INFECTION AND IMMUNITY, Sept. 2009, p. 3533–3541 Vol. 77, No. 90019-9567/09/$08.00�0 doi:10.1128/IAI.00081-09Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Amino Acid Changes in Elongation Factor Tu ofMycoplasma pneumoniae and Mycoplasma genitalium

Influence Fibronectin Binding�

Sowmya Balasubramanian,1 T. R. Kannan,1 P. John Hart,2,3 and Joel B. Baseman1*Department of Microbiology and Immunology1 and Department of Biochemistry,2 University of Texas Health Science Center at

San Antonio, 7703 Floyd Curl Drive, San Antonio, Texas 78229-3900, and Geriatric Research, Education, and Clinical Center,Department of Veterans Affairs, South Texas Veterans Health Care System, The University of Texas Health Science Center at

San Antonio, San Antonio, Texas 782293

Received 21 January 2009/Returned for modification 12 March 2009/Accepted 13 June 2009

Mycoplasma pneumoniae and Mycoplasma genitalium are closely related organisms that cause distinct clinicalmanifestations and possess different tissue predilections despite their high degree of genome homology. Wereported earlier that surface-localized M. pneumoniae elongation factor Tu (EF-TuMp) mediates binding to theextracellular matrix component fibronectin (Fn) through the carboxyl region of EF-Tu. In this study, wedemonstrate that surface-associated M. genitalium EF-Tu (EF-TuMg), in spite of sharing 96% identity withEF-TuMp, does not bind Fn. We utilized this finding to identify the essential amino acids of EF-TuMp thatmediate Fn interactions by generating modified recombinant EF-Tu proteins with amino acid changes corre-sponding to those of EF-TuMg. Amino acid changes in serine 343, proline 345, and threonine 357 were sufficientto significantly reduce the Fn binding of EF-TuMp. Synthetic peptides corresponding to this region of EF-TuMp(EF-TuMp 340-358) blocked both recombinant EF-TuMp and radiolabeled M. pneumoniae cell binding to Fn. Incontrast, EF-TuMg 340-358 peptides exhibited minimal blocking activity, reinforcing the specificity of EF-Tu–Fn interactions as mediators of microbial colonization and tissue tropism.

Many pathogens express surface proteins that facilitate col-onization and cellular invasion (12, 39, 44, 49, 55). The humanmycoplasmas, Mycoplasma pneumoniae and Mycoplasma geni-talium, have genome sizes of 816,394 bp (20) and 580,070 bp(12), respectively, with the latter considered the smallest self-replicating biological cell (14, 38). These bacterial pathogenspossess terminal tip-like structures comprised of specific mem-brane adhesins and adherence-related accessory proteins thatmediate surface parasitism of target cells (5) and are essentialfor virulence (4). While adherence of virulent M. pneumoniaeis mediated primarily by tip organelle-associated adhesins (10,24), the absence of these proteins in hemadsorption-negativemutants (HA� class II mutants) (17) still permits detectableadherence (18), suggesting the involvement of alternativemechanisms by which mycoplasmas bind to host cells.

Recently, we showed that M. pneumoniae surface-associatedelongation factor Tu (EF-TuMp; MPN665) and the pyruvatedehydrogenase E1 beta subunit (MPN392) interact with fi-bronectin (Fn) (11). In addition, we demonstrated that HA�

class II mutants also bind Fn through EF-Tu (11). Fn is anabundantly available pathogen target (22) that exists in solubleform in blood fluids and plasma and in fibrillar form in theextracellular matrix (56). M. pneumoniae could readily accessthe extracellular matrix through virulence-related determi-nants following epithelial cell damage (29) and could directly

bind to subepithelial tissue targets through EF-Tu interactionswith Fn. Furthermore, these distinct pathogenic pathways mayalso contribute to the ability of M. pneumoniae to invade and toestablish intracellular and perinuclear residence (9, 57).

Detailed analyses of EF-TuMp–Fn interactions revealedthe critical role of the carboxyl region of EF-Tu (aminoacids 192 to 219 and 314 to 394) in Fn recognition (3). Othermycoplasmas with tip organelles, such as Mycoplasma pen-etrans and Mycoplasma gallisepticum, have been reported tobind Fn through a 65-kDa protein (13) and the PlpA andHlp3 proteins (34).

Following our initial findings of EF-TuMp–Fn interactions,surface-associated EF-Tu proteins from other microorganisms,including Lactobacillus johnsonii, Listeria monocytogenes, andPseudomonas aeruginosa, were reported to bind mucin (16),fibrinogen (43), plasminogen, and factor H (32). Since EF-Tuis one of the most highly conserved proteins in mycoplasmas, ithas been used to create an EF-Tu sequence-based mycoplasmaphylogeny tree. This allows the classification of the humanpathogens, M. genitalium and M. pneumoniae, along with M.gallisepticum, a poultry pathogen, in the same group (28). M.pneumoniae is an established pathogen of the respiratory tract(54) but has also been isolated from the urogenital tract (15).M. genitalium, an emerging sexually transmitted disease patho-gen (27, 51), has also been associated with respiratory (6) andjoint (50) pathologies. It has been suggested that the tissue-specific tropisms and pathogenic mechanisms of these twomycoplasmas are determined by genetic distinctions betweenthem (19). Most of the open reading frames proposed for M.genitalium are present in M. pneumoniae. Overall, M. pneu-moniae and M. genitalium share 67.4% average identity at theamino acid level, while conserved housekeeping proteins ex-

* Corresponding author. Mailing address: Department of Micro-biology and Immunology, University of Texas Health Science Cen-ter at San Antonio, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900. Phone: (210) 567-3939. Fax: (210) 567-6491. E-mail: baseman@uthscsa.edu.

� Published ahead of print on 22 June 2009.

3533

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

hibit 70 to 97% identity (19). Among the latter proteins, EF-Tudisplays a high sequence identity (96%).

In this study, we compared EF-Tu–Fn binding between M.pneumoniae and M. genitalium and discovered biological andbiochemical differences that facilitated the identification of keyamino acids responsible for these interactions. Such distinc-tions provide evidence of unique colonization capabilities ofthese bacteria.

MATERIALS AND METHODS

Bacterial strains, plasmids, and DNA manipulations. Escherichia coli INV�F�[F� endA1 rec-1 hsdR17 supE44 gyrA96 lacZ�M15 (lacZYA-argF)] (Invitrogen,Carlsbad, CA) and E. coli BL21(DE3) [F� ompT hsdSB(rB

� mB�) gal dcm

(DE3)] (Stratagene, La Jolla, CA) were grown in Luria-Bertani (LB) broth forcloning, expression, and purification of recombinant EF-TuMp (rEF-TuMp), re-combinant EF-TuMg (rEF-TuMg), and mutagenized constructs. pCR2.1 (TAcloning vector; Invitrogen) and E. coli INV�F� were used for gene manipula-tions, and pET19b (N-terminal His10-tagged expression vector; Novagen/EMDBiosciences Inc., San Diego, CA) and E. coli BL21 were used for protein ex-pression. M. pneumoniae clinical isolate S1, reference strain M129, and its classII HA� mutant and M. genitalium reference strain G37 and clinical isolate 1019V(37) served as sources of genomic DNA (10). Since both M. genitalium referencestrain G37 and clinical isolate 1019V exhibit similar biological properties (52), weused G37 along with M. pneumoniae strain S1 for comparative EF-Tu bindingexperiments.

Mycoplasma culture conditions. M. pneumoniae cells were grown to late logphase in SP-4 medium at 37°C for 72 h in 150-cm2 tissue culture flasks. Adherentmycoplasmas were harvested by being washed three times with phosphate-buff-ered saline (PBS) (150 mM NaCl, 10 mM sodium phosphate, pH 7.4), scraped,and pelleted at 12,500 � g for 15 min at 4°C. For radiolabeling, mycoplasmasgrown as surface-attached monolayers were washed three times with PBS,scraped, and collected by centrifugation. Cells were resuspended in 1/10 theiroriginal volume in Dulbecco’s modified Eagle’s medium without cysteine ormethionine and supplemented with 10% fetal bovine serum. [35S]methionine (1mCi; specific activity, 43.5 TBq/mmol) (Perkin-Elmer Inc., Waltham, MA) wasadded, and mycoplasmas were incubated at 37°C for 4 h on a rocker, pelleted,and washed four times with PBS.

Identification of Fn binding proteins by ligand immunoblot assay. M. pneu-moniae and M. genitalium whole-cell lysates were separated in 4 to 12% prepar-ative NuPAGE gels and transferred to nitrocellulose membranes. Membraneswere cut into strips, blocked for 1 h at room temperature (RT) with 3% (wt/vol)nonfat dry milk in Tris-buffered saline (TBS) (Blotto), and incubated at 4°C

overnight with human Fn (20 �g/ml; Sigma, St. Louis, MO) in Blotto. Individualmembrane strips were washed three times with TBST (TBS containing 0.05%Tween 20) and incubated for 2 h at RT with rabbit anti-Fn antibodies (Sigma) ata 1:1,000 dilution in 1% Blotto. Parallel strips of mycoplasma lysates wereincubated with rabbit anti-EF-Tu serum (11) diluted 1:2,000 in 3% Blotto for 2 hat RT. Subsequently, blots were washed three times and incubated for 1 h at RTwith alkaline phosphatase (AP)-conjugated goat anti-rabbit immunoglobulin G(IgG) antibody (Invitrogen) at a 1:2,000 dilution in 3% Blotto, washed withTBST, and developed with nitroblue tetrazolium chloride–5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics, Indianapolis, IN).

Mycoplasma membrane purification. Mid-log-phase cultures of M. pneu-moniae and M. genitalium cells were pelleted and subjected to membrane isola-tion by osmotic lysis. Membranes were further purified by sucrose gradientcentrifugation as previously described (11), and protein concentrations in totaland membrane fractions were estimated by the bicinchoninic acid method(Pierce, Rockford, IL). Equal amounts of each fraction were further separatedby 4 to 12% NuPAGE gel electrophoresis and transferred to nitrocellulosemembranes. Immunoblotting was performed with rabbit anti-EF-Tu (1:2,000) oranti-elongation factor G (EF-G) (1:2,000) serum and goat anti-rabbit–AP (1:2,000) antibodies. The percentage of membrane-associated EF-Tu was deter-mined as described earlier (11).

Immunogold electron microscopy. Immunogold labeling of M. genitalium wasperformed as described earlier (11). Intact M. genitalium cells were incubatedwith rabbit anti-EF-Tu or prebleed sera (1:1,000) followed by a 1:20 dilution ofgoat anti-rabbit IgG–gold particles (20 nm) in PBS (pH 7.4) containing 1%bovine serum albumin. After multiple washes, mycoplasma cells were mountedon Formvar-coated nickel grids and fixed with 1% glutaraldehyde–4% formal-dehyde for 20 min at RT. Individual grids were examined by JEOL 1230 trans-mission electron microscopy at an 80-kV accelerating voltage after being stainedwith 7% uranyl acetate followed by Reynold’s lead citrate.

Site-directed mutagenesis using overlap extension PCR. Amino acid and nu-cleotide sequences of EF-TuMp and EF-TuMg were subjected to BLAST analysis(http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi) (48). Complementary oli-godeoxyribonucleotide primers were synthesized with nucleotide changes encod-ing multiple amino acid substitutions (Table 1) and used in overlap extensionPCR (21). pCR2.1 plasmids with EF-TuMp inserts served as templates for am-plification of mutagenized EF-Tu constructs. Multiple overlapping DNA frag-ments with nucleotide changes were generated for each construct by amplifica-tion using Pfu Turbo polymerase (Stratagene) and mutagenic primers. Thesefragments were combined in a subsequent fusion reaction in which the overlap-ping ends annealed. The resulting product was subjected to a final PCR ampli-fication using Platinum Taq high-fidelity DNA polymerase (Invitrogen), MPNEF-Tu FP forward primer, and specific reverse primers (RP) (Table 1) to gen-erate complete DNA fragments.

TABLE 1. Primers used for amplification of EF-Tu constructsa

Primer Nucleotide sequence (5�33�)b Amino acid change(s)(EF-TuMp3EF-TuMg)

MPN EF-Tu FP GAGACGTAATTCAAACATATGGCAAGAGAG NoneMPN EF-Tu RP GTGCCTGGCTTTCCTTGAGGATCCTAACAGAGT NoneMG EF-Tu FP CATATGGCAAGAGAGAAATTTGACCG NoneMG EF-Tu RP GGATTCTCACTATTCTAGAACTTCTG None1 FP GAGACGTAATTCAAACATATGGCAAGAGAG None1 RP CGGAGCCTTATCGATTTCGTCGTAACGAG Q3E2 FP CTCGTTACGACGAAATCGATAAGGCTCCG Q3E2 RP CACTTGCAATGTCACACTTGTTTAGGAACACTACCATTTTTGG RT3KS3 FP CCAAAAATGGTAGTGTTCCTAAACAAGTGTGACATTGCAAGTG RT3KS3 RP CGTGTAGGAGTTGGAATCCATTCATCAACTGCTTTAATTAAATC MNE3IKT4 FP GATTTAATTAAAGCAGTTGATGAATGGATTCCAACTCCTACACG MNE3IKT4 RP GGTTTTAAACCAACGATTTCAACTTCTTG IR3VK5 FP CAAGAAGTTGAAATCGTTGGTTTAAAACC IR3VK5 RP CACTTGACCACGTTCCACTTCTTTACGTTCCAC D3E6 FP GTGGAACGTAAAGAAGTGGAACGTGGTCAAGTG D3E6 RP CGAAGCATTGTCACCTGGTAGCACCATTTCGGTGTTTTCAGCTAGAGC SPT3AAA7 FP GCTCTAGCTGAAAACACCGAAATGGTGCTACCAGGTGACAATGCTTCG SPT3AAA7 RP GGATCCTATTCAAGCACTTCCGTGACAGTACCAGCACCAAC S3T

a All regions were amplified using the respective mutagenic forward and reverse primers, as required. Overlapping fragments with changes were then annealed andamplified using MPN EF-Tu FP and either MPN EF-Tu RP or 7 RP to generate full-length products.

b Introduced BamHI and NdeI sites are italicized. Changed nucleotides are shown in bold.

3534 BALASUBRAMANIAN ET AL. INFECT. IMMUN.

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

Cloning, expression, and purification of EF-Tu. rEF-TuMp was purified asdescribed previously (3). rEF-TuMg was generated by PCR amplification of DNAfrom M. genitalium strain G37. All EF-Tu-related fragments were cloned intopCR2.1 and pET-19b vectors as described earlier (3). pET-19b plasmids withinserts were screened by PCR amplification using specific primers (Table 1) andthen sequenced. Representative clones containing changes corresponding to theamino acid mutations in the EF-Tu amino and carboxyl regions were selectedand transformed into E. coli BL21(DE3) for expression studies. Expression andlarge-scale purification of rEF-TuMg and mutagenized proteins under nativeconditions were performed as reported previously (3). All purified proteins wereseparated in NuPAGE 4 to 12% gradient gels and visualized using Coomassieblue. Immunoblots of parallel gels transferred to membranes were performedwith rabbit polyclonal anti-EF-Tu antibodies and mouse anti-His monoclonalantibodies (MAb) (Clontech/BD Biosciences, San Jose, CA) (3).

Interactions of EF-Tu with Fn. Interactions between rEF-Tu and Fn weremeasured by enzyme-linked immunosorbent assay (ELISA) (3). Individual wellsof 96-well plates (Reacti-Bind amine binding, maleic anhydride activated;Pierce) were coated overnight at 4°C with 100 �l of 100-ng/well Fn in PBS (pH7.4). After wells were blocked with 200 �l of 0.1% BSA (Sigma), increasingconcentrations (100 �l at 25 nM, 50 nM, 75 nM, and 100 nM in PBS) ofrecombinant His-tagged proteins were added and incubation continued for 2 h atRT. Individual wells were washed with PBS and incubated with a 1:2,000 dilutionof anti-His MAb in PBS followed by a 1:2,000 dilution of goat anti-mouse–APantibody in PBS. Wells coated with 0.1% BSA alone served as negative controls.All assays were performed in triplicate and developed using p-nitrophenyl phos-phate (pNPP) substrate (Sigma). Values were determined by an ELISA reader(Dynatech Laboratories, Chantilly, VA) at 405 nm. Comparisons of Fn bindingof different EF-Tu mutagenized constructs were performed as described above,except that a 75 nM concentration was used for Fn binding. NonmutagenizedrEF-TuMp served as a positive control. We also examined all purified proteins forreactivity to anti-His MAb and anti-EF-Tu antibodies.

Peptide design and synthesis. Peptides representing amino acid regions 192 to219 and 340 to 358 in EF-TuMp and EF-TuMg (Table 2) were generated by NewEngland Peptides LLC (Gardner, MA). Their purity was �99%.

Peptide inhibition assay. Individual wells of 96-well plates were coated over-night at 4°C with 75 nM rEF-TuMp. Separately, 0.1 �g of Fn was added to 100 �lPBS contained in Eppendorf tubes in the presence of 75, 375, or 750 nM of eachspecified EF-Tu-related peptide, and incubation was continued for 2 h at RT. Fnalone (0.1 �g/well) or Fn incubated with peptides was then added to the rEF-TuMp-coated wells for 2 h at RT. After washes with PBS, the relative quantity ofbound Fn was determined using rabbit anti-Fn antibodies (1:2,000) and goatanti-rabbit IgG–AP (1:2,000). All assays were performed in triplicate, and pNPPsubstrate was used to develop color. The background absorbance values weredetermined for wells without Fn and subtracted from test values. To furtherdetermine the blocking activities of individual peptides on M. pneumoniae cellbinding to Fn, ELISA plates were coated with 0.1 �g/well Fn and blocked with0.1% BSA as described earlier. After being blocked, Fn-coated wells were incu-bated with 75, 375, or 750 nM of each specified peptide for 2 h at RT. Biosyn-thetically [35S]methionine-labeled M. pneumoniae cells were then added for 1 hat 37°C. After extensive washes with PBS, M. pneumoniae binding to Fn wasassessed by radioactivity.

Mycoplasma EF-Tu sequence alignment and phylogeny. All available myco-plasma EF-Tu amino acid sequences in the comprehensive microbial resourcedatabase (http://cmr.jcvi.org/tigr-scripts/CMR/CmrHomePage.cgi) were sub-jected to ClustalW2 sequence alignment analysis (http://www.ebi.ac.uk/Tools

/clustalw2/index.html) (8, 33). Evolutionary relationships based on the EF-Tusequences were also generated in the form of a phylogeny tree by ClustalW2analysis.

Molecular modeling of M. pneumoniae EF-Tu. To further characterize EF-Tusequence and conformational properties that might influence Fn binding, wesearched for the best structural homologs of EF-TuMp by using a variation ofprotein threading as implemented in the program HHPRED (http://toolkit.tuebingen.mpg.de/hhpred) (45, 46). HHPRED uses pairwise comparisons ofprofile hidden Markov models (HMMs). First, an alignment of sequence ho-mologs was built for the EF-TuMp query sequence via multiple iterations ofPSI-BLAST against the nonredundant sequence database from NCBI. Second, asingle EF-TuMp profile HMM was generated from this multiple sequence align-ment. This HMM contained a statistical description of the alignment, includingsecondary structural information. For each column in the multiple sequencealignment that had a residue in the query sequence, an HMM column wascreated that contained the probabilities of each of the 20 amino acids plus fourprobabilities that described how often amino acids were inserted and deleted atthis position (insert open and extend and delete open and extend). These insert/delete probabilities were translated into position-specific gap penalties when anHMM was aligned to a sequence or to another HMM (45, 46). The same twosteps were also performed for each sequence corresponding to a known structurein the Protein Data Bank (PDB) in order to generate a library of profile HMMsto which the query profile HMM could be compared. Third, the query profileHMM was compared to each profile HMM in the structural database and scored(45, 46). The HHPRED output, which consisted of an alignment of a sequenceto be modeled with known related structures, was used as input for the programMODELLER, which automatically calculates a model of the query sequencecontaining all nonhydrogen atoms by satisfaction of spatial restraints (42).

RESULTS

EF-TuMg does not interact with Fn. Parallel ligand immu-noblot assays were performed with M. genitalium and M. pneu-moniae whole-cell lysates to compare profiles of mycoplasmaproteins that bind to human plasma Fn. As reported earlier(11), EF-TuMp (43 kDa) interacted with Fn. Interestingly, noM. genitalium protein in the 43-kDa range bound to Fn (datanot shown), suggesting that structural and functional differ-ences exist between EF-TuMp and EF-TuMg.

To further confirm this observation, EF-TuMg was expressedand purified as a His-tagged recombinant protein in E. coli.Similar to EF-TuMp, EF-TuMg constitutes 394 amino acids,with a predicted molecular mass of 43.34 kDa; rEF-TuMg re-solved around 45 kDa, as predicted with a His tag (Fig. 1A).Both anti-His MAb and polyclonal rabbit anti-EF-TuMp serarecognized rEF-TuMg, similar to rEF-TuMp (see Fig. 4A). Tocompare Fn binding properties of rEF-TuMp and rEF-TuMg,increasing concentrations (10, 25, 50, 75, and 100 nM) ofrEF-Tu proteins were added to immobilized Fn, and Fn inter-actions were monitored using anti-His-tag antibodies. As ex-pected, rEF-TuMp bound to Fn in a dose-dependent manner(Fig. 1B) (3, 11). In contrast, rEF-TuMg exhibited minimalbinding to Fn at all concentrations (Fig. 1B).

Surface localization of EF-TuMg. We isolated M. genitaliummembranes to determine EF-Tu localization. Membranefractions were shown to be free of cytoplasmic contamina-tion based upon the absence of EF-G, a protein restricted tothe cytosol (Fig. 2A). Immunoblot analysis of mycoplasmacellular fractions with rabbit anti-EF-Tu antibodies revealed12% of total EF-Tu to be associated with M. genitaliummembranes (Fig. 2A). Immunoelectron microscopy of M.genitalium cells further confirmed the surface topography ofEF-Tu (Fig. 2B).

EF-Tu sequence differences exist between M. genitalium andM. pneumoniae. We compared EF-Tu sequences of M. geni-

TABLE 2. Peptides used in Fn blocking assays

Peptide Amino acid sequencea Positions of aminoacid changes

EF-TuMp 192-219 LMNAVDEWIPTPEREVDKPFLLAIEDT

193M, 194N, 204E

EF-TuMg 192-219 LIKAVDEWIPTPTREVDKPFLLAIEDT

193I, 194K, 204T

EF-TuMp 340-358 GSISLPENTEMVLPGDNTS

343S, 345P, 357T

EF-TuMg 340-358 GSIALAENTEMVLPGDNAS

343A, 345A, 357A

a Amino acid residues that differ in EF-TuMp and EF-TuMg peptides areunderlined.

VOL. 77, 2009 M. PNEUMONIAE EF-Tu BINDS FIBRONECTIN 3535

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

talium reference strain G37 and clinical isolate 1019V anddetermined that they were identical (data not shown). In ourprevious study (11), we compared EF-Tu sequences from M.pneumoniae strains S1 and M129 and an HA� class II mutant

and found them to be identical. However, since subpopulationsof EF-TuMp and EF-TuMg are surface associated but exhibitmarkedly different Fn binding abilities (Fig. 1), we comparedtheir sequences through amino acid alignment and observed98% similarity and 96% identity. EF-Tu sequences from M.pneumoniae and M. genitalium differed in 13 amino acids, 10 ofwhich were found within the carboxyl Fn binding region(amino acids 192 to 394) (Fig. 3); the remaining 3 were locatedwithin the non-Fn-binding amino-terminal region (amino acids1 to 192) (Fig. 3) of EF-TuMp. These conserved amino acidvariations between EF-TuMg and EF-TuMp are species specific,not strain specific.

Expression and purification of mutagenized rEF-TuMp.Based on these amino acid distinctions, we determined whichof the amino acid changes in EF-TuMp might result in the lossof its Fn binding ability. As shown in Fig. 3, seven modifiedrEF-TuMp constructs were generated, among which one con-struct (QRT-EKS) had substitutions within the non-Fn-bind-ing amino-terminal region (amino acids 1 to 192) and twoconstructs (QMN-EIK and MNE-IKT) had changes in the Fnbinding region 1 of EF-Tu (amino acids 192 to 219). Fourconstructs were generated with substitutions in the carboxylregion, with three (TS-AT, SPTS-AAAT, and SPT-AAA) (Fig.3) being specific to Fn binding region 2 (amino acids 314 to394) (3). All recombinant modified EF-Tu proteins resolvedaround 45 kDa, similar to unaltered rEF-TuMp and rEF-TuMg

proteins, and were recognized by immunoblotting (Fig. 4A) aswell as by ELISA with rabbit anti-EF-Tu and mouse anti-HisMAb (data not shown).

Fn binding properties of mutagenized EF-Tu constructs.ELISAs were performed to determine the Fn binding propertyof each mutagenized rEF-Tu protein, which was compared to

FIG. 1. Characterization of Fn binding properties of mycoplasma EF-Tu proteins. (A) Purification of rEF-TuMp and rEF-TuMg. The geneencoding EF-TuMg (MG451) was cloned, expressed, and purified, along with that for EF-TuMp (MPN665), separated in 4 to 12% NuPAGE gels,and stained with Coomassie blue. (B) Interactions of rEF-TuMp and rEF-TuMg with Fn. Individual wells were coated with 0.1 �g human Fn andincubated with increasing concentrations of recombinant His-tagged EF-Tu for 2 h at RT. Bound proteins were detected with mouse anti-His MAb(1:3,000) and AP-conjugated goat anti-mouse antibodies (1:2,000), followed by pNPP substrate. Results are expressed as means standarddeviations. Each sample point is based upon triplicate values. OD 405, optical density at 405 nm.

FIG. 2. Localization of EF-TuMg. (A) Membrane association ofEF-TuMg. M. genitalium membranes were purified by osmotic lysis andultracentrifugation (30 to 60% sucrose gradient). Four-microgram-samples of total mycoplasma and membrane proteins were separatedby 4 to 12% NuPAGE gel electrophoresis and transferred to nitrocel-lulose membranes. Immunoblotting was performed with rabbit anti-EF-G (1:2,000) and rabbit anti-EF-Tu (1:2,000) antibodies as de-scribed in Materials and Methods. (B) Immunogold labeling of EF-Tuon intact M. genitalium cells. Mycoplasmas were incubated with anti-sera (1:1,000) generated against rEF-TuMp followed by anti-rabbitIgG–gold complex (20 nm). Mycoplasma membrane-associated goldlabeling of EF-Tu was readily observed. Prebleed sera demonstratedno background labeling. Bar � 100 nm.

3536 BALASUBRAMANIAN ET AL. INFECT. IMMUN.

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

nonmutagenized rEF-TuMp and rEF-TuMg. Although a rangeof concentrations were tested, a 75 nM concentration of eachrecombinant protein was used because this concentration con-sistently demonstrated maximum binding to Fn (3). The con-struct with substitutions in the amino-terminal region (QRT-EKS) exhibited binding similar to that of rEF-TuMp (Fig. 4B).Also, constructs with modifications within Fn binding region 1

(QMN-EIK and MNE-IKT) did not exhibit reductions in Fnbinding under these experimental conditions. In contrast, mod-ifications of amino acids within Fn binding region 2 (IDTS-VEAT, TS-AT, SPTS-AAAT, and SPT-AAA) demonstratedsignificantly reduced Fn binding. More specifically, the SPTS-AAAT and SPT-AAA constructs showed the most dramaticreductions (Fig. 4B).

FIG. 3. Schematic representation of amino acid changes between EF-TuMp and EF-TuMg and construction of mutagenized EF-TuMp-derivedconstructs. EF-TuMp and EF-TuMg differ by 13 amino acids. Amino acid residues that differ between EF-TuMp and EF-TuMg are represented asvertical dotted lines, with their numerical positions indicated. EF-TuMp-derived constructs and their amino acid substitutions are shown ashorizontal lines, with vertical lines intercepting positions where they have been modified. Individual constructs are designated with single-letterrepresentations of the amino acid residue changes from EF-TuMp to EF-TuMg, with the positions of these amino acids in parentheses. Fninteracting regions of EF-TuMp, designated Fn binding regions 1 and 2 (amino acids 192 to 219 and 314 to 394, respectively), are represented bygray boxes. Based on these regions, constructs were divided into three categories. The first includes changes in the non-Fn-binding amino-terminalregion (QRT-EKS), and the other two categories have changes within the previously identified Fn binding region 1 (QMN-EIK and MNE-IKT)and region 2 (IDTS-VEAT, TS-AT, SPTS-AAAT, and SPT-AAA) (3). The IDTS-VEAT construct has only two of its four amino acid substitutionswithin Fn binding region 2. Synthetic peptides used for functional Fn blocking studies (Fig. 5) are represented by bold lines with amino acid residuepositions in italics.

FIG. 4. Site-directed mutagenized constructs and their Fn interactions. (A) Purification of recombinant proteins. All mutagenized proteinswere cloned, expressed, and purified under native conditions, separated along with rEF-TuMp and rEF-TuMg by electrophoresis on 4 to 12%Nu-PAGE gels, and stained with Coomassie blue. Immunoreactivities of all modified proteins were tested by blotting with anti-EF-Tu antibodies(1:2,000) and anti-His MAb (1:10,000). (B) Comparison of Fn binding of different EF-Tu mutagenized constructs. Individual wells were coatedwith 0.1 �g/well Fn and incubated sequentially with a 75 nM concentration of recombinant His-tagged EF-Tu protein, anti-His MAb (1:2,000), andgoat anti-mouse–AP antibodies (1:2,000), followed by pNPP substrate. Values represent the means for triplicate wells. Based on amino acidsequence distinctions between EF-TuMp and EF-TuMg proteins, constructs were generated as described in the legend to Fig. 3. QRT-EKSrepresents the construct with amino acid substitutions only in the amino-terminal region. QMN-EIK and MNE-IKT contain substitutions in Fnbinding region 1. IDTS-VEAT contains two amino acid substitutions within Fn binding region 2 and two substitutions between regions 1 and 2;TS-AT, SPTS-AAAT, and SPT-AAA contain substitutions only in Fn binding region 2. OD, optical density.

VOL. 77, 2009 M. PNEUMONIAE EF-Tu BINDS FIBRONECTIN 3537

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

Peptide inhibition assays. To further confirm the role of theimplicated EF-Tu amino acids in Fn recognition, we per-formed competitive ELISAs with synthetic peptides corre-sponding to amino acids 192 to 219 (Fn binding region 1) and340 to 358 (Fn binding region 2) of both EF-TuMp and EF-TuMg (Table 2; Fig. 3). As shown in Fig. 5, both EF-TuMp

192-219 and EF-TuMp 340-358 peptides blocked Fn–rEF-TuMp

interactions, by 22% and 62%, respectively. The correspondingM. genitalium peptides exhibited a markedly reduced ability toblock Fn binding (Fig. 5). EF-TuMp 192-219 and EF-TuMp

340-358 peptides at a 75 nM concentration were also capableof blocking the binding of radiolabeled intact M. pneumoniaecells to Fn, by 20% and 38%, respectively. As expected, thecorresponding EF-TuMg peptides did not have an effect (datanot shown).

Molecular model of EF-TuMp. Table 3 shows the statisticsfor the five top-scoring hits coming from the HHPRED anal-ysis using the EF-TuMp amino acid sequence to query. EF-Tufrom Thermus thermophilus scored highest for the query EF-

TuMp sequence and is 69% identical at the amino acid level.Figure 6 presents a molecular model of EF-TuMp, based on theT. thermophilus EF-Tu structure generated by the programMODELLER (42), highlighting the residues involved in Fnbinding. Importantly, note that the key EF-Tu amino acidsimplicated in Fn binding (Fn binding regions 1 and 2) (Fig. 3;Table 2) are surface accessible. While domain 1 catalyzes GTPbinding, domains 2 and 3 modulate EF-Tu interactions withmacromolecular ligands (7, 30, 31).

FIG. 5. Fn binding competition between EF-TuMp and EF-TuMgpeptides located in Fn binding regions 1 and 2. Competitive assayswere performed as described in Materials and Methods. Fn was incu-bated in the presence or absence of a 75 nM concentration of theindicated peptides for 2 h at RT prior to addition to ELISA wellscoated with rEF-TuMp. Binding of Fn to rEF-TuMp in the absence ofpeptides served as a positive control and was considered 100% binding.The percent inhibition of each peptide was calculated based on thebinding percentage.

TABLE 3. Top-scoring structures that can serve as templates for the EF-TuMp amino acid sequence in the program MODELLER, asidentified by the program HHPRED

Hit PDB code(reference) Protein % Amino acid

identityTotalscorea

Secondarystructure score

No. of matchedcolumnsb

Aligned residues

QueryHMM

TemplateHMM

1 2c78 (40) Thermus thermophilus EF-Tu 69 714.7 39.1 393 2–394 1–405 (405)2 1d2e (2) Bos taurus EF-Tu 56 687.1 40.0 383 10–392 1–385 (397)3 1jny (53) Sulfolobus solfataricus EF-Tu 36 672.8 37.5 376 9–392 3–427 (435)4 1f60 (1) Saccharomyces cerevisiae EF-Tu 32 671.0 37.3 379 8–394 3–441 (458)5 1zun (36) Pseudomonas syringae ATP sulfurylase 25 626.7 34.3 372 9–391 21–434 (434)

a The total score column includes the score from the secondary structure comparison.b Total number of matched columns in the query-template alignment.

FIG. 6. Molecular model of EF-TuMp and its Fn binding residues.The EF-TuMp amino acid sequence was modeled on the structure ofEF-Tu from T. thermophilus (PDB code 2c78) (40; see the text). Crys-tallographic and biochemical studies reveal that EF-Tu is organizedinto three domains, labeled domains 1, 2, and 3 (31). Domain 1 isshown in green, domain 2 is in purple, and domain 3 is in blue. Theregions carrying amino acids 193 to 204 and 343 to 357, which areincluded within Fn binding regions 1 and 2, respectively, are shown inorange and yellow. Residues in these regions that differ from those inM. genitalium and are believed to participate in Fn binding are shownin ball-and-stick representation.

3538 BALASUBRAMANIAN ET AL. INFECT. IMMUN.

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

DISCUSSION

In spite of being nearly identical (96%) to EF-TuMp, EF-TuMg does not bind Fn. Since characterization of homologousgenes from related organisms provides valuable informationon conserved regions important for protein functions and in-teractions, we utilized this non-Fn-binding property of EF-TuMg (Fig. 1B) to identify critical amino acids in EF-TuMp thatfacilitate Fn recognition. This could lead to important insightsabout EF-Tu “moonlighting” properties and mycoplasma tis-sue tropism. Therefore, we characterized EF-TuMg and itspossible biological relevance as a surface membrane compo-nent by examining its location, using immunoblots of mem-brane preparations (Fig. 2A) and immunoelectron microscopy(Fig. 2B). It is clear that a subpopulation of EF-TuMg is mem-brane associated and surface exposed, like EF-TuMp. The un-usual phenomenon of surface or membrane association ofEF-Tu in microorganisms has been described in our previouspublications (3, 11). As we discussed previously (11), a multi-tude of intrinsic and/or other physiological stress-related fac-tors or posttranslational modifications could signal the trans-location of a subpopulation of cytoplasmic EF-Tu to themicrobial surface. It is worth noting that EF-Tu exists in mul-tiple isoforms in both M. pneumoniae and M. genitalium (41,47), suggesting that distinct, modified EF-Tu molecules couldexhibit unanticipated biological functions, such as surfaceplacement and Fn binding. While it could be argued that sur-face association of EF-Tu is due to the lysis of mycoplasmacells, we have consistently demonstrated that fewer than 1% ofmycoplasmas are lysed during our experimental procedures(11), which would not account for the percentage of EF-Tuassociated with mycoplasma membranes. Furthermore, incu-bation of M. pneumoniae cells with antibodies generatedagainst rEF-TuMp did not lead to cell lysis, indicating thatsurface-associated EF-Tu permits advantageous moonlightingproperties (3, 11).

EF-TuMg differs from EF-TuMp by only 13 amino acids,among which 7 are located within specific regions of EF-TuMp

that have already been implicated in Fn interactions (Fig. 3)(3). Based upon these observations, we generated three cate-gories of EF-TuMp-derived constructs, i.e., those with changesin the non-Fn-binding amino-terminal region (amino acids 1 to192), those with changes in Fn binding region 1 (amino acids192 to 219), and those with changes in Fn binding region 2(amino acids 314 to 394) (Fig. 3), and monitored their Fninteractions. Substitutions in the amino-terminal region of EF-TuMp did not reduce Fn binding (Fig. 4B), reinforcing ourprevious report that only the carboxyl regions of EF-TuMp

(amino acids 192 to 219 and 314 to 394) mediate Fn interac-tions (3). Interestingly, full-length constructs with amino acidchanges within Fn binding region 1 did not show a reduction inbinding, while modifications within Fn binding region 2 (aminoacids 314 to 394), especially alanine substitutions at serine 343,proline 345, and threonine 357, markedly reduced Fn binding(Fig. 4B). These findings suggest that the subregion corre-sponding to amino acids 340 to 358 within Fn binding region 2is critical for Fn binding. Synthetic peptides that correspondedto Fn binding region 1 (amino acids 192 to 219) and thesubregion within Fn binding region 2 (amino acids 340 to 358)reduced rEF-TuMp binding to Fn by 22 and 62%, respectively

(Fig. 5). The latter suggests that amino acids 340 to 358 withinFn binding region 2 contain the primary Fn interacting site.This could also explain why full-length recombinant EF-Tuproteins with substitutions only in Fn binding region 1 stillretained Fn binding capacity.

A molecular model of EF-TuMp is shown in Fig. 6, highlight-ing key amino acid residues within Fn binding regions 1 and 2.Consistent with this role, these amino acid residues are foundon the surface of the EF-Tu molecule, where they are acces-sible for interactions with other molecules, such as Fn. Methi-onine 193, asparagine 194, and glutamic acid 204 are posi-tioned on the exterior of the carboxy-terminal helix of domain1 and in the linker connecting domains 1 and 2 (31). Serine343, proline 345, and threonine 357 are positioned in a loopand �-strand at one end of the domain 3 �-barrel. There is adeep groove at the end of the �-barrel which is lined by theseresidues, which are all alanine in M. genitalium. We speculatethat serine 343 and threonine 357 may participate in hydrogenbonding interactions with Fn, and further studies are needed toconfirm this hypothesis.

In this study, we further extended the EF-Tu-based phylog-eny tree among sequenced mollicutes by including M. pen-etrans, along with M. pneumoniae, M. genitalium, and M. galli-septicum (data not shown). Comparisons of amino acids 340 to358 of EF-Tu among these closely related mycoplasmas con-firmed that serine 343 and proline 345 are unique to EF-TuMp.The other three Mycoplasma species do not have conserved orsemiconserved amino acid substitutions at these positions. Noprotein of EF-Tu’s size (43 kDa) in M. penetrans and M. gal-lisepticum has been identified to bind Fn (13, 34). These ob-servations reinforce and distinguish the unique functionalmoonlighting role of EF-TuMp as an Fn binding protein. Also,it appears that different proteins with unique Fn binding motifsexist in other mycoplasma species (13, 34).

Many biological and morphological similarities and serolog-ical cross-reactivities are shared by M. pneumoniae and M.genitalium (19, 23, 26). However, although the major tip-asso-ciated adhesins of M. pneumoniae and M. genitalium exhibitsequence homologies and comparable immunological proper-ties (25, 35), the exact mechanisms by which these pathogenicmycoplasmas are preferentially directed to either the respira-tory or urogenital tract are still largely unknown. Differences intheir predominant tissue tropisms could likely be determinedby distinct adherence mechanisms. In this study, we identifiedthe primary amino acids of EF-TuMp that mediate its interac-tion with Fn. We further showed that substitutions in these keyamino acids dramatically alter its Fn binding properties. Fur-thermore, we provide evidence that these key amino acids areconformationally accessible to mediate interactions betweenEF-Tu and Fn. Our findings indicate that EF-Tu binding to Fncan serve as a possible biomarker for distinguishing tissuetropism among closely related pathogens, thus implicating themoonlighting activities of surface-associated metabolic en-zymes as contributing factors to pathogen colonization andbiological versatility.

ACKNOWLEDGMENTS

This project was supported by the National Institute of Allergy andInfectious Diseases (awards U19AI070412 and UI9AI45429 to J.B.B.),

VOL. 77, 2009 M. PNEUMONIAE EF-Tu BINDS FIBRONECTIN 3539

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

The Kleberg Foundation (to J.B.B.), and The Robert A. Welch Foun-dation (to P.J.H.).

The content of this study is solely the responsibility of the authorsand does not necessarily represent the official views of the NationalInstitute of Allergy and Infectious Diseases or the National Institutesof Health.

We thank Rose Garza for her assistance in finalizing the manuscript.

REFERENCES

1. Andersen, G. R., L. Pedersen, L. Valente, I. Chatterjee, T. G. Kinzy, M.Kjeldgaard, and J. Nyborg. 2000. Structural basis for nucleotide exchangeand competition with tRNA in the yeast elongation factor complex eEF1A:eEF1Balpha. Mol. Cell 6:1261–1266.

2. Andersen, G. R., S. Thirup, L. L. Spremulli, and J. Nyborg. 2000. Highresolution crystal structure of bovine mitochondrial EF-Tu in complex withGDP. J. Mol. Biol. 297:421–436.

3. Balasubramanian, S., T. R. Kannan, and J. B. Baseman. 2008. The surface-exposed carboxyl region of Mycoplasma pneumoniae elongation factor Tuinteracts with fibronectin. Infect. Immun. 76:3116–3123.

4. Baseman, J. B. 1993. The cytadhesins of Mycoplasma pneumoniae and My-coplasma genitalium, vol. 20. Plenum Press, New York, NY.

5. Baseman, J. B., R. M. Cole, D. C. Krause, and D. K. Leith. 1982. Molecularbasis for cytadsorption of Mycoplasma pneumoniae. J. Bacteriol. 151:1514–1522.

6. Baseman, J. B., S. F. Dallo, J. G. Tully, and D. L. Rose. 1988. Isolation andcharacterization of Mycoplasma genitalium strains from the human respira-tory tract. J. Clin. Microbiol. 26:2266–2269.

7. Cetin, R., P. H. Anborgh, R. H. Cool, and A. Parmeggiani. 1998. Functionalrole of the noncatalytic domains of elongation factor Tu in the interactionswith ligands. Biochemistry 37:486–495.

8. Chenna, R., H. Sugawara, T. Koike, R. Lopez, T. J. Gibson, D. G. Higgins,and J. D. Thompson. 2003. Multiple sequence alignment with the Clustalseries of programs. Nucleic Acids Res. 31:3497–3500.

9. Dallo, S. F., and J. B. Baseman. 2000. Intracellular DNA replication andlong-term survival of pathogenic mycoplasmas. Microb. Pathog. 29:301–309.

10. Dallo, S. F., A. Chavoya, and J. B. Baseman. 1990. Characterization of thegene for a 30-kilodalton adhesion-related protein of Mycoplasma pneu-moniae. Infect. Immun. 58:4163–4165.

11. Dallo, S. F., T. R. Kannan, M. W. Blaylock, and J. B. Baseman. 2002.Elongation factor Tu and E1 beta subunit of pyruvate dehydrogenase com-plex act as fibronectin binding proteins in Mycoplasma pneumoniae. Mol.Microbiol. 46:1041–1051.

12. Finlay, B. B., and S. Falkow. 1989. Common themes in microbial pathoge-nicity. Microbiol. Rev. 53:210–230.

13. Giron, J. A., M. Lange, and J. B. Baseman. 1996. Adherence, fibronectinbinding, and induction of cytoskeleton reorganization in cultured humancells by Mycoplasma penetrans. Infect. Immun. 64:197–208.

14. Glass, J. I., N. Assad-Garcia, N. Alperovich, S. Yooseph, M. R. Lewis, M.Maruf, C. A. Hutchison III, H. O. Smith, and J. C. Venter. 2006. Essentialgenes of a minimal bacterium. Proc. Natl. Acad. Sci. USA 103:425–430.

15. Goulet, M., R. Dular, J. G. Tully, G. Billowes, and S. Kasatiya. 1995.Isolation of Mycoplasma pneumoniae from the human urogenital tract.J. Clin. Microbiol. 33:2823–2825.

16. Granato, D., G. E. Bergonzelli, R. D. Pridmore, L. Marvin, M. Rouvet, andI. E. Corthesy-Theulaz. 2004. Cell surface-associated elongation factor Tumediates the attachment of Lactobacillus johnsonii NCC533 (La1) to humanintestinal cells and mucins. Infect. Immun. 72:2160–2169.

17. Hansen, E. J., R. M. Wilson, and J. B. Baseman. 1979. Isolation of mutantsof Mycoplasma pneumoniae defective in hemadsorption. Infect. Immun. 23:903–906.

18. Hansen, E. J., R. M. Wilson, W. A. Clyde, Jr., and J. B. Baseman. 1981.Characterization of hemadsorption-negative mutants of Mycoplasma pneu-moniae. Infect. Immun. 32:127–136.

19. Herrmann, R., and B. Reiner. 1998. Mycoplasma pneumoniae and Myco-plasma genitalium: a comparison of two closely related bacterial species.Curr. Opin. Microbiol. 1:572–579.

20. Himmelreich, R., H. Hilbert, H. Plagens, E. Pirkl, B. C. Li, and R. Her-rmann. 1996. Complete sequence analysis of the genome of the bacteriumMycoplasma pneumoniae. Nucleic Acids Res. 24:4420–4449.

21. Ho, S. N., H. D. Hunt, R. M. Horton, J. K. Pullen, and L. R. Pease. 1989.Site-directed mutagenesis by overlap extension using the polymerase chainreaction. Gene 77:51–59.

22. Hook, M., L. M. Switalski, T. Wadstrom, and M. Lindberg. 1989. Interac-tions of pathogenic microorganisms with fibronectin. In D. E. Mosher (ed.),Fibronectin. Academic Press, Inc., New York, NY.

23. Hu, P. C., U. Schaper, A. M. Collier, W. A. Clyde, Jr., M. Horikawa, Y. S.Huang, and M. F. Barile. 1987. A Mycoplasma genitalium protein resemblingthe Mycoplasma pneumoniae attachment protein. Infect. Immun. 55:1126–1131.

24. Inamine, J. M., T. P. Denny, S. Loechel, U. Schaper, C. H. Huang, K. F. Bott,

and P. C. Hu. 1988. Nucleotide sequence of the P1 attachment-protein geneof Mycoplasma pneumoniae. Gene 64:217–229.

25. Inamine, J. M., S. Loechel, A. M. Collier, M. F. Barile, and P. C. Hu. 1989.Nucleotide sequence of the MgPa (mgp) operon of Mycoplasma genitaliumand comparison to the P1 (mpp) operon of Mycoplasma pneumoniae. Gene82:259–267.

26. Jacobs, E., T. Watter, H. E. Schaefer, and W. Bredt. 1991. Comparison ofhost responses after intranasal infection of guinea-pigs with Mycoplasmagenitalium or with Mycoplasma pneumoniae. Microb. Pathog. 10:221–229.

27. Jensen, J. S. 2004. Mycoplasma genitalium: the aetiological agent of urethritisand other sexually transmitted diseases. J. Eur. Acad. Dermatol. Venereol.18:1–11.

28. Kamla, V., B. Henrich, and U. Hadding. 1996. Phylogeny based on elonga-tion factor Tu reflects the phenotypic features of mycoplasmas better thanthat based on 16S rRNA. Gene 171:83–87.

29. Kannan, T. R., and J. B. Baseman. 2006. ADP-ribosylating and vacuolatingcytotoxin of Mycoplasma pneumoniae represents unique virulence determi-nant among bacterial pathogens. Proc. Natl. Acad. Sci. USA 103:6724–6729.

30. Krab, I. M., and A. Parmeggiani. 2002. Mechanisms of EF-Tu, a pioneerGTPase. Prog. Nucleic Acid Res. Mol. Biol. 71:513–551.

31. Krab, I. M., and A. Parmeggiani. 1998. EF-Tu, a GTPase odyssey. Biochim.Biophys. Acta 1443:1–22.

32. Kunert, A., J. Losse, C. Gruszin, M. Huhn, K. Kaendler, S. Mikkat, D. Volke,R. Hoffmann, T. S. Jokiranta, H. Seeberger, U. Moellmann, J. Hellwage, andP. F. Zipfel. 2007. Immune evasion of the human pathogen Pseudomonasaeruginosa: elongation factor Tuf is a factor H and plasminogen bindingprotein. J. Immunol. 179:2979–2988.

33. Larkin, M. A., G. Blackshields, N. P. Brown, R. Chenna, P. A. McGettigan,H. McWilliam, F. Valentin, I. M. Wallace, A. Wilm, R. Lopez, J. D. Thomp-son, T. J. Gibson, and D. G. Higgins. 2007. Clustal W and Clustal X version2.0. Bioinformatics 23:2847–2948.

34. May, M., L. Papazisi, T. S. Gorton, and S. J. Geary. 2006. Identification offibronectin-binding proteins in Mycoplasma gallisepticum strain R. Infect.Immun. 74:1777–1785.

35. Morrison-Plummer, J., A. Lazzell, and J. B. Baseman. 1987. Shared epitopesbetween Mycoplasma pneumoniae major adhesin protein P1 and a 140-kilodalton protein of Mycoplasma genitalium. Infect. Immun. 55:49–56.

36. Mougous, J. D., D. H. Lee, S. C. Hubbard, M. W. Schelle, D. J. Vocadlo, J. M.Berger, and C. R. Bertozzi. 2006. Molecular basis for G protein control of theprokaryotic ATP sulfurylase. Mol. Cell 21:109–122.

37. Musatovova, O., C. Herrera, and J. B. Baseman. 2006. Proximal region ofthe gene encoding cytadherence-related protein permits molecular typing ofMycoplasma genitalium clinical strains by PCR-restriction fragment lengthpolymorphism. J. Clin. Microbiol. 44:598–603.

38. Mushegian, A. R., and E. V. Koonin. 1996. A minimal gene set for cellularlife derived by comparison of complete bacterial genomes. Proc. Natl. Acad.Sci. USA 93:10268–10273.

39. Ouaissi, M. A., D. Afchain, A. Capron, and J. A. Grimaud. 1984. Fibronectinreceptors on Trypanosoma cruzi trypomastigotes and their biological func-tion. Nature 308:380–382.

40. Parmeggiani, A., I. M. Krab, S. Okamura, R. C. Nielsen, J. Nyborg, and P.Nissen. 2006. Structural basis of the action of pulvomycin and GE2270 A onelongation factor Tu. Biochemistry 45:6846–6857.

41. Regula, J. T., B. Ueberle, G. Boguth, A. Gorg, M. Schnolzer, R. Herrmann,and R. Frank. 2000. Towards a two-dimensional proteome map of Myco-plasma pneumoniae. Electrophoresis 21:3765–3780.

42. Sali, A., and T. L. Blundell. 1993. Comparative protein modelling by satis-faction of spatial restraints. J. Mol. Biol. 234:779–815.

43. Schaumburg, J., O. Diekmann, P. Hagendorff, S. Bergmann, M. Rohde, S.Hammerschmidt, L. Jansch, J. Wehland, and U. Karst. 2004. The cell wallsubproteome of Listeria monocytogenes. Proteomics 4:2991–3006.

44. Skerl, K. G., R. A. Calderone, E. Segal, T. Sreevalsan, and W. M. Scheld.1984. In vitro binding of Candida albicans yeast cells to human fibronectin.Can. J. Microbiol. 30:221–227.

45. Soding, J. 2005. Protein homology detection by HMM-HMM comparison.Bioinformatics 21:951–960.

46. Soding, J., A. Biegert, and A. N. Lupas. 2005. The HHpred interactive serverfor protein homology detection and structure prediction. Nucleic Acids Res.33:W244–W248.

47. Su, H. C., C. A. Hutchison III, and M. C. Giddings. 2007. Mapping phos-phoproteins in Mycoplasma genitalium and Mycoplasma pneumoniae. BMCMicrobiol. 7:63.

48. Tatusova, T. A., and T. L. Madden. 1999. BLAST 2 Sequences, a new tool forcomparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174:247–250.

49. Thomas, D. D., J. B. Baseman, and J. F. Alderete. 1985. Fibronectin medi-ates Treponema pallidum cytadherence through recognition of fibronectincell-binding domain. J. Exp. Med. 161:514–525.

50. Tully, J. G., D. L. Rose, J. B. Baseman, S. F. Dallo, A. L. Lazzell, and C. P.Davis. 1995. Mycoplasma pneumoniae and Mycoplasma genitalium mixture insynovial fluid isolate. J. Clin. Microbiol. 33:1851–1855.

3540 BALASUBRAMANIAN ET AL. INFECT. IMMUN.

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from

51. Tully, J. G., D. Taylor-Robinson, R. M. Cole, and D. L. Rose. 1981. A newlydiscovered mycoplasma in the human urogenital tract. Lancet 13:1288–1291.

52. Ueno, P. M., J. Timenetsky, V. E. Centonze, J. J. Wewer, M. Cagle, M. A.Stein, M. Krishnan, and J. B. Baseman. 2008. Interaction of Mycoplasmagenitalium with host cells: evidence for nuclear localization. Microbiology154:3033–3041.

53. Vitagliano, L., M. Masullo, F. Sica, A. Zagari, and V. Bocchini. 2001. Thecrystal structure of Sulfolobus solfataricus elongation factor 1alpha in com-plex with GDP reveals novel features in nucleotide binding and exchange.EMBO J. 20:5305–5311.

54. Waites, K. B., and D. F. Talkington. 2004. Mycoplasma pneumoniae and itsrole as a human pathogen. Clin. Microbiol. Rev. 17:697–728.

55. Wyler, D. J., J. P. Sypek, and J. A. McDonald. 1985. In vitro parasite-monocyte interactions in human leishmaniasis: possible role of fibronectin inparasite attachment. Infect. Immun. 49:305–311.

56. Yamada, K. M., L. H. Hahn, and K. Olden. 1980. Structure and function ofthe fibronectins. Prog. Clin. Biol. Res. 41:797–819.

57. Yavlovich, A., M. Tarshis, and S. Rottem. 2004. Internalization and intra-cellular survival of Mycoplasma pneumoniae by nonphagocytic cells. FEMSMicrobiol. Lett. 233:241–246.

Editor: S. R. Blanke

VOL. 77, 2009 M. PNEUMONIAE EF-Tu BINDS FIBRONECTIN 3541

on February 16, 2019 by guest

http://iai.asm.org/

Dow

nloaded from