BRG May 2014

OPENING DAY

HanginG

BasketS

springproduce

VEGGIE

StartS

MeaT CheesE

& EggS

sATURDAYMAY 3RD........................8AM - 1:30 PM

beavertonfarmersmarket.com

FREE Community Paper, Take One! Volume 4 | Issue 5 | May 2014

www.BeavertonResourceGuide.com

• What’s the Beaverton Police doing in Bangladesh? Find out on page 2

• What’s a Cascara? It’s Beaverton’s native plant of the month! See page 15

• Have you eaten at La Hacienda Real? We have! See our review on page 19

• Is your child creative? Submit a poem & drawing for our Kids Corner. See page 32

• Veggie Hunt Contest! Win a $25 gift certificate to Black Bear Diner! See page 32

• Wh t’ th B t P li d i i BB l d h??Wh t’ th B t P li d i i B l Fi d t 2

What's Happening this Month in Beaverton?

Cover Art

Farmers Market(See pages 26-27)

Hi

There!

2 – Beaverton Resource Guide | Volume 4–Issue 5 (May 2014) Find us on Facebook or visit - - - > www.beavertonresourceguide.com

Co

nte

nts

Chief's MessageChief's Message

BEAVERTON, OREGON, USAAverage rainfall: 36.3 inches per year

City size: 18.7 square miles

Coordinates: N 45º 29.14 / W 122º 47.84 (latitude / longitude)

Elevation above sea level:• Low: 131.7 feet above sea level

(at the Progress Ridge Rock Quarry / Murray-Scholls Transit Center area)

• Average: 189 feet above sea level

• High: 698.2 feet (just north of Hwy. 26 and Camelot Ctr)

First Settled: 1847 by Augustus Fanno

Location: Seven miles west of Portland, Oregon

Median family income: $71,303 (2009)

Population: 91,205

MAYOR & CITY COUNCILMayor: Denny Doyle Council: Catherine Arnold, Betty Bode, Ian King, Marc San Soucie, Mark Fagin

MEETINGS Tuesdays, 6:30pm City Council meetings are held in the Forrest C. Soth Council Chambers in City Hall and open to the public. For the most up to date agenda and materials call 503-526-2222 or visit: www.beavertonoregon.gov.

USEFUL NUMBERSBeaverton Recycling ........................................503-526-2665Beaverton School District ................................503-591-8000 Chamber of Commerce ................................... 503-644-0123 City Hall ............................................................503-526-2222 City of Beaverton (Water) ................................503-526-2257 Hazardous Waste Disposal (Metro) ................ 503-797-1700 Oregon DMV ....................................................503-299-9999 Oregon Ecycle ..................................................888-532-9253 NW Natural (Gas) ............................................. 503-226-4211 PGE (Electricity) ...............................................800-743-5000 Police (Non-Emergency) .................................503-526-2260 Waste Management (Trash) ............................800-808-5901

BRG HistoryThe Beaverton Resource Guide (BRG) is a free monthly community paper written, edited and published in Beaverton, by Beaverton residents and for the businesses and people of Beaverton, Oregon, USA. Cedar House Media published the first edition in April of 2011 featuring local businesses, community news, and the Farmers Market. That first issue was 16 pages. Today, the paper is 32 pages and sponsored by a diverse cross section of public and private community organizations.

BRG GoalsBeaverton has so many positive attributes and many go unnoticed. The BRG is our way of giving back to the community by highlighting what makes our city a great place to live, work and shop. With a focus on small, local businesses, we’d like to encourage our neighbors to first visit nearby stores and give them a chance before moving on to businesses outside our community.

BRG AdvertisingWith our unique layout, colorful design and exclusive community content, our readers are beyond loyal. Not only do they want to know "What's Happening in Beaverton This Month" but they also agree with our philosophy of: "Shop Local - Give Local - Stay Local."

As a business in the Beaverton area, your ad will be seen by those who are most willing to go out of their way to keep their dollars close to home. These shoppers, your potential new customers, also happen to be our best readers! In addition, we don’t print massive quantities and mail them out to uninterested parties. Our papers are located in convenient and high traffic locations ready to be picked up by those who love Beaverton. With low rates, targeted distribution and a willingness to provide more value than what you pay for, you'll find that we're just as interested in stretching your advertising dollar as you are!

Publisher / Executive Editor Cory Burden

Content Editor / Advertising Michael Wong

Graphic Design Audrey Moran

Cartoonist Ralph Scheeler

WritersContact

"The Beaverton Resource Guide is a vibrant snapshot of the Beaverton Community."

Marie Prins, Washington County Visitors Association

Chief Geoff SpauldingMark TwainFox 12 StaffTVFR StaffCity Staff

Oregon Zoo StaffAnn KoppyMark Hyde

Ginger RapportGreg MattieBob Strong

Brigid FitzpatrickSpencer RubinJolene Guptill

Larry FergusonHailee Meacham

Laila MottaghiStevie Freeman Montes

Katie WilsonJim BrooksBill Evans

Karen BadiGinger RapportCelia Lambert

Dan HortchKristie cox

Beverlee RyanChelsea Ploof

Last Month’s Cover ArtBy Ralph Scheeler

Questions or comments? Email us:

[email protected]

4575 SW Tucker Ave. Beaverton, OR 97005

503.641.3320

“Yes ma’am, new to the farmers

market i AM... specializing in

fruit fLavored bark chips,

100% Organic!“

Over the past few months, the Beaverton Police

Department has part-nered with the Portland Police Bureau in their Bangladesh Community Police Partnership Program. Thanks to funding from the United States Department of Justice International Criminal Investigative Training Assistance Program, the program is

Bangladesh each year to enhance the United States’ ability to build positive, enduring relationships with developing nations that improve long-term internal secu-rity and enhance goodwill. Police

and citizens community policing

strategies, assist them with imple-mentation, provide hands-on

instruction, modeling and mentoring to the cities of

Rajshahi and Sardah.

their responsibilities of policing in a democratic society, how to utilize citizens as an element of police effectiveness,

investigative techniques and strategies, supervi-

sory and leadership and human rights. To date, the

Beaverton Police Department

currently in-country and another

This has been a very rewarding and eye opening experience for our department and one that the

teaching others.

Welcome! (Chief’s Message) .......................................................................... 2

Shop Beaverton (Local Businesses) ..........................................................3-13

Our Town (Community News) ..............................................................14-25

Just for Fun (What’s Happening This Month in Beaverton?) ...............................26-32

Cedar Hills Crossing 3

Advertising Bulletin Board 4-6, 8, 21

Announcements 5-6

Maps 8-10

Business Directory 7-13

Thrive! Beaverton Business 14

Sustainable Beaverton 15

KPTV Channel 12 16

Beaverton History 17

Local Eats & Treats 18-19

Cruisin’ Beaverton 20-21

Automotive/Traffic Q&A 20-21

TVF&R 21

THPRD 22

Senior News 23

Oregon Zoo 24

Teen Thinking 25

Beaverton Farmers Market 26-27

City Library 29

Happy Hour Listings 29

Washington Country Event Calendar 30

Theatre & Movies 30-31

Beaverton Kid’s Corner 32

May “Easter Egg” Hunt Contest 32

Volume 4–Issue 5 (May 2014) | Beaverton Resource Guide – 3Shop Local – Give Local – Stay Local… this is how we build a better Beaverton.

C e d a r H i l l s C r o s s i n g

Massage, Waxing & Facialswww.handandstone.com

503-626-8200Mall Information

3205 SW Cedar Hills Blvd 503-643-6563

www.cedarhillscrossing.com

Vegg

ie G

rill

T-M

obile

Past

ini P

asta

ria

McGrath’sFish House

Bask

inRo

bbin

s

Bankof the West

US

Bank

SW

Wal

ker

Rd

SW

Jenkin

s Rd

SW

Hal

l Blv

d

SW H

ocken

Rd

SW Cedar Hills Crossing Blvd

State Farm

Labor Max

Thai Imports

Vogue Nails

Cedar Hills Salon

Mr. Formal

Subway

Bugatti’s

McMenamin’sPub

Entr

ance

Entrance

Entrance

13475 SW Millikan Way

Catalyst

Chiropractic

Hair MTanRepublic

Virgina GarciaMedical Center

Roxy’sIslandGrill

MOD Pizza VerizonZoomCare(Coming Soon)

OnP

oint

(Com

ing

Soon

)

Fire

hous

e Su

bs

Life

Way

PaneraBread

ULTA

PacS

un

Star

buck

s --

Mac

Sto

re --

Veriz

on --

---Fa

mou

sFo

otw

ear

NEW Stores & Restaurants Coming Soon!

Visit These Stores

INSIDEthe Mall!

A Lil'Sumpin' Sumpin'

AT&T Wireless

Beaverton Ballroom

BedCo

BG Pizza

Claire’s Boutique

Cold Stone Creamery

Game Trader

GNC

HairMasters

L&L Hawaiian BBQ

Merle Norman

MLY Jewelry

Peachwave (Frozen Yogurt)

Powell’s Books

Substunce

Sunflower Beauty

Teaser’s Top Shop

Thai Noodle Etc.

Top Shopping USA

Visionworks

Weight Watchers

971-238-4409

503-924-1819

503-274-9040

503-430-7277

971-238-4409

503-644-9142

503-352-3880

503-641-5511

503-626-8484

503-644-1835

503-726-0770

503-469-0884

971-238-4659

503-746-7729

503-228-4651

971-238-4460

503-644-9190

503-526-8970

503-941-9112

Coming Soon!

503-646-7995

800-651-6000

1-800-FANDANGO + 984#call Fandango today for movie listings. www.fandango.com

Opening Soon

ZoomCare

OnPoint Credit Union

Top Shopping USA

Now Open

Firehouse Subs

Verizon (New Location)

MOD Pizza

Events

Children’s Safety FairSaturday, May 3rd, 11am-1pmActivities include children hel-met inspections, children helmet replacements (if needed), bike safety course, basic bike safe-ty checks and adjustments, face painting! All free while supplies last! Bring your bike and helmet with you! Generously presented by NW Bicycle Safety Fair, Bea-verton Police, The Sports Author-ity. Meet us inside the Mall.

Mother’s Day FREE Gift with Purchase

Friday & Saturday, May 9 & 10, 12pm-6pmFREE Mother’s Day Gift with Pur-chase - a FREE Manicure! Simply present $75 in same day sales receipts from any combination of Cedar Hills Crossing stores/restaurants to the Gift Booth INSIDE the mall to receive your FREE Mother’s Day Gift, a certif-icate for a free manicure! While supplies last!

Sports Card ShowSaturday, May 10th, 10am-4pmThe Twin Oaks Sports Card Show will be held throughout the inte-rior mall on Saturday, May 10th, 10am-4pm. Stop by the check out the large inventory of sports cards and memorabilia.

Radio Disney EventSaturday, May 17th, 11:30am-1pmIt’s a Disney Junior Party! Come dressed as your favorite Disney Junior Character and join Radio Disney for games, music, danc-ing, prizes and a Sherriff Callie Craft Station.

Kid’s Club EventTuesday, May 27th, 5pm-6:30pmJoin us for Kid’s Club! Not a member? That’s ok! Children 12 years of age and younger are always invited to join the fun! To become a member and receive advance notice on event activi-ties, simply sign up on the “Kid’s Club” tab at top of page!

Mon-Sat: 10 - 9, Sun: 11 - 7 www.powells.com

503-228-4651

Children’s Safety Fair11 am - 1 pm • inside the mall

Saturday, May 3

» FREE Children Helmet Fitting Checks

» FREE Children Helmets (if replacement needed)

» FREE Bike Safety Course

» FREE Basic Bike Safety Check & Adjustments

» FREE Face Painting

A special thank you to all of our generous sponsors! NW Bicycle Safety Council, Beaverton Police, The Sports Authority.

3205 SW Cedar Hills Blvd, Beaverton

(while supplies last)

ents

e

Bring your bike and helmet!


(1835-1910)

“Under certain circumstances, profanity provides a relief denied even to prayer.”

“Of all the animals, man is the only one that is cruel. He is the only one that inflicts pain for the pleasure of doing it.”

“I’ve had a lot of worries in my life, most of which never happened.”

“Go to heaven for the climate and hell for the company.”

“I do not fear death. I had been dead for billions and billions of years before I was born, and had not suffered the slightest inconvenience from it.”

“The reports of my death are greatly exaggerated.”

Get a bicycle. You will not regret it, if you live.

“Always do right. This will gratify some people and astonish the rest.”

“Life is short, break the rules, forgive quickly, kiss slowly, love truly, laugh uncontrollably, and never regret anything that made you smile. Twenty years from now you will be more disappointed by the things you didn’t do than by the ones you did. So throw off the bowlines. Sail away from the safe harbor. Catch the trade winds in your sails. Explore. Dream. Discover.”

Samuel Langhorne Clemens, better known by his pen name Mark Twain, was an American author and humorist. He wrote The Adventures of Tom Sawyer and its sequel, Adventures of Huckleberry Finn, the latter often called “the Great American Novel.”

We have 1 bedrooms from $715, 2 bedrooms from $965

www.OverlookatMurrayhill.com

Drop on by and you’ll also find:

Please call us at

Heated year-round swimming poolSmoke free community

Assigned parking & more!

Conveniently located near Murrayhill Marketplace

(503)579-9326

Protecting your health and property since 1949!A local family owned & operated business.

Birds Insects & Spiders Rodents

(503) 646-2119GuaranteedPestControl.net Please call for an estimate (CCB #43186).

503-591-9031

1st Appointment Specials!Residential: Stove & refridgerator cleaned for FREE!Commercial: Floors (stripping/waxing/buffing) or carpets for FREE!

Commercial / Residential High Quality Service at Affordable Prices!

503-591-9031Cell: 503-933-6239 / Fax: 503-591-5800

Professional Cleaning Services

Call for a free estimate (Bonded & Insured!)www.craterlakejanitorial.com

Call us for FREE estimates: 503-330-2137

CC

B# 202354

Commercial & Residential Yard Work Cleanup, Bark, Hedges, Trees, Roof, Gutter, Pressure Wash, Retain Walls, French Drain, Fences, Gravel, Ivy/Junk Removal and more!

Shop Beaverton

$299 $399$149

SAVE UP TO 80% OFF RETAIL PRICES!

PortlandMattressOutlet.com503.747.2896

12602 SW Farmington Rd. Beaverton, OR 97005

$149Twin Size

Mattress & Box Set

$299Queen Pillowtop

Mattress & Box Set

$399Queen Size Memory

Foam Mattress, Box & Frame

Located next to the City Library4755 SW Tucker Avenue Beaverton, OR 97005

(503) 644-1814Catholic Book Store

Books/CDs/DVDsChristmas/NativityCrucifixes/RosariesFirst Communion

Holy Water FontsLiturgicalStatuesGifts and more!

Tuesday - Friday: 10am to 5pmSaturday: 10am to 3pm

Sunday and Monday: Closed

Thrift Shop

Consignment Shop

A bargain hunter’s paradise!

The smart, easy way to buy or sell

clothing jewelry housewaresfurniture books CDs

jewelry collectibles china crystalhome furnishings unique accessories

We believe we can make a difference...because we have.

4000 SW 117th Ave.Beaverton, OR 97005

503-526-9300

Hours Mon: Noon - 4pm Tue-Sat: 10am - 4pm

of Greater PortlandWWW.PORTLAND.ASSISTANCELEAGUE.ORG

Retail

KELLY CHRISTIANSEN 503-464-67119248 SW Bvtn Hillsdale Hwy Beaverton, OR 97005

Living Proof Moroccanoil J Beverly Hills

THE CATWALK HAIR STUDIO

“Our goal is to meet or exceed your expectations!”

RAGGEDY ANN’S DUSTBUSTERS

503-240-0787

32 Years Good Old Fashion Cleaning

• A+ Rating @ Better Business Bureau

• Listed “Best of the CITY“ by Portland Monthly Magazine

• Rates among the best that companies offer

• Insured, Licensed & Bonded

• Discounts for Seniors

503.646.8653 www.curiositiesvintage.com

12705 SW Beaverdam Road, Beaverton (behind Ludeman’s and Tom’s Pancake House)

OpenTues - Sun:

10am - 6pm

6000 square feet of vintage shopping space to explore!

General

To place your business card here, email [email protected] Bulletin BoardBBBBBBeB


503.350.1234

Same Day Crowns Available!

Conveniently located in Downtown Beaverton (4690 SW Hall Blvd.)

PreferredDentalCareCenter.com

Nic Grasvik, DMD

GENERALCOSMETIC FAMILYDENTISTRY

(503)590-7574

Scott R. Walker, D.M.D.

www.MurraySchollsFamilyDental.com

in Progress Ridge | 503-352-5202 | www.playboutique.com

Healthcare

Advertising Bulletin Board

503-641-5678www.MVPdanceelite.com

12570 SW Farmington Rd. Beaverton (3yrs to Adult)

Jazz | Tap | Ballet | Lyrical | Contemporary | Hip Hop | Breaking | Acting Acro | Stretch-n-Strength | Toddler Combination & Specialty Classes

Bricks & Minifigs503.644.5701

facebook.com/[email protected]

3861 SW 117th Ave | Beaverton, OR 97005

WE DO BIRTHDAY PARTIES!

Announcements

Beaverton City HallMayor’s Office, City Council, Water Utility Billing, Police Dept., City Courts, Neighborhood Programs, Arts Commission & more. (4755 SW Griffith Dr.) www.beavertonor-egon.gov, 503-526-2222

Spring Book & Media Sale (Location: Beaverton City Library) The New Friends of the Beaverton City Library invite you to their 4th annual Grow Your Mind book sale. 5/1 Thursday 10 am - 8 pm 5/2 Friday 10 am - 5:30 pm 5/3 Saturday 10 am - 2 pm Books half price Saturday at noon.

FREE Mediation AssistanceBuilding community one con-versation at a time! The Dispute Resolution Center helps neighbors, landlords, tenants, HOA members, businesses, seniors and others resolve their differences. Call us, we’re here to help. 503-526-2523

History PresentationJoin us at the Beaverton History Center every 2nd Tuesday, 7 - 830pm, for an enjoyable evening. For details, see the History page in this issue.

Got homework? Beaverton City Library offers trained volunteer homework helpers after school and in the evenings. Whether you’re looking for help with math, science, writing, or almost any other subject, our Homework Helpers are here for you! Helpers for grades 6-12 can be found in the Teen Room, Main and Murray Scholls libraries.

Library Storytime Pre-school: Tuesdays at 9:30 (ages 3-6). Toddlers: Thursdays at 11:30 (ages 2-3). 503-644-2197

Restaurant & Office Space Avail. at the Village on Scholls Ferry (16315 SW Barrows Rd) For more information: 503-747-7238 [email protected]

Fundraising@Dairy QueenThe Downtown Beaverton Dairy Queen donates a portion of all cake sales sold at regular price to both the Highland Park Band and the Beaverton High School Bands & Ensembles. Customers simply need to stamp their receipt with the school of their choice and place in the customer comment box. This offer is year round!

11 City NAC Meeting Locations1-Central Beaverton NAC: Beaverton Community Center 2-Denney Whitford / Raleigh West

(Continued Page 6)

Medical Alarm, Inc.

(503)644-4736

www.columbiamedalarm.com

Personal Safety & Health Solutions

Just For Fun

To place your business card here, email [email protected] Beaverton Bulletin BoardB d


503-644-0129 | 4705 SW Watson Ave

www.beavertonflorists.com

Friday Flowers, ONLY $4.99!Friday Flowers, ONLY $4.99!

(Continued from page 5)

Announcements

503-579-160014661 Teal Blvd, Beaverton, OR 97007 (near Safeway in Murrayhill)

158th & Walker Rd (Across from Fred Meyer) | www.monteauxs.com | 503-439-9942

Join Us For Lunch or Dinner!

Wild Salmon Filet . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17Roasted salmon, a bed of confit yukon potatoes with leek cream sauce

Chili Verde Burger . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12Topped with roasted new mexico chili, onion and jalapeno blend

Dine in or Take out12600 SW Crescent St #150503-718-7101planetthaibeaverton.com

(Locally owned and operated)Let’s share the meals our moms taught us in Thailand

$5 OFF!Your meal of $30 or more

or

$10 OFF!Your meal of $50 or more

(expires 05/31/2014)

Coupon

Expires 05/31/14 PLU # 19 Expires 05/31/14 PLU # 20

Expires 05/31/14

Advertising Bulletin Board

Beaverton Bulletin Board

Edgewood Downs Retirement Ctr 3-Five Oaks Triple Creek NAC: Elmonica Elementary School 4-Greenway NAC: Conestoga Middle School Library 5-Highland NAC: Beaverton Resource Center 6-Neighbors Southwest NAC: Nancy Ryles Elementary School 7-Sexton Mountain NAC: Sexton Mt Elementary Cafeteria 8-South Beaverton NAC: Southridge HS, Community Room 9-Vose NAC: Beaverton Community Center 10-West Beaverton NAC: Seventh Day Adventist Church 11-West Slope NAC: West Sylvan Middle Sch. Library **For dates and times, visit: www.BeavertonOregon.gov/NAC

Donate Books, CDs & DVDsThe Book Corner is a used bookstore run by the New Friends of the Beaverton City Library. Fiction/Nonfiction/Children’s Books Available. Open: Tues-Sat 10 am - 4 pm, 12470 SW Fifth St., 503-643-5188. Shop our Amazon store at: BookCornerBeaverton.org

Multifamily Recovery Groupto help support positive changes. Learn how to set boundaries and tune in to your own wisdom. Plz call 503-980-3118 (Sliding scale).

Learn about OsteoporosisFrom toddlers to grandmas, learn about the importance of bone density for all ages. May 20, 630pm at 485 NW Saltzman Rd, 97229. Presented by Community Health Education Forum, 503-575-9261

Aloha Historical SocietyAnthony Mills and Eric Squires are taking the initiative to start a historical society for the urban, yet unincorporated area known as Aloha, Oregon. The Aloha Historical Society already has a website and is delivering content of podcasts, the first recorded at the neighboring Beaverton Historical Society of the promi-nent Attorney John Tyner. Learn More & Get Involved, visit www.AlohaHistory.com.

Pop and Paint FundraiserBenefiting Diabetic Support Services. Create your own personalized painting. Artistic directors will be available for your support. All you need to do is show up and have fun. All supplies are included. May 4th, 4-730pm at Hide Away Bar & Grill (18385 SW Tualatin Valley Hwy), $37, RSVP: 503-523-7478

Is it really*less than $100*to put my business card here??Yes!

Restaurant Coupons

To place your business card here, email [email protected]

(Continued Page 7)

Expires 04/30/14

2 Entrees & 2 Beverages

or $2.50 Off the Purchase of 1 Entree & 1 Beverage

OFF!$5

Valid at participating restaurants. Side dishes, kids meals, beverages and pies are not consid-ered an adult entree. Not valid with other offers, promotions or discounts. Not valid with Pie Rush Wednesday. One coupon per person per visit. No cash value. Sales tax, if applicable, must be paid by customer. Gratuity not included. Expires 5/31/14.


L o c a l B u s i n e s s D i r e c t o r yBusiness

Directory

Arts & Culture

Will you help reverse theDIABETES EPIDEMIC in AMERICA!

If not for yourself, a loved one? www.wellnessasalifestyle.net

All local artists, All original art!Free monthly reception! See story in Just For Fun section

www.artonbroadway.net 503-601-3300 C3

Beaverton Civic TheatreBeavertonCivicTheatre.org

503-754-9866

Visitors Center forBeaverton and Washington County

oregonswashingtoncounty.org 503-644-5555 B2

Lana L. Nelson Oil PaintingSee my work LanaLNelson.com &

www.villagegalleryarts.org/ lana-lnelson/ (in Facebook too!)

Call me at 503 830-7894

Sustaining High Quality Artwithin the community. Providing

culturally enriching activities, programs and services. www.beavertonarts.org

Learn About our City’s Pastthrough historic photos, artifacts,

exhibits and more! Open Tu/Th from noon to 4pm.

www.historicbeaverton.org C3

Broadway Rose Theatrewww.broadwayrose.org

503-620-5262

HART Theatrewww.hart-theatre.org

503-693-7815

Auto Care

Alexia's Window TintingSigns & Banners, clear bra paint protection, safety/security film. www.alexiawindowtinting.com

503-671-9615 B2

Local NAPA Auto Auto CareCenter for over 25 years! 16770 SW Shaw St, Aloha www.atbautorepair.com

503-642-7070

www.kunicollisioncenter.comLuxury Services at Affordable

Prices. Free estimates. Rental cars available onsite.

503-372-7563

Proudly celebrating 75 years!Eco-Biz certified, Family owned 11800 SW Bvtn.-Hillsdale Hwy HeitzmanBodyAndPaint.com

503.646.5181 D3

Beaverton Infinitiwww.beavertoninfiniti.com

888-319-6583

Banking

Services

The Right Bankfor your business.

Call one of our client service specialists TODAY! 503-350-1205

www.therightbank.com C3

Personal & businesssolutions, real estate loans

Call a personal banker today. 503-579-1947

www.bannerbank.com B

BankingConsumer and business

accounts, loans, mortgages www.onpointcu.com

503-228-7077 A

Body & Beauty

Tokyo BeautyGreen Peel Treatments

Full Body Waxing, Facials Hair Cuts & Beauty Care

Call Minh Le, 503-643-5907 B2

Make a Day Extraordinary!Specializing in color, cut & styling for every occassion.

We are a Goldwell Alliance Salon. 503-644-0510 C3

Murrayhill MarketplaceVersaSpa Spray on tan 1-only $30, 2-only $50

oasistanningoregon.com 503-521-8268 A

Nutritional MakeoversLearn how to eliminate medication

through eating healthy. Celia Lambert, PhD

971-732-6777

The Catwalk Hair StudioLiving Proof, J Beverly Hills,

Moroccanoil Call Kelly Christiansen at

503-464-6711 S4

Full Service Salonfor Men, Women & Kids,

Facials, Skin Care Head to Toe Waxing

503-430-0008 D

Education &

Learning

Beaverton City Library12375 SW 5th St, Hours:

Sunday 1pm - 5pm, Monday - Thursday: 10am - 9pm, Friday:

10am - 6pm, Saturday: 10am - 5pm (503) 644-2197 D3

Looking for a career in IT?Learn computer science, Python, Mobile development, JavaScript,

ASP.NET, C# and more! 888-503-2906 B3

Support Your Library

by donating to the Beaverton Library Foundation online @

beavertonlibraryfoundation.org

Lim’s Taekwondo AcademyBe competetive, be a champion!

503-277-7711 D2

Learn to sew, quilt and create your own clothes. Kids and Adult

classes. Call 503-526-9999 *Wicked Stitch of the West* B4

French LessonsExperienced Teacher & Native

Speaker. All ages OK! Call Danielle @ 503-746-4424

Preschool- Grade 7Education centered in the heart.

livingwisdomportland.org 4855 SW Watson Ave. Beaverton

503-671-9112 C4

Learn Taoist Tai Chiwww.oregon.usa.taoist.org

503-220-5970

Bilingual Chinese PreschoolReggio inspired & play based

curriculum. After school, enrich- ment activities. 971-225-0698

risingstarchineseschool.com C4

Customized Learningin a choice-based environment.

Small classes, all subjects, PreK - High School.

www.villagehome.org 503-597-9100 C4

Aloha Community Librarywww.alohalibrary.org

503-746-6918

Food & Drink

Local Listings for Beaverton...See Just for Fun section!

HappyHour

Do you find to snacking and drinking with friends fun and

entertaining? Well we sure do and that’s why you’ll find our list of

local happy hours in our Just For Fun section.

Join us for Weekend Brunch!Enjoy Breakfast, Lunch or Dinner

by the Lake at Murrayhill. www.cafemurrayhill.com

503-590-6030



Ava Roasteriawww.avaroasteria.com

503-641-7470 C4

Hall Street Grillwww.hallstreetgrill.com

503-641-6161 B1

SW Barrows Rd

SW

Hor

izon

Blv

d

SW Scholls Ferry Rd

CCCCCoommmmeee VVVVViiiissitttt

503-747-7238 | 16315 SW Barrows Rd. Beaverton

g g503-641-6161161666111111116666666611111 BBBBBB111BBBBBB111BB1111111111111BBBBBBBBBB111BBBBBBBBBBBB1111BBBBBBBBBBBBB11BBBBBBB1B1111BB11BB1B11BB111

Retail Space NOW Available!


BeavertonCity Library

BeavertonPost Office

BeavertonHistoryCenter

Elsie Stuhr Center

BeavertonSwim Center

BeavertonHigh School

TVR&RStation 67

BeavertonTown Square

Canyon PlaceShopping Center Canyon

Square

Beaver Creek VillageShopping Center

Hall Street Center

The Round

A

Parking

Parking

Parking

Parking

A

Parking

Sun ConnectionTravel & Cruises

Columbia MedicalAlarm

HeitzmanBody & Paint

Beaverton FamilyChiropractic

Fred MeyerTrader Joe’s

Starbucks

Starbucks

Cedar HouseMedia

BeavertonPharmacy

Motel 6

Lim’s TaekwondoAcademy

24 HourFitness

Hall Street CenterBeaverton Law GroupPacific Medical GroupFanno Creek Healing ArtsDon Filippi Ins. Agency

fromBlessings

Heaven

Ava Roasteria

La Hacienda RealMexican Restaurant

Bricks & MiniFigs

Assistance Leagueof Portland

PacificContinental

Black Bear Diner

GuaranteedPest Control

Comfort InnBudgetHotel

Things from Another World

Tom’s Pancake

House

Alexia’s WindowTinting

Curiosities

GoodiesCell Phone

Shop

Hometown Buffet

Beaverton EducationFoundation

Goodwill

Goodwill

Optimum Capital Strategies

BESThq

McDonalds

Taco Bell

New Seasons

Hall Street Grill

BeavertonSigns

Planet Thai

Chamber of Commerce

KuniCollision Center

Camelia’sCandles

MVP Dance

Sage Center

Honey ToastCafe

Beaverton Florists

The Vault

Irina Moga, DDSDenture Clinique

Wicked Stitchof the West

GoodnessCoffee

Singing RiverNatural Medicine

Haven Spa,Pool, Hearth

First UnitedMethodist Church

Rising StarChinese School

Book CornerBiZee BirdStore

Living WisdomSchool

Dairy Queen

VillageHomeSchool

Quilter’sCornerStore

Art on Broadway

Gloria’s Secret Cafe

SunsetComputer

Einstein Bros Bagels

Emerald City Smoothies

Noodles & Company

Arts & CommunicationMagnet Academy

(ACMA)

City Hall& Police Dept

Decarli

MattressOutlet

FringeSalon

Mill e Moto

Apple BlossomPhotography

Preferred DentalCare Center

StarkstreetLawn & Garden

Fresh Start DetailRingo’s

Beaverton LodgeCreekside Village

BBB

Farmington Rd

Canyon Rd

Canyon RdBroadway St

Lom

bard

Ave

Lom

bard

Ave

Hoc

ken

Ave

SW

Wat

son

Ave

Millikan Way

Eric

kson

Ave

Gri

ffith

Dr

7th St

Cady Ln7th St

7th St

Was

hing

ton

St

Ang

el S

t

Bet

ts A

ve

Sto

tt A

ve

Mai

n S

t

Fran

klin

Ave

Tuck

er A

ve

Tuck

er A

ve

9th St

9th St

10th St

8th St8th St

6th St

6th St

Hazel St

6th St

2nd St2nd St

3rd St

4th St

1st St

Center St

117t

h A

ve

114t

h A

ve

122t

h A

ve

123t

h A

ve

124t

h A

ve

125t

h A

ve

5th St

5th St

Hal

l Blv

d

Hall Blvd

Wat

son

Ave

Tualatin Valley Hwy

Ced

ar H

ills

Blv

d

217

Bvtn Hillsdale Hwy

Crescent Ave

217

8

10

A B C D E

A B C D E

1

2

3

4

5

1

2

3

4

5

Downtown Map

L o c a l B u s i n e s s D i r e c t o r y

Beaverton First Friday, May 2ndMusic, Sidewalk Vendors, Art and DiscountsODowntown Association will host an International themed First Friday event that includes a variety

addition of free limo service, more musicians, more sidewalk vendors and free First Friday reusable tote bags.

Free Limo Service FREE hop-on/hop-off service

will be available during the hours

of 5-8pm. There will be 5 stops with Limo signs around the First Friday area between Broadway

limo will be making rounds all evening picking up visitors to take them around the area.

Music

Galley (outside at Natural Grocers), Klezmacracy (main band

Brown(harpist outside at Peddler’s

(outside at Beaverton Florist).

Sidewalk vendorsThere will also be new side-

walk vendors including a distillery, vodka maker, fresh jams, art

photography, art prints and spe-cialty dog treats.

EventsSpecial Performances by:

Rock Creek Campus Choir from 7

Host Business for MayNatural Grocers. Come see

of Africa as she demonstrates the art of African Cuisine. (Sponsored by Beaverton Sister Cities Advisory

Shopping bagsThrough the generous donation

of 6 businesses, we have free First Friday shopping bags available in

while supplies last. Klezmacracy performs live on

Broadway St on May 2nd

Find us on Facebook or visiiiisitttt - - >>>>>>- >- > wwwwwwwwwwwwwwwwwwwwwwwwwwwww bbbbbbbbw bw bw bw bw bw bw bw bw bw bw bw bw bw bw.bw.bw.bbw.bw.bw eaveaveaveaveaveaveaveaveaveaveavaeaveaveaveaveaveaveaveaveaeaveaeaveae erterterterterteertertertertertertertertertertrertertertertertererte onronronronronronrnonronronronronrononronronrnonrononoo esoesoesoesoesoesoesoesoesesoeese urcuruurcurcu eegegegegegegggggggggguguguuuuuuggggeeeguegegg ide.ertert ronronrrn sesoeesooeso rcurcurcurceeegeeee

5 Nights/6 Days, land-only rates, only available at Sandpiper Bay, Florida

(does not include any airfare, transfer or travel insurance.

CLUB MED RESORTSSandpiper, Florida

Sun Connections Travel & Cruises | 503-655-4850 | [email protected]

$830 per adult (all inclusive rate)

$415 per child (15 years and under)

Price includes:

Call/email office for airfare costs or more information

Travel Layaway Plan!

Only $150 per person deposit required to confirm trip.

Final payment is not due until July 7, 2014

Historic Downtown District



Sylvan Zoo House & SaloonFull Menu w/Pizza & Patio Seating

--w/e Brunch w/Free Mimosa-- --HH Daily 3-6pm & 9pm -Close--

--all Sports Pkgs, 19 Flat Screens-- www.sylvanzoohouse.com

503-297-5568 (Dine in / Take out)

Authentic Jalisco StyleMexican Cuisine. $5 Lunch

Specials in 5 min or it's FREE! www.guichosrestaurant.com

503-746-5980

Schwan’s Home Food Service*Open Your Door To Delicious!*

Over 350 delicious foods, delivered right to your door! NEW CUSTOMER SAVINGS!

Call Donna at 503.716.2231

A Little Taste of El SalvadorOpen Tues-Sat: 11am-3pm.

Saturday Breakfast 9am-11am. Homemade salsa and soups to go! 503-268-2124 B4

Goodness Coffee HouseA Family Cafe w/ a Healthy menu.

Gluten free welcome. goodnesscoffeehouse.com

503-616-3020 B4

Licensed Preschoolw/school readiness programs Mention ad for 20% discount

[email protected] www.playboutique.com D

In Progress RidgeLunch~Dinner~Late Night Dining

Full Bar~16 Beers on Tap Happy Hour Daily 3-6pm, Su-Th 930p-closing. www.bjwillys.com

503-747-7319 D

Thai & Laos CuisineDaily special from $6.95

Try our Spicy Mango Chicken! M-Th: 11a-9p / F-Su: 11a-10p

503-579-7542 D

Bar & RestaurantLunch, Dinner, Brunch, Cocktails

Happy Hour 4-6p www.watsonhallbar.com

503-596-2153 B3

TapatioMexican Restaurant

503-649-7545

VinotopiaRestaurant & Bar

503-597-6911 D

Honey Toasts, Bubble Tea, illy coffee & more!!

Open Tuesday-Sunday www.honeytoastcafe.net

503-747-2712 C3

Black Bear DinerBreakfast, Lunch, Dinner

503-646-4507 A3

Featuring our Cheesburgers& beer garden. All lottery games.

Happy Hour M-F: 4-7. www.ringosbar.com

503-644-7847 E3

Crazy Sushi ShotenDine in or Take out

503-746-6373

Dairy Queen BeavertonBurgers, hot dogs, chicken,

salads, shakes, cakes and more. Fan Food not Fast Food!

503-644-3469 B3

Italian inspired with a menuthat changes weekly featuring

fresh seasonal ingredients from the Northwest. 503-641-3223

decarlirestaurant.com C3

Sambi Japanese Restaurant;Sushi, Tempura, Ramen & More!

503-296-0045 S4

Village Inn Restaurantwww.villageinn.com

503-644-8848 S2

Monteaux’s Public Housewww.monteauxs.com

503-439-9942

Noodles, Salads & Sandwichesfrom around the world.

All for around $8! www.noodles.com

503-350-0591 E3

M-F Lunch Specials, $5.95Fresh tortilla’s made daily. Happy hour daily, 3-6pm

Dine-in or Take-out. 503-601-7000 D2

Breakfast-Lunch-Diner30 varieties of pancakes & waffles. Beaverton’s Favorite Restaurant!

503-646-2688 B3

Coldstone CreamerySee coupon in Food section

503-646-4507

www.ernestositalian.com*Great Lunch Menu *Dinner Specials *Banquet Facilities

*Happy Hour in Cozy Bar! 503-292-0119 S5

Food Photography Servicesby Cedar House Media

503-641-3320

Azteca Mexican Restaurantwww.aztecamex.com

503-643-8269 N2

Thai Home CookingJust how our mothers taught us! Dine in, take out & happy hour. www.planetthairestaurant.com

503-718-7101 C2

General

Services

Cartridge Network6800 SW Beaverton Hillsdale Hwy

Portland, OR 97225 www.cartridge-network.com

503-246-0665

Crator Lake JanitorialProfessional Cleaning Services

503-591-9031

\

Custom Sewing, Embroidery & Alterations

Wicked Stitch of the West “We make it YOURS!”

503-526-9999 B4

Goodies Cell Phone Shopbuy, sell, repair, bill pay, PCs too!

503-935-4495 B2

FOX OregonChannel 12

www.kptv.com

Brisbin Computer ConsultingFrom corporate networks to home

helpdesk and affordable web design, let me know how i can be

of service... 503-641-3320.

Your Full Service Sign Company!www.beavertonsigns.com

[email protected] 3899 SW Hall Blvd

503-672-9037 C1

Natural Birth Center and Family Care ClinicHealth

Available

2100 SW Camelot Ct., Portland, OR 97225(503) 252-8125 CanyonMedCenter.com

Vaccine Seminars, Birthing Classes and Presentations on Various Health Topics each month… See our website for details!

Clockwise from top left: Dr. Karen DeWitt, ND

Dr. Seth Burrell, ND Dr. Leslie Hamlett, ND

Dr. Nathan McVeigh, ND

SW Barrows Rd

SW

Wal

nut

St

SW

Hor

izon

Blv

d

SW Scholls Ferry Rd

SW

Mur

ray

Blv

d

Gas

SW Teal Blvd

SW Osprey Dr

SW

Dav

ies

Rd

B

A

C

DE

MurrayhillMarketplace

Murray & Scholls Map

Village at Scholls Ferry

Progress Ridge

Albertson's Shopping Center

Murray Scholls Townsquare


Get $10 OFF per monthYou want DirectTV, I have

DirectTV. Use my referral code when you sign up and we both get $10/month OFF! Call Mike @ 503-314-3459

The Strong VoiceCommercial Voiceover

www.thestrongvoice.com

Your Local Business PartnerProfessional printing, graphics,

photography, web design, marketing and advertising. Home

of the Beaverton Resource Guide! www.cedarhousemedia.com

503-641-3320 C3

The Elsie Stuhr Centeris designed for adults 55 years

and better. Classes, trips events, fitness center, lunch and friends

503-629-6342 C5

Sun ConnectionsTravel & Cruises, LLC

**Layaway Plans Available**. www.sunconnections.com

503-655-4850 D3

AM 1360 KUIKThe Voice of Washington County

www.kuik.com

Health Care

Integrated Massage & Reikiharu.massagetherapy.com

971-340-8860



Family Chiropractic CenterSpecializing in children and

athletes. Wellness Awaits You! www.tpcportland.com

503-574-4872

Traditional East Asian MedicineAcupuncture, Herbs, Massage,

Qi Gong, Movement Therapy Mill-e-Moto.com

503-372-6463 C3

Precision Compoundswww.pcrxpdx.com

503-292-1146 N4

Natural Healthcare ConsultantAromaTouch & Reiki Therapist

www.doterraculture.com 503-730-8102

Dr. Dan MillerVisit our Maximized Living clinic!

BeavertonFamilyChiropractic.com 5075 SW Griffith Dr, Suite 120

503-644-8844 E5

Medical Alarm, Inc.

Local LifeLine ProviderPersonal health & safety solutions including GPS

& medication dispensing ColumbiaMedAlarm.com D4

Fanno Creek Healing Arts, LLPHall St. Station · 4530 SW Hall

Chiropractic · Acupuncture Naturopathy · Massage

503-644-6555 C3

Preventive, WhiteningAesthetic, Operative Implants, Periodontal

www.murrayhilldental.com 503-521-1333 B

Comprehensive dentalcare for your entire family. Visit us at:

murrayschollsfamilydental.com 503-590-7574 B

Dr. Robert ShermanAuto Accident Injuries,

Spinal Care & more. www.murrayhillchiro.com

503-590-4000 A

Prescription delivery, drive-upwindow, fine giftware,

mobility- DME sales/rentals medicare accredited

503-644-2101 C3

Michael Moga, LDFull and partial dentures

Open 7 days a week by appointment!

503-643-6213 B4

Dr Irina Moga, DDSFor your Smile, For your

health, For you! www.drmoga.com

503-646-5909 B4

Family PracticeSpanish, Hindi & Punjabi

speaking providers available. Mon-Sat Extended Hours

503-644-1171 C3

Office of Dr. MeansNaturopathic physician,

Acupuncturist, Nutritional suppliments & massage

503-641-6400 B4

Rebound Massage Therapyreboundmassagewellness.com

503-746-6585 A

Are You Ready for a Tune Up? Gentle Therapy for

*Individuals, Couples & Families* Groups too! Beaverton and

Sherwood. Please call Coleen Moreno,LCSW

503-980-3118. C3

Housing &

Home care

Free House Painting Estimates!Exterior & interior painting, decks and power washing.

www.smarthomepainting.com Call us at (503) 303-1475

BUY, LIST Your HomeFull service property managements. 9880 SW Bvtn-Hillsdale Hwy, #100

www.PdxHouseForRent.com 503-530-8246


217

SW Beaverton Hillsdale HwySW Beaverton Hillsdale Hwy

SW

107th Ave

SW

109th Ave

SW

110th Ave

SW

103rd Ave

SW

99th Ave

SW

96th Ave

SW

91st Ave

SW

White Pine Ln

SW Apple WaySW Apple Way

SW

Laurelwood A

ve

SW

Western A

ve

SW

Jamieson A

ve

Michael’s

KaiserPermanente

US BankChase BankAzteca

PrecisionCompounds

Catwalk Hair Studio

Heritage Schoolof Interior Design

Sambi JapaneseRestaurant

Ernesto’s Italian Restaurant

Sisters N StyleVillage Inn Scandia Imports Craig's

Rare Coins

Borean Realty

SignatureShoes

Smith & BevillJewelers

China Delight

Valley Plaza

JesuitHigh School

AM KennedyPark

McMillianPark

See Downtown Map

1 2 3 4 5

NO

RT

H

N

SO

UT

H

SBeaverton Hillsdale Hwy Map


Raleigh Hills Assisted Livingwww.rhliving.com

503-297-3200

Solar Works in Beaverton!Ask me about my 4kW system on

lease for $0 down and only $31/month. For 5 months last

summer, my PGE bill was $0! For more info, [email protected].

All Gutters & MoreInstallation and Cleaning

Moss removal, pressure washing, gutter cleaning, roof repair.

FREE estimates. Licenced & Ins’d. 503-268-9121

Lisa Fain, Realtor/Prop. Mgmt.Beaverton/Westside Specialist!

Working w/buyers, sellers & investors. The Sunset Group

503-679-8477 A

Retirement ResidenceHit the road with us because we

never stand still for too long! www.beavertonlodge.com

503-646-0635 B5

FOR SALEResidential Listings

(Address | Bdr/Bth/SqFt=$)Sponsored By

Portland Metro's ONLY LocalReal Estate Newspaper!

allthingsrealestatepdx.com503-641-3320

Home$ in 97005

420 SW 133RD AVE 3/1/1132=$205,000

13480 SW RITA DR 2/1/1132=$209,900

12290 SW 12TH ST 3/1/1407=$220,000

13080 SW RITA DR 3/1/1140=$240,000

13381 SW DEVONSHIRE DR 3/1/1008=$260,000

14370 SW LISA LN 4/2/1848=$275,000

11860 SW WALKER RD 2/2.1/1394=$283,900

3340 SW MERCER TER 4/2.1/1961=$305,000

13045 SW CASTLEWOOD ST 3/1.1/1660=$312,000

13466 SW DEVONSHIRE DR 3/1.1/1212=$315,000

1921 SW 144TH AVE 4/2.1/1748=$324,001

10075 SW KENNEDY ST 4/2/2324=$379,950

Home$ in 97006

18146 SW NIKS DR 3/2.1/1538=$214,900

19600 SW ALEXANDER ST 3/1/1978=$220,000

1191 SW 182ND AVE 3/2.1/1419=$224,900

20726 SW GRACIE ST 3/2.1/1399=$229,950

18435 SW LONGACRE ST 3/2.1/1526=$230,000

18660 SW AUGUSTA LN 3/2/1350=$234,900

2790 SW 199TH PL 4/2/1424=$234,900

20603 SW LONGACRE ST 3/2/1332=$234,900

3169 SW 176TH AVE 3/2/1488=$250,000

21485 SW ROCK RD 3/2/1379=$262,000

21795 SW LOIS ST 4/2.1/1760=$265,000

517 SW 199th AVE 4/2.1/1642=$276,990

2195 SW 203RD AVE 3/2/1828=$279,000

577 SW 198th AVE 4/2.1/1642=$289,990

1314 SW 216TH PL 4/2.1/2042=$294,900

21290 SW WINTERFIELD LN 4/2.1/1824=$295,000

3107 SW 197TH AVE 3/2.1/1996=$309,500

19695 SW SHAROAKS DR 4/2.1/2028=$314,500

20531 SW ANNA CT 3/2.1/2112=$318,000

Home$ in 97007

6217 SW 205TH AVE 3/2.1/1672=$200,000

5050 SW 175TH AVE 3/2/1346=$229,900

17080 SW VINCENT CT 3/2.1/1324=$229,900

7295 SW MILLENNIUM TER 4/2.1/1682=$250,000

18478 SW OAKVILLE CT 4/2.1/2216=$259,900

5810 SW 176TH AVE 4/2.1/1760=$259,900

20789 SW EGGERT WAY 4/2.1/1796=$289,900

16821 SW WRIGHT ST 4/2.1/2021=$299,900

14795 SW CITRINE WAY 3/2.1/1366=$319,900

8440 SW 184TH LOOP 3/2.1/2460=$350,000

7606 SW 194TH TER 4/2.1/2231=$369,900

7785 SW GEARHART DR 4/2.1/2408=$374,900

Home$ in 97008

12150 SW KEAS CT 4/2/1612=$289,900

13880 SW MARTINGALE CT 4/2/1773=$289,900

9940 SW 135TH AVE 3/2/1408=$289,950

9740 SW ROBBINS DR 4/3/1590=$300,000

7275 SW CRESMOOR DR 3/2/1984=$319,900

8385 SW CONNEMARA PL 4/2.1/2116=$329,000

13850 SW STIRRUP ST 3/2/1568=$335,000

14230 SW KIMBERLY DR 4/3/2229=$340,000

12675 SW TIGER LILLY LN 4/3/2530=$369,900

Milton Yard MaintenanceFull Yard Service & Clean up

503-330-2137

Senior Living CommunityWe make it easy to feel

right at home. www.creekside-village.com

503-643-9735 B5

Divine Window DecorBlinds, Shades & Shutters Free in Home consultation

www.DivineWindowDecor.com 971-282-2306

Guaranteed Pest ControlProtecting your health and

property since 1949! www.guaranteedpestcontrol.net

503-646-2119

Edgewood DownsIndependent Ret. Community

503-643-5418

MovingForSeniors.comSmooth Transitions

503-590-8562

earthstoneof Beaverton

Charming Boutique-Style Assisted Living

Close to the Elsie Sturh Center! www.hearthstonealc.com

503-641-0911

Pet Care

Companion Pet ClinicQuality Care, Affordable Prices

503-641-9151

Healthy Affordable Pet Supplies Grooming & Self-wash. Cat adoptions available.

www.naturespetmarket.com 503-579-2403 A

The place for all your bird needs.Exotic birds, healthy foods,

toys, boarding & advice. Great prices! 503-644-9515

www.bizeebird.com C4

Grooming at your DoorstepYour Full Service mobile pet

grooming provider since 2007 www.dogvan.com

503-995-8991

Professional

Services

Business Done Here!Printing, Shipping, Freight,

Notary, Gifts, Card and more! $10 PMB boxes available.

503-747-2278 D

ADAMS - UFFELMAN - RAVELO - NGUYEN

Personal Injury, Criminal LawDUII, Immigration, Wills/Trusts Probate, Family/Business Law

www.beavertonlaw.com 503-644-2146 C3

Sunset Computerswww.sunsetcomputer.net

503-866-3747 B3

The RoundRes/Com space avail.

503-381-1670 B2

Village on Scholls FerryClass A Retail Complex.

Restaurant & Office Space Avail. www.guansusa.com

503-747-7238

Raleigh Hills Assisted Living 12290 SW 12TH ST 577 SW 198th AVE 7275 SW CRESMOOR DR

We l c o m e t o B e a v e r t o n , t h e B e s t D a m C i t y i n O r e g o n !

Includes new patient exam, x-rays and routine cleaning.

For your smile, for your health, for you...For your smile, for your health, for you...

Restrictions apply,call for details.$79 Special Offer:

-- Irina Moga, DDS

We offer comprehensive dental care for the whole family.We strive to provide patients with friendly, quality care in a relaxed atmosphere.

4970 SW Main Ave., Suite 200, Beaverton, OR 97005 | www.drmoga.com

503.646.5909


An Oregon Registered Investment Advisor Firm.

Financial planning Portfolio mgmt www.investocs.com

971-250-0301 E5

Don Filippi Insurance AngencyBusiness & Commercial,

Auto, Home & Life Insurance www.donfilippiagency.com

503-646-4101 C3

Independent Insurance AgentBig and Small, We Write it All. Business Ins., Worker's Comp.,

Home, Auto, Health/Life. 503-644-9945

www.lianenishimura.netAuto, home, life, renters,

health, business, boat & more! Call Liane at

503 579-3005 A

Hough Law | Nicole A. HoughFamily Law | Estate Planning

503.208.6610 www.houghlawfirm.com

Religious

& Spiritual

Open Minds, Open HeartsOpen Doors. Beaverton First

United Methodist Church. www.beavertonumc.org

Sunday Worship: 10:30am 503-646-7107 C4

Retail

Quilter’s Corner StoreFabric, Kits, Gifts & More

503-819-0214 Tues - Sat C3

We do Birthday Parties!www.bricksandminifigs.com

503-644-5701 D2

Classic & New Video GamesBUY-Sell-Trade-Repair

Greenway Shopping Center www.gamehavenclassic.com

503-372-6817

We Buy Gold & Silver!Engagement, Jewelry, Antique,

Timepieces, Gifts, Service/Repair. www.smithandbevill.com

503 644-1333 N3

Thrift & Consignment ShopA bargain shoppers paradise!

Clothing, jewelry, books & more. portland.assistanceleague.org

503-526-9300 D2

Real Local Florist*Flowers for every occasion, plants, cards, gifts & more! www.beavertonflorists.com

503-644-0129 C4

A Vast Selection of Treasures

Purveyers of antique, vintage and collectible merchandise. www.curiositiesvintage.com

503-646-8653 B3

Mattress Outlet$149 Twin Mattress & Box set

503-747-2896

Catholic Book Store & Gift ShopRosaries, statues, crucifixes,

DVDs and more. www.blessingsfromheaven.org

503-644-1814 C4

All natural candlewaxRecycle old candles and get credit towards a new one.

Open Wed-Sat 10-6 or by appt. 503-318-9648 C3

Scandia Importswww.scandiaimports.com

503-643-2424 S3

Signature Shoeswww.signatureshoes.com

503-626-8413 N3

The Vault Vintage Clothing Boutique

Vintage Clothing for the Modern Woman. 503-520-9369 C3

A d v e r t i s i n g h e r e s t a r t s a t o n l y $ 1 0 / m o n t h , C a l l 5 0 3 - 6 4 1 - 3 3 2 0 To d ay !

Oregon Metropolitan Elite Gymnastics Academy

503.466.4872

Locally Owned | Recreational Classes Parent and Me Classes | Camps

Birthday Parties | Competitive Team Field Trips | Drop-In Classes

OMEGA - | 8160 SW Nimbus AVE, 5E, Beaverton OR 97008 | www.omega-gymnastics.com

Aloha Business Association: Shop Local, Shop Aloha!

President’s MessageSupport Our Schools and Local Fire District, PLEASE VOTE!

Mission / VisionVision: Stewards of the Path to 2040. Mission: Serve as a Voice for Changes that Impact the Aloha Com-munity--Property owners, Business owners, Residents/consumers.

About UsThe Aloha Business Assoc. supports a strong community that is affordable, accessible and safe! Be sure to check out our website to see our “Everything Aloha” community calendar. www.alohabusinessassociation.com

Board MembersPresident:Karen Bolin, Edward Jones

Secretary:John Tyner III, Attorney

Treasurer:Mike Holcomb

At-Large:Daryl Welch, Affordable Web Tech. Rebecca Ross, Ross Realty Group

Committee ChairsCommunity Partnerships:Sally Fabre, Agape Com. Ins.

Membership:Rebecca Ross, Ross Realty Group

Webmaster:Daryl Welch, Affordable Web Tech.

Meetings/Programs:Karen Bolin, Edward Jones

Monthly MeetingsMay 8th, Member Showcase!Ten different members will set up their table with a display and give a five minute summary of their business.

Meetings are the 2nd Thursday of each month, 11:30am @Peppermill Restaurant (17455 SW Farmington Rd)

MembershipTier 1 ($60/year)Name Listed in Directory

Tier 2 ($480/year)Logo + 5 line ad

DirectoryB2B ServicesBy All Means VirtualBeaver Express, Inc

Cedar House MediaCommunity NewspaperHolcomb Computer ServicesImpact SignReciProty

CommunityAloha Community Library Assoc.Aloha High SchoolBvtn Education FoundationBeaverton Optimist ClubCooper Mt. Presbyterian FellowshipDomestic Violence Resource Ctr Edwards CenterFoursquare Church of AlohaHabitat for Humanity, Willamette WestJanel K. Josephson, AuthorLove Inc., BeavertonOregonianReedville Presbyterian ChurchTri-MetTualatin Valley Water DistrictWash. Co. Sheriff’s Office

DiningGodfathers PizzaPeppermill RestaurantSakura Teriyaki

General ServicesATB AutoBeaverton TowingDavis Lock & SafeHula Halau, Hawaiian DanceIn Line, Commercial ConstructionKD ContractingSun Connections Travel & CruisesTravel By Tom Higham

HealthABC OptometricPCAloha Animal Medical CenterCarol Cartier w/Juice PlusCurvesEmbracing Health 4 LifeMonroe OrthodonticsRingsage Chiro. & sports Injury ClinicSequoia Mental, Health Services Songbird Healing ArtsTherassageThompson Family DentalTresor Day SpaUsana Health Sciences

Professional ServicesAffordable Web TechnologyAloha CPA, Kenneth Rigert Electronics Unlimited & Comp Srvs

Foundations 4 Your LifeGaroken Energy Co., IncGrass Skirt MarketingHot Tech ComputersInSphere Insurance Solutions John J. Tyner III, Attorney Knipe Realty NWMartin Hunter, CPAMarilyn Mays, RealtorMike Sahagian, AttorneyRoss Realty GroupSchmidt & YeeSource RealtyVeritas FundingYP

RetailA Cut Above PawnCedar West PlazaExclusively MaureenFrom My Bed To YoursJan’s PaperbacksKey Bank - Farmington BranchPostal AnnexSuburban Ace HardwareThe UPS Store, Allen & MurrayUS Bank

AC Communi yInsurance

Agape

AgencyProtecting Your Story...Building

Community. Auto, home, renters, Fire, motorcycles, RV’s, boats.

agapecommunityinsagency.com 503-626-5790

Aloha-Reedville’s FutureBe part of shaping it!

Google: alohareedville [email protected].

or.us, 503-846-3519

18540 SW Vincent, Aloha, OR 970078 40 S

David E. Nevills, DMD Megan L. Nevills, DMD

nevillsfamilydentistry.com (503) 649-3232.

Accepting New Patients!

Funeral Home and Crematory“Your loved ones never leave

the care of our home.” www.springerandson.com

503-356-1000


S u p p o r t yo u r l o c a l n e i g h b o r h o o d b u s i n e s s e s !

West Hills Office Plaza

Troy A. Noland LUTCFSpecializing in home, auto,

commercial & life [email protected]

503-497-2811

Dr. John Tuttle, DC, CKTPChiropractic Ctr of Raleigh Hills

New client specials! www.r3chiropractic.com

503-292-0781

I Get Under Your SkinPersonalized day-spa specializing

in wax, facials and peels. www.facesbyvivian.com

503-292-7546

Holistic Bodywork & Massage. Massage that Makes a Difference. Effective auto, injury, and chronic

pain care (garylwass.com) 509-240-6989

Located in Raleigh Hills!4475 SW Scholls Ferry Rd, Portland OR 97225

SW Scholls Ferry Rd

SW Beaverton Hillsdale Hwy

Business

Directory

BusinessSpotlight

Hot Tubs, Stoves, FireplacesPools, Free Water Analysis

Service & Installation www.HavenSpaPoolHearth.com

503-649-2201 C3

Things From Another World Comics • Toys • Collectibles

4390 Sw Lloyd Ave. • 503.643.4222 Find Us Online at:

www.Tfaw.Com B2

Outdoor Power EquipmentSpecialists

Sales • Service • Parts www.starkstreet.com

503-626-9193 C3

The Book CornerFor gently used books at

affordable prices w/ proceeds donated to the Beaverton library. www.bookcornerbeaverton.org

503-643-5188 C4

Sports &

Activities

Inside Every Child Lies a ChampionRecreational Classes, Birthday

Parties, Camps, Parent’s Night Out, and more!

www.omega-gymnastics.com 503.466.4872

Lim’s Taekwondo AcademySerious yet fun, we specialize

in making champions! www.pdxkarate.com

503-277-7711 D2

CinemarkCedar Hills Crossing 800-FANDANGO+984

My Masterpiece Art StudioOpen Studio, Parties & Classes 7905 SW Cirrus Dr., Beaverton

www.mymasterpieceartstudio.com 503-453-3700

Why see a movie in coach, when you can sit in first class?

For Tickets and Showtimes Visit: www.cinetopia.com

503.597.6900 D

MVP Dance Elitemvpdanceelite.com

503-641-5678 C3

Valley Cinema PubBvtn-Hillsdale Hwy.

503-296-6843

Healthy Lunch & Diner OptionsGluten Free Menu!

Beer, Wine, Soda & Coffee Private Parties & Events

www.playboutique.com D

Beaverton Farmers MarketSee ad in Community section

www.beavertonfarmersmarket.org

JazzerciseStrength-Cardio-Tone

503-646-5299

Billings Dance Company70+ weekly classes

503-670-7008

Beaverton Swim CenterAquatic fitness programs

Lessons for all levels www.thprd.org

503-629-6312 B4

Try the hottest new barre workout!Pilates Based Dance Amplified

Open to ALL fitness levels www.xtendbarrebeaverton.com

503-610-3214 D

Oregon Zoowww.oregonzoo.org

503-226-1561

Washington Square Mallwww.shopwashingtonsquare.com

503-639-8860

**FREE**One week of

KETTLEBELL TRAINING Hellz Bellz Fitness

503-312-5744

Learn Taoist Tai ChiExplore this ancient Chinese

exercise emphasizing balance and health improvement.

www.oregon.usa.taoist.org 503-220-5970

You Found Me!Find more of me thoughout the

paper, and you could win a $25 gift certificate to Black Bear Diner!

There will be 3 winners each month. See back page for details.

Directory Listings start at only

$10/month (Call 503-641-3320)

A Counted Stitch

EstablishmentFabrics, threads, charts & more!

Come see us to start your project. 503-292-4457

www.acornsandthreads.com

Threads, your Portland area counted cross stitch store.

fabrics, threads, charts and kits we’re sure to have something wonderful for you to stitch. Classes are offered for techniques such as cross-stitch, hardanger and embroidery as well as project classes and with some fun events thrown in. Or come stitch with

stitch all summer long outside on the patio on Saturdays, weather permitting. There is an email newsletter that is sent every couple of weeks, to let you know what’s new in the shop!

We hope you’ll stop by and enjoy the variety we have to offer.

If a man does his best, what else is there? - General George S. Patton (1885-1945)

Political correctness is tyranny with manners. - Charlton Heston (1924-2008)

You can avoid reality, but you cannot avoid the consequences of avoiding reality.” - Ayn Rand (1905-1982)

STUDENT SUCCESS: This program has taken the subject of software development and made it simple and easy to understand for anyone. As I went through the curriculum, I felt my fear of learning computers melt away. I recommend attending Prosper IT Academy to anyone looking to break into the IT industry. These guys deliver! -- Cliff Cannon, Portland

888-503-2906 | 12745 SW Beaverdam Rd Suite 210, Beaverton | www.prosperitacademy.com

Looking for a Career as a Software Developer?

In our 12 Week dot.Net training program, you’ll learn:

Computer Science basics Python fundamentalsMobile development

JavaScript (HTML, CSS)ASP.NETC# and more!


Our Town

Keep Shooting!Beaverton Business: Build! Maintain! Grow! Thrive!

smart young man…a hard worker…and looking for a job this summer. I am trying to help

been talking about persistence…and how it is such an important ingredient to success. Keep look-ing for employment after many rejections…keep going back to a desired place of employment and keep checking in…etc…

PERSISTENCE…in sales and business…it is likely the hardest skill, characteristic and daily activ-ity to master.

Giving up is easy. Persistence is the path packed with challenges, barbs, with people saying NO! But it is the road to The Promised Land!

ABE LINCOLN: -

ily was forced out of their home. -

never give up mind set helped land

MILTON HERSHEY: Started three different candy

companies in three different cities,

succeeding with his Lancaster

empire!

THOMAS EDISON:

boy he was labeled as “stupid” and

lost job after job as a young man. Asked in his later years about the many detours and roadblocks on his road to success, the famous inventor said “I never failed once.

process.”Persistence takes mental forti-

tude. It is a must. Some come by it more naturally, but in today’s era of reset buttons…it is more impor-tant than ever.

Giving up, is accepting the sta-tus quo…or worse.

you think you can do a thing or think you can’t do a thing, you’re right!”

It’s all in the mind. Take a chance. Ask a question…if they say no…keep trying.

If you don’t take the shot…it’s

score a goal.Keep Shooting! The worst dis-

tance in golf…or in a marathon…or life…quite often is the 6-inches in between your ears!

By Spencer “The Catalyst” Rubin

Spencer Rubin is a Beaverton Resident with 3 kids attending local schools. With 23 years in the adver-tising and marketing Industry with AM1360-KUIK, Spencer has become a passionate advocate for the success of small, local business owners. This article has been adapted for the BRG from his weekly Catalyst newsletter.

Questions? Contact Spencer at971-732-4745 [email protected]

The history of Mother’s DayTDay dates back to the ancient annual spring festival the Greeks dedicated to maternal goddesses. The Greeks used the occasion to honor Rhea, wife of Cronus and the mother of many deities of Greek mythology.

Ancient Romans celebrated a -

cated to Cybele, a mother goddess. The celebration began on the Ides

the temple of Cybele lasted for three days and included parades, games and masquerades.

Early Christians celebrated a

festival on the fourth Sunday of

England the holiday was expanded to include all mothers. It was then

Gift Ideas for the Modern Mother’s Day.

A gift of enduring beauty will remind her of your appreciation

jewelry she can enjoy every day is a lasting tribute to her love.

Pearls- the ancients favored pearls as an offering to the god-desses. They are still the perfect gift for the mother with classic style.

Lockets- a custom engraved

a lock of baby’s hair makes a wonderful gift for the new mom. It’s also a wonderful idea for new grandmothers.

Colored Gem stones- honoring mom with a custom made piece of jewelry incorporating her chil-dren’s birthstones can be tricky, but a very personal way of bringing the family together.

of Spain has been crafting breath-taking masterworks of enamel and precious gems. Select a fan-

These exquisite pieces make a per-fect way to celebrate mom.

By Kaaren Bedi

Smith & Bevill is your local family jew-elery store has AGS certified appraisers on staff as well as master gold smiths and factory certified watch makers. We are always buying gold, silver and platinum jewelry.

www.smithandbevill.com | 503.644.1333 | 9875 SW Beaverton-Hillsdale Hwy, Beaverton, OR 97005

We Buy Gold, Silver & Diamond Jewelry!Plus: The sun is shining, so bring in your dusty jewelry wardrobe for a complimentary Spring Cleaning!

Dental gold, sterling flatware & broken jewelry Free evaluations while you wait Payment given on the spot No appointment necessary

20% Extrafor your gold and silver

scrap when used towards in store purchases

Expires 6/30/14

SPRING

CLEANING!

www.sm

OCSO P T I M U MC A P I T A LSTRATEGIES LLC

Changing jobs? What should you do with your retirement funds?TAKING ACTION can mean the difference between retiring

comfortably on your terms vs. out-living your money!

James Bauman971.250.0301 [email protected]

For a free consultation contact:

5075 SW Griffith Drive, Suite 100 Beaverton, OR 97005


S u s t a i n a b l e B e a v e r t o n

Local Green ResourcesAccording to the

Environmental Protection Agency, sustainability is based on a simple principle: Everything that we need for our survival and well-being depends, either directly or indirectly, on our natural envi-ronment. Sustainability creates and maintains the conditions under which humans and nature can exist

in productive harmony, that permit

other requirements of present and future generations.

Sustainability is important to making sure that we have and will continue to have, the water, materials, and resources to protect human health and our environment.

Beaverton’s Native Plant of the MonthCascara (Rhamnus Purshiana)Cascara is native from north-

ern California to British Columbia, as far east as the Rocky

in fairly dry to wet sites in full to partial sun and is most common in mixed woods and along stream

sides.Cascara is an erect, tall shrub

tall, with thin, smooth, silver-grey bark. The shiny, deciduous leaves are simple, alternate and are clus-tered near the ends of twigs. They

wide), are darker green on top than the bottom, have tiny teeth on the margins, and parallel veins.

mm long) and greenish-yellow in color. Its fruits (5-8 mm across) are edible but have a distinctive taste and look like blue-black to purplish-black berries. Cascara’s

originally used for this purpose

Native Americans. It can also be used as a medicine for washing sores, swellings and for internal strains.

has been brought to you by the City of Beaverton’s Landscape and Urban Forestry Department along

Finder webpage for interactive

By Katie Wilson, City of Beaverton

This Native Plant of the Month has been brought to you by the City of Beaverton’s Landscape and Urban Forestry Department along with Clean Water Services. Visit Clean Water Service’s Native Plant Finder webpage for interactive questions to help you find the right native plant to fit your needs!

Common Name: Cascara

Binomial Name: Rhamnus purshiana

Soil Type: Moist to Dry

Sunlight: Full Sun to Partial Sun

Spreads/Multiples: No

Plant Type: Tall Shrub/Small Tree

Foliage: Deciduous

Flowering: Yes

Sustainable BeavertonEnergy Efficiency Opportunities for Local Businesses One of the main pillars of

a sustainable community is the economic security of our

local businesses. This is why the Sustainability Division works hand in hand with Portland General Electric (PGE) to help local businesses cut energy use and save money through ener-

the Sustainability Division does this is through the Beaverton Better Buildings Challenge where

receive free assistance with their

visit www.BeavertonOregon.gov/BBC.

Right now there’s another exciting opportunity: PGE is

Businesses who sign up for an

a free lighting upgrade – this year

each!Through the free consultation,

business owners will get smart

out how Energy Trust of Oregon cash incentives can make lighting upgrades more affordable and con-nect with local contractors.

Already had a consultation?

by visiting the website above. By City of Beaverton, Sustainability Staff

Visit www.portlandgeneral.com/lightsweeps or call 800-822-1077 to schedule your consultation today.

For more information about the city’s sustainability efforts, visit www.BeavertonOregon.gov/Green.

Howdy folks! May I interest you in

an energy eFFICiency upgrade?

[email protected]

Does Solar Work in Beaverton?Ask me about my 4 kW system in Sexton Mt. that I’m leasing for $0 down, $31/month and credits from PGE over the Summer months! Email: [email protected]

Paula Conway, PGE Energy Expert, doing a consultation

with a local business.

Sustainability ResourcesBeaverton Farmers Market: Check out weekly events, vendors, schedules and more. BeavertonFarmersMarket.com (503) 643-5345

Community GardensLearn where community gardens are located and their associated fees. BeavertonOregon.gov/Gardens (503) 526-2665

THPRD Community Gardens thprd.org/parks/communi-tygardens.cfm (503) 645-6433

Beaverton CompostingLearn about the new Beaverton Composts program for local busi-nesses, www.BeavertonOregon.gov/Compost (503) 526–2460

Energy Trust of OregonSchedule a free home energy review, learn about cash incen-tives, or find a contractor. (www.EnergyTrust.org) (866) 368-7878

Beaverton Sustainability DivisionLearn more about the city’s sustainability division, its activities and community events ((503) 526-2474) www.BeavertonOregon.gov/Green

Beaverton Recycling & Waste ProgramsRecycling at work, home, or school. Learn more about recy-cling programs in Beaverton and what to do with hard-to-recycle items. www.BeavertonOregon.gov/Recycling 503) 526-2460

PGE Green Power ProgramLearn the renewable power options and costs offered by PGE www.GreenPowerOregon.com (800) 542-8818

Solar OregonLearn about the steps and costs of installing a residential solar electric system. www.solarore-gon.org (503) 231-5662


C o m m u n i t y N ew s

Viral Video HitBeaverton Girl Juggles Soccer Ball All Over Town

A amazing soccer juggling act is getting some love online from U.S.

Katelyn Penner’s video of her juggling a soccer ball all around the Portland metro area has more

Katelyn’s personal juggling

touches without the ball hitting

minutes.Sure, it’s an impressive number,

but juggling a ball in place started to get “a little boring” for her. So

skill challenges posted by U.S.

“They inspired her to try some different things,” said Loren Penner, Katelyn’s father.

Katelyn’s completed skill chal-

it’s her recent juggling act around Beaverton and Portland that takes the cake.

The “walkabout” starts at her home in Beaverton, crosses

a neighborhood bridge, heads to Chehalem Elementary School and then tours the Nike campus. She eventually ends up in front of Providence Park, home of the Portland Timbers and Portland Thorns, but not before a quick trip through the Dairy Queen drive-through.

Averbuch even commented on

awesome!!!!!”The video was taken over the

course of a couple sunny days in

plays for the Portland Thorns and made her own “walkabout” video a few years ago.

weeks -- came as a big surprise to Katelyn.

“I wouldn’t think so many people would see it as they have, I thought maybe a couple hundred,” she said.

By FOX 12 Staff

Watch the video at kptv.tv/12juggle.

The Dispute Resolution Center Offers HOA HelpIs your homeowner asso-

Professionally trained volunteer mediators at The Dispute Resolution Center are ready to help.

to provide a means for home-owners to care for common spaces in the neighborhood as well as to provide a structure for maintaining property values of its member homes. In managing these respon-

and homeowners may experience

effectively be addressed with the help of a neutral third party.

HOA issues that can be addressed in mediation include:• Board elections / appointments• Understandings of bylaws• Application of rules • Roles and responsibilities of

board / tenants The Dispute Resolution

Center’s professionally trained volunteer medi-ators are available to

their members resolve all types of disputes. Oregon

laws that govern planned communities and condominiums

offer mediation as a way to resolve issues (except those involving col-lection of assessments) before either party can pursue a remedy through the court system. Our services are free and are completely voluntary

costly litigation while helping to promote a more livable community.If you would like more information about mediation and the Dispute Resolution Center visit the City Website at www.beavertonoregon.gov/disputeresolution or call us at (503) 526-2523.

HOAHELP

Become a CASA VolunteerMake a Difference in a Child’s Life

Dianna Schmid long had wanted to work with people

who need a hand in bettering their lives. “I wanted,” she says, “to get into the trenches.”

That she did. A former news-paper journalist who since the

marketing and communications

CASA – Court Appointed Special

in those counties, Schmid looks

out for the interests of abused and neglected children in state custody.

For her impressive work dur-

recently was honored as the

her attention to the seven cases assigned to her. She also works with the Oregon State CASA Nework in a marketing capacity.

Like those other volunteers,

of training and works with a CASA supervisor. Like those other vol-unteers, Schmid is appointed by the court to a case that she follows to conclusion by working with

case workers, therapists, foster parents, the biological parents and others.

The rewards are deep. “I don’t do it for me,” Schmid said. “I do it to make a tiny bit of difference in a child’s life.”

In the process, parents who have faced challenges and lost custody of their children because

of their neglect or physical harm might turn their lives around, often because a CASA volunteer has provided the support not just to the children but to the parents as well. If that ideal does not work out, vol-

with relatives or other foster fami-lies or, sometimes, adoption.

The work is far-reaching.

appointed CASAs to advocate for

Upon completion of the train-

have the ever-present support of their supervisors to guide them.

By Dan Hortsch, CASA Volunteer

Those interested in learning about volunteering can email [email protected] or telephone 503.988.5115

New Business Spotlight:Learn Software Development at Prosper IT AcademyThe World’s Premier Career Oriented Software Developer Institute

Prosper IT Academy is rapidly becoming a vital part of the

strong Information Technology business community that makes the west side such a desirable place to live and work.

is a major shortage of competent software developers. Over the next

exist in IT but at the current rate

will be trained as computer pro-grammers/software developers in that time. There is a great need for software developers in the US and Prosper IT Academy was founded

“I created the school because I really like to help people,” says Erik Gross, the Academy’s founder. A senior software developer with over thirty years’ experience in

experience in mentoring junior developers.

“It is so cool to see these stu-dents get it. They walk in the door

actually afraid; worried that they aren’t smart enough, that the tech-nical nature of the subject will be beyond them. Then you see them just a few weeks later - they’re

They’ve got a set of skills that they know will make them valuable.”

One of the Academy’s main training offerings is the Dot

“immersive” course is designed to train even a novice in the funda-mentals of software development.

camp’ model for making soft-ware developers began in the San Francisco Bay Area only a few years ago, but has rapidly become one of the most popular methods

of software development. The students and staff of

Prosper IT Academy are very diverse. About half of the current

working men and women looking for a career change. There are also young people, fresh out of high school and college, working hard to become entry-level professionals.

The focus of the training isn’t just on learning the technical skills needed to do the job - it’s on becoming comfortable with the

job market, hiring managers want to see strong skills in communica-tion, teamwork and leadership. The Academy addresses those needed skills through a dynamic combina-

leadership roles, communication workshops and mock interviews.

Finally, they work closely with

Technology Group to help the graduates get hired. So far, says the Academy’s CEO, Jack Stanley,

-ten jobs in IT.

In addition to the individual training Prosper IT Academy offers, they provide customized training curriculums for companies looking to train staff in software development and computer pro-gramming languages. If you have

employees in Python, for example, you can send them down to Prosper IT Academy (as other companies

will have staff that can write appli-cations, websites, programs, etc. in Python.

For more information, send an email to [email protected]. They are located at 12745 SW Beaverdam Rd Ste 210 Beaverton, OR 97005.

Erik Gross, founder of Prosper IT Academy in Beaverton


B e a v e r t o n H i s t o r y

12412 SW Broadway St | www.historicbeaverton.org | 503-430-0106

ON Exhibit• We Remember• Men’s Case (1920s – 1940s)• Early Medicine (1880s – 1930s)• Children’s Games (1920 - 1965)• Country Store (1900s - 1940)• Farming Tools (1890 - 1920)• On the Oregon Trail Display• Beavers of Beaverton Display• Early Farming (1900s – 1950s)

FEATURED Exhibit‘We Remember’ is a military exhibit honoring the veterans of Spanish-American, World War I, World War II, and Vietnam Wars. Come see: the uniform of Cor-poral Ernest Hite, ration books, medals, honorable discharge papers, the use of sphagnum moss and more.

Interested in Local History?Volunteer or become a member! 503-430-0106

Beaverton History CenterBeaverton History Center

History PresentationThe Spruce Goose and how it got to the Evergreen Museum, May 13, 7pm

Learn about the Spruce Goose.

it, why is it wood, when was it

Long Beach, CA, and the move

exciting things are happening at the Evergreen Aviation and Space

in Portland and attended Benson

he was commissioned in the United

squadrons, was an instructor pilot in training squadrons and an air-

commanded both a squadron and an aircraft group. Retiring in

returned to Oregon and taught mid-dle school science in Keizer, OR.

the Evergreen Aviation and Space

was named executive director of

live in Salem and have three grown children and four grandchildren.

Speaker: Larry Wood, Marine Corps Fighter Pilot

Tuesday, May 13, 7pm at The Bea-verton History Center (12412 SW Broadway). Admission: $2.00 suggest-ed donation, members free

For more information: HistoricBeaverton.org, (503) 430-0106

Early Beaverton BusinessesM.P. Cady and Monopole

A familiar photograph depicts -

chandise store in Beaverton about

one-story, wood structure is the

behind the image.

early Beaverton’s most prominent families. Alonzo Brockway Cady,

town’s landmark brick structure. All were politically active leading businessmen.

was the youngest of three boys in a family that moved to Kansas

they would have two daughters and

for good roads as a member of the Oregon Letter Carriers’ Association, and within a few years opened a mercantile.

resigned before the end of his term

notes that he was past president

County automobile dealers’ asso-

popular brand of canned goods manufactured, packaged, and dis-

wholesale grocers and coffee roast-

Samuel, and Frank Kerr to establish

building on Portland’s Front Street.

expanding enterprise relocated to a larger, more advantageous site with

They packaged two product -

pensive Palace Car. Oils and olives from Spain and Italy added an exotic touch to a household’s well-

vegetables, seafood, jellies, spices, peanut butter, and much more. Foods were packed in glass jars, tin cans, and cartons; coffee was the exception. It was sold only in reusable glass containers, patented

homemakers then had a useful con-tainer for home canning, although

in the home makes you ready

customers were requesting out-of-season fruits and vegetables.

Newspaper advertising empha-sized fresh taste, high quality, and purity, important in an era when tinned foods were usually bland

wanted to serve the best natural

than, homemade preserved fare

The many varieties were readily

Cady, and several other retailers

After three decades, the corpo-

story building is currently used as a commercial warehouse in the Pearl District. Listed on the National

legacy of the city’s manufacturing history.

By Ann Koppy, Center Director

For more information, contact:Beaverton History Center 503-430-0106

Fred Willis Cady, Mayor and Builder of the Cady Bldg on

Farmington & Watson

Cady Building, Beaverton’s Oldest Brick Structure

EERR’’SS DAAYSS DDAMMMOOOTTTHHEE att

Oppeneniningg ata 1pm With Full Dinner MenuWith Full DDininnOpNow Accceepting Reservationsow Ac g ResserNo

Fresh Fillet of King Salmon filled with crab stuffing and topped with a Béarnaise sauce and served with shrimp scampi ravioli and seasonal vegetables.

14 oz. Choice T-Bone Steak topped with a Gorgonzola Compound Butter and served with roasted fingerling potatoes and seasonal vegetables.

Dinner Specials and Menu entrees will include our holiday once through salad bar featuring many brunch style salads.

Ernesto’s Italian Restaurant: 8544 SW Apple Way, Portland OR 97225503.292.0119 | [email protected] | www.ernestositalian.com


Ninja vs Samurai Beaverton Roll Tekka Don Monkey Brains

Tonkotsu Ramen

Ask about our Sushi or Sashimi Lunch and Dinner Combination Specials!

Monkey Brain . . . . . . . . . . . . . . . . . . . . . . $7Half an avocado with spicy tuna and spicy crab, battered and deep fried. Served with 3 sauces.Salmon Miso Yaki . . . . . . . . . . . . . . . . . . . . $7Salmon marinated in miso and sweet sake, finished with our house “sweety“ sauce. Tuna on Fire (Sushi) . . . . . . . . . . . . . . . . . . $14Spicy tuna, spicy crab and avocado with pepper tuna on top with jalapeno & garlic chips.Beaverton Roll (Sushi) . . . . . . . . . . . . . . . . . $12Shrimp tempura, spicy crab and avocado topped with seared salmon and eel sauce. Crusty Philly (Sushi) . . . . . . . . . . . . . . . . . . $11Creamy philly cheese, salmon and avacado with a fried corn flake crust.

Dine in or Take out

503-746-6373www.shotendining.com

16165 SW Regatta Lane #500, BeavertonOpen Mon. - Sat. 11:30am - 2:30pm (Lunch),

5pm - 10pm (Dinner)

L o c a l E a t s & Tr e a t s

ALOHA 185th & Farmington18615 SW Farmington | www.eltapatiomexican.com

FULL LOUNGE: Happy Hour3:00-6:00pm Daily (bar only)Daily Food & Drink Specials

503.649.7545503.649.7545

CATERING AVAILABLE: For any event

guichosrestaurant.com

$5 Lunch Special in 5 Minutes or it’s FREE!

BEAVERTONMURRAY & ALLEN

6159 SW Murray Blvd(Behind Shari’s)

503.746.5980

TAPATIOTAPATIO MEXICAN RESTAURANTCelebrating 10 Years in Aloha

Lunch or Dinner

FREE

Coupon

Buy 1 lunch or dinner & 2 beverages at reg. price & get the 2nd lunch or dinner of equal or lesser value free. Lunch value up to $6.25, dinner value up to $8.00.

1 coupon per table. Not valid with other offers or specials.Good at Tapatio or Guichos restaurants. Expires 12/31/13Expires 03/31/14

Swedish Pancakes ..............................................................................$9.553 delicately rolled pancakes, dusted with powdered sugar and served with lingonberry butter.

Three Little Pigs ..................................................................................$8.65Link sausage rolled in 3 large pancakes with apple sauce on the side.

Master Burger .....................................................................................$9.25Deluxe burger, served with cheddar cheese and sliced lean ham, served on sesame bun with all the fixings.

Monte Cristo Sandwich......................................................................$9.25Our own thick french toast bread with turkey, ham and Swiss cheese.

Pot Roast ........................................................................................... $11.95Just like mom’s. Served with creamy mashed potatoes that we made from scratch and fresh sauteed vegitables. Satisfying!

Open Daily: 7am - 9pm

Breakfast served daily till 3pm

Dinners served from 4pm

Join us for Weekend Brunch!

Everyday 3pm - 6pm

join us forHAPPY HOUR

503-590-6030www.cafemurrayhill.com

14500 Murray Scholls Drive #103

Cafe Murrayhill Eggs Benedict .. .. .. .. .. .. .. .. .. .. .. .. 11.95avacado. tomato. spinach. poached eggs. pesto hollandaise sauce.

Club Panini.. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 11.50roasted turkey. applewood smoked bacon. herb mayo. avacado spread. lettuce. tomato. served on sourdough.

Butternut Squash Ravioli . .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 17.00gorgonzola. candied hazelnets. balsamic reduction. sage-brown butter.

Grilled Steelhead .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. 24.00quinoa. fresh seasonal vegetables. chimmichurri sauce.

C f M hill E B di t 11 95

Enjoy Breakfast, Lunch or Dinner by the Lake at Murrayhill

WELCOME TO GREAT BEAVERTON DINING

dec

arli

italian inspired cuisine...where rustic meets modern

503.641.3223

www.dec

arlir

esta

uran

t.co

m

4545 SW Watson Ave | Beaverton, OR 97005

HOURS

Tues - Thurs: 11a - 11p

Fri - Sat: 11a - midnight

Sunday Brunch: 10a - 2p

Happy Hour 4p - 6p

503-616-2416 | watsonhallbar.com12655 SW 1st Street, Beaverton


R e s t a u r a n t R e v i ew

La Hacienda Real Mexican Restaurant

Arestaurant reminds you of a

hacienda means “a large estate or plantation with a dwelling house”. As you walk in, you are immedi-ately greeted with bienvenido or “welcome” and that’s exactly how I felt. The restaurant is adorned with bright colors, traditional Jaliscomurals of farm life.

Jose Arechiga is the General

is the owner and together they run

run restaurant opened in Salem

I’m not kidding. Jose told me that

dispersed throughout the four eat-eries! The restaurants are known for their homemade tortillas (more on that later) and margaritas. The Beaverton location is the only one with an open air patio and full bar (I assured Jose that I would men-tion this little detail).

menu is extensive, serving Jalisco-

about what Jose and his family were going to serve. I think their three choices were spot on:

��Chicken Fajitas (Price: $12.95)

you can share with a loved one. The chicken is grilled into a secret sauce and presented in traditional, sizzling fashion to your table

beans, rice, sautéed onions and green peppers, pico de gallo, sour cream, guacamole and homemade

are what make this plate so tasty. There’s something so refreshing about having homemade tortillas with your meal. Store-bought tor-tillas leave little to be desired. The tortillas are the vessel to hold all of

to force myself to stop eating since I had two more dishes to go!

��Pollo Mazatlan (Price: $12.95)

editor of the BRG loved this dish.

and this plate has plenty. In all, the charcoaled grilled chicken is served with guacamole and topped with a cream sauce, the aforemen-tioned mushrooms, onions, celery and carrots. The chicken has a smoky quality, thanks to the char-coal, and pairs well with the cream

had a stew-like quality which I found unique, but inviting.

��Burrito Chipotle (Price: $13.95)

I harken this to a wet burrito, since it is topped with a cream

with grilled chicken breast and bell pepper and onion. It is then

and fresh peppers, lettuce, tomato and sour cream. Essentially, this

is a simple dish which I like. The chicken, as the other two dishes have been, is tender and perfectly cooked. The veggies are fresh not overcooked.

All three of these dishes come with beans and rice and as I have talked about in a past articles, tasty beans and rice is a telling sign to

-plishes this in addition to their fabulous tortillas.

-ing anything alcoholic so I unfor-tunately was unable to try their award-winning margaritas (I guess I will have to make a personal trip back soon). Overall, this is a nice establishment, with the right mix of scenic décor and delicious options. Thank you to both Joses, for inviting us into your hacienda.

Until next time, these were my

going to try?Story & Photos By Greg Mattie

Mexican Restaurant

503-601-7000 | 12025 SW Canyon Rd. Beaverton | Open: Sun - Thurs: 11am - 10pm, Fri - Sat: 11am - 11pm

Enjoy Authentic Mexican Food at its Best!

Dine-in or Take-outPollo Fundido ...................................................................................$13.95Deep fried four tortilla filled with chicken breast and monterey jack cheese.

Burrito Chipotle ................................................................................$13.95Wrapped flour tortilla with grilled chicken breast, onion and bell pepper.

Suiza Enchilada ..................................................................................$9.95Two corn tortillas stuffed with your choice of filling with a delicious green tomatillo sauce and melted cheese.

Arroz con Pollo .........................................................................$11.95Boneless chicken breast sauteed in a traditional sauce with mushrooms, carrots, celery and spring onions.

As a graduate of the Le Cordon Bleu Program in Culinary Studies, I enjoy experiencing the fine dining avail-able at so many of our local eating establishments. Beaverton has such diversity to offer the curious palate that it’s hard to know where to begin. Well, now you can start your month off right here with me and my 3 Dish-es Review.

Greg may be contacted at: [email protected]


Beaverton Infinitiwww.BeavertonInfiniti.com9500 SW Canyon Rd, Portland / (888) 319-6583

The Infiniti Q50Powerful. Luxurious. Revolutionary.

And now available at Beaverton Infiniti.


Automotive Q&A: With the Beaverton Car Guy

Q: I left my dome light on over-night and I was surprised &

relieved that my vehicle started. If my battery is fully charged, how many hours could have passed for me vehicle to start?A: Different vehicles have different amounts of interior lighting, so in most cases on a newer vehicle, or a vehicle with a new or recent battery, the interior lights would easily stay on, as well as allow the vehicle to start after a 12 hour period. If it were the headlights, they draw a much greater amount of power so the time is greatly reduced. I think that 6 hours would be the maximum amount of time.

Q: Last February we had a big snow storm, I had to use my tire chains, however my neighbor men-

tioned that his snow tires worked just as well if not better. Is this true?A: It is well known that snow tires are far better in the snow & ice than highway tires, however getting going in slick driving conditions is certainly a plus, stopping is quite another story. The addition of chains when there is snow or ice, provides much better traction, not only for getting the vehicle going, but it will help the vehicle to stop as well. Most accidents during slick driving conditions occur, due to inability to stop your vehicle.

Larry has been in the automotive industry for over 25 years and has several degrees in automotive technology. Although currently working for Beaverton Infiniti, Larry prides himself on shooting straight with practical, unbiased information and advice.

If you have an automotive question for the Car Guy, please email us at: [email protected]. For all other questions, call Larry at 503-930-1493.

By Larry Ferguson New BusinessSpot l ightBIO Force Youth Fitness

Acenter in Beaverton Oregon that was developed to provide children, their parents, and coaches proper strength training tech-niques, proper nutrition, and proper bio-mechanical development in an effort to battle youth obesity to promote a healthy lifestyle, increase injury prevention, excel in sports, and empower them to

specialized strength equipment has -

Now kids have a place where they can work out, whether they want to increase their sports performance and become a better athlete, or they just want to work out in a

variety of different programs for kids and parents including personal training, circuit training, group training, long term development, after school programs, boot camps, summer camps, and much more.

For More Information, contact Tyler: 971-238-0048 www.bioforceyouthfitness.com

New Natural PlaygroundComing To Cedar Hills KindergartenTKindergarten and Preschool

old parent-child cooperative school in North Beaverton, are swing-ing into full gear to build an entirely new kind of play-g r o u n d that will give chil-dren even more opportunity to direct their play using their imag-inations and creativity rather than allowing play equipment to dictate play time.

Nationally renowned nature playscape designer Leon Smith with Earthplay (www.Earthplay.net), has been working with the students, teachers and parents this year to design a unique nature

imaginations surprise their senses, and allow children of all abilities to interact with nature as they play

Research shows that chil-dren who play regularly in nat-ural environments show more

coordination, balance and agility. Children also develop observation and social skills as they interact with their peers.

“ T h e new natural playground will be a barri-e r - f r e e , i n c l u s i v e playground for our c o m m u -n i t y , ” said Lori

Gamroth, Three’s Teacher and Playground Committee Chair, “Everyone is invited to join us in building this extraordinary playground for our children. As a

for local community business support—both monetary and labor—especially anyone in the construction arena.”

by Kristie Cox

Build dates will begin in June continue through August. Everyone is welcome. For more information or to find out how you can contribute email Teacher Lori at [email protected].

Learn more about Cedar Hills Kindergarten & Preschool at www.cedarhillskp.org.


Traffic Q&A: With the Beaverton Police Department

Q: My mother is disabled and does not drive.

There are times that I go to the store for her while she stays home. Because I’m shopping for her, can I use her permit to park in a disabled space?A: (No) Oregon Revised Statute 811.625, “A person commits the offense of unlawful use of a disabled persons parking permit if the person is not a person with a disability and is not transporting the holder of a disabled person parking permit to or from the parking location; and uses a disabled person parking permit.”

Q: I have noticed that more and more cars are equipped with these super bright white head-

lights, sometimes in different colors. It sure makes driving more difficult when the on-coming vehicles use these lights. Are these headlights legal?A: Although there is a section in the Oregon statute regarding headlight specifications (ORS 816.050), Oregon has adopted the Federal Department of Transportation’s definition which does indeed allow for many of these kinds of headlights. Use of high beams or having misaligned lights that would shine into oncoming traffic is enforceable under ORS811.520 and/or ORS816.300.

Q: I heard that jaywalking is only an offence if the nearest cross streets have signals like in a com-

mercial district. But can one technically get a jaywalk-ing ticket for walking across a residential street in a quiet neighborhood?A. It’s possible. Part of ORS 814.040 (Failure to yield to vehicle) says “Pedestrian Fails to yield the right of way to a vehicle upon a roadway when the pedestrian is crossing the roadway at any point other than within a marked crosswalk or an unmarked crosswalk at an intersection”. Beaverton code 6.02.510 Pedestrian must use available crosswalk says “ No pedestrian shall cross a roadway outside of a marked crosswalk if within 150 feet of a marked crosswalk”.

If you have a traffic question that you'd like us to ask the Beaverton Police Department for this column, email us at: [email protected] (For all other police questions, call the police non-emergency number: 503-526-2260)

Beaverton Police Department2014 Police Service Awards Ceremony

Police and the public gathered at Southwest Bible church

whose actions during the calendar -

We have included a list of recipients as well as an edited version of their actions.•

for providing training guidance and support to new and veteran reserves.

• was honored with the Citizen Commendation Award after he helped pull a woman to safety after threatening to jump off an overpass.

• Civilian Eileen Rice was also honored with the Citizen Commendation Award after she witnessed a robbery/assault and took cell phone pictures of the suspect and suspect auto as he

in part, led to his capture and conviction.

• Civilian employees Traci

service to the city.•

retired, was recognized for his years of service to the agency and city.

•

Beane and Rebecca Cline were given a Unit Commendation for their work in the training division that included stream-lining the in-service training and developing a self-defense program for victims of domestic violence.

• bestowed on Sgt. Robert Davis

their actions in taking into custody a suspect high on drugs

received during the same incident.

•

acknowledged for life saving efforts locating a suicidal person

into a local park.• -

food and saving his life.•

the life of a man threatening to jump off of a parking structure.

• Detectives Jason Buelt and Alara DeLand received the

their work on a counterfeit ring that worked the metro area.

· honored with the Distinguished

· The Dan Bortolin Community

recognized for her work in the schools and Katrina for her work with crime victims.•

Team.• The Civilian Employee of the

work as the departments False Alarm coordinator.

•

honored for nine years of ded-icated service as a team. Barak retired at the end of last year.

• The Chiefs award went to

his work with the FBI and the Regional Computer Forensics Laboratory.

Our sincere thanks to Southwest Bible Church for hosting the event for the third straight year.

By Officer Mark Hyde

For questions about this story, call the BPD at 503-526-2260

C r u i s i n ’ B e a v e r t o n

3725 SW Cedar Hills Blvd., Beaverton, OR 97005 | kunicollisioncenter.comLuxury Service

at affordable pricesLuxury Service FREE Estimates

Rental Cars available onsite

Lifetime Warranty on all workmanship

503.372.7563Oregon’s only BMW certified collision center

By BPD Staff

Welcome Spring SafelyTips from Your Friends at TVF&R

Spring has sprung and many of

into the yard and cleaning up from winter. As you head outdoors and your body awakens from winter’s

some stretching exercises before you dive into your yard chores. This can help you feel better overall and may reduce yard work-related muscle strains and pains.

Remember that ladders are tools. If you need to climb a ladder, make sure someone is there to keep an eye on you and help steady the ladder. A Consumer Product Safety Commission (CPSC) report on

ladder safety showed that more than

room treatment from ladder-re-lated injuries every year. Ladder accidents are entirely preventable. The following four causes account for the vast majority: selecting the wrong type of ladder, using worn or damaged ladders, incorrect use of ladders, and incorrect placement of ladders.

As you open your doors and windows to spring, consider the following:

•

fall involving a child of the season in April. Remember that screens are meant to keep bugs out, not children in. Install window stops to windows you want to open no more than four inches.

•

your doors, patios, porches, steps, and walkways are well lit and clear of obstacles.

• secure and in place and use them.

• Even if you’ve cleaned that walkway from winter’s moss, keep in mind that there may still be uneven or slippery areas.

urges you to consider these tips as you get outside and smell the roses during this beautiful time of year to ensure that your spring is safe and enjoyable.

By TVF&R Staff

For more information, visit www.tvfr.com.

SAFETYSpring

By BPBBPBBPDPDDDDBPDBPDPDDPDD SttStStSSt fffafff



Providence Elderplace Maintaining Dignity & Emphasizing independence for our Seniors

Senior Citizen’s Advisory Committee

As we age, we all want to remain as independent as possible.

that independence, we look for programs to provide options. Providence ElderPlace offers an option to help keep older adults healthy and independent as possi-ble. They provide comprehensive, high quality health care and social services tailored to meet the unique needs of each individual.

This is a long-term health plan that strives to keep participants out of the hospital and rehab. It is a Program of All-inclusive Care for the Elderly (PACE), a federally recognized program which offers total care and enhances the quality of live for seniors.

receive medical and social ser-vices while attending one of

receive those services in their own home. Transportation is provided to and from medical appointments and to the social center.

This program is open to anyone

counties who is 55 or older and in

by the state of Oregon. The cost?

services. Those who do not qualify

ElderPlace premium. By Beverlee Ryan

For more information phone 503-215-6556 or online www.providence.org/elderplace.

About the Senior Citizens Advisory CommitteeServing as a liaison between Beaver-ton’s senior community and the City, the SCAC is here for you!

Edgewood DownsIndependent Retirement Community

Come and join us for

Resident Spring ConcertMay 10th at Noon

Immediately followed by a Complimentary Lunch

Please RSVP at 503-643-5418Reserved Seating

7799 SW Scholls Ferry Road, Beaverton, OR 97008 | 503-643-5418 | www.holidaytouch.com

May 10th at

Noon

Speeder Spotlight: Moving for SeniorsFor those of us who have been

more years we have managed to accumulate a lot of “stuff”. The very thought of tackling the clutter can be discouraging. The organizational and physical tasks associated with planning and accomplishing a complex project can be overwhelming. That’s when an experienced, non-judgmental professional can be invaluable: with high energy, enthusiasm and expertise, the worry and the work are taken off your shoulders.

Karen Brandenburger, owner of Smooth Transitions of Portland LLC, and a member of the Smooth Transitions national network, pro-vides individuals and families the emotional and physical assistance needed to make a change in living arrangements. Services include pre-move planning, deciding what to take to the new home, moving

-ing, unpacking and setting up the new home, and taking care of all aspects related to closing out the former home.

Over the years, Karen has developed useful guidelines for folks thinking about or needing to make a change. Try a “virtual move”: take a look at your stuff and ask yourself the following questions:

Do I actually use this? Does this work properly and do I know how to use it?If I get rid of this, how hard will

need it?

own versus how many do I really need?

5. Is this a memento I want to keep?

6. Am I keeping this because I’ll

feel guilty if I give it away?7. And, most importantly, do I

love it? Karen is a graduate of George

Fox University with over twen-

professional project manager. In addition to helping seniors and their families make smooth transitions in life, she is a mem-ber of the National Association

Better Business Bureau, Tualatin

Gardener, and a weekly driver for

Remember to check your speed and enjoy the ride!

As former chair of the SCAC, Jolene Guptill has been advocating for Beaverton seniors for the past 12 years and continues to bring awareness to senior issues and news through the BRG.

Questions? Contact:Jolene at: [email protected]

MINIMUMSPEED

55YEARS OF AGE

OR OLDER

Last October, Of cer Anthony Jenkins of the Beaverton

Police Department received word that a woman was in “the woods” intending to kill herself. Her whereabouts were unknown, so Jenkins called Brady Schwartz of THPRD’s Park Patrol and asked if he might have an idea where she could be.Schwartz had a hunch, and it was a good one. He led Jenkins to a spot deep in the forest off the Fanno Creek Trail, and there they found the woman, wet and barely breathing but alive.Schwartz helped Jenkins carry the woman about 150 yards out

of the woods. He also called emergency personnel and helped them determine the exact location so they could get there ef ciently to render aid.In a letter of recognition to the district, Jenkins wrote, “Schwartz had a calm and collected demeanor throughout the call and followed direction without hesitation. Schwartz was integral in the successful retrieval...from the woods. Without Schwartz’s knowledge of locations within the park (she) would not have been found.”For his efforts, Beaverton Police honored him on April 3 with a citizen commendation award. Schwartz also was selected as a quarterly winner of THPRD’s “PRIDE” award, which is presented to employees for extraordinary service.Schwartz has had a special

connection to BPD since high school when, in the darkest hour of his life, his father committed suicide. Of cer Mike Rowe helped the young man get through it.“He reached into his pocket and pulled out his business card,” Schwartz recalled. “He wrote on it, handed it to me and said, ‘This is my personal cellphone. Anytime you need anything, even if you wake up in the middle of the night and need someone to talk to, call me.’ ” Schwartz never forgot the gesture and showed his gratitude in a personal way last fall after Rowe’s wife, Kendall, died of colon cancer. He helped raise money in Kendall Rowe’s name for OHSU’s Knight Cancer Institute.“Doing the fundraiser in my wife’s name, it was very attering,” Rowe said. “Most of us get into law enforcement because we want to

help people.”He added, “I’m glad it stuck with him, and that he’s trying to do things to help other people. He’s paying it forward.”

Before & After


Active retirement at it’s best!

5450 SW Erickson Ave. Beaverton, OR 97005

Call Julie Miller to schedule your lunch tour today!

503-643-9735www.creekside-village.com

S p e e d e r N ew s . . . f o r S e n i o r s !

503.646.0635

12900 SW 9th St, Beaverton, OR 97005 | www.BeavertonLodge.com

Take the plunge!

Call or stop by today. We look forward to

showing you around!

We have some of the largest studio, 1-bedroomand 2-bedroom apartments in the area.

Prices start at $1,695, including all utilities,(except telephone) and you will enjoy your weekly

housekeeping and linen service along with a

Heated indoor mineral saline pool with seniorwater aerobic classes, art gallery, full activity

schedule and so much more...

Join us for Retirement Living at its Very Best!

Life is Great at Beaverton Lodge!

Elsie Stuhr Center

21st Annual National Senior Health & Fitness

Day, May 28th

Make A Move Toward Better Health on May 28th, 2-3:30pm•

Introduction •

•

The Elsie Stuhr Center is designed for adults 55 years and better. Classes, trips events, fitness center, lunch and friends.

For more information, call us at 503/629-6342 or stop by for a visit.

[email protected] | (503) 590-8562

Right-SizingDone Right!

MOVING for SENIORS . com

Food for ThoughtEating Right at the Farmers Market

ello Beaverton, with the sun shining upon us, isn’t it time

to think healthy, look healthy and be healthy? Forget all those diet books and let’s start having fun by heading down to the Farmers

Losing weight and being healthy is as simple as that!

Today’s family can gather at our local farmers market to hunt for goodies, visit with our local farmers and choose fresh produce among the plentiful spring harvest! The yield at this time of year brings a variety of greens as well as car-rots, beets and asparagus.• Any of these vegetables would

be wonderful combined with a complex carbohydrate in the form of whole grains, pasta or

potatoes. •

produce from the market with a lean protein.

• Serving a meal with ingredients from just two different food groups will ease the digestion process, allow the body to absorb more nutrients and eliminate indigestion and acid

• Finish the meal with a salad and you will be keeping in the vegetable family of foods.

it be fresh fruit or from a variety of delicious baked goods that are also quite plentiful at the mar-ket. Remember to eat it mid-day because the digestion process for

sweets can take up to two hours.

Have fun, eat well and remember, “Let food be thy medicine!” - - Hippacrates

Celia Lambert has earned her PhD in Holistic Nutrition and fine tuned it through the school of life. She is the mother of six happy, health children. Questions? Contact me! [email protected]

Learn to Draw & Paint Loved ones, pets and family members!

and observe the class, then sign up for this most fun and rewarding type of artwork learning. To register, contact Kumi Pickford:

[email protected], 503-436-8502, www.kumipickfrord.com

t me! celia.lam

healthy and l those ddddddieeieeei tt t ttttthaving ffffffffffffuunununununnunnunnu

the Farmemeemememmmememmmmmemmmmmmeeerrsrsrssrsrss

ng hhhhehhhhh alalthhththy yyy is

an gggggggaattatattataataaa hhhhehhhhh rr r at rkettttttttt tttttttttto ooooooooo hhhuhhh ntntnttt th ooouuuuouooooo rrrr r lolololollololocal esh ppppppppprororodududududududuucecc ring hhhhhhhhhhhararraaa vevev st!!!!f year bbbbbbbbbbririiringn s well as ccccaar-us.bles would nenedd iwi hth raratete in the

produce frolean protein

• Serving a mfrom just twgrgggggggg oups willprprprrrrocess, allabbbsorb morelleelelliminate in

• FFFFiFFFFFFFF nish the maaaanaaaaaa d you wivevvvv getable f

it be fresh frof delicious balso q iuitete ppket. Reme emembb



The Care & Feeding of Your HomeHow to Earthquake Proof Your House

Growing up in Portland, I remember hearing about the

“big one” that scientists were cer-

each major earthquake that occurs somewhere else in the world, we are reminded that we are sitting on

sense then that it is not a matter of “if”, but a matter of “when” it will strike here.

-

years ago is that they have virtually no building codes. Construction technique in that situation is left

had building codes in place since -

general, won’t withstand an earth-quake as well as newer ones.

And, just so there’s no mis-understanding, seismic building codes are not designed to build earthquake proof structures, rather they help us build earthquake resistant structures. The intent is to build something that won’t collapse on the occupants and will allow them to escape safely.

For the most part, old fashioned building techniques simply relied on gravity to hold a house on its foundation, so the addition of anchor bolts through the sill plate into the concrete makes good sense. But, that only keeps the house from sliding off the foundation.

Once the house is anchored in place, shear wall hold-down anchors should be attached at each corner. This will keep the house from being tipped over like an old

All post and beam construction under the house should be tied together to keep the posts from coming off their piers and to pre-vent the beams from sliding off the

posts. Gravity is great so long as all forces are straight down. But when the earth begins to pitch and roll and twist and heave, all bets are off for any parts of the house that aren’t tied together.

Now, let’s go back into the house and see what we should do in there to make things safer. If your water heater isn’t strapped to a nearby wall, it should be. In a major earthquake, this container

precious commodity you will ever

spill out could be the difference between life and death. Of course,

full of water tip over can also cause a lot of serious damage, too.

Are they all attached to the wall, so they won’t tip over and crush someone?

Outside your home, do you have an earthquake wrench strapped to your gas meter, so you can shut the gas off at the source in the event the gas line gets broken? They’re

-able on line or at many plumbing supply and hardware stores.

That’s a real quick primer on earthquake protection for your home. If it’s something you really want to investigate more fully,

kxl.com and I’ll be happy to point you in the direction of some good contractors who can discuss it in a lot more detail with you.

By “Handyman Bob“ Strong

Handyman Bob offers home improve-ment advice on his radio show, Around The House, every Saturday from noon to 2:00 on FM News 101 KXL.

And, during the week, he is the Development Director for Molly’s Fund Fighting Lupus. For information on this debilitating disease, visit www.mollysfund.org.

Zoo News is Good NewsSet For Another Summer Concert Season

country singer’s favorite

where the word is overused, and

kicking off a summer’s worth of fantastic music.

-mer concert series — presented by Regence BlueCross Blue Shield of Oregon, the Oregon College

-concerts.com.

“Nothing says summer in Portland like a warm evening on the concert lawn listening to some great music,” said Kim Smith, zoo director. “And the best part is these

for animal welfare, education and conservation.”

This year’s series brings some familiar faces back to the zoo.

will close the series with two

And, really, are there more familiar faces than Pat Benatar and Rick

with all-time greats and some contenders. For more information, including show times and a full schedule, visit zooconcerts.com.

New this year: Tickets printed at home come with a coupon good

-age purchases (excluding alcohol) at the AfriCafé, right next to the concert lawn. Coupons are vali-dafter 5 p.m. on concert nights.

By Oregon Zoo Staff

Spring Hours thru May 24: 9am to 4pm, grounds open until 5 p.m.

14611 SW Teal Blvd, Beaverton, OR 97007 | 503-579-2403

“Wholesome Grub for the Pets You Love!”

Locally Owned and Operated

Successful Business Expo West 2014“Sustainable Impact”Obusiness professionals gath-ered for BESThq’s Business Expo

and the Triple Bottom Line,” the business-business event demon-strated true community in action featuring student volunteers from Portland Community College and

-itors created lasting relationships fueling our growing and vibrant economic recovery.

Attendees found themselves amidst hundreds of business build-ing opportunities from large, small,

dedicated to making a difference

action, food was readily available thanks to local food vendors includ-ing Curry and Crust, Red Tomato

industry sectors demonstrated the diversity of our recovery and community opportunity. BESThq

the crowd introducing Beaverton

Journal editor Suzanne Stevens and

Event highlights included spe-cial lounges where participants could interact with selected special guests. The theme of sustainability

-nies was explained in more detail

Bank, a B Corp. Once the par-ticipants understood more about

-

Building Services, Kate Taylor from Beaverton Recycling at

Better Business Bureau discussed the importance of the triple bottom line. Presented by BBSI, the line-up of special guests included State

School District Superintendent Dr.

By Chelsea Ploof

Attendees (and those not able to attend) are encouraged to reunite with all of their new connections at ReCONNECT on Friday, May 16th , 4-6 PM at BESThq in Beaverton, 12745 SW Beaverdam Road. For more informa-tion visit besthq.net.

Th CTh C


Te e n T h i n k i n g

Musings of a Beaverton TeenRight is Wrong: How our school system does not help everyone

ave you ever felt like your teachers’ lessons don’t make

sense to you? Are you more of a hands-on, visual learner? Some of us teens are right-brained ori-ented, but the school system is designed almost exclusively for the left-brain.

Which are You?So what am I talking about?

Simply put, the right brain is in charge of the “overall picture” in your mind, as well as creativity, music, art, and emotion. The left brain is in charge of reasoning, numbers and words, analysis, and linear/straight-forward thinking.

sides, and a few people have an

each. No matter which brain is more of your style, it’s clear that

-ferent ways of thinking and under-standing the world.

discover the type of brain you are:

http://en.sommer-sommer.com/braintest/

The Impact on SchoolworkAnd our society doesn’t honor

that. It seems like to me that the way we’re taught to think is that the left-brain is the only worth-while brain. In school, the lessons are taught in a very left-brain heavy style, with lectures and very little

-cally art-oriented classes. I’ve seen so many of my peers become frus-trated and hateful towards school because they’ve never found a way to fully understand or connect to the work. That doesn’t seem good at all. There’s been so many times when one of my classmates asked for my help during school and I

my thinking to them. People so obviously have different ways to learn, yet we’re all placed in the same styles of learning.

variety in the styles of schoolwork to make sure that all doors are open for every brain-type. Perhaps more creative, hands-on activity in the classes that usually don’t have that sort of thing, like in math or science. There needs to be an equal amount of logical, black-and-white lessons and creative, colorful classes, and that is not the case now. I feel like there would be a better appreciation of schoolwork and learning if we have variety and newness in every lessons.

Overall, teens shouldn’t be dis-advantaged if they have a different style of learning. The ability to solve equations and other left-brained activity is very important, but so is the creation of artwork and originality in ideas and styles of the right-brain. If you have either brain, you should be cele-brated for being an individual and given equal opportunity.

By Brigid Fitzpatrick

Brigid Fitzpatrick is a student at Southridge High School. She is an active member of the Color Guard and hopes to pursue a career in journalism one day. Brigid is an intern at Cedar House Media.

Busy Beavers: Outstanding Students at Beaverton HighIntroducing Kaya Patton and her visit with Vice President, Joe Biden

Spring Break is an exciting time for any high school student.

Some students get to travel, some spend their time hibernating to make up for lost sleep, but few can say they had dinner with one of the most powerful men in America:

student, senior Kaya Patten, could make such a claim.

lives. Some of the most important women in the United States were in attendance, including Supreme Court Justice Sonia Sontemayor and, of course, Dr. Jill Biden. Patten’s mother helped work for Susan Bonamici’s campaign and was invited to accompany her to the dinner, an invitation she and her daughter excitedly accepted.

The dinner was not the tradi-tional sit-down meal that most were anticipating. They served appetiz-ers such as crab puffs and quarter sized ice cream sandwiches, which were to die for, according to Patten. Though it was not what Patten had envisioned, she was still not disap-pointed at all, “It was amazing. The

it was relaxed, but there was a buzz of intellect which was really fun.”

At the event, Patten listened to the vice president discuss how women are sculpting the United States. Then Dr. Jill Biden’s presented what she would like to see happen for women in the future. For Patten, the experience was almost unbelievable, “Every time we turned a corner there was someone really important standing there… it was crazy.”

Patten even had the opportunity

to talk to the vice president him-self, and was surprised at how

got to meet him afterwards and he

Kaya, I’m a senior in high school, I’m graduating soon,’ and he was just so excited about that, he told

-uating high school!’ and I was like

For Patten, it was an experience she wouldn’t trade for the world. “I’ve gone to work with my mom and I’ve lobbied and I’ve talked with powerful people but never that many that quickly, and I learned a lot about presenting yourself and introducing yourself and talking yourself up.” As an aspiring politi-cian herself, this will certainly be a day to remember.

By Hailee Meacham and Laila Mottaghi

Hailee and Laila are senior editors of Beaverton High School’s newspaper, the Hummer, and enjoy reading, writing, and watching documentaries. You can contact them at: [email protected].

Virtual Office Space

Jackie Butts(503) 734-8885

Identity theft solutions, to make your world a safer place

Independent Insurance AgentServing Portland to Salem

(503) 307-4811 Guiding You Around Life’s Bases

Edible Sculptured ArtCakes, Pies, Pastries and More!

*I MAKE SMILES* www.KatisCakes.com

503-961-4397

Sustainable construction Framing and Drywall

(503) 646-6164 www.bronzeconstruction.net

State-of-the-art technologyTraining & Prints

[email protected] Located at BESThq

RESOLVING your commercial& residential pest issues

(503) 895-2510 www.pestsolutionsllc.com

Green As Can Be

Residential, commercial,Maintenance construction

(503) 231-9444 www.nwrconstructionllc.com

Creating unexpected value

Join our business community and take Your business to the next level!

503-626-1700www.BESThq.net

Virtual Office SpaceCollaborative Business Community,

Conference Rooms & More!

FREE Business Event

Join us Tuesdays at 7:30am for our Executive Briefing!

Connections, opportunities, events, and more!

Join Us!

New Location inDowntown Beaverton

12745 SW Beaverdam Rd

Canyon Rd

Ceda

r Hill

Blvd

Wats

on R

d

Kaya Patton (far left) with Vice President Joe Biden


Vendor Guide

Offering an exclusive selectionof Oregon wines, handcrafted by our dedicated winemaker.

www.ArcaneCellars.com 503-868-7076Booth # 118

From our hives to your homeLocal raw honey, creamed raw

honey, bee pollen, royal jelly, and more. www.tbshoney.com

503-858-7207Booth # 35

41Pine Mountain

Ranch

43Spring Hill

Organic Farm

24Lady-Lane

Farm

67Moh'sMobileKitchen

59Ken & June’s

Hazelnuts65Stephens Farm

67Kuys Cambodian

Sauces

57Kimo’s Dips &For the Love

of Pasta

55Henry Higgins Boiled Bagels

52Sun Gold Farm

69Champoeg Farm

70Garden Lane Farm

51

49Pumpkin Ridge

Gardens

48PearsonNursery

71Stoller Farms

78Humdinger

Foods

80Martinez

Family Farm

83Decadent Creations

87Willamette Valley

Cheese

88DeNoble's FarmFresh Produce

91Rose City

Pepperheads

95Kaleng

Produce

98Salmon

Creek Farm

136Ambacht Brewing

128May's Produce

and Flowers

127Price Right Nursery

and Produce

126Portland

JuiceCompany

135Bloominghill

Vineyards

145ELA Farms

146Rainbow Nursery

123May's Produce

and Flowers

122Grandma Candys

Jam/Country CharmAcres

121Sweet Briar Farms

120Tabor Bread

119Zoe Ann's

Cheesecakes

117NW Cactus &

Succulents

139House Spirits

Distillery

140New DealDistilling

141Eastside Distilling

143Pete's Mtn. Perennials

138Wild Roots

Vodka

130Loibl Farms

147Mak Lilies &

Perennials, Inc

148Greenville Farms

149Northern Pacific Farm

152Liepold Farms

154Happy Campers

Gluten Free

155Happy Cup Coffee

9SimingtonGardens

184Clint’s Ice Pops

181Fetzer’s German

Saugage

104It’s

PartytimeCatering

111McCarthy’sBeverages

101-5Malou's Gourmet

Brittle

101-4Olympic

Provisions

101-9Don

Felipe

101-10EsoticaPasta

15Briar Rose Creamery

16Margie’s Buds

and Blooms

101-8March

Biological Control

115Country GrainsDeli & Catering

177Smokin

RoseBBQ

161Casa deTamales

164McCarthy'sBeverages

175Liquid

Sunshine

173C’est

Si Bon!

166Homemade

HappyCuisine

167Gabriel'sBakery

168PBJ's

37Fressen

Artisan Bakery

1Greens Bridge

Gardens

4Skipanon

Brand Seafood

29Denison Farms

25The Berry Patch

34SOMA Evolutionary

Refreshment

36Portland Creamery

38Souper Natural

39Sterling Cookies

40Hammer & Tuffy's

23Danielle's Sauces

18N & M Herb

Nursery

169Big O’s

DeliciousPizza

102Master

Gardeners

105GatheringTogether

Farm

113Pony

Espresso

56True Nature

Parking

178-AEdgemaster

MobileSharpening

7 Alex Farm

11Packer

Orchards

172Feastworks

97Feastworks

101Nut-

Tricious Foods

101-1Simply Grown

Beef

101-3Pacific

NW KaleChips

118Arcane Cellars

157Hoda’s Middle

EasternCuisine

84Linda

Brand Crab

103Bleu

DiamondDressings

101-7DovetailCoffee

101-6Bone Yard

Bakery

92ProFarmProduce

125Quinn’s

Crab Cakes

109Unger Farms

100Hummus

Stop

73WintersFarms

85Lonely Lane

Farms

58Sedum Chicks

61Red Pot Spot

165IC

Confections

33AlottoGelato

35TBees

MusicStage

Hand made & local dressing.

Do you like fresh chopped garlic, pepper & chunks of bleu cheese?

Stop by our booth for a treat.Booth # 103

Ageless WinesYou Can Drink Right Now

Lovingly Handcrafted. Tasting room open F- Su. 503-992-1196

www.abloominghillvineyardBooth # 135

Exceptional coffees from around the world

artfully roasted with pride in Beaverton OR.

www.dovetailcoffee.comBooth # 101-6

Fresh Falafel SandwichesAll Local.Flavorful.Made from

scratch! Stop by and try our Leba-nese Omelette! Gluten Free

Menu. www.hodas.comBooth # 157

Fresh Dungeness CrabAlso salmon, halibut, tuna,

rock fish, oysters and more! www.lindabrandcrab.com

866-569-4891Booth # 84

100% Grass Fed Beef Heritage Pork

On-Farm USDA processing www.lonelylanefarms.com

503-845-4252Booth# 85

Continued on Next Page

M U I Cat the Market

MAY3rd: Beaverton Community Band

10th: Water Tower Bucket Boys

17th: Boka Marimba

24th: Sandy Saunders Band

31st: Water Tower Bucket Boys

WHATS IN SEASON?

May: Asparagus, Rhu-barb

June (early): Aspara-gus, Cherries , Greens, Herbs, Rhubarb, Straw-berries

June (late): add Rasp-berries to the list

July (early): Apricots, Beans, Beets, Black-berries, Blueberries, Broccoli, Cabbage, Carrots , Celery, Cherries , Cucumber, Eggplant, Gooseberries, Greens, Herbs, Nectarines, Peaches, Raspberries, Strawberries , Summer squash, Tomatoes

Message From the Market MasterJoin us for Opening Day at the Beaverton Farmer’s Market: Saturday, May 3rd from 8am 1:30pm.

F

open for the summer season on the

Day weekend, but this year the market is expanding the summer

This year, the market boasts -

brand new vendors, including Tabor Bread, Jacobsen Salt Co.,

another record-breaking season, -

asked about the lengthened season, Ginger states, “our vendors have

responded to the nearly year-round demand for their products, to the point where there are only two months in the year when we do not have a market. Opening our regular Summer Season market a week earlier this year was a logical extension of the increased supply and demand for locally produced plants, produce and artisan foods.”

On opening day, the market will showcase an outstanding selection of locally grown and crafted prod-ucts from local farmers, produc-ers, and artisans. The Beaverton

largest selection of nursery stock available at any regional farmers market including lush hanging baskets, veggie starts, annuals,

Beaverton Farmers MarketSaturdays: May - November (8am - 1:30pm)

Located on SW Hall Blvd between 3rd & 5th Streetswww.beavertonfarmersmarket.com

To Key Bank andFarmington Rd

- 3rd St -

- 4th St -

- Was

hin

gto

n A

ve -

- H

all

Blv

d -

To BeavertonArt Court Booths

��

To Beaverton City Library

Beaverton City Park

To Public Restrooms,Playground &

Fountain

Just for Fun

I


B e a v e r t o n Fa r m e r s M a r k e t

Vendor SpotlightMoh’s Mobile Kitchen (Booth # 67)

authentic Pan-Asian food?

that’s never hit the food scene?

where all these wonder can be found and more. From our wide selection that is customizable to any customers liking, we make even the most selective taste buds

From our famously known Pad

Thai that put us on the map, to our fresh salad rolls and eggroll wraps handcrafted right in front of you to name a few, we offer a selection of items that can be consumed at

and Gluten-free options are also available, as we want everyone to

not want to miss our unique take on Pan-Asian cuisine every Saturday

and a wide variety of the beautiful nursery stock grown in Oregon.

area for a sampling of Oregon’s best distillers and craft breweries.

to offer the popular pet care service -

allows both market goers and their pets the opportunity to enjoy the

has always been pet-free, but now customers may bring their pet and pay a small donation for a dog-sit

-

The popular kids program,

activities this year, with more hands-on educational activities and scavenger hunts to educate and excite young people about where

All of that to say, we are excited to kick off another season.

See you at the Market!

Market MasterGinger Rapport

Quinn’s CrabcakesSimply the best!

Fresh and handmade from locally caught dungeness.

503-709-6984Booth # 125

Ask to Join Our CSACome see us for your fresh

and picked asperagus www.profarmproduce.com

509-280-3900Booth # 92

Oregon grown strawberries,blueberries, raspberries, blackberries and grapes.

www.ungerfarms.com 503-992-0710Booth # 109

Mediterranian AppetizersFresh Pita Bread Fresh Pita Chips

503-209-5517Booth # 100

Sustainable Family FarmWide variety of vegetables,

berries, fruit, flowers, honey, jams & syrup.

www.wintersfarms.comBooth # 73

Artisan Gelato Handcrafted from natural

ingredients & made fresh daily! www.alottogelato.biz

503-228-1709Booth # 33

Cold-Pressed Raw Fruit & Veggie Juice. No preservatives or sugars. Delivered to your doorstep

daily! portlandjuicepress.com 503-913-3367

Booth # 126

Delicious Laotian CuisineEgg Rolls, Pad Thai, Salad Rolls,

Lemon Grass Beef Sticks, Chicken Sticks & Fried Rice. Gluten Free

and Vegetarian Menu. Booth # 67

SMALL FAMILY FARMLocated in Aurora, Oregon

Organic produce 12 months a year Join our CSA farm share

www.simingtongardens.comBooth # 9

Ken & June’s Hazelnutsoffer a delicious selection of Raw, Dry Roasted and Roasted & Salted

Hazelnuts. Milk, Dark, & White Chocolate coated Hazelnuts too!

Booth # 59 (May Vary)

Wild Roots Vodka produces all-natural spirits that

strive to embody the true essence of the Northwest.

www.simingtongardens.comBooth # 138

The Ultimate Dog TreatBaked and organic, we believe in healthy pet treats. No wheat,

soy, corn, grain or GMO’s! www.boneyardbakery.net

Booth # 101-5

Vendor SpotlightKen & June’s Hazelnuts (Booth Varies)

Dup and moved their family from Norfolk, Nebraska to St. Paul, Oregon where they purchased

orchard. It was one of the largest

-

After Ken died in the fall of

son took over the family business

grown the farming operation to

his wife, Sylvia, decided to expand their farming success into what

-

appropriate to name the business after the original hazelnut farm-

-ing fresh, Oregon grown, farmer direct hazelnuts.

67)

Message

Continued


W h a t ’s H a p p e n i n g i n B e a v e r t o n t h i s M o n t h ?

Raleigh Hills K-8 Middle School Presents:

5225 SW Scholls Ferry Rd, Portland, Oregon 97225 | 503.259.7385

Washington County Open StudiosCall to ArtistsCall to Artists for 5th Annual

process and promote your work in

a full-color catalog and website. Artists with a working studio

must be willing to open their stu-

both days. Participation fee $100. Application online beginning March 1 at wash-coart.org. Deadline June 1.

Oregon SymphonyClassical Up Close comes to Beaverton!

Oregon Symphony musicians are on the loose and headed to Beaverton!•

• Church of Christ

• brings world class symphony

musicians to you. • Cost: FREE!For more information, please visit www.classicalupclose.com.

Art On Broadway Gallery Pam Nichol’s Special Fundraising Exhibit to Benefit Susan G. KomenTigard resident and encaus-

tic artist, Pam Nichols, has

G. Komen breast cancer organ-ization. To accomplish this, she has invited local artists to donate

works of art for a special sale at Art On Broadway Gallery during

For more information, please visit http://www.artonbroadway.net/.

Audition NoticeMay, 4, 5, 6 – 6 - 8pm at HART Theatre

OPEN CALL, NO APPOINTMENTS MADE.

ART Theatre is very proud to announce a special audition

opportunity for the premiere of an original full-length, fully pro-duced musical comedy written by local playwrights Darrell Baker, Tina Arth and Carl Coughlan, and directed by Paul Roder.

Noah, his family, his neighbors, his vision, and the carnival that comes

to town. Like the current Russell Crowe movie, it is loosely based

but that is where the resemblance ends!

This is your chance to be part of a unique process and to put your stamp on an original role.

Auditions will consist of cold readings and a prepared song of no longer than two minutes. We will have an accompanist, please do not bring your own.

African Cooking Exhibit, May 2ndWith Wambui Machua

The Sister Cities Program will be participating at the season

opening First Friday “interna-

5 – 8 p.m. Natural Grocers will host, opening their kitchen to Sister Cities Advisory Board mem-

share her African cooking exper-tise. Entertainment provided by

See page 8 for First Friday informationBumper Sticker: to order, email [email protected]

Bumper Stick

ers

Only $2.50

!

Service to Beaverton

Award

2014Complete a nomination form for a Service to Beaverton Award in the following categories: • Outstanding Beaverton Individual • Business • Neighborhood Association Committee (NAC) Member • Service Organization • Emerging Leader (18 and under) • Educator/Teacher

For tips on submitting a great nomination and to complete a nomination form, visit www.BeavertonOregon.gov/Service or email [email protected]. For more information, call Megan Cohen at 503-526-2584.Winners will be announced at the Service to Beaverton Awards Luncheon on July 18, 2014. Tickets will be available for purchase.

Who do you know that deserves recognition for contributions to our community? Let us know!

Nomination Form Deadline: Tuesday, May 27 at 4 PM


B e a v e r t o n C i t y L i b r a r y

Library News

Beaverton City Library12375 SW 5th St., Beaverton www.BeavertonLibrary.org

503-644-2197

All events are free. Registration, where noted, is one month in advance. www.BeavertonLibrary.org/register. For more informa-tion, call or visit library website.

General

Third Thursday Film SeriesColorful Films: How Hollywood Gets its Green On (where all the films have the word “Green” in the title!). Please call the library at 503-644-2197 to find out which movie will be shown. This event is free and open to the public. No registration required.

Portland Opera Sneak Peak Tuesday May 6. 7pm in the Auditorium. Pirates of Penzance sneak peak presented by Portland Opera

Events for Kids,

Tweens and Teens

Planes, Trains, and Automobiles!Monday, May 5, 10:30-11:30am Are you crazy about planes, trains, and automobiles? Come and play with your favorite kinds of transportation! There will be crafts and lots of fun! Ages 2-6 with adult.

Tween Book ClubWednesdays, May 7 & June 4, 4-5pm. Come by the Teen Desk to check out your copy of the latest pick. Then join us for pizza and chat! Grades 5-8, drop-off.

Poetry CoffeehouseThursday, May 8, 6 – 7:30pm Bring something to share— it could be a poem, monologue, skit, or the limerick you entered in the April poetry contest—and

read it out loud! Also, enjoy deli-cious coffee. Grades 6-12.

SAT Practice TestSaturday, May 10, 12-4:30pm Take a free SAT Practice Test, proctored by Kaplan. To regis-ter, call 1-800-KAPTEST, or visit http://www.kaptest.com/enroll/SAT/97005/events

Mother’s Day Crafts and TeaSunday, May 11, 1:30-2:30pm Come by the library and make something to show your mom how much you love her and relax with tea or lemonade. Ages 0-12 with family, drop-in.

Anime ClubTuesdays, May 13 & 27, 6-8pm Chill out with other anime fanat-ics while you eat snacks, watch anime, and master surprise anime activities! Grades 6-12.

Chess ClubSaturday, May 17, 10:30-11:30am Hone your skills against oth-er players or learn the game. Grades 3-8, drop-off.

Puppet Show: Rascally Rabbit TalesSaturday, May 17, 11-11:45am Celebrate Children’s Book Week with a puppet show, Rascally Rabbit Tales. Enjoy this hilarious and interactive puppet show by Pink Pig Puppet Theater. Ages 4-8 with family, drop-in.

Family MoviesSunday, May 18, 2pm Enjoy a great new DVD release on the big screen! All ages, chil-dren under 10 must be accompa-nied by an adult.

Messy ArtFriday, May 23, 4-5pm Create messy art together. Ages 2-6 with adult.

Library Sponsors

Support Your Library

by donating to the Beaverton Library Foundation online @

beavertonlibraryfoundation.org

The Book CornerFor gently used books at

affordable prices w/ proceeds donated to the Beaverton Library. www.bookcornerbeaverton.org

503-643-5188

New at Washington Square

Learn more here: www.shopwashingtonsquare.com/Events/KidsClub

HappyHour

AztecaSun & Mon-All Day!

Tues-Sat, 3-6:30pm/9pm-close Try our Sangria or Mojitos

Well Drinks are $2.50 503-643-8269

BenihanaMon-Thurs: 3-7pm

Sake, Beer, Wine & Specialty Cocktails; Sushi rolls from $4.50,

Teriyaki Wings & more 503-643-4016

Big Al’sMon-Thurs 3-6pm & 9pm-close

Fri 3-6pm; 10pm-close Sat 10-close; Sun 9pm-close

Food & Drink Specials 503-748-6118

Bistro 153Mon-Fri 2-7pm & 9-close

All Day Sat & Sun Food, Beer, Wine, Cocktails 3203 SW 153rd Dr., Suite 419

503-626-8282

BJ Willy’s Progress RidgeDaily: 3-6pm

Sun-Thu: 9:30p-closing Full Bar~16 Beers on Tap

www.bjwillys.com 503-747-7319

Black Bear DinerMon-Fri: 3 - 6pm

$4.95 Small Taco Salad Choice of Chicken or Beef

includes beverage! 503-646-4507

Brickyard TavernEveryday 3-7pm and 10pm-Close

$2 to $6 Food Specials Daily Drink Specials

13095 SW Canyon Road 503-718-7033

Broadway Saloonin Old Town Beaverton

Daily 4:30-6:30pm & 10pm-12am $3.95 HH food & $1 off drinks

12434 SW Broadway St 503-641-7474

Buffalo Wild WingsTue & Thurs 12pm-12am

Mon-Fri 3-6pm & 10pm-12am $1 off tall pints, 50¢ wings allday

www.buffalowildwings.com 503-645-9424

Cafe MurrayhillEveryday from 3:00-6:00pm

Discounted appetizers! Wine, Beer & Cocktails.

www.cafemurrayhill.com 503-590-6030

CinetopiaEveryday 3-6pm & 8pm-close $3.99 & $4.99 Food Specials Discounted Beer and Wine

www.cinetopia.com 503-597-6911

Coach’s Bar & GrillSat-Thur: 3-7pm & Fri: 3-8pm

Great Burgers, pizza, sandwiches and dessert.

Pool, shuffle board & karaoke. 503-203-8250

decarli RestaurantTue-Sat: 4:30-6pm

9pm-close; Sun 5-9pm Panini’s, Pizzetta’s & more!

Try a Cool Hand Cuke! 503-641-3223

Ernesto’sMon-Fri: 3:00-6:30pm Sat-Sun: 4:00-6:30pm

$3.50-5.50 Food Specials & More Discounted Beer, Wine, Well

Drinks. 503-292-0119

Hall Street GrillM–Sa: 3–630 & 9-close

Sun: 3-close Drink specials,

tasty morsels & nibbles. 503-641-6161

Ickabod’s“Stimulus Hour”

Everyday from 4:00 to 6:00pm Domestic pint & pitcher specials.

Best Burger in Town! 503-646-0222

La Hacienda RealHappy Hour Daily from 3-6pm

Any dish only $3.95! Margaritas, well drinks & beer.

12025 SW Canyon Rd 503-601-7000

Malones Cafe & BarDaily 4:00-7:00pm & 10pm-12am

$1 - $4 Food Specials Pizza, sliders, & more Draft & Well Specials

503-579-3663

The Mark Lounge& The Mark Cigar Bar

Daily 3:00-6:00pm; Drinks, Apps, Sports, Cigars & more!

www.themarkpdx.com 503-643-5451

McCormick’s Fish HouseDaily 4-6pm & 9-cl,

Food starting at $2.95! Beer, Cocktail and Wine specials,

never offered before! 503-643-1322

McGrath’s Fish HouseMon-Thu 3-6pm & 9-9:30pm,

Fridays 3:00-5:00pm, Enjoy $3 Food Specials, $4 Beers,

www.mcgrathsfishhouse.com 503-646-1881

McMenamins-Murray & AllenDaily 3-6pm & 10pm-close

Drink Specials. Food starting at $1.75! 6179 SW Murray Blvd.

503-644-4562

MiNGO RestaurantTues-Fri 2:30-6:00

Sun & Mon 5:00-6:00 pastas, pizzas, burgers & more

wine, beer & cocktails mingowest.com

Monteaux’s Public HouseHappy Hour Menu Early: 3:00-6:00pm

Late: Last 2 hours to close and 10 Terrific Taps too

Ask about ‘oomph’!

Newport BayM-Sa: 3-6p/8-10p, Sun.-all day

Food specials $.99 - $5.99. $1 off Draft Beers.

Wine & Well Drink Specials. 503-645-2526

Peppermill LoungeMon-Fri: 4:00-7:00pm

(22 draft beers) · Food & drink specials + huge late nite menu.

Open till 2:30am daily. 503-642-5193

Planet ThaiDaily 3-6pm and all day Sunday.

Drink and appetizer specials. Try our Philly Crab Puffs ($4), or Crispy Spring Rolls ($3.50)

503-718-7101

Red RobinMon-Fri: 3-6pm & 8pm-close

Beverage & Appetizer Specials www.redrobin.com

10100 SW Wash. Square Road 503-624-3955

Ringo’s Bar & GrillMon-Fri: 4:00-7:00pm

Cocktails, Food & Juke Box Voted Portland’s Best Burger!

12300 SW Broadway St. 503-644-7847

Ruby TuesdayDaily: 3-6pm & 9pm-close

Chips, Dips, Shrimp & Chicken Cocktails, Beer & Wine www.rubytuesday.com

503-579-3737

House


D o yo u h a v e a n e v e n t w e s h o u l d k n o w a b o u t ?

WASHINGTON COUNTY Event Calendar

Oregon's Washington County is a short drive from Portland, and is home to nationally renowned golf courses, award-winning wineries, tax-free shopping, agricultural experiences, outdoor recreational activities & more. With a combination of suburban and rural settings, Washington County offers an unparalleled experience for all travelers.

503-644-5555 | www.oregonswashingtoncounty.org

Messages: The Art of Carolyn ColeThrough June 1 – WashCo Museum (Hillsboro Civic Center) washingtoncountymuseum.org

Downtown Beaverton First Friday EventMay 2 – Beaverton History Center, HistoricBeaverton.org

Over the River and Through the WoodsMay 2 -18 – Mask & Mirror Community Theatre (Tigard) www.maskandmirror.com

Annual Oyster & Saké EventMay 3 – SakéOne (Forest Grove) www.sakeone.com

Faire in the GroveMay 3 and 4 – Grand Lodge (Forest Grove), www.fairein-thegrove.com/index.html

Nature Days in the ParkMay 5, Vista Brook Park (Portland), May 10 – Pioneer Park (Beaverton) www.thprd.org

First Tuesday Art WalkMay 6 – WashCo Museum (Hillsboro), www.washington-countymuseum.org

First Wednesday Forest GroveMay 7 (“Spring into Action”) – Downtown Forest Grove www.fgcityclub.com/

Evening Hour at the HawkMay 8 – Hawks View Cellars (Sherwood) www.hawksviewcellars.com

Private LivesMay 8 - 30 – Bag&Baggage (Venetian Theatre – Hillsboro) www.bagnbaggage.org/events

A Musical FeastMay 9 and 10 – Voices for the Performing Arts (Sherwood) www.vpafoundation.org

Date NightMay 9 – Plum Hill Vineyards (Gaston), plumhillwine.com

Guys and DollsMay 9 through 11 – Theatre in the Grove (Forest Grove) www.theatreinthegrove.org

Tillamook TalesMay 10 – Tillamook Forest Center

www.tillamookforestcenter.com

Hippie Chick Half & Quarter MarathonMay 10 – Gordon Faber Rec- reational Complex (Hillsboro), www.betterseries.com

Tears of Joy Theatre: Malika, Queen of CatsMay 10 – Walters Cultural Arts Center, hillsboro-oregon.gov

OMSI Star Party: Astronomy Day CelebrationMay 10 – Stub Stewart State Park (Buxton), www.omsi.edu

Family Fun DayMay 11 – Washington County Museum (Hillsboro Civic Center) washingtoncountymuseum.org

Mother’s Day at Garden VineyardsMay 11 – Garden Vineyards (Hillsboro), gardenvineyards.com

Mother’s Day Wine BrunchMay 11 – Plum Hill Vineyards (Gaston), plumhillwines.com

Tualatin River Bird FestivalMay 17 – Tualatin River National Wildlife Refuge (Sherwood) tualatinriverbirdfestival.org/

Tualatin River Bird Fest PaddleMay 17 – Tualatin Riverkeepers (Sherwood) tualatinriverkeepers.org

Friar TrotMay 17 – St. Francis School (Sherwood), thefriartrot.com

The Sum of Many Parts: Quiltmakers in Contemporary AmericaMay 21 - June 15 – Washington County Museum (Hillsboro) washingtoncountymuseum.org

Open Alpaca BarnMay 24 and 25 – Alpacas of Oregon (Sherwood), www.easy-gofarm.net/AOOMemDay.html

Memorial Weekend in Wine CountryMay 24 - 26: Washington County Wineries, www.ore-gonswashingtoncounty.com/Discover-Wine-Country

MAY 2ND - MAY 17TH$15 ADULT | $12 STUDENT, GROUP, SENIOR | $5 YOUTH

PRESENTS

FRI & SAT 7:30 PM | SUN 2 PM - BEAVERTON LIBRARY AUDITIORIUM

WRITTEN BY BERNARD POMERANCEDIRECTED BY JESSICA REED

503-754-9866 | www.BeavertonCivicTheatre.org

BEAVERTON CIVIC THEATRE

Synopsis: Bernard Pomerance’s The Elephant Man poses many questions that remain relevant today. The most obvious revolve around the eponymous Joseph Merrick. We are asked to consider the true measure of a man. Merrick’s condition sets him apart from the rest of the world but the pursuit of normalcy is a capricious quest when no one can really decide what normalcy is. He was put up in comfortable lodgings and supposedly made friends with a great many important people. He became something of a celebrity in his own right. Yet were these people really his friends or had they simply come to gawk as others had done during the sideshow? The intrinsic brutality of society is a recurring image in the piece.

The character of Frederick Treves presents other questions. The play begins and ends with Treves and it is his crisis of conscience that the audience must experience. Are the rules set out “for our own good” really so good after all? As Mer-rick’s condition deteriorates, we see Treves’s certainties about goodness, faith, and propriety do the same. The audience must feel the same heartache as Treves as he comes to realize that all he has held to be true and righteous is in reality false and hollow. The Elephant Man is a play about questions and ques-tioning and it leaves it up to the audience to seek the answers for themselves.

Black Bear DinerMon-Fri: 3 - 6pm

$4.95 Small Taco Salad Choice of Chicken or Beef

includes beverage! 503-646-4507

Dairy QueenWeekdays 2:00-4:00pm Half-Price Soft Drinks Shakes & Arctic Rush

12870 SW Farmington Rd. 503-644-3469

Einstein Bros BagelsDaily 3pm to 430pm (closing)

all bagels & beverages! Beaverton Town Sq. Location

503-643-2334

Honey Toast CafeTue-Fri: 3-6pm

20% OFF all appetizers $8.88 Petite Honey Toast

+ tea or coffee. 503-747-2712

John's Incredible Pizza Co.$2.99 Kids' Buffet Tuesdays

For more Spring specials johnspizza.com

503-520-0000

Mom’s Dessert CafeHappy Hour on Sat / Sun

Say the Secret Word ‘Longbottom’ to get a 12 oz Long Bottom House Coffee for only $.99 (or have a 12

oz latte $1.50) 503-579-1600

Taco Bell$1 Happier Hour

Medium Drinks or Loaded Grillers 2pm - 5pm Everyday

www.tacobell.com/happier_hour

Happy

FamilyFriendly

Hour

Stockpot BroilerDaily 4:00-6:00pm &

9:00pm-close Menu items from $2.50

and bar items from $3.25. 503-643-5451

Sylvan Zoo House & SaloonDaily 3-6pm & 9pm-Close

Free Food w/2 drinks M-F 4pm-6pm

$3.25 Wells - $4.00 Micros Sylvan Exit off Hwy 26

503-297-5568

Thai Bloom!Daily: 4:00-6:00pm; 8pm-close

Mon-Thurs; 9pm-close Fri & Sat All Day on Sundays.

3800 SW Cedar Hills Blvd. 503-644-8010

The Pit StopMon-Fri: 3:00-6:00pm; Sat & Sun,

food only 11pm-close Beer, Blood Mary, Micro Brews

10245 SW Canyon Road 503-643-4758

SStStStStSStSStSSSSSSSStSSSSSSS oD


W h a t ’s H a p p e n i n g i n B e a v e r t o n t h i s M o n t h ?

CinemarkCedar Hills Crossing 800-FANDANGO+984

CinetopiaProgress Ridge 503-597-6900

Valley Cinema PubBvtn-Hillsdale Hwy. 503-296-6843

Call Theaters for Show Times

TheaterListings

Bold Text = Nationwide Release

Synopsis: Back together after 20 years! That girl group from the sixties everyone loves is bringing back the sun, fun and all the great songs they sang down on the boardwalk at the Jersey Shore... all to raise money for the good folks at Sandy Shores Mobile Home Beach Resort. With a show that promises to get everyone dancing in the aisles, The Bikinis, relive their heyday and beyond, beginning the summer of 1964, the night these four in-separable friends got their name, winning the Belmar Beach Talent Contest, wearing just their bikinis!

NEW FRIENDS OF THE BEAVERTON CITY LIBRARY INVITE YOU TO THEIR 4TH ANNUAL

GROW YOUR MINDSpring Book & Media Sale

If you love books and want to serve a community of readers, fill out a volunteer application and join us.

All proceeds benefit the Beaverton City Library & the Murray Scholls Branch.

MEMBERS ONLY PREVIEW SALEWednesday, April 30

5:30-7:30 pmMembership ($15) is available at the door

Open Sale: May 1-35/1 Thursday 10 am - 8 pm5/2 Friday 10 am - 5:30 pm5/3 Saturday 10 am - 2 pm

All books 50% off on Saturday After 12:00 pm

To learn more about us: www.bookcornerbeaverton.org. or call 503.643.5188.

Beaverton City Library Lobby & Conference Room12375 SW Fifth Street, Beaverton

TICKETS 503.620.5262 www.broadwayrose.org

APRIL 17 - MAY 18Featuring hit tunes from the‘60s such as “It’s In His Kiss,” “Yellow Polka Dot

Bikini,” “Heat Wave,” “Under The Boardwalk,” “These Boots AreMade For Walkin’,” and “It’s Raining Men.”

OregonCultural

Trust

Friday May 2Bad Johnson NR

Belle PG

Beneath the Harvest Sky NR

Decoding Annie Parker NR

Mr. Jones PG-13

The Amazing Spiderman 2 PG-13

The Protector 2 R

The Walk of Shame R

Whitewash NR

Friday May 9Chef NR

Devil's Knot NR

Fed Up PG

God's Pocket NR

Legends of Oz: Dorothy's Return PG

Moms' Night Out PG

Neighbors R

Palo Alto R

Stage Fright NR

The Double R

The Hornet's Nest NR

Friday May 16A Night in Old Mexico NR

Godzilla PG-13

Million Dollar Arm PG

The Immigrant R

Wolf Creek 2 NR

Friday May 23Blended PG-13

The Angriest Man in Brooklyn R

Tracks PG-13

Words and Pictures PG-13

X-Men: Days of Future Past NR

Friday May 30A Million Ways to Die in the West NR

Filth NR

Maleficent PG

Night Moves NR

Party Central NR

The Grand Seduction NR

We are The Best NR

Volume 44444 IIIIII–Isssssss ueueueueue 55555555555555555 ((((((((((((((MMMMMMMMMaMMaMaMaMaMaMaMaMaMaMayyyyyyyyyyyy 20202202020202020202020202020202020202020200 ) BeeeeeeeeeeeeeeeBeBBBeavavavavavavaavavavavavavavavavavavererererererererererererererererererererrtototototototototototoototototottototototototoonnnnnnnnnnnnnnnnnnnnn RRRRRRReReReReReReReReReReReRReReReReReReReReResososoososososososososososososourururururururururururcececececececece GGGGGGGGGGGG iiiiiiuidddddde – 31000000000000000000000111111114141414141414141411141114) | BBBBB

What’s showing in

Beaverton


A d v e n t u r e s i n B e a v e r t o n

Beaverton Kids CornerThis month’s Kids Corner features 11 year old Ayla Maldarelli, 5th grader at Chehalem Elementary School.

The waterfall tricklesTrickles down the creek

It washes over my feetBuried in the sand

I close my eyes and listenTo the quiet orcestra of nature

The Orcestra

(Do you have a talented pre-teen? Submit your child’s poem and artwork to: [email protected])

Thursday, May 1, 2014Thursday, May 1, 2014

Questions for the Candidates or Bond Measures?

Email in advance to: [email protected].

Deadline for submission of questions is Wednesday, April 30.

For more information: Call Miles Glowacki in the Neighborhood Program

at 503-526-3706 or visit www.BeavertonOregon.gov/VotersForum.

Presented by: Beaverton Committee for Citizen Involvement

6:30 PM — Meet the Candidates and enjoy refreshments

7 PM — Voters’ Forum

Beaverton City Hall • 4755 SW Griffith Dr.

Spring Voters’ ForumJoin us for the Join us for the

Spring Voters’ ForumThe Voters’ Forum will highlight candidates and bond measures

for the Primary Election. Come listen, learn and ask questions.

Featured Races:

Beaverton City Council Position 1

Lacey Beaty

Alton Harvey, Sr.

Ian King (Incumbent)

Beaverton City Council Position 5

Marc San Soucie (Incumbent)

John A. Somoza

Measure 34-211 Tualatin Valley Fire & Rescue

Replacement local option levy for fire and medical emergency response

Measure 34-219 Beaverton School District

Bonds for repairs, reducing overcrowding, modernization, safety and technology upgrades

Washington County Commissioner at Large

Allen Amabisca

Andy Duyck (Incumbent)

Candidates for City Council Position No. 1, Ian King (Incumbent)Beaverton is a great place to

call home. As a husband, father, and community member I appreciate all that Beaverton

I are glad to be raising our son, Samuel, in such a vibrant and diverse community.

Over the past four years we have done a lot we can be proud of in this city! Beaverton has been rebranded as “open

of our community with our growing outreach efforts, and with our focus on public safety we continue to be ranked among the safest cities in the Northwest.

successes for granted. It takes experience, dedication,

tough questions, and demand accountability. A city councilor needs to be more than just a rubber stamp for others’ ideas. I will continue to be an independ-ent voice that will challenge and advocate for a solid future for Beaverton.

Position No. 1, Lacey BeatyLacey Beaty, I am a com-

munity-focused resident and cur-

Committee and sit on the board

only drop in center for youth experiencing homelessness.

As a military veteran, wife, and avid community volunteer I care deeply about Beaverton- because

it’s more than just a great city, it’s my home. I bring passion and sincerity in everything that I do and make decisions that I know will not only affect me, but my next door neighbor. I will treat everyone with respect and when community members reach out to me, I will respond. I am pleased to announce my candidacy for Beaverton City Council for the upcoming elec-

information about me and a list of local supporters at- www.BeatyForBeaverton.com or Facebook.com/laceybeatyforbeaverton

Position No. 1, Alton Harvey, Sr.Aservant to the betterment of the City of Beaverton and all our city’s residents and businesses. Alton’s tireless spirit is the breath of fresh air the citizens and businesses of this city need to address every concern, no matter the size. Alton’s sense of fairness,

his loyalty, and his desire to serve are truly worthy of

Maria I. Moreno, Former Commissioner of the Beaverton Human Rights Advisory Commision

Position No. 5, Marc San Soucie (Incumbent)ello, all! Beaverton is a very exciting place to live

great opportunities ahead of us, and I’ll keep working to make

upcoming priorities for me:• Develop strong market-

ing campaigns to raise Beaverton’s reputation and

• Continue to invest in techniques to encourage people to engage, volunteer, and offer thoughts about city work.

• Keep enhancing opportunities for public input

regarding the budget and the Capital Improvement Program.

• Complete the downtown streetscape projects so people see change happen - Canyon Road improve-

system, alternative street networks.• Complete the Allen Blvd. corridor improvement

study and take action.• Support the development of the Timberland area,

the Peterkort Sunset Station properties, and South

• Continue work to attract investment in our city by landowners, businesses, local developers, and

Position No. 5, John A. Somoza• No marijuana dispensaries in beaverton•

• • Stronger neighborhoods not denser neighborhoods

Let’s have fun in the BRG! Throughout the paper there are 6 happy veggie toons scattered about. Find and count up Mr. Carrot (shown below) and you could win a $25 gift certificate to Black Bear Diner!

Email your answer to [email protected] and the 3 winners will be chosen at random from all the correct answers at the end of the month. Good luck and Happy Hunting!

C dC d

May “Easter Egg” Hunt Contest

*Win A $25 Gift Certificate*

Find Me! Win

a $25

Gift

CertiF

icate!

Win

a $25

Gift

CertiF

icate!

Documents

BRG May 2014