Evaluation of the catalase promoter for expressing the alkaline xylanase gene (alx) in Aspergillus niger

R E S EA RCH L E T T E R

Evaluation of the catalase promoter for expressing the alkalinexylanase gene (alx) in Aspergillus niger

Ruchika Sharma1, Meenu Katoch1, Nagraj Govindappa3, P. S. Srivastava2, Kedarnath N. Sastry3 &Ghulam Nabi Qazi1,2

1Biotechnology Division, Indian Institute of Integrative Medicine (CSIR), Jammu, India; 2Jamia Hamdard, New Delhi, India; and 3Biocon Pvt.

Limited, Banglore, India

Correspondence: Meenu Katoch,

Department of Biotechnology, Indian Institute

of Integrative Medicine (CSIR), Canal Road,

Jammu-180001, India. Tel.:

+91 09419157224; fax: +91 01912 569017;

e-mail: [email protected]

Received 20 January 2011; revised 5 October

2011; accepted 31 October 2011.

Final version published online 12 December

2011.

DOI: 10.1111/j.1574-6968.2011.02454.x

Editor: Olga Ozoline

Keywords

catR promoter; AlX reporter gene; Aspergillus

niger.

Abstract

Aspergillus niger represents a promising host for the expression of recombinant

proteins, but only a few expression systems are available for this organism. In this

study, the inducible catalase promoter (PcatR) from A. niger was characterized.

For this, constructs were developed and checked for the expression of the alkaline

xylanase gene transcriptionally fused under the cat R promoter. Two versions of

the catalase (catR) promoter sequence from A. niger (Pcat300, Pcat924) were isolated

and tested for their ability to drive expression of the alkaline xylanase (alx) gene.

Pcat924 showed better efficiency (more than 10-fold increase in AlX activity com-

pared to Pcat300) under the optimized culture conditions. Induction of the catR

promoter with 0.20% H2O2 and 1.5% CaCO3 in the culture medium, further

increased expression of AlX 2.61- and 2.20-fold, respectively, clarifying its induc-

ible nature. Specific induction or repression of the catR promoter provides the

possibility for utilization of this promoter in heterologous protein production.

Introduction

Filamentous fungi have been used for decades as major

producers in the pharmaceutical, food, and food process-

ing industries because of their GRAS (‘generally recog-

nized as safe’ in the terminology of the US Food and

Drug Administration) status, and their ability to secrete

large amounts of protein. Previous studies suggested that

Aspergillus niger is an ideal host organism for production

of recombinant proteins (Roberts et al., 1992; Tellez-Jura-

do et al., 2006; Karnaukhova et al., 2007; Zhang et al.,

2008). For the efficient production of the recombinant

protein, strong promoter sequences are required. Various

promoters of different categories have been reported from

many filamentous fungi. Inducible promoters which are

not affected by catabolite repression include endoxylanase

(exl A) from Aspergillus awamori (Gouka et al., 1996) and

TAKA amylase (amyA) from Aspergillus oryzae (Tsuchiya

et al., 1992). Among the strongest inducible promoters

regulated by carbon catabolite repression are the glucoam-

ylase A promoter (glaA) of A. niger var. awamori (Ward

et al., 1990) and the Trichoderma reesei cellobiohydrolase 1

(cbh1) promoter (Ilmen et al., 1996). A constitutive

promoter used across fungal species is the Aspergillus

nidulans glyceraldehyde-3-phosphate dehydrogenase gpdA

(Punt et al., 1992). Till 2007, only the glucoamylase A

promoter (glaA) from A. niger has been used for the

expression of heterologous proteins. Recently, a new

inducible promoter Psuc1 from A. niger AB1.13 was char-

acterized (Roth et al., 2007). To obtain a new, promising

promoter for the expression of heterologous protein pro-

duction, we targeted promoter of catR gene from A. niger

because some strains of A. niger are efficient producers of

catalase. It is anticipated that a high catalase producer

might have a strong promoter and as such, there are no

reports on the use of catR promoter in expression systems.

Hence it is a legitimate target for cloning and exploita-

tion. In this attempt, we developed the constructs and

checked the expression of alkaline xylanase gene transcrip-

tionally fused under the catR promoter from A. niger and

also addressed the length and nature of the catR

promoter.

FEMS Microbiol Lett 327 (2012) 33–40 ª 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

MIC

ROBI

OLO

GY

LET

TER

S

Materials and methods

Extraction of genomic DNA

Aspergillus niger taken from the culture collection of IIIM,

Jammu, was used throughout the study (Traeger et al.,

1991). The strain of A. niger used in the study was

maintained on potato dextrose agar (PDA). For extraction

of total genomic DNA, the fungus was grown for 3 days in

Sabouraud’s broth at 28 °C. DNA was isolated from

A. niger using a modified TES method (Mahuku, 2004).

Construction of promoter-less xylanase/pAN56-1

plasmid vector

Promoter-less xylanase/pAN56-1 plasmid vector was

developed in the following steps.

(1) Construction of pAN7-1 (ClaI). A polylinker was

designed to create a unique ClaI site in the EVpAN7-1

vector. The nucleotide sequence of the double stranded

primer was: 5′-GCTCTAGAATCGATTCTAGAG C-3′.Two primers were annealed and digested with ClaI and

cloned in XbaI site of EVPAN7-1 vector. The vector was

now called pAN7-1 (ClaI) (Fig. 1).

(2) Construction of pAN56-1 (SalI-NcoI). A polylinker

was designed to create multiple cloning sites (SalI-

NotI-EcoRV and NcoI) to introduce the promoter

5′-ACGCGT CGACCCATCGATGGGCGGCCGCGATAT

CCCATGGCA TG 3′. Two primers were annealed

and digested with SalI and NcoI, and then cloned into

SalI- and NcoI-digested alkaline xylanase vector pAN56-1

(alx xylanase-truncat) to construct the pAN56-1 (SalI-

NcoI) (Fig. 1). The alkaline xylanase is from Actinoma-

dura sp.

(3) Construction of promoter-less xylanase/pAN56-1-vector.

pAN7-1 (ClaI) and pAN56-1 (SalI-NcoI) were digested

by SalI and ClaI separately. A smaller fragment (around

2121 bp) from plasmid pAN7-1 (ClaI) containing the

selection marker, i.e. hygromycin gene, was ligated to

the linearized pAN56-1 (SalI-NcoI) containing multiple

EVPAN716756 bp

hyg

gpdA

Amp, Ori, f1 regions

Promoter P 1

trpC terminator

BamHI (3340)

BglII (139)

HindIII (4123)

NarI (4288)

NcoI (2649)

SalI (1945)

XbaI (4059)

ClaI linker

BglII (139)

pAN56-1 alkxylanase (trunc)

8159 bp

Alkaline xylanase

gpdA

GLAA2

Amp, ori regions gpdA promoter

trpC terminator GLAA2

BamHI (4074)

NarI (4762)

NcoI (2305)

SalI (1949)

XbaI (5520)

SalI–NcoI linker

pAN7-1 (Cla1)6768 bp

hyg

gpdA

Amp, ori, f1 regions

Promoter P 1

trpC terminator

BamHI (3340)

ClaI (4066)

HindIII (4135)

NarI (4300)

NcoI (2649)

SalI (1945)

XbaI (4059)

XbaI (4071)

Xylanase/pAN56-1 (Sal1-Nco1)

7833 bp

Alkaline xylanase

Amp, ori regionsgpdA promoter

trpC terminator GLAA2

BamHI (3748)

ClaI (1958)

EcoRV (1975)

NarI (4436)

NcoI (1979)

NotI (1966)

SalI (1949)

XbaI (5194)

SalI-ClaI(Vector fragment)SalI-ClaI

(hyg gene fragment)Ligate

Promoterless Xylanase/pAN56-1

9945 bp

Alkaline xylanase

hyg

Amp, ori regions

gpdA

gpdA promoter

trpC terminator

trpC terminatorGLAA2

ClaI (4070)

EcoRI (2544)

EcoRV (4087)

NarI (6548)

SalI (1949)

NotI (4078)

BamHI (3344)

BamHI (5860)

Fig. 1. Construction of promoter-less xylanse/pAN56-1 vector. hyg, hygromycin resistance marker; AlX, alkaline xylanase gene; ori, Escherichia

coli origin of replication.

ª 2011 Federation of European Microbiological Societies FEMS Microbiol Lett 327 (2012) 33–40Published by Blackwell Publishing Ltd. All rights reserved

34 R. Sharma et al.

cloning site (MCS), reporter gene (alkaline xylanase from

Actinomorpha), gluco-amylase terminator, ampicillin

gene, a selection marker for Escherichia coli and ori for

replication in E. coli. Finally, the constructed vector was

digested by various restriction enzymes (viz. SalI plus

EcoRV, BamHI plus EcoRI, NcoI, ClaI, NotI) to confirm

the availability and functionality of different restriction

sites.

Amplification, cloning and sequencing of catR

promoters (Pcat300, Pcat924)

As the region between �562 and �318 regulates the high

level expression of glaA (Fowler et al., 1990), catR pro-

moter was also analyzed within 1000 bp upstream of the

starting ATG. The effect of the CAAT motif was evaluated

particularly with reference to Pcat300 and Pcat924 as the

former does not contain the CAAT sequence (Pcat300),

whereas Pcat924 has CAAT motifs. The catR promoters

(Pcat300, Pcat924) were amplified from A. niger genomic

DNA by PCR using the primers cat300F (5′-ACTTGTTGTGGTGATCTTGAGCA-3′) and cat300R (5′-GCATGGCGGAGTAAACGAA-3′) and cat924F (5′-AGGTTTAGTGAAGGAACACCCGTGGCGAGT-3′) and cat924R (5′-GCATGGCGGAGTAAACGAA-3′) synthesized by M/S Sigma

USA. Primers were designed on the basis of the complete

genome sequence of wild-type A. niger ATCC 1015 strain.

For PCR amplification, 20 ng of DNA, 10 pmol of each

primer, 200 lM dNTP mix, 1 U of Taq DNA polymerase

(Bangalore Geneii, India) with reaction buffer supplied by

the manufacturer were used. Amplification was performed

in a 20-lL reaction volume in a Thermocycler (Eppendorf,

Germany). Cycling parameters for Pcat300 were 3 min of

denaturation at 95 °C followed by 35 cycles at 94 °C for

30 s, 55 °C for 30 s, and 72 °C for 1 min. Cycling condi-

tions for Pcat924 were the same as Pcat300 except for the

annealing temperature (60 °C). The PCR product was ana-

lyzed in a 2% agarose gel and purified from the gel using

the gel extraction kit (Qiagen). The purified fragment was

then inserted into the cloning vector (pGEMT; Promega)

to confirm their identity. Plasmid isolation and purification

were done using the Wizard plus SV Minipreps DNA puri-

fication system (Promega). The presence of insert in the

plasmid was checked by double digestion with restriction

enzymes NotI plus NcoI. Plasmid containing the insert was

sequenced using an automatic DNA Sequencer (310

Genetic Analyser; Applied Biosystems, Foster City, CA).

Cloning of catR promoter fragments in

promoter-less xylanase/pAN56-1

The catR promoters (Pcat300, Pcat924) were then inserted

into the promoter-less xylanase/pAN56-1 plasmid to

check their functionality. Pcat300 and Pcat924 were re-

amplified using the above-mentioned primers and Pfu

DNA polymerase to get blunt-ended amplified products.

Promoter-less xylanase/pAN56-1 vector was digested with

EcoRV and de-phosphorylated. Digested and de-phos-

phorylated vector was ligated to Pfu-amplified Pcat300and Pcat924 promoter fragments. Both ligated mixtures

were electroporated in JM110-competent cells using gene

pulser (Bio-Rad). The plasmids were isolated with Qia-

gen’s spin column according to the instructions of the

manufacturer. The presence of insert in the plasmids

and orientation of the Pcat300 and Pcat924 in promoter-

less xylanase/pAN-56-1 was checked by digestion with

NcoI.

Transformation of A. niger

Transformation of A. niger by constructs (Pcat300/xylanase/

pAN56-1, Pcat924/xylanase/pAN56-1) was carried out by

electroporation as described by Sanchez & Aguirre

(1996). Transformed spores were spread on minimal

medium agar plates containing 175 lg mL�1 hygromycin

(Biogene; Imperial Biomedics) as the selective agent, and

incubated at 37 °C (Tilburn et al., 1983; Malardier et al.,

1989). Transformants were observed after 36–48 h at 37 °C.Individual clones were transferred to fresh Sabouraud’s/

hygromycin plates. Genomic DNA of putative transfor-

mants was extracted and amplified by the E. coli ori

primers (Varadarajalu & Punekar, 2005) to confirm that

each construct had been integrated into the genome of

A. niger.

Screening of transformants for alkaline

xylanase activity

The transformants were further evaluated quantitatively

for xylanase production by growing in seed medium

under shaking conditions (200 rpm) for 48 h at 28 °C(inoculum size was 2 9 106 spores per flask) and then

10% inoculum was transferred in wet wheat bran (pro-

duction medium pH 6.0) under static conditions for

96 h. The AlX enzyme from production medium was

extracted by shaking at 30 °C for 2 h using 0.05 M phos-

phate buffer (pH 8.0) and filtered through a wet muslin

cloth by squeezing. The extract was centrifuged at 6000 g

for 5 min. Clear supernatant sample from each transfor-

mant was taken and used for the enzyme assay. Xylanase

activity was estimated by quantifying the release of

reducing sugar and expressed in terms of IU mL�1 (Gup-

ta et al., 2000). One international unit of enzyme activity

was defined as the amount of enzyme required to release

1 lmol reducing sugar mL�1 min�1 under the assay con-

ditions. Released reducing sugar was determined using


Catalase promoter from Aspergillus niger 35

known amounts of xylose as a standard. All of the experi-

ments were performed in triplicate. Specific AlX activity

was expressed as U mg�1 protein. Protein was deter-

mined by the Bradford assay (Bradford, 1976) using

bovine serum albumin as a standard (Bio-Rad Laborato-

ries, Hercules, CA).

Effect of different seed media on AlX activity

The effect of different seed media on AlX production was

investigated by growing 10 representative transformants

(A1–A10 containing Pcat300/xylanase/pAN56-1; K1–K10containing Pcat924/xylanase/pAN56-1) of both the con-

structs in Sabouraud’s (glucose 40 g L�1, peptone

10 g L�1; pH 6.0)/wheat flour medium (Maida 55.2 g L�1,

Soya Peptone 4.08 g L�1, Mono ammonium phosphate

0.2 g L�1, copper sulphate 0.08 g L�1; pH 6.0). After 48 h,

inoculums were transferred in production medium as

described above.

Effect of different inducers on reporter gene

(AlX) activity

One selected transformant (K6) harboring Pcat924/xylan-

ase/pAN56-1 was subjected to various inducing condi-

tions and the expression pattern of AlX was analysed.

H2O2, CaCO3 and a combination of both were used as

inducers in the study. The inducers were added to the

seed media in which K6 was grown. Different concentra-

tions of the inducers were used to determine the opti-

mum concentration required for the maximum reporter

gene activity.

Results

Construction of Pcat300/xylanase/pAN56-1 and

Pcat924/xylanase/pAN56-1

The promoter-less xylanase/pAN56-1 vector was con-

structed using EVPAN7-1 and pAN56-1 alk-xylanase

(truncated) (Fig. 1). Pcat300 and Pcat924 were amplified

by using specific primers, cloned and sequenced (Fig. 2).

Pcat300 and Pcat924 were cloned in promoter-less xylanase/

pAN-56-1 to check the functional activity of Pcat300and Pcat924 (Fig. 3a). Constructs (Pcat300/xylanase/pAN56-1

and Pcat924/xylanase/pAN56-1) were transformed in A.

niger. Genomes of putative transformants were initially

screened for the presence of introduced construct using

the E. coli ori primers, which amplified a 400-bp fragment

from all the transformants, confirming that the construct

was integrated successfully in the genome of the host,

whereas from the host there was no amplification (data

not shown; Fig. 3b).

Screening of transformants for alkaline

xylanase activity

Effect of seed media on the AlX expression

To study the regulation of catR promoter, the transfor-

mants were grown in two different seed media (Sabou-

raud’s and wheat flour media) to check the effect of seed

media composition on the expression of AlX. In Sabou-

raud’s media, the AlX-specific activity profile of the

transformants carrying Pcat(300) xylanase/pAN56-1, and

Pcat924bp xylanase/pAN56-1 constructs are shown in

Table 1. The activity was in the range of 41.91–91.4U mg�1. Among the transformants carrying Pcat(300) xy-

lanase/pAN56-1, A8 showed maximum 3.21-fold increase

in specific activity compared to transformant containing

promoter-less xylanase/pAN-56-1, whereas A5 showed the

minimum change, with a 1.86-fold increase in specific

activity. Transformant K5 containing Pcat924/xylanase/

pAN56-1 construct showed the highest specific activity,

with a 3.64-fold increase compared to transformant con-

taining the promoter-less xylanase/pAN-56-1.

There was a significant change in the activity profile

when wheat flour medium was used (Table 2). A8

showed the maximum change, with a 3.95-fold increase

in the specific activity, whereas A5 showed the minimum

change, with a 2.78-fold increase in the specific activity

compared to the transformant harboring promoter-less

xylanase/pAN-56-1. The activity of the transformant

K5 carrying the Pcat924/xylanase/pAN56-1 showed the

maximum change, with a 10.3-fold increase in the specific

–924 TACTCGCATAACTCATTCACTAACCCTGGGGGAAAACGATGAATAATGTATGCTACT

–867 AATGAAGGCAACCCCCACCGTCCAGACCCGATCACGTGAGCGGTTGATGACCTGATC

–810 GGCTTTGTATCTTGTCATCTGGCATCGGCGATCCTCCCACCCTCGATGACGCACCAG

–753 GTTCAAGGCATGGGATGATGGCCGATTAATAACTGAAAGAGGTCCAGAGCCCAGAAA

–696 TCTCAGAAACATCGTTCGCAACATGTAGATAAGAGTGTTTGGGAAGCTGGTCTGGCA

–639 GTGGAACCAACGGAACGATCCAGATTCTGGGGATTACCAAGCAGCCGCACCAATCGG

–582 TGGCTTCTTACCAAGCAGCGCGTGTCCAGAACCGCTTGCTGAAGTACCCACGCCTAA

–525 TGGCTTCTTACCAAGCAGCGCGTGTCCAGAACCGCTTGCTGAAGTACCCACGCCTAA

–468 CCCACGGCCTTGGCAATGCCTGCAGGCCACCCCTCAGCACTCTACTATTTCGGTTTG

–411 CACCAGGCACAGCGCTAATCCTCCAAACTAGTTGACCGAATCCTTGGTAACCTATAA

–354 AATCCCTGTGCTAACTCAACGGGGGGTGTACTTTCCGATAGCCTATCAAAGGTCCTG

–297 TTCTTGACCGAGCCCCGCTTGTCACTTGTTGTGGTGATCTTGAGCACATCGCGTTCC

–240 TCTCGTCTCATCACATCGAGTGATCAACATTGCATGACCCTAGTGGAGCCCCTTCGT

–183 CTCCCAACAGGAGGGTCCGGATTACCAAGTCCCGACACCGTTTGGCTGTAATTCGAC

–126 TCAAATTCTGGATTCGTAGCTTAACTAAGACGCGTGGTCTGTTAACCGGCCTCGCCA

–69 TGGATGCCGATATAAGGACCCCAGGGGGACTACCCCCCCTGGTGACTCTCGTCGGAA

–12 GATCGCAGCATA-1ATGTGGGTCCCTTGA

Fig. 2. Sequence of the catR promoter of the Aspergillus niger

highlighting the TATA-, CAAT- motifs in gray, heat shock transcription

factor motifs in bold and italics, and cre motifs in bold,

highlighted and underlined with double line. Nucleotides are

numbered from the putative translation initiation codon (ATG)

indicated as �1 above.


36 R. Sharma et al.

activity compared to the transformant harboring the pro-

moter-less xylanase/pAN-56-1, whereas transformant K2

showed the least, with a 2.91-fold increase in specific

activity. The results clearly depicted that AlX was

expressed 6.35-fold more under the Pcat924 promoter in

comparison with Pcat300.

Effect of inducers on AlX activity

The effect of inducers on AlX activity in K6 was exam-

ined. The inducers used in this study were H2O2, CaCO3

and a combination of both. The inducers were added to

the seed media. Optimal concentration of the inducer was

(a)

(b)

Fig. 3. (a) Restriction digestion of promoter-less xylanase/pAN56-1 vector. (b) Integration of construct in Aspergillus niger genome and Scheme

to confirm the integration of construct in A. niger genome by using the Escherichia coli ori primers.

Table 1. AlX activity of transformants in Sabouraud’s medium

followed by wheat bran. Bold values depicts the highest fold increase

in xylanase activity

Transformants

Specific activity

(IU mg�1)

Fold increase

with respect

to P0xylanase/

pAN56-1

Pcat300xylanase/pAN56-1#A1 54.28 ± 0.25 2.16










Pcat924xylanase/pAN56-1#K1 54.21 ± 0.45 2.16


Pcat924xylanase/pAN56-1#K3 46 ± 0.52 1.83








P0xylanase/pAN56-1 25.08 ± 0.22

Table 2. AlX activity of transformants in wheat flour medium

followed by wheat bran. Bold values depicts the highest fold increase

in xylanase activity

Transformants

Specific activity

(IU mg�1)

Fold increase

with respect

to P0xylanase/

pAN56-1





















P0xylanase/pAN56-1 2.01 ± 0.120



determined for the maximum activity of the reporter

gene. 0.1, 0.15, 0.20 and 0.25% (v/v) of H2O2 were used

to examine the enzyme production. The maximum

increase of 9.62-fold in specific activity was observed at

0.20% (v/v) H2O2 (Fig. 4), when compared to control 2

(transformant harboring promoter-less xylanase/pAN56-1)

and a 2.61-fold increase in specific activity was observed

when compared to control 1 (K6 transformant harboring

Pcat(924) xylanase/pAN56-1 but grown without inducer).

Induction of the promoter by CaCO3 was also studied

using various concentrations (1.5%, 2.5%, 3.5% and 4.5%)

of CaCO3. There was an appreciable decrease in AlX activ-

ity when the concentration of CaCO3 was increased from

1.5% to 4.5% (Fig. 4). The maximum increase in specific

activity of 8.11-fold compared to control 2 and 2.20-fold

compared to control 1, was seen with 1.5% CaCO3.

Combinations of H2O2 and CaCO3 (0.1% H2O2 +1.5% CaCO3, 0.15% H2O2 + 2.5% CaCO3, 0.20% H2O2 +3.5% CaCO3, 0.25% H2O2 + 4.5% CaCO3) were investi-

gated. The maximum increase of 7.59-fold in specific

activity compared to control 2 and 2.06-fold compared to

the control 1 was observed at 0.20% H2O2 + 3.5%

CaCO3 (Fig. 4). Therefore, it appears that each of the

two inducers is involved in co-operative regulation of

catR promoter.

Discussion

In this study, we sought to exploit catR promoter to pro-

duce recombinant protein. For this purpose, two promot-

ers of different lengths. Pcat300 and Pcat924, were amplified

and cloned in promoter-less xylanase/pAN56-1 vector.

The ability drive the expression of alx gene was evaluated

for both transformants harboring Pcat(300) xylanase/

pAN56-1 and Pcat924bp xylanase/pAN56-1. Expression of

AlX in all transformants suggested that Pcat(300) contained

the sequences required to initiate the start of transcrip-

tion. Different AlX activity was found in different trans-

formants (A1–A10 and K1–K10) which might be

attributed to varying copy number or varying position in

the genome of the host at which integration took place,

as also reported by Verdoes et al. (1993).

To evaluate the effect of seed media on the AlX expres-

sion of transformants, two seed media (Sabouraud’s and

wheat flour media) were tried. AlX expression was found

to be highest in transformants grown in Sabouraud’s

media (41.91–91.4 U mg�1) in comparison with wheat

flour media (5.61–20.72 U mg�1). This may be because

of better growth of transformants in Sabouraud’s media

than in wheat flour media. Wheat bran is considered as

one of the most popular components of complex media

for xylanase production (Deschamps & Huet, 1985; Hoq

et al., 1994; Sa-Pereira et al., 2002). Many authors

reported the advantages of using wheat bran as a sub-

strate for xylanase production, and therefore for func-

tional characterization; wet wheat bran was used as

production medium.

In Sabouraud’s media, transformants A1–A10 showed

AlX activity in the range of 46.66–80.74 U mg�1, which

showed a 3.21-fold increase in AlX activity. This might

be attributed to TATA box present at �59 position in

Pcat300. The TATA box was the first core promoter ele-

ment identified in eukaryotic protein-coding genes

(Breathnach & Chambon, 1981). In Sabouraud’s media,

transformants K1–K10 showed AlX activity in the range

of 41.91–91.4 U mg�1, which showed a 3.64-fold

increase in AlX activity that might be attributed to two

TATAA boxes at position �59 and �359 and two

CCAAT motifs lying at positions �355 and �590. As

reported by Bucher (1990), in filamentous fungi and

higher eukaryotes, the CCAAT motif is an essential and

functional element for high-level expression of a large

number of genes. The region from �59 to �590 con-

tains the two TATAA and two CCAAT boxes and thus

was involved in strong expression. As also suggested by

Liu et al. (2003), multiple copies of CCAAT motifs

improved the heterologous protein production in A.

niger. Results discussed here indicated that there was no

significant increase in specific activity in K transformants

despite two CCAAT and two TATAA boxes, perhaps

because of three cre1-binding sites (5′-SYGGRG-3′) pres-

ent at �98, �613 and �900, which are responsible for

repression by glucose.

Fig. 4. Effect of different inducers and their concentrations on AlX

activity of transformant K6. The AlX activity of the K6 transformant

grown with inducers was compared with K6 transformant grown under

non-induction conditions (control 1) and transformant harboring

promoter-less construct (control 2).


38 R. Sharma et al.

In wheat flour media, transformants A1–A10 showed

AlX activity in the range of 5.75–7.67 U mg�1, which

showed a 3.95-fold increase in AlX activity. In contrast,

transformants K1–K10 showed AlX activity in the range

of 5.85–20.72 U mg�1, showing a 10.3-fold increase in

AlX activity. This increase might be attributed to two

TATAA boxes, two CCAAT motifs and absence of

repression created by binding of glucose with three

cre1-binding sites (5′-SYGGRG-3′) because of absence of

glucose in wheat flour medium. Similarly, Roth et al.

(2007), using the Psuc1 promoter, observed a sevenfold

increased GFP fluorescence in recombinant A. niger strain.

High expression levels and induction of the A. niger cat

encoding gene, catR, by CaCO3 and H2O2 have been

reported by Liu et al. (1998, 1999). The induction of cat

synthesis by CaCO3 was thought to be due either to the

high calcium ion concentration of an insoluble salt, which

acts as a solid support for mycelial growth, or to resistance

to pH change caused by CaCO3. It is also well known that

heat shock and hydrogen peroxide induce catalase gene

expression in Aspergilli (Abrashev et al., 2005; Hisada

et al., 2005) and that each catalase gene promoter has a

regulatory element for stress response. The AGAAN motifs

are consensus DNA-binding sites of the heat shock

transcription factor (HSF) of A. oryzae as reported, by

Ishida et al. (2004). The HSF positively regulates the stress

response and catR is involved in the defense against oxida-

tive stress in submerged culture. It is therefore anticipated

that the AGAAN motifs are involved in the positive

regulation of catR promoter. The Pcat924 contained nine

AGAAN sequences, consisting of four AGAAN at �701,

�692, �555, �498 bp in the sense strand and five

AGAAN (reverse compliment; NTTCT) at �616, �579,

�522, �298 and �122 bp in the antisense strand.

With the frequently used PglaA of A. niger, glucoamy-

lase expression was reported to be 7.5-fold, using glucose

as inducer vs. xylose (Ganzlin & Rinas, 2008). The catR

promoter also showed a 6.66-fold increase in AlX activity

while growing in medium containing maida vs. glucose,

suggesting that the catR promoter is as efficient as PglaA

of A. niger.

The results demonstrated that Pcat924 showed better

efficiency under the given growth conditions. This is the

first report describing the identification of the regulatory

element of catR gene in A. niger. Clarifying the specific

induction or repression of the catR promoter provides

the possibility for utilization of this promoter in heterolo-

gous protein production industry.

Acknowledgements

R.S. gratefully acknowledges the Council of Scientific and

Industrial Research (CSIR), Government of India, for

awarding Senior Research Fellowship and the authors

would like to thank the New Millennium Indian Technol-

ogy Leadership Initiative (NMITLI) for financial support.

This is Institutes Publication No. IIIMJ/1465/2011.

Authors’ contributions

R.S. and M.K. contributed equally to this work.

References

Abrashev R, Dolashka P, Christova R, Stefanova L & Angelova

M (2005) Role of antioxidant enzymes in survival of

condiospores of Aspergillus niger 26 under conditions of

temperature stress. J Appl Microbiol 99: 902–909.Bradford MM (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing

the principle of protein-dye binding. Anal Biochem 72:

248–254.Breathnach R & Chambon P (1981) Organization and

expression of eukaryotic split genes coding for proteins.

Annu Rev Biochem 50: 349–383.Bucher P (1990) Weight matrix descriptions of four

eukaryotic RNA polymerase II promoter elements derived

from 502 unrelated promoter sequences. J Mol Biol 212:

563–578.Deschamps F & Huet MC (1985) Xylanase production in

solid-state fermentation: a study of its properties. Appl

Microbiol Biotechnol 22: 177–180.Fowler T, Berka RM & Ward M (1990) Regulation of the glaA

gene of Aspergillus niger. Curr Genet 18: 537–545.Ganzlin M & Rinas U (2008) In-depth analysis of the

Aspergillus niger glucoamylase (glaA) promoter

performance using high-throughput screening and

controlled bioreactor cultivation techniques. J Biotechnol

135: 266–271.Gouka RJ, Hessing JG, Punt PJ, Stam H, Musters W & Van

den Hondel CA (1996) An expression system based on the

promoter region of the Aspergillus awamori 1,4-beta-

endoxylanase A gene. Appl Microbiol Biotechnol 46: 28–35.Gupta S, Bhushan B & Hoondal GS (2000) Isolation,

purification, and characterization of xylanase from

Staphylococcus sp. SG-13 and its application in biobleaching

of kraft pulp. J Appl Microbiol 88: 325–334.Hisada H, Hata Y, Kawato A, Abe Y & Akita O (2005)

Cloning and expression analysis of two catalase genes from

Aspergillus oryzae. J Biosci Bioeng 99: 562–568.Hoq M, Hempel C & Deckwer WD (1994) Cellulase-free

xylanase by Thermomyces lanuginosus RT9: effect of

agitation, aeration, and medium components on

production. J Biotechnol 37: 49–58.Ilmen M, Onnela ML, Klemsdal S, Keranen S & Penttil M

(1996) Functional analysis of the cellobiohydrolase I

promoter of the filamentous fungus Trichoderma reesei.

Mol Gen Genet 253: 303–314.



Ishida H, Hata Y, Kawato A, Abe Y & Kashiwagi Y (2004)

Isolation of a novel promoter for efficient protein

production in Aspergillus oryzae. Biosci Biotechnol Biochem

68: 1849–1857.Karnaukhova E, Ophir Y, Trinh L, Dalal N, Punt PJ, Golding

B & Shiloach J (2007) Expression of human a1-proteinaseinhibitor in Aspergillus niger. Microb Cell Fact 6: 34.

Liu J, Yang H, Zhao J, Weng L & Ji L (1998) A study on axial

ligands of model enzyme to activize catalase: a new method

of enhancement natural enzyme activity. Acta Sci Nat Univ

Sunyatseni 37: 125–127.Liu J, Yang H, Weng L & Ji L (1999) Synthesis of glucose

oxidase and catalase by Aspergillus niger in resting cell

culture system. Lett Appl Microbiol 29: 337–341.Liu L, Liu J, Qiu RX, Zhu XG, Dong ZY & Tang GM (2003)

Improving heterologous gene expression in Aspergillus niger

by introducing multiple copies of protein-binding sequence

containing CCAAT to the promoter. Lett Appl Microbiol 36:

358–361.Mahuku GS (2004) A simple extraction method suitable for

PCR based analysis of plant, fungal, and bacterial DNA.

Plant Mol Biol Rep 22: 71–81.Malardier L, Daboussi MJ, Julien J, Roussel F, Scazzocchio C

& Brygoo Y (1989) Cloning of the nitrate reductase gene

(niaD) of Aspergillus nidulans and its use for transformation

of Fusarium oxysporum. Gene 78: 147–156.Punt PJ, Kramer C, Kuyvenhoven A, Pouwels PH & Van den

Hondel CAMJJ (1992) An upstream activating sequence

from the Aspergillus nidulans gpdA gene. Gene 120: 67–73.Roberts IN, Jeenes DJ, MacKenzie DA, Wilkinson AP, Sumner

IG & Archer DB (1992) Heterologous gene expression in

Aspergillus niger: a glucoamylase-porcine pancreatic

prophospholipase A2 fusion protein is secreted and

processed to yield mature enzyme. Gene 122: 155–161.Roth A, Zuccaro A, Kneip S & Dersch P (2007)

Charcterization of a new inducible promoter for

protein expression in Aspergillus niger, using a green

fluorescent protein reporter system. J Biotechnol 131: S256–S257.

Sanchez O & Aguirre J (1996) Efficient transformation of

Aspergillus nidulans by electroporation of germinated

conidia. Fung Genet Newsl 43: 48–51.Sa-Pereira P, Costa-Ferreira M & Aires-Barros MR (2002)

Enzymatic properties of a neutral endo-1, 3(4)-xylanase Xyl

II from Bacillus subtilis. J Biotechnol 94: 265–275.Tellez-Jurado A, Arana-Cuenca A, Gonzalez Becerra AE,

Viniegra-Gonzalez G & Loera O (2006) Expression of a

heterologous laccase by Aspergillus niger cultured by solid-

state and submerged fermentations. Enzyme Microb Technol

38: 665–669.Tilburn J, Scazzocchio C, Taylor GG, Zabicky-Zissman JH,

Lockington RA & Davies RW (1983) Transformation by

integration in Aspergillus nidulans. Gene 26: 205–221.Traeger M, Quazi GN, Onken U & Chopra CL (1991)

Contribution of endo- and exocellular glucose oxidase to

gluconic acid production at increased dissolved oxygen

concentrations. J Chem Technol Biotechnol 50: 1–11.Tsuchiya K, Tada S, Gomi K, Kitamoto K, Kumagai C, Jigami

Y & Tamura G (1992) High level expression of the synthetic

human lysozyme gene in Aspergillus oryzae. Appl Microbiol

Biotechnol 38: 109–114.Varadarajalu LP & Punekar NS (2005) Cloning and use of sC

as homologous marker for Aspergillus niger transformation.

J Microbiol Meth 61: 219–224.Verdoes JC, Punt PJ, Schrickx JM, Van Verseveld HW,

Stouthamer AH & Van den Hondel CA (1993)

Glucoamylase overexpression in Aspergillus niger: molecular

genetic analysis of strains containing multiple copies of the

glaA gene. Transgenic Res 2: 84–92.Ward M, Wilson LJ, Kodama KH, Rey MW & Berka RM

(1990) Improved production of chymosin in Aspergillus by

expression as a glucoamylase-chymosin fusion. Biotechnology

8: 435–440.Zhang J, Pan J, Guan G, Li Y, Xue W, Tang G, Wang A &

Wang H (2008) Expression and high yield production of

extremely thermostable bacterial xylanaseB in Aspergillus

niger. Enzyme Microb Technol 43: 513–516.


40 R. Sharma et al.

Documents

Evaluation of the catalase promoter for expressing the alkaline xylanase gene (alx) in Aspergillus niger