AP

OJa

b

c

a

ARRA

KRPCINM

1

nka[mtrmaiatg[

m

1d

Pharmacological Research 59 (2009) 330–337

Contents lists available at ScienceDirect

Pharmacological Research

journa l homepage: www.e lsev ier .com/ locate /yphrs

nti-inflammatory mechanisms of resveratrol in activated HMC-1 cells:ivotal roles of NF-�B and MAPK

k-Hwa Kanga, Hye-Jin Janga, Hee-Sung Chaea, You-Chang Oha, Jang-Gi Choia, Young-Seob Leea,ong-Hak Kima, Youn Chul Kimb, Dong Hwan Sohnb, Hyun Parkc, Dong-Yeul Kwona,∗

College of Pharmacy and Wonkwang-Oriental Medicines Research Institute, Wonkwang University, Iksan, Jeonbuk 570-749, Republic of KoreaDepartment of Pharmacy, College of Pharmacy, Wonkwang University, Iksan, Jeonbuk 570-749, Republic of KoreaDepartment of Parasitology, College of Medicine, Wonkwang University, Iksan, Jeonbuk 570-749, Republic of Korea

r t i c l e i n f o

rticle history:eceived 18 September 2008eceived in revised form 6 January 2009ccepted 19 January 2009

eywords:esveratrolro-inflammatory cytokineOX-2

2+

a b s t r a c t

Resveratrol is a phytoalexin polyphenolic compound found in various plants, including grapes, berries, andpeanuts. Recently, studies have documented various health benefits of resveratrol including cardiovascu-lar and cancer-chemopreventive properties. The aim of the present study was to demonstrate the effectsof resveratrol on the expression of pro-inflammatory cytokines, as well as to elucidate its mechanism ofaction in the human mast cell line (HMC-1). Cells were stimulated with phorbol 12-myristate 13-acetate(PMA) plus A23187 in the presence or absence of resveratrol. To study the possible effects of resvera-trol, ELISA, RT-PCR, real-time RT-PCR, Western blot analysis, fluorescence, and luciferase activity assayswere used in this study. Resveratrol significantly inhibited the PMA plus A23187-induction of inflamma-

ntracellular CaF-�BAPKs

tory cytokines such as tumour necrosis factor (TNF)-�, interleukin (IL)-6 and IL-8. Moreover, resveratrolattenuated cyclooxygenase (COX)-2 expression and intracellular Ca2+ levels. In activated HMC-1 cells,phosphorylation of extra-signal response kinase (ERK) 1/2 decreased after treatment with resveratrol.Resveratrol inhibited PMA plus A23187-induced nuclear factor (NF)-�B activation, I�B degradation,and luciferase activity. Resveratrol suppressed the expression of TNF-�, IL-6, IL-8 and COX-2 througha decrease in the intracellular levels of Ca2+and ERK 1/2, as well as activation of NF-�B. These results

l exer

indicated that resveratro

. Introduction

Resveratrol (trans-3, 4′, 5-trihydroxystilbene) is a polyphe-ol found in grapes and other plants. Resveratrol has beennown to protect plants against fungal infections and to exhibitnti-proliferative, anti-oxidative and anti-inflammatory properties1–3]. Resveratrol suppressed the expression of pro-inflammatory

arkers including cyclooxygenase (COX)-2 and inducible NO syn-hase (iNOS) in both macrophages and cancer cell lines [4]. Recently,esveratrol was found to exert a beneficial effect in the treat-ent of ischemia and neurodegenerative diseases [5,6]. Also, the

nti-inflammatory effects of resveratrol have been associated withnhibition of the transcription factor NF-�B [7], possibly medi-

ted via inhibition of I�B kinase [8]. Some reports demonstratedhe inhibitory effects of resveratrol on NF-�B activation and tar-et gene expression induced by various pro-inflammatory stimuli9,10]. Although the activity of resveratrol in some biological events

∗ Corresponding author at: Department of Oriental Pharmacy, College of Phar-acy, Wonkwang University, Iksan, Jeonbuk, 570-749, Republic of Korea.

E-mail address: sssimi@wonkwang.ac.kr (D.-Y. Kwon).

043-6618/$ – see front matter © 2009 Published by Elsevier Ltd.oi:10.1016/j.phrs.2009.01.009

ted a regulatory effect on inflammatory reactions mediated by mast cells.© 2009 Published by Elsevier Ltd.

has been investigated, its direct molecular targets and the mecha-nism of action on mast cell-mediated inflammation such as allergicdisease are not known.

Mast cells are one of the major effecter cells in the immuneresponse system. Activated mast cells release pro-inflammatorycytokines, such as tumour necrosis factor (TNF)-�, interleukin(IL)-6, IL-8, IL-13 and inflammatory mediators including his-tamine, leukotrienes, serotonin, prostaglandin (PG)E2 as wellas PGD2 [11–13]. Cytokines, such as TNF-�, IL-6 and IL-8 arereleased in a coordinate network and play an important role inchronic inflammation. As such, the pattern of cytokine expressionlargely determines the nature and persistence of the inflammatoryresponse [14]. TNF-� is either preformed and stored in granules ofmast cells or is newly synthesized following mast cell activation;it is a multifunctional cytokine and an important mediator of theimmune and inflammatory response. TNF-� is an autocrine stimu-lator as well as a potent inducer of other inflammatory cytokines,

including IL-1�, IL-6, IL-8, and GM-CSF [15,16]. Moreover, IL-6 isa potent mediator of inflammatory processes, and a pleiotropicinflammatory cytokine produced by T cells, macrophages, mono-cytes, and synovial fibroblasts. On the other hand, IL-8 from mastcells acts on surrounding cells such as neutrophils, T-lymphocytes

gical

atisarrg

vpMCRaoItI�ma

rseeI

2

2

ft(([wUfa8oa(ItSw

2

1f1wi

2

m

O.-H. Kang et al. / Pharmacolo

nd eosinophils, and plays a role in the activation of inflamma-ory effecter cells [17]. In recent years, important roles for COX-2n various tumours and inflammatory diseases have been demon-trated [18]. COX-2 is strongly induced in activated monocytesnd macrophages, one of the major mediators of inflammatoryeactions. Recent studies demonstrated that a COX-2 metaboliteeleased from activated mast cells was also essential for the patho-enesis of eosinophilic airway inflammations [19].

Calcium (Ca2+) acts as a second messenger during cell acti-ation, and an increase in the intracellular Ca2+ level has beenroposed as an essential trigger for mast cell activation [20,21].oreover, it has been reported that the release of intracellular

a2+ from internal stores is required for MAPK activation [22].ecently studies demonstrated the involvement of Ca2+ in MAPKnd NF-�B activation and that increased Ca2+ levels were capablef inducing the release of biological mediators including TNF-�,L-6 and IL-8 [23,24]. Moreover, NF-�B activation is required forhe expression of many inflammatory proteins such as TNF-�,L-6, COX-2, as well as iNOS [25]. Therefore, inhibition of NF-B could reduce the expression of inflammatory genes and is aechanism by which anti-inflammatory agents might elicit their

nti-inflammatory effects [26].The aim of this study was to investigate the mechanism by which

esveratrol affected the production of inflammatory cytokines. Thistudy was conducted using the human mast cell line (HMC-1). Theffects of resveratrol were evaluated on PMA plus A23187-inducedxpression of pro-inflammatory mediators by inhibiting MAPK and�B�/NF-�B signal pathways.

. Materials and methods

.1. Reagents

Resveratrol (trans-3, 4′, 5-trihydroxystilbene) was purchasedrom Sigma–Aldrich and dissolved in dimethyl sulfoxide (DMSO);he final DMSO concentration was adjusted to below 0.01%v/v) in the culture media. PMA, calcium ionophore A23187Calcymycin; C29H37N3O6), PD98059, SP600125, SB203580 and 3-4,5-dimetylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT)ere purchased from the Sigma Chemical Co. (St. Louis, MO,SA). Iscove’s modified Dulbecco’s medium (IMDM) was obtained

rom Gibco BRL (Grand Island, NY, USA); anti-human TNF-�, IL-6nd IL-8 antibodies, biotinylated anti-human TNF-�, IL-6 and IL-antibodies, and recombinant human TNF-�, IL-6 and IL-8 were

btained from BD PharMingen (San Diego, CA, USA); the PKC, NF-�B,nd I�B antibodies were obtained from Santa Cruz BiotechnologySantacruz, CA, USA). LipofectamineTM 2000 was purchased fromnvitrogen (Carlsbad, CA, USA), the NF-�B Luciferase Reporter vec-or from Panomics Inc. and the Dual-Luciferase® Reporter Assayystem from Promega (Madison, WI, USA). SYBR Premix Ex TaqTMas purchased from Takara Bio (Shiga, Japan).

.2. Cell culture

The HMC-1 cells were grown in IMDM and supplemented with00 units ml−1 of penicillin, 100 �g ml−1 of streptomycin, and 10%etal bovine serum (FBS) at 37 ◦C in 5% CO2 with 95% humidity. HMC-

cells were treated with resveratrol (10–50 �M) for 1 h. The cellsere then stimulated with 50 nM of PMA plus 1 �M of A23187 and

ncubated at 37 ◦C for the indicated time periods.

.3. MTT assay

For the MTT colorimetric assay of cell survival, we used theethod described by Kang et al. with minor modifications [27].

Research 59 (2009) 330–337 331

Cell aliquots (3 × 105) were seeded in microplate wells and incu-bated with 20 �l of MTT solution (5 mg ml−1) for 4 h at 37 ◦C under5% CO2 and 95% air. DMSO (250 �l) was used to extract the MTTformazan and an automatic microplate reader was used to read theabsorbance of each well at 540 nm.

2.4. Cytokine assay

The HMC-1 cells were pretreated with various concentrationsof resveratrol (10 and 50 �M) for 1 h before PMA + A23187, onlyPMA, or A23187 stimulation. An enzyme-linked immunosorbentassay (ELISA) was used to assay the culture supernatants for TNF-�,IL-6, and IL-8 protein levels. To measure the cytokines, we used amodified ELISA method. First, we conducted a sandwich ELISA forTNF-�, IL-6, and IL-8 in duplicate in 96-well ELISA plates (Nunc,Denmark). Then the supernatant was decanted into a new micro-centrifuge tube, and quantitation of cytokines conducted by ELISA.ELISA plates (Falcon, Becton Dickinson Labware, Franklin Lakes, NJ)were coated overnight at 4 ◦C with anti-human TNF-�, IL-6, and IL-8 monoclonal antibodies antibody diluted in coating buffer (0.1 Mcarbonate, pH 9.5) and then washed four times with phosphatebuffered saline (PBS) containing 0.05% Tween 20. The nonspecificprotein binding sites were blocked with assay diluent (PBS con-taining 10% FBS, pH 7.0) for at least 1 h. After washing the platesagain, the test sample or recombinant TNF-�, IL-6 and IL-8 stan-dards were added. After incubation for 2 h, a working detector(biotinylated anti-human TNF-�, IL-6 and IL-8 monoclonal antibod-ies and streptavidin-horseradish peroxidase reagent) was addedand incubated for 1 h. Accordingly, substrate solution (tetramethyl-benzidine) was added to the wells and incubated for 30 min in thedark before the reaction was stopped by the addition of 2N H3PO4.The absorbance was read at 450 nm. All subsequent steps were con-ducted at room temperature, and all standards and samples wereassayed in duplicate.

2.5. Reverse transcriptase-polymerase chain reaction (RT-PCR)analysis

Using a GeneAllR RiboEx RNA extraction kit (GeneAll Biotech-nology, Republic of Korea), we isolated total RNA from HMC-1cells in accordance with the manufacturer’s specifications. Theconcentration of total RNA in the final eluate was determined byspectrophotometry. The total RNA (2.0 �g) was heated at 65 ◦Cfor 10 min and then cooled on ice. A cDNA synthesis kit (iNtRONBiotech, Republic of Korea) was used for 90 min at 37 ◦C to reverse-transcribe each sample to cDNA. Primer sequences for TNF-�, IL-6,IL-8, and �-actin were used for PCR analysis as described previ-ously [28]. The PCR products increased as the concentration of RNAincreased. Finally, the products were electrophoretically resolvedon a 2.0% agarose gel and visualized by staining with ethidiumbromide.

2.6. Real-time RT-PCR

The levels of TNF-�, IL-6, IL-8, and �-actin mRNA were mea-sured with the real-time reverse transcription (RT)-PCR methodusing SYBR green. Total RNA was extracted from the cells with anRNeasy® Mini kit (Qiagen Inc., Valencia, CA, USA). Aliquots (1 �g)of total RNA were used for RT, using a PrimeScriptTM RT reagentkit (Takara Bio, Shiga, Japan) and a Smart cycler®II System Takara

Bio, Shiga, Japan). The RT reaction was performed in total volume of20 �l using a SYBR Premix Ex TaqTM (Takara Bio); 2 �l of cDNA sam-ple was used as a template. Their sequences are shown in Table 1.Cycling was started with an activation step at 95 ◦C for 10 s, andamplification program was repeated 45 times (denaturation, 95 ◦C

332 O.-H. Kang et al. / Pharmacological Research 59 (2009) 330–337

Table 1Sequences of oligonucleotide primers designed for real-time PCR.

Forward (5′–3′ orientation) Reverse (5′–3′ orientation) Accession no.

hTNF-� GACAAGCCTGTAGCCCATGTTGTA CAGCCTTGGCCCTTGAAGA NM 000594.2hIL-6 AAGCCAGAGCTGTGCAGATGAGTA TGTCCTGCAGCCACTGGTTC NM 000600.1h�

T

fs

fcsttttt�(�

2

uwwtvTa2tpfe

2

eoc40WgtclH1cnapq

2

(

IL-8 ACACTGCGCCAACACAGAAATTA-actin ATTGCCGACAGGATGCAGAAG

he primers pairs were designed using Primer Express® software.

or 5 s; annealing/extension, 60 ◦C for 20 s) with fluorescence mea-urement at 72 ◦C.

The fluorescence of the SYBR green dye was determined as aunction of the PCR cycle number. In order to confirm amplifi-ation specificity, the PCR products from each primer pair wereubjected to a melting curve analysis. The �CT values (Ct = cyclehreshold value) for the housekeeping gene (�-actin) and thearget gene (TNF-�, IL-6, and IL-8) were calculated by sub-racting the experiment group (PMA + A23187 + resveratrol) fromhe control (nonstimulated value). The relative expression ofhe target gene was calculated on the basis of 2−�(�Ct). The

(�Ct) values were calculated by subtracting the drug treatedPMA + A23187 + resveratrol) �Ct from the control (PMA + A23187)

Ct.

.7. Fluorescent measurements of the intracellular Ca2+ level

The intracellular Ca2+ values were obtained from a single cellsing Fluo-3/AM, the fluorescent Ca2+-sensitive indicator. The cellsere incubated with 4 �M Fluo-3/AM at 37 ◦C for 30 min, and thenashed with PBS. After the addition of the culture medium, the

emperature was maintained at 37 ◦C for 10 min, and the cells wereiewed using confocal laser scanning microscope (Olympus, Japan).he Fluo-3 loaded cells were illuminated with the 488 nm line of anrgon laser and the emitted fluorescence was collected through a0× water-immersion objective and by setting the confocal pinholeo 2 �M. The intensity of fluorescence was detected with one of twohotomultipliers. To obtain a good spatial image, three successiverames were collected for each cell. The intracellular Ca2+ level wasvaluated using fluorescent intensity [29].

.8. Preparation of cytoplasmic and nuclear extracts

Nuclear and cytoplasmic extracts were prepared as describedlsewhere [27]. Briefly, after activating the cells for the time peri-ds indicated, 5 × 106 cells were washed with ice-cold PBS andentrifuged at 15,000 × g for 1 min. The cells were resuspended in0 �l of a cold hypotonic buffer [10 mM Hepes/KOH, 2 mM MgCl2,.1 mM EDTA, 10 mM KCl, 1 mM DTT, and 0.5 mM PMSF, pH 7.9].e then allowed the cells to swell on ice for 15 min, followed by

entle lysis with 2.5 �l of 10% Nonide P (NP)-40 and then cen-rifugation at 15,000 × g for 3 min at 4 ◦C. The supernatant wasollected and used as the cytoplasmic extract. The nuclear pel-ets were gently resuspended in 40 �l of cold saline buffer [50 mMEPES/KOH, 50 mM KCl, 300 mM NaCl, 0.1 mM EDTA, 10% glycerol,mM DTT, and 0.5 mM PMSF, pH 7.9] and left on ice for 20 min. Afterentrifugation (15,000 × g for 15 min at 4 ◦C), the aliquots of super-atant containing nuclear proteins were frozen in liquid nitrogennd stored at −70 ◦C until ready for analysis. The Bicinchoninic acidrotein assay (Sigma, St. Louis, MO, USA) was used to for proteinuantitation.

.9. Western blot analysis

The HMC-1 cells (5 × 106 cells/well) were stimulated with PMA50 nM) plus A23187 (1 �M). Cell lysates were prepared in a sample

TTTGCTTGAAGTTTCACTGGCATC NM 00584.2ATGGAGCCACCGATCCACA NM 0016142

buffer containing sodium dodecyl sulfate (SDS). The samples wereheated at 95 ◦C for 5 min and briefly cooled on ice. Following cen-trifugation at 15,000 × g for 5 min, the proteins in the cell lysateswere separated by 10% SDS-polyacrylamide gel electrophoresis(SDS-PAGE) and transferred to a nitrocellulose membrane. Themembrane was then blocked with 5% skim milk in PBS-tween-20for 1 h at room temperature and then incubated with anti-MAPKs,PKC, NF-�B, and I�B. After washing the blot in PBS-tween-20 threetimes, it was incubated with a secondary antibody for 1 h and thenthe antibody-specific proteins were visualized using an enhancedchemiluminescence detection system in accordance with the rec-ommended procedure (Amersham Corp., Newark, NJ, USA).

2.10. Transient transfection and a luciferase assay

The transfection was prepared as described elsewhere [30].Briefly, we used LipofectamineTM 2000 (Invitrogen, Carlsbad, CA,USA) to transiently transfect pNF-�B luciferase reporter vector andpRL-TK control vector constructs into HMC-1 cells. In brief, weincubated the cells for 48 h at 37 ◦C in a 5% CO2 incubator, andthe transfected HMC-1 cells were plated and stimulated with PMAplus A23187. Resveratrol was added 1 h before stimulation. Fourhours after the stimulation, we harvested the cells and washedthem in cold PBS before lysing them in a 500 �l lysis buffer (Dual-Luciferase® Reporter Assay System; Promega). After vortex mixingthe lysate and centrifugation at 12,000 × g for 3 min at 4 ◦C, thesupernatant was stored at −70 ◦C until further analysis. For theluciferase assay, 20 �l of cell extract was mixed with 100 �l ofthe luciferase assay reagent at room temperature. A luminometer(1420 luminescence counter, Perkin Elmer) was used to quantifyluciferase activity, in accordance with the manufacturer’s protocol.The relative luciferase activity was defined as the ratio of fireflyluciferase activity to renilla luciferase activity.

2.11. Statistical analysis

Statistical analysis was performed using one-way analysis ofvariance (ANOVA) followed by Dunnett’s t-test for multiple com-parisons, and the Student’s test for single comparisons. The datafrom the experiments are presented as means ± S.E.M. The num-bers of independent experiments assessed are given in the figurelegends.

3. Results

3.1. Effects of resveratrol on pro-inflammatory cytokineproduction

Initially we examined the cytotoxicity of resveratrol on HMC-1cells using the MTT assay. Resveratrol did not show any cytotoxiceffects up to 100 �M (data not shown). To evaluate the effect of

resveratrol on the production of pro-inflammatory cytokines, wepretreated cells with resveratrol (10 and 50 �M) before stimula-tion with PMA (50 nM) and A23187 (1 �M) for 8 h, and analysisusing ELISA. As shown in Fig. 1, the levels of TNF-�, IL-8 were con-siderably increased after stimulation with PMA + A23187, PMA, and

O.-H. Kang et al. / Pharmacological Research 59 (2009) 330–337 333

Fig. 1. Effect of resveratrol on production of pro-inflammatory cytokines in PMAplus A23187-induced HMC-1 cells. Cells were pretreated with resveratrol (10 and50 �M) for 1 h prior to PMA (50 nM) + A23187 (1 �M), only PMA, or A23187 stimu-lation for 8 h. The protein levels of TNF-�, IL-6 and IL-8 were determined by ELISA.E #

cs

AuorAwlAc

3e

lIbpi

Fig. 2. Effect of resveratrol on gene expression of pro-inflammatory cytokines inPMA plus A23187-induced HMC-1 cells. Cells were pretreated with resveratrol (10

vation of MAPKs. The stimulation of HMC-1 cells with PMA plus

ach bar represents the means ± S.E.M. of three independent experiments. p < 0.05,ompared with unstimulated cell values. *p < 0.05, compared with PMA + A23187-timulated values.

23187 in HMC-1, but levels of IL-6 were only increased after stim-lation with PMA + A23187. Moreover, the levels of TNF-� inhibitedn PMA + A23187-stimulated cell and only PMA-stimulated cell byesveratrol in a concentration-dependent manner, but not with23187 (Fig. 1A). In contrast, the release of IL-6 inhibited onlyith PMA + A23187-stimulated cell by resveratrol (Fig. 1B). Also, the

evels of IL-8 inhibited on PMA + A23187-stimulated cell and only23187-stimulated cell by resveratrol (50 �M) statistically signifi-ant manners, but not with PMA (Fig. 1C).

.2. Effects of resveratrol on pro-inflammatory cytokinexpression

The pro-inflammatory cytokine gene expression was then ana-yzed using RT-PCR and real-time RT-PCR. Enhanced TNF-�, IL-6 and

L-8 mRNA expression induced by PMA plus A23187 was inhibitedy pretreatment of the cells with resveratrol (Fig. 2). In particular,retreatment with resveratrol at a concentration of 50 �M inhib-

ted PMA and A23187-induced gene expression of TNF-�, IL-6 and

and 50 �M) for 1 h prior to PMA (50 nM) + A23187 (1 �M) stimulation for 6 h. ThemRNA expression level of TNF-�, IL-6 and IL-8 was determined by RT-PCR (A) andreal-time RT-PCR (B). Each bar represents the means ± S.E.M. of three independentexperiments. *p < 0.05, compared with PMA + A23187-stimulated values.

IL-8. Resveratrol at a concentration of 10 �M only slightly decreasedthe gene expression of TNF-�.

3.3. Effects of resveratrol on COX-2 protein and COX-2 mRNAexpression

In recent studies, the important roles of COX-2 in mastcell-mediated inflammation have been demonstrated. Thus, todetermine the effects of resveratrol on COX-2 protein and COX-2 mRNA expression induced by PMA plus A23187, Western blotand RT-PCR analysis was conducted. The cells were pretreated withresveratrol (10 and 50 �M) for 1 h and then treated with PMA plusA23187. As shown in Fig. 3, resveratrol inhibited the PMA plusA23187-induced COX-2 protein and COX-2 mRNA expression.

3.4. Effects of resveratrol on intracellular Ca2+ levels

We also investigated the effects of resveratrol on the intracel-lular levels of Ca2+, using confocal laser microscopy to detect thefluorescence signal coming from the individual cells. The PMA plusA23187 treatment of cells considerably increased the intracellularCa2+ levels, but pretreatment with resveratrol (50 �M) inhibitedthis increase in the intracellular Ca2+ levels (Fig. 4).

3.5. Effects of resveratrol on activation of MAPKs and PKCactivation

In order to elucidate the mechanisms underlying the effects ofresveratrol, we examined the possible effects of resveratrol on acti-

A23187 resulted in an increased phosphorylation of all three typesof MAPKs, p38, JNK, ERK, and activation of PKC after 15–30 min posttreatment (data not shown). As shown in Fig. 5, resveratrol atten-uated PMA plus A23187-induced ERK 1/2, but did not affect the

334 O.-H. Kang et al. / Pharmacological Research 59 (2009) 330–337

Fig. 3. Effect of resveratrol on COX-2 protein and mRNA expression in PMA plusA23187-induced HMC-1 cells. (A) Cells were pretreated with resveratrol for 1 hprior to PMA (50 nM) + A23187 (1 �M) stimulation for 24 h, and then expressionof the COX-2 protein was analyzed by Western blot analysis. (B) Cells were pre-tfpw

prtE

3o

gei[daAp

aNpcos

Fig. 4. Effect of resveratrol on intracellular calcium levels. Cells were pretreatedwith resveratrol for 1 h before stimulation with PMA (50 nM) + A23187 (1 �M). (A)

reated with resveratrol for 1 h prior to PMA (50 nM) + A23187 (1 �M) stimulationor 10 h, and then expression of COX-2 mRNA was analyzed by RT-PCR. Values areresented as means ± S.E.M. of three independent experiments. *p < 0.05 comparedith PMA + A23187-stimulated values.

hosphorylation of JNK 1/2, and p38 MAPK (data not shown). Also,esveratrol had no effect on PMA plus A23187-induced PKC activa-ion. To further support this result, we used a potent inhibitor forRK1/2 (PD98059, 20 �M).

.6. Effects of resveratrol on activation of NF-�B and degradationf I�B

To evaluate the mechanism by which resveratrol affected theene expression of pro-inflammatory cytokines, we examined theffects of resveratrol on NF-�B activation. Expression of these pro-nflammatory cytokines is regulated by a transcription factor, NF-�B31]. Stimulation of HMC-1 cells with PMA plus A23187 induced theegradation of I�B� and the nuclear translocation of p65 NF-�Bfter 2 h of incubation (Fig. 6A). Resveratrol inhibited the PMA plus23187-induced degradation of I�B� and nuclear translocation of65 NF-�B.

In order to confirm the inhibitory effect of resveratrol on NF-�Bctivation, we examined the possible effects of resveratrol on an

F-�B-dependent gene reporter assay. We transiently transfectedNF-�B luciferase reporter vector and pRL-TK vector into HMC-1ells, and incubated the cells with PMA plus A23187 in the presencer absence of resveratrol. As shown in Fig. 6B, the PMA plus A23187-timulation increased the reporter gene expression though this

Fluorescent images (1–3) were analyzed using confocal microscopy (4–6). Confocalimages of HMC-1 cells were stained with fluo-3/AM. (B) The intensity of intracellu-lar calcium was measured in three separate experiments. *p < 0.05 compared withPMA + A23187-stimulated values.

increased activity was significantly decreased by treatment withresveratrol (50 �M). The potent inhibitor for NF-�B, PDTC (5 �M),blocked PMA plus A23187-induced luciferase activity.

4. Discussion

Many recent studies on plant-derived anti-inflammatory com-pounds have investigated the potential inhibitory effects of naturalproducts using in vivo and in vitro systems. Resveratrol, found inthe powdered root of Polygonum cuspidatum (Polygonaceae), is anactive ingredient of oriental medicine, and has been used sinceancient times to cure diseases such as inflammation, allergy andhyperlipemia [32]. Peanuts, grapes and related products such asred wines are probably the most common foodstuffs containingresveratrol [33]. Therefore, recent research has shown resveratrolto act as a pleiotropic and multistage biological effecter. These stud-ies add a new dimension to the expanding role of resveratrol asa potential chemopreventive agent exhibiting anti-inflammatory,cell growth-modulatory and anticarcinogenic effects. The aim ofthe present study was to examine the effects of resveratrol onthe production of TNF-�, IL-6 and IL-8 in HMC-1 cells, as thesecytokines have powerful inflammatory effects and are released byactivated mast cells. Moreover, we used a PKC activator and cal-cium ionophore-stimulated HMC-1 cells in this study. In Fig. 1, wecan see the direct impact of the expression of cytokines whether inpresence of the association of PMA + A23187 or not. It shows clearly

in Fig. 1, that the expression of TNF-� and IL-8 is greater whenstimulated with PMA + A2318 compared to an independent stimu-lation from PMA or A23187. On the other hand, in Fig. 1B, there isalmost no expression of IL-6 when stimulating separately by PMA

O.-H. Kang et al. / Pharmacological Research 59 (2009) 330–337 335

Fig. 5. Effect of resveratrol on activation of MAPKs and PKC. After pretreatment withresveratrol for 1 h, HMC-1 cells were stimulated by PMA (50 nM) + A23187 (1 �M)3(2s

actimiaItiiIImaoi

ht

Fig. 6. Effect of resveratrol on the activation of NF-�B in HMC-1 cells. Cells were pre-treated with resveratrol for 1 h prior to PMA (50 nM) + A23187 (1 �M) stimulation.(A) I�B degradation and NF-�B translocation were assayed by Western blot. (B) ForNF-�B luciferase assay, cells were transiently transfected with the NF-�B luciferasereporter construct or pRL-TK control vector. NF-�B-dependent transcriptional activ-

0 min for MAPK activation and PKC activation. (A) Phosphorylation of ERK1/2 andB) activation of PKC were analyzed by Western blot. The ERK inhibitor (PD 98059,0 �M) was used as a positive control. *p < 0.05 compared with PMA + A23187-timulated values.

nd A23187. This brings us to the assumption that inflammatoryytokines are better expressed while stimulated by the associa-ion of PMA plus A23187. We then demonstrated that resveratrolnhibited the expression of pro-inflammatory cytokines in a human

ast cell line. Thus, resveratrol inhibits the production of TNF-�n presence of PMA stimulation and even greater with the associ-tion of PMA + A23187. And resveratrol inhibits the production ofL-8 in presence of A23187 stimulation and it is even greater withhe association of PMA plus A23187. However, IL-6 is resveratrol-ndependent when stimulated singularly by A23187 and PMA. Thus,t cannot play its anti-inflammatory role in that single stimulation.n these results, resveratrol inhibits PKC-dependent on TNF-� andL-8 production whereas IL-6 production involves PKC-independent

echanism. Also, resveratrol suppressed the expression of COX-2nd intracellular levels of Ca2+. Resveratrol blocked the activation

f ERK 1/2, and NF-�B, and therefore attenuated expression of pro-nflammatory cytokines and COX-2.

The mast cell contains potent mediators, including histamine,eparin, proteinases, leukotrienes, and multifunctional cytokines;hese have potential contributions to the processes of inflamma-

ity was determined by luciferase activity assay. PDTC (5 �M) was used as a positivecontrol. *p < 0.05 compared with PMA + A23187-stimulated values.

tion and therefore play important roles in inflammation [34]. Mastcell-derived pro-inflammatory cytokines, particularly TNF-�, IL-6and IL-8, have critical biological roles to play in allergic inflam-mation. These cytokines are released as prestored cytokines butcan also be newly synthesized upon mast cell activation [35]. Thereduced level of pro-inflammatory cytokines released from mastcells is a key indicator of reduced inflammatory symptoms. Recentstudies showed that resveratrol exhibited anti-inflammatory activ-ity through the inhibition of IL-8 and GM-CSF-release from lungepithelial cells [36]. Also, resveratrol inhibited the release of TNF-� and histamines mediated by immunoglobulin E (IgE) in bonemarrow-derived mouse mast cells [37]. These reports indicatedthe anti-inflammatory effect of resveratrol as a potent inhibitor ofmast cell activation. In this study, we demonstrated that resvera-trol suppressed the expression of TNF-�, IL-6 and IL-8 in PMA plusA23187-induced HMC-1 cells.

Calcium acts as a secondary messenger during cell activation.An increase in the intracellular Ca2+ level has been proposed asan essential trigger for mast cell activation [38]. Increases in lev-els of intracellular Ca2+ induce the release of biological mediatorsincluding TNF-�, IL-8 and IL-6 [39]. It has also been reported thatthe release of intracellular Ca2+ from internal stores is required forMAPK activation [22]. A depletion of intracellular Ca2+ levels inhib-ited pro-inflammatory cytokine expression via NF-�B signalingpathway in RBL-2H3 cells [24]. In a study published by Dobrydnevaet al. resveratrol was found to inhibit Ca2+ influx into thrombin-stimulated human platelets [40]. Studies of calcium channels incells after exposure to resveratrol have shown the ability of this phy-toalexin to control inflammatory mediators through COX-2. COX-2is also strongly induced in activated monocytes and macrophages.It has been reported that PGD2, which is the COX-2 metabolite

released from activated mast cells, is also essential for the patho-genesis of eosinophilic airway inflammations [41]. In this study,we tested the effects of resveratrol on COX-2 expression togetherwith intracellular Ca2+ release in HMC-1 cells. The results indicated

3 ogical

te

tpitIEacdtMp(sspa

fitsuetcI[dEoitIdPaaouc

6aaTtce

A

Rm

R

[

[

[

[

[

[

[

[

[

[

36 O.-H. Kang et al. / Pharmacol

hat resveratrol reduced the intracellular Ca2+ release and COX-2xpression.

The MAPK (i.e. ERK, JNK, and p38 MAPK) cascade is one ofhe important signaling pathways in immune responses, and theseathways are appropriate targets for pharmacological treatment of

nflammatory disorders [42]. The effect of resveratrol on the activa-ion of MAPK members in selected cell lines has also been reported.n several studies, resveratrol inhibited PMA-induced activation ofRK1/2 and p38 MAPK pathways in human monocyte cell lines [43],s well as the activation of MAPK and NF-�B in LPS-induced vas-ular smooth muscle cells [44]. This discrepancy may arise fromifferences in stimulation or cell type. The present study showedhat resveratrol inhibited phosphorylation of ERK 1/2 but not of p38

APK and JNK1/2 (Fig. 5). Moreover, resveratrol inhibited phos-horylation of ERK to a greater extent than the ERK 1/2 inhibitorPD98059). We also investigated the role of PKC, and the resultshowed that resveratrol had no effect on PKC activation. These datauggested that resveratrol inhibited pro-inflammatory cytokineroduction and intracellular Ca2+ release via the inhibition of ERKctivation.

Recently, a number of published studies have indicated the inter-erence of resveratrol with NF-�B. Because this transcription factors strongly linked to inflammatory and immune responses, we pos-ulate that resveratrol mediates its effects at least partly throughuppression of NF-�B activation. Although NF-�B activation is reg-lated by MAPKs through multiple mechanisms, accumulatingvidence indicates that NF-�B activation is modulated by MAPKshat induce site-specific phosphorylation of an inhibitory proteinalled I�B. Activation of NF-�B is dependent on the degradation of�B�, an endogenous inhibitor that binds to NF-�B in the cytoplasm45]. The role of NF-�B activation and its regulation of cytokine pro-uction in inflammation have previously been characterized [46].xpression of the TNF-�, IL-6, IL-8 and GM-CSF genes is dependentn the activation of transcription factor NF-�B in mast cells. Thismplies that resveratrol might inhibit the expression of inflamma-ory mediators through the suppression of NF-�B activation and�B degradation in HMC-1. Resveratrol was shown to decrease theegradation of I�B� and nuclear translocation of p65 NF-�B inMA plus A23187-stimulated mast cells. This indicated that resver-trol exerted its inhibitory effects on expression of TNF-�, IL-6, IL-8nd COX-2 through both the activation of NF-�B and degradationf I�B� degradation. Experiments aiming to confirm and furthernravel the details of the molecular mechanism of resveratrol areurrently underway in our lab.

In conclusion, resveratrol regulated the production of TNF-�, IL-and IL-8 in PMA plus A23187-stimulated HMC-1 cells. Resveratrollso decreased COX-2 expression and intracellular Ca2+ release. Inddition, resveratrol inhibited the ERK 1/2, and NF-�B pathway.herefore, regulation of the NF-�B signal pathway by resvera-rol in HMC-1 cells could potentially be used as an attractive andharacteristic probe for studying mast cell-mediated allergic dis-ases.

cknowledgements

This work was supported by grant no. RTI 05-03-02 from theegional Technology Innovation Program of the Ministry of Com-erce, Industry and Energy (MOCIE) in the Republic of Korea.

eferences

[1] ElAttar TM, Virji AS. Modulating effect of resveratrol and quercetin on oralcancer cell growth and proliferation. Anticancer Drugs 1999;10:187–93.

[2] Kawada N, Seki S, Inoue M, Kuroki T. Effect of antioxidants, resveratrol,quercetin, and N-acetylcysteine, on the functions of cultured rat hepatic stellatecells and Kupffer cells. Hepatology 1998;27:1265–74.

[

[

Research 59 (2009) 330–337

[3] Wadsworth TL, Koop DR. Effects of the wine polyphenolics quercetin and resver-atrol on pro-inflammatory cytokine expression in RAW 264.7 macrophages.Biochem Pharmacol 1999;57:941–9.

[4] Martinez J, Moreno JJ. Effect of resveratrol, a natural polyphenolic compound,on reactive oxygen species and prostaglandin production. Biochem Pharmacol2000;59:865–70.

[5] Tsai SK, Hung LM, Fu YT, Cheng H, Nien MW, Liu HY, et al. Resveratrol neuropro-tective effects during focal cerebral ischemia injury via nitric oxide mechanismin rats. J Vasc Surg 2007;46(2):346–53.

[6] Rocha-González HI, Ambriz-Tututi M, Granados-Soto V. Resveratrol: a naturalcompound with pharmacological potential in neurodegenerative diseases. CNSNeurosci Ther 2008;(July):29.

[7] Manna SK, Mukhopadhyay A, Aggarwal BB. Resveratrol suppresses TNF-induced activation of nuclear transcription factors NF-B, activator protein-1,and apoptosis: potential role of reactive oxygen intermediates and lipid perox-idation. J Immunol 2000;164:6509–19.

[8] Holmes MM, Baldwin ASJ. Chemopreventive properties of trans-resveratrolare associated with inhibition of activation of the IB kinase. Cancer Res2000;60:3477–83.

[9] Misko TP, Schilling RJ, Salvemini D, Moore WM, Currie MG. A fluorometricassay for the measurement of nitrite in biological samples. Anal Biochem1993;214:11–6.

[10] Newton R. Molecular mechanisms of glucocorticoid action: what is important?Thorax 2000;55:603–13.

[11] Zhu Z, Homer RJ, Wang Z, Chen Q, Geba GP, Wang J, et al. Pulmonary expressionof interleukin-13 causes inflammation, mucus hypersecretion, subepithe-lial fibrosis, physiologic abnormalities, and eotaxin production. J Clin Invest1999;103:779–88.

12] Royer B, Varadaradjalou S, Saas P, Gabiot AC, Kantelip B, Féger F, et al. Autocrineregulation of cord blood-derived human mast cell activation by IL-10. J AllergyClin Immunol 2001;108:80–6.

[13] Stassen M, Müller C, Arnold M, Hültner L, Klein-Hessling S, Neudörfl C, et al. IL-9and IL-13 production by activated mast cells is strongly enhanced in the pres-ence of lipopolysaccharide: NF-kappa B is decisively involved in the expressionof IL-9. J Immunol 2001;166(7):4391–8.

[14] Barnes PJ, Adcock I. Anti-inflammatory actions of steroids: molecular mecha-nisms. Trends Pharmacol Sci 1993;14(12):436–41.

[15] Arend WP, Dayer JM. Inhibition of the production and effects of interleukin-1 and tumor necrosis factor alpha in rheumatoid arthritis. Arthritis Rheum1995;38(2):151–60.

[16] Butler DM, Maini RN, Feldmann M, Brennan FM. Modulation of proinflam-matory cytokine release in rheumatoid synovial membrane cell cultures.Comparison of monoclonal anti TNF-alpha antibody with the interleukin-1receptor antagonist. Eur Cytokine Netw 1995;6:225–30.

[17] Mukaida N. Interleukin-8: an expanding universe beyond neutrophil chemo-taxis and activation. Int J Hematol 2000;72(4):391–8.

[18] Kong G, Kim EK, Kim WS, Lee KT, Lee YW, Lee JK, et al. Role of cyclooxygenase-2and inducible nitric oxide synthase in pancreatic cancer. J Gastroenterol Hepatol2002;17(8):914–21.

[19] Bochenek G, Nizankowska E, Gielicz A, Swierczynska M, Szczeklik A. Plasma9alpha,11beta-PGF2, a PGD2 metabolite, as a sensitive marker of mast cell acti-vation by allergen in bronchial asthma. Thorax 2004;59(6):459–64.

20] Rasmussen H, Goodman DB. Relationships between calcium and cyclicnucleotides in cell activation. Physiol Rev 1977;57(3):421–509.

21] White JR, Pluznik DH, Ishizaka K, Ishizaka T. Antigen-induced increase in proteinkinase C activity in plasma membrane of mast cells. Proc Natl Acad Sci USA1985;82(23):8193–7.

22] Crossthwaite AJ, Hasan S, Williams RJ. Hydrogen peroxide-mediated phospho-rylation of ERK1/2, Akt/PKB and JNK in cortical neurones: dependence on Ca(2+)and PI3-kinase. J Neurochem 2002;80(1):24–35.

23] Kim MS, Lim WK, Park RK, Shin T, Yoo YH, Hong SH, et al. Involvement ofmitogen-activated protein kinase and NF-kappaB activation in Ca2+-inducedIL-8 production in human mast cells. Cytokine 2005;32(5):226–33.

24] Jeong HJ, Hong SH, Lee DJ, Park JH, Kim KS, Kim HM. Role of Ca(2+) on TNF-alphaand IL-6 secretion from RBL-2H3 mast cells. Cell Signal 2002;14(7):633–9.

25] Pastore S, Fanales-Belasio E, Albanesi C, Chinni LM, Giannetti A, GirolomoniG. Granulocyte macrophage colony-stimulating factor is overproduced bykeratinocytes in atopic dermatitis. Implications for sustained dendritic cellactivation in the skin. J Clin Invest 1997;99(12):3009–17.

26] Newton R, Kuitert LM, Bergmann M, Adcock IM, Barnes PJ. Evidence for involve-ment of NF-kappaB in the transcriptional control of COX-2 gene expression byIL-1beta. Biochem Biophys Res Commun 1997;237(1):28–32.

27] Kang OH, Lee GH, Choi HJ, Park PS, Chae HS, Jeong SI, et al. Ethyl acetateextract from Angelica Dahuricae Radix inhibits lipopolysaccharide-inducedproduction of nitric oxide, prostaglandin E2 and tumor necrosis factor-alpha viamitogen-activated protein kinases and nuclear factor-kappaB in macrophages.Pharmacol Res 2007;55(4):263–70.

28] Salgame P, Abrams JS, Clayberger C, Goldstein H, Convit J, Modlin RL, et al.Differing lymphokine profiles of functional subsets of human CD4 and CD8T cell clones. Science 1991;254:279–82.

29] Grynkiewicz G, Poenie M, Tsien RY. A new generation of Ca2+ indicatorswith greatly improved fluorescence properties. J Biol Chem 1985;260(6):3440–50.

30] Bakhtiarova A, Taslimi P, Elliman SJ, Kosinski PA, Hubbard B, Kavana M,et al. Resveratrol inhibits firefly luciferase. Biochem Biophys Res Commun2006;351(2):481–4.

gical

[

[

[

[

[

[

[

[

[

[

[

[

[

[

O.-H. Kang et al. / Pharmacolo

31] Azzolina A, Bongiovanni A, Lampiasi N. Substance P induces TNF-alpha and IL-6production through NF kappa B in peritoneal mast cells. Biochim Biophys Acta2003;1643:75–83.

32] Jang M, Pezzuto JM. Cancer chemopreventive activity of resveratrol. Drug ExpClin Res 1999;25:65–77.

33] de la Lastra CA, Villegas I. Resveratrol as an anti-inflammatory and anti-aging agent: mechanisms and clinical implications. Mol Nutr Food Res2005;49(5):405–30.

34] Bradding P, Holgate ST. Immunopathology and human mast cell cytokines. CritRev Oncol Hematol 1999;31(2):119–33.

35] Hide I, Toriu N, Nuibe T, Inoue A, Hide M, Yamamoto S, et al. Suppression ofTNF-alpha secretion by azelastine in a rat mast (RBL-2H3) cell line: evidence fordifferential regulation of TNF-alpha release, transcription, and degranulation. JImmunol 1997;159:2932–40.

36] Donnelly LE, Newton R, Kennedy GE, Fenwick PS, Leung RH, Ito K, et al.Anti-inflammatory effects of resveratrol in lung epithelial cells: molecularmechanisms. Am J Physiol Lung Cell Mol Physiol 2004;287(4):L774–83.

37] Baolin L, Inami Y, Tanaka H, Inagaki N, Iinuma M, Nagai H. Resveratrol inhibitsthe release of mediators from bone marrowderived mouse mast cells in vitro.Planta Med 2004;70:305–9.

38] White DH, Pluzmik K, Ishizaka T. Antigen-induced increase in protein kinaseC activity in plasma membrane of mast cells. Proc Natl Acad Sci USA1986;82:8139–97.

[

[

Research 59 (2009) 330–337 337

39] Beaven MA, Moore JP, Smith GA, Hesketh TR, Metcalfe JC. The calciumsignal and phosphatidylinositol breakdown in 2H3 cells. J Biol Chem1984;259(11):7137–42.

40] Tredici G, Miloso M, Nicolini G, Galbiati S, Cavaletti G, Bertelli A. Resveratrol,MAP kinases and neuronal cells: might wine be a neuroprotectant? Drug ExpClin Res 1999;25:99–103.

41] Bochenek G, Nizankowska E, Gielicz A, Swierczynska M, Szczeklik A. Plasma9alpha, 11beta-PGF2, a PGD2 metabolite, as a sensitive marker of mast cellactivation by allergen in bronchial asthma. Thorax 2004;59:459–64.

42] Lewis TS, Shapiro PS, Ahn NG. Signal transduction through MAP kinase cascades.Adv Cancer Res 1998;74:149–239.

43] Huang Z, Wang C, Wei L, Wang J, Fan Y, Wang L, et al. Resveratrol inhibits EMM-PRIN expression via P38 and ERK1/2 pathways in PMA-induced THP-1 cells.Biochem Biophys Res Commun 2008;374(3):517–21.

44] Son YH, Jeong YT, Lee KA, Choi KH, Kim SM, Rhim BY, et al. Roles of MAPK andNF-kappaB in interleukin-6 induction by lipopolysaccharide in vascular smoothmuscle cells. J Cardiovasc Pharmacol 2008;51(1):71–7.

45] Lee FS, Hagler J, Chen ZJ, Maniatis T. Activation of the IkappaB alpha kinasecomplex by MEKK1, a kinase of the JNK pathway. Cell 1997;88:213–22.

46] Blackwell TS, Blackwell TR, Christman JW. Impaired activation of nuclearfactor-kappaB in endotoxin-tolerant rats is associated with down-regulation ofchemokine gene expression and inhibition of neutrophilic lung inflammation.J Immunol 1997;158:5934–40.