgenic mice were purified on a den-sity gradient Histopaque-1119 (Sigma) and activated by chick ovalbumin peptide (aminoacids 323 through 339), referred to as OVA, at 3×106 cells/ml in IDME media. IL-12 (10U/ml) and anti–IL-4 (11B11, 10 µg/ml) were added for TH1 development. T cell lines werepassed at 2.5×105 cell/ml on a weekly basis by activation by OVA (0.3 µM) and irradiatedBALB/c splenocytes (2000 rad, 5×106 cells/ml). For anti-CD3 stimulation, anti-CD3(500A2, 5 µg/ml) in PBS was coated onto plates overnight at 4 °C or for 4 h at 37 °C,washed twice and T cells applied (2×106 cells/ml) with or without cytokines, as indicated.For the experiment in Fig. 6a, Tyrophostin A1 was used at 5 µΜ, CsA at 100 ng/ml andSB203580 at 5 µΜ.

Northern analysis and quantitative RT-PCR. Total RNA was isolated by Trizol reagent(Life Technologies, Grand Island, NY). RNA (10 µg/lane) was separated by electrophore-sis and transferred to Zeta Probe membrane (BioRAD, Richmond, CA) and hybridized asdescribed55. Real time LightCycler PCR was as described61,62. Double-strand DNA–specificdye SYBR Green I (Molecular Probes, Eugene, OR) was used to quantify the PCR reaction.Fluorescence was measured after the completion of each extension of PCR at: 82 °C forIFN-γ; 88 °C for GADD45β; and 87 °C for β-actin. These temperatures were determined byexamination of individual melting curves for each reaction to optimize specific signal ofproduct in relation to background from primer and primer dimers. The quantity of eachcDNA was normalized by β-actin. The log fluorescence of each sample at a particular PCRcycle is shown at the end of each PCR cycle. The following PCR primers were used for

162

Figure 7. Model of IL-18 and IL-12 signaling for induction of IFN-γ. (DN,dominant-negative MEKK4 mutant lacking the kinase domain. MKK3-6, MKK3 andMKK6.)

IFN-γ

STAT4

NF-κB

24 147

GADD45β

Kinase domain

MEKK4147 250 1342 1607

* New protein synthesis

MKK3-6

p38

ATF2, Elf-1, MEF2C, SAP-1

SB 203580

Kinase deletedDN MEKK4

147 250 645

IL-12 IL-18

STAT4

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co


ARTICLES


amplification: IFN-γ sense; 5′–TGGAGGAACTGGCAAAAGGATGGT–3′; IFN-γ anti-sense, 5′–TTATTCTTATTGGGACAATCTCTT; GADD45β sense , 5′–GCGGTTCAGAA-GATGCAGGC; GADD45β antisense , 5′–GGTTGTGCCCAATGTCTCCG; β-actin sense,5′–TGGAATCCTGTGGCATCCATGAAAC; β-actin antisense, 5′–TAAAACGCAGCTCAGTAACAGTCCG.

Oligonucleotide array gene expression analysis. Resting or STAT1-deficient TH1 cellswere left untreated or treated with IL-12 + IL-18 for 2 h. Total RNA was extracted usingTrizol and mRNA purified using the Oligotex mRNA Midi Kit (Qiagen, Valencia, CA). Wefirst confirmed the quality of RNA and the polarization of TH1 cells using northern analysisfor IFN-γ and IL-4. We then synthesized double-strand cDNA from mRNA using theSuperScript Choice System (Life Technologies) primed with the T7-(dT)24 primer. We con-firmed the quality of cDNA using 32P-dCTP to trace cDNA synthesis and also by measuringIFN-γand β-actin cDNA with LightCycler PCR. This cDNA was then used to prepare biotin-labeled cRNA and in vitro transcription reaction carried out according to the manufacturer’sprotocol with the T7 primer. These cRNAs were hybridized to Affymetrix MU6500 oligonu-cleotide arrays63. Comparisons were made between IL-12 + IL-18–treated and untreated sam-ples for both wild-type and STAT1-deficient cells. We analyzed the data using Gene Chip™Comparison Analysis Algorithm (Affymetrix GeneChip™ Software, Santa Clara, CA) todetermine the relative fold induction of transcripts for each probe set in IL-12 + IL-18–treat-ed samples over untreated samples32,33 (where the untreated sample probe hybridization wasdefined as the baseline and the IL-12 + IL-18–treated sample hybridization was defined asthe experimental data). We restricted further analysis to only those transcripts induced by IL-12 + IL-18 treatment in both the wild-type and in STAT1-deficient cells to enrich our searchfor genes sensitive to STAT4 rather than only STAT1 activation.

Cloning, constructs, and generation of retroviral expression vectors. Full-length murinecDNA for GADD45β and GADD45γ were generated by RT-PCR with Vent polymeraseusing the following primers: BglII-MyD118-S: 5′–CTGAGATCTCTGTGGAGTGTGACT-GCATC–3′; XhoI-MyD118-AS: 5′–GATCTCGAGTGTTTGGAGTGGGTCTCAGC–3′.GADD45γ-BglII 5′–ATGAGATCTTAACTTGCTGTTCGTGGATCGC–3′; and GADD45γ-XhoI 5′–AGTCTCGAGTCCCTGCCAGGCTGTCACTC–3′. After reverse transcriptionand amplification (22 cycles) from activated TH1 cDNA, PCR products were isolated anddigested with BglII and XhoI and ligated into the BglII-XhoI–digested retroviral vectorGFP-RV36. GADD45β and GADD45γ were confirmed by DNA sequencing. We also placedGADD45β into a second, newly created, retroviral vector GFP-pA-CMV-RV. To make thisvector, the IRES was first removed from GFP-RV36 by BglII-NcoI digestion, followed byblunting with Vent polymerase and self-religation to create the intermediate GFP-only-RV.Next, a PCR product containing the polyadenylation signal from a gene encoding murineMHC Class I H2-Kb was generated by PCR with a plasmid H2-Kb template and the oligonu-cleotides pA-BamHI: 5′–TCAGGATCCGATTGAGAATGCTTAGAGGT–3′ and pA-EcoRI: 3′–CTAGAATTCCTGTTCACACTCAGCTGC–5′. The PCR product was isolated,digested with BamHI and EcoRI and ligated into BamHI-EcoRI–digested GFP-only-RVplasmid to produce GFP-pA-RV. Next, a Vent polymerase-blunted BglII fragment of theCMV promoter, isolated from CMV-Luc64, was cloned into the Vent-polymerase-bluntedClaI site of GFP-pA-RV to produce the final expression vector GFP-pA-CMV-RV. To insertGADD45β, the BglII-XhoI–digested GADD45-β cDNA obtained from GADD45β-GFP-RV was blunted by Vent polymerase and ligated into the Vent-blunted SalI-HindIII sites ofGFP-pA-CMV-RV to generate CMVp-GADD45β-RV. PCR analysis and restriction map-ping confirmed orientation of the cDNA. Retroviral transfections were as described58,65. Onday 7 after primary activation, retrovirally infected cells were purified by cell sorting byexpression of GFP and murine CD4.

We generated two dominant-negative MEKK4 mutants for expression by retrovirus,MEKK4∆ N1 and MEKK4∆ N2. Using a full-length MEKK4 cDNA (MEKK4α.dn3) kind-ly supplied by G. Johnson (Denver, CO) as a template, Vent polymerase was used to gener-ate blunt ended PCR products using the oligonucleotide MEKK-95 (5′–GCGGTCA-TGCGAAGCTTGGTGC–3′) with either MEKK4-AS-1109 (5′–TCAGCCCACACG-GTTTGTCTCC–3′) with MEKK-AS-2057 (5′–TCACTCTCGCACTAGCTGTTTGAT-AC–3′) that encode mutant proteins containing amino acid residues 1–329 or 1–645, eachlacking the MEKK4 kinase domain. PCR products were treated with kinase and cloned intothe Vent-polymerase blunted BglII site of GFP-RV. Constructs were confirmed by sequenc-ing. We also expressed the IκB dominant-negative mutant, which lacks amino acid residues1–36 (IkB∆N)38, in GFP-RV (a gift of W. C. Sha, Berkeley, CA).

Immunoblotting. Whole cell extracts were prepared from T cells (2×107) and stimulated bycollection in cold PBS followed by lysis with 100 µl of SDS sample buffer (62.5 mM Tris-HCl, pH 6.8, 2% SDS, 10% glycerol, 50 mM DTT and 0.1% bromophenol blue).Supernatants were heated to 95 °C, centrifuged at 14,000 rpm for 5 min, resolved by SDS-PAGE and transferred to nitrocellulose. Membranes were probed with rabbit polyclonalanti–phospho-p38 MAPK (1:1000 dilution, New England Biolabs, MA) or rabbit polyclon-al anti–p38 MAPK (1:400 dilution) (Santa Cruz Biotechnology, Santa Cruz, CA) and devel-oped using an rabbit HRP-conjugated antibody and ECL™ chemiluminescence reagents(Amersham Life Science, Little Chalfont), as described66.

Acknowledgements

We thank J. D. Farrar for careful reading of the manuscript. Supported by grants from theNIH.

Received 13 September 2000; accepted 13 December 2000.

1. Bach, E. A.,Aguet, M & Schreiber, R. D.The IFNγ receptor: a paradigm for cytokine receptor signal-ing. Ann. Rev. Immunol. 15, 563–591 (1997).

2. Manetti, R. et al. Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1(Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells. J. Exp. Med.177, 1199–1204 (1993).

3. Mosmann,T. R., Cherwinski, H., Bond, M.W., Giedlin, M.A. & Coffman, R. L.Two types of murinehelper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins.J. Immunol. 136, 2348–2357 (1986).

4. Seder, R. A. & Paul,W. E.Acquisition of lymphokine-producing phenotype by CD4+ T cells. Ann. Rev.Immunol. 12, 635–673 (1994).

5. Robinson, D. et al. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-γproduction and activates IRAK and NFκB. Immunity 7, 571–581 (1997).

6. Yang, J., Murphy,T. L., Ouyang,W. & Murphy, K. M. Induction of interferon-γ production in Th1 CD4+ Tcells: evidence for two distinct pathways for promoter activation. Eur. J. Immunol. 29, 548–555 (1999).

7. Penix, L.A. et al.The proximal regulatory element of the interferon-γ promoter mediates selectiveexpression in T cells. J. Biol. Chem. 271, 31964–31972 (1996).

8. Sweetser, M.T. et al.The roles of nuclear factor of activated T cells and ying-yang 1 in activation-induced expression of the interferon-γ promoter in T cells. J. Biol. Chem. 273, 34775–34783 (1998).

9. Yoshimoto,T. et al. IL-12 up-regulates IL-18 receptor expression on T cells,Th1 cells & B cells: syner-gism with IL-18 for IFN-γ production. J. Immunol. 161, 3400–3407 (1998).

10. Jacobson, N. G. et al. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phos-phorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181,1755–1762 (1995).

11. Murphy, K. M. et al. Signaling and transcription in T helper development. Ann. Rev. Immunol. 18,451–494 (2000).

12. Penix, L.,Weaver,W. M., Pang,Y.,Young, H. A. & Wilson, C. B.Two essential regulatory elements in thehuman interferon γ promoter confer activation specific expression in T cells. J. Exp. Med. 178,1483–1496 (1993).

13. Aune,T. M., Penix, L.A., Rincon, M. R. & Flavell, R.A. Differential transcription directed by discrete γinterferon promoter elements in naive and memory (effector) CD4 T cells and CD8 T cells. Mol. CellBiol. 17, 199–208 (1997).

14. Sica,A. et al.The c-rel protooncogene product c-Rel but not NF-κ B binds to the intronic region ofthe human interferon-γ gene at a site related to an interferon-stimulable response element. Proc.Natl Acad. Sci. USA 89, 1740–1744 (1992).

15. Campbell, P. M., Pimm, J., Ramassar,V. & Halloran, P. F. Identification of a calcium-inducible,cyclosporine sensitive element in the IFN-γ promoter that is a potential NFAT binding site.Transplantation 61, 933–939 (1996).

16. Sica,A. et al. Interaction of NF-κB and NFAT with the interferon-γ promoter. J. Biol. Chem. 272,30412–30420 (1997).

17. Xu, X., Sun,Y. L. & Hoey,T. Cooperative DNA binding and sequence-selective recognition conferredby the STAT amino-terminal domain. Science 273, 794–797 (1996).

18. Rincon, M. et al. Interferon-γ expression by Th1 effector T cells mediated by the p38 MAP kinase sig-naling pathway. EMBO J. 17, 2817–2829 (1998).

19. Lu, H.T. et al. Defective IL-12 production in mitogen–activated protein (MAP) kinase kinase 3(Mkk3)-deficient mice. EMBO J. 18, 1845–1857 (1999).

20. Okamura, H. et al.A novel costimulatory factor for γ interferon induction found in the livers of micecauses endotoxic shock. Infect. Immunol. 63, 3966–3972 (1995).

21. Okamura, H. et al. Cloning of a new cytokine that induces IFN-γ production by T cells. Nature 378,88–91 (1995).

22. Matsumoto, S. et al. Interleukin-18 activates NF-κB in murine T helper type 1 cells. Biochem. Biophys.Res. Commun. 234, 454–457 (1997).

23. Wesche, H., Henzel,W. J., Shillinglaw,W., Li, S. & Cao, Z. MyD88: an adapter that recruits IRAK to theIL-1 receptor complex. Immunity 7, 837–847 (1997).

24. Kojima, H. et al. Interleukin-18 activates the IRAK-TRAF6 pathway in mouse EL-4 cells. Biochem.Biophys. Res. Commun. 244, 183–186 (1998).

25. Barbulescu, K. et al. IL-12 and IL-18 differentially regulate the transcriptional activity of the humanIFN-γ promoter in primary CD4+ T lymphocytes. J. Immunol. 160, 3642–3647 (1998).

26. Tsuji-Takayama, K. et al. Interleukin-18 induces activation and association of p56(lck) and MAPK in amurine TH1 clone. Biochem. Biophys. Res. Commun. 237, 126-130 (1997).

27. Cao, Z., Henzel,W. J. & Gao, X. IRAK: a kinase associated with the interleukin-1 receptor. Science271, 1128–1131 (1996).

28. Cao, Z., Xiong, J.,Takeuchi, M., Kurama,T. & Goeddel, D.V.TRAF6 is a signal transducer for inter-leukin-1. Nature 383, 443–446 (1996).

29. Huang, J., Gao, X., Li, S. & Cao, Z. Recruitment of IRAK to the interleukin 1 receptor complexrequires interleukin 1 receptor accessory protein. Proc. Natl Acad. Sci. USA 94, 12829–12832 (1997).

30. Hsieh, C. S. et al. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-inducedmacrophages. Science 260, 547–549 (1993).

31. Takekawa, M. & Saito, H.A family of stress-inducible GADD45-like proteins mediate activation of thestress-responsive MTK1/MEKK4 MAPKKK. Cell 95, 521–530 (1998).

32. Lockhart, D. J. et al. Expression monitoring by hybridization to high-density oligonucleotide arrays.Nature Biotechnol. 14, 1675–1680 (1996).

33. Wodicka, L., Dong, H., Mittmann, M., Ho, M. H. & Lockhart, D. J. Genome-wide expression monitoringin Saccharomyces cerevisiae. Nature Biotechnol. 15, 1359–1367 (1997).

34. Vairapandi, M., Balliet,A. G., Fornace,A. J. Jr, Hoffman, B. & Liebermann, D.A.The differentiation pri-mary response gene MyD118, related to GADD45, encodes for a nuclear protein which interactswith PCNA and p21WAF1/CIP1. Oncogene 12, 2579–2594 (1996).

35. Newton, R. et al. Superinduction of COX-2 mRNA by cycloheximide and interleukin-1β involvesincreased transcription and correlates with increased NF-κB and JNK activation. FEBS Lett. 418,135–138 (1997).

36. Ranganath, S. et al. GATA-3-dependent enhancer activity in IL-4 gene regulation. J. Immunol. 161,3822–3826 (1998).

37. Tsuji-Takayama, K. et al. Interleukin-18 induces interferon-γ production through NF-κB and NFATactivation in murine T helper type 1 cells. Cell. Immunol. 196, 41–50 (1999).

38. Ten, R. M., McKinstry, M. J.,Trushin, S.A.,Asin, S. & Paya, C.V.The signal transduction pathway ofCD23 (Fc epsilon RIIb) targets I κ B kinase. J. Immunol. 163, 3851–3857 (1999).

39. Yang, D. D. et al. Differentiation of CD4+ T cells to Th1 cells requires MAP kinase JNK2. Immunity 9,575–585 (1998).

40. Dong, C. et al. Defective T cell differentiation in the absence of Jnk1. Science 282, 2092–2095 (1998).41. Rincon, M. & Flavell, R.A.Transcription mediated by NFAT is highly inducible in effector CD4+ T

163

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co



ARTICLES

helper 2 (Th2) cells but not in Th1 cells. Mol. Cell Biol. 17, 1522–1534 (1997).42. Ciccarone,V. C., Chrivia, J., Hardy, K. J. & Young, H.A. Identification of enhancer-like elements in

human IFN-γ genomic DNA. J. Immunol. 144, 725–730 (1990).43. Barbulescu, K., Meyer, zum Buschenfelde K. H. & Neurath, M. F. Constitutive and inducible

protein/DNA interactions of the interferon-γ promoter in vivo in CD45RA and CD45R0 T helpersubsets Eur. J. Immunol. 27, 1098–1107 (1997). [Erratum in Eur. J. Immunol. 27,1830 (1997).]

44. Szabo, S. J. et al.A novel transcription factor,T-bet, directs Th1 lineage commitment. Cell 100,655–669 (2000).

45. Ye, J., Cippitelli, M., Dorman, L., Ortaldo, J. R. & Young, H.A.The nuclear factor YY1 suppresses thehuman γ interferon promoter through two mechanisms: inhibition of AP1 binding and activation of asilencer element. Mol. Cell Biol. 16, 4744–4753 (1996).

46. Thierfelder,W. E. et al. Requirement for Stat4 in interleukin-12-mediated responses of natural killerand T cells. Nature 382, 171–174 (1996).

47. Kaplan, M. H., Sun,Y. L., Hoey,T. & Grusby, M. J. Impaired IL-12 responses and enhanced developmentof Th2 cells in Stat4-deficient mice. Nature 382, 174–177 (1996).

48. Gu,Y. et al.Activation of interferon-γ inducing factor mediated by interleukin-1β converting enzyme.Science 275, 206–209 (1997).

49. Takeda, K. et al. Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity 8,383–390 (1998).

50. Ahn, H. J. et al.A mechanism underlying synergy between IL-12 and IFN-γ-inducing factor inenhanced production of IFN-γ. J. Immunol. 159, 2125–2131 (1997).

51. Chang, J.T., Segal, B. M., Nakanishi, K., Okamura, H. & Shevach, E. M.The costimulatory effect of IL-18on the induction of antigen-specific IFN-γ production by resting T cells is IL-12 dependent and ismediated by up-regulation of the IL-12 receptor β2 subunit. Eur. J. Immunol. 30, 1113–1119 (2000).

52. Zhang, S. M. & Kaplan, M. H.The p38 mitogen-activated protein kinase is required for IL-12-inducedIFN-γ expression. J. Immunol. 165, 1374–1380 (2000).

53. DeSilva, D. R., Jones, E.A., Feeser,W. S., Manos, E. J. & Scherle, P.A.The p38 mitogen-activated proteinkinase pathway in activated and anergic Th1 cells. Cell. Immunol. 180, 116–123 (1997).

54. Merritt, C. et al. Activation of p38 mitogen-activated protein kinase in vivo selectively induces apop-tosis of CD8(+) but not CD4(+) T cells. Mol. Cell Biol. 20, 936–946 (2000).

55. Szabo, S. J., Dighe,A. S., Gubler, U. & Murphy, K. M. Regulation of the interleukin (IL)-12R β 2 subunitexpression in developing T helper 1 (Th1) and Th2 cells. J. Exp. Med. 185, 817–824 (1997).

56. Xu, D. et al. Selective expression and functions of interleukin 18 receptor on T helper (Th) type 1but not Th2 cells. J. Exp. Med. 188, 1485–1492 (1998).

57. Andre-Schmutz, I., Hindelang, C., Benoist, C. & Mathis, D. Cellular and molecular changes accompany-ing the progression from insulitis to diabetes. Eur. J. Immunol. 29, 245–255 (1999).

58. Ouyang,W. et al. Inhibition of Th1 development mediated by GATA-3 through an IL-4-independentmechanism. Immunity 9, 745–755 (1998).

59. Ohara, J. and Paul,W. E. Production of a monoclonal antibody to and molecular characterization ofB-cell stimulatory factor-1. Nature 315, 333–336 (1985).

60. Tripp, C. S., Gately, M. K., Hakimi, J., Ling, P. & Unanue, E. R. Neutralization of IL-12 decreases resis-tance to Listeria in SCID and C.B-17 mice. Reversal by IFN-γ. J. Immunol. 152, 1883–1887 (1994).

61. Wittwer, C.T. et al.The LightCycler: a microvolume multisample fluorimeter with rapid temperaturecontrol. Biotechniques 22, 176–181 (1997).

62. Wittwer, C.T., Herrmann, M. G., Moss,A.A. & Rasmussen, R. P. Continuous fluorescence monitoringof rapid cycle DNA amplification. Biotechniques 22, 130–131 (1900).

63. Chee, M. et al.Accessing genetic information with high-density DNA arrays. Science 274, 610–614(1996).

64. Szabo, S. J., Gold, J. S., Murphy,T. L. & Murphy, K. M. Identification of cis-acting regulatory elementscontrolling interleukin-4 gene expression in T cells: roles for NF-Y and NF-ATc Mol. Cell Biol. 13,4793-4805 (1993). [Erratum in Mol. Cell Biol. 13, 5928 (1993).]

65. Ouyang,W. et al.The Ets transcription factor ERM is Th1-specific and induced by IL-12 through aStat4-dependent pathway. Proc. Natl Acad. Sci. USA 96, 3888–3893 (1999).

66. Guler, M. L., Jacobson, N. G., Gubler, U. & Murphy, K. M.T cell genetic background determines main-tenance of IL-12 signaling: effects on BALB/c and B10.D2 T helper cell type 1 phenotype develop-ment. J. Immunol. 159, 1767–1774 (1997).

164

©20

01 N

atu

re P

ub

lish

ing

Gro

up

h

ttp

://im

mu

no

l.nat

ure

.co


Documents

document