Icariin attenuates chronic mild stress-induceddysregulation of the LHPA stress circuit in rats

Ying Pan, Fu-Meng Wang, Li-Qin Qiang, Dong-Mei Zhang, Ling-Dong Kong *

Psychoneuroendocrinology (2010) 35, 272—283

ava i lab le at www.sc ienced i rect .com

journa l homepage: www.el sev ier.com/locate/psyneuen

State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093,People’s Republic of China

Received 20 March 2009; received in revised form 25 June 2009; accepted 27 June 2009

KEYWORDSIcariin;The LHPA stress circuit;CMS;CRF;GR;5-HTR1A

Summary Chronic mild stress (CMS) is suggested to develop dysregulation of the limbic-hypothalamic-pituitary-adrenal (LHPA) stress circuit. Icariin, a major constituent of flavonoidsisolated from Epimedium brevicornum, has been previously confirmed to rescue the HPA axisabnormalities in animal models of depression. However, antidepressant treatment of icariin oncorticotropin-releasing factor (CRF) system within the LHPA stress circuit and its interaction withserotonergic receptor are still seldom studied in CMS model of animals. The present study furtherinvestigated the effects of CMS procedure and subsequent icariin treatment on mRNA and proteinlevels of CRF, CRF receptor 1 (CRFR1) and CRF binding protein (CRFBP), as well as sucrose intake inrats. Moreover, the levels of cyclic adenosine 30,50-monophosphate (cAMP) response elementbinding protein (CREB), glucocorticoid receptor (GR) and 5-hydroxytryptamine 1A receptor (5-HTR1A) in hypothalamus, hippocampus and frontal cortex were simultaneously evaluated fortheir participations in CRF system in this model. We found that CMS procedure significantlyincreased CRF expression levels in the brain regions, and decreased GR and 5-HTR1A inhippocampus and frontal cortex, with sucrose intake reduction representing the hedonic deficitin rats. Icariin restored these alterations in CMS rats. These results confirmed the hypothesis thaticariin exerted antidepressant-like effect via its regulation of central CRF system. And hippo-campus was suggested as an important neural area controlling the LHPA stress circuit in icariin-treated CMS rats. These findings for the first time proved that the potential molecular mechanismof antidepressant action of icariin was targeted on the interaction of the LHPA stress circuit andserotonergic function in CMS rats.# 2009 Elsevier Ltd. All rights reserved.

* Corresponding author. Tel.: +86 25 83594691;fax: +86 25 83594691.

E-mail address: kongld@nju.edu.cn (L.-D. Kong).

0306-4530/$ — see front matter # 2009 Elsevier Ltd. All rights reservedoi:10.1016/j.psyneuen.2009.06.020

1. Introduction

Dysregulation of the limbic-hypothalamic-pituitary-adrenal(LHPA) stress circuit with the HPA axis hyperactivity is themost frequently occurring neuroendocrinological abnorm-ality in depressive disorders (Cubala and Landowski, 2006;Egliston et al., 2007). It has been demonstrated that chronic

d.

The neural-regulated effect of icariin on the LHPA stress circuit 273

antidepressant treatment could normalize the HPA axishyperactivity in depressed patients (Nickel et al., 2003;Nikisch et al., 2005). Among corticotropin-releasing factor(CRF) system, CRF is a key mediator of the mammalianresponse to stress stimuli, involving in the HPA axis dysfunc-tion in depression (Arborelius et al., 1999; Dunn and Swier-giel, 2008). CRF action is initiated by binding CRF receptors(CRFRs). Recent evidence indicated that CRFR1, rather thanCRFR2, was primarily involved in depression and anxietydisorders (Nielsen, 2006). CRFR1 antagonists were con-firmed to exhibit antidepressant-like actions in chronic mildstress (CMS) model of depression in animals (Ducottet et al.,2003). Another indicator, CRF binding protein (CRFBP), inhi-bits CRFRs activation because CRFBP binds CRF with higheraffinity than that with CRFRs (Behan et al., 1995). CRFBPhasa regulatory function on the HPA axis and responds to stressand pathophysiology of major depressive disorder (Van DenEede et al., 2005). In addition, cyclic adenosine 30,50-mono-phosphate (cAMP) response element binding protein (CREB)plays a particularly important role in the central nervoussystem (Impey et al., 2004). The phosphorylation of CREB(pCREB) modulates the transcription of stress sensitivegenes including CRF and CRFBP (Kemp et al., 1998; Carlezonet al., 2005).

In the LHPA stress circuit, the HPA axis activity is con-trolled by a feedback mechanism triggered mainly by stimu-lated glucocorticoid receptor (GR) in cerebral cortex,hippocampus and hypothalamus (Mizoguchi et al., 2003).Reduced GR expression and function are involved in theresponse to stress and followed by high levels of glucocorti-coids in depression (Webster et al., 2002; Cubala and Land-owski, 2006). On the other hand, depression and stress areassociated with dysfunction of serotonergic system (Leitchet al., 2003), showing reduction of postsynaptic 5-hydroxy-tryptamine 1A receptor (5-HTR1A) activity and alteration ofsynaptic 5-HTuptake (Cubala and Landowski, 2006). Increas-ing neurotransmission at postsynaptic 5-HTR1A may mediatethe therapeutic efficacies of some antidepressants (Drevetset al., 2007).

Icariin is a major constituent of flavonoids isolated fromEpimedium brevicornum Maxim (Berberidaceae). Our pre-vious studies demonstrated antidepressant-like effects oficariin in forced swimming test (FST) and tail suspension test(TST) in mice, and in CMS model in Sprague—Dawley andWistar rats (Pan et al., 2005, 2006, 2007). Moreover, we foundthat icariin decreased CRF concentrations in serum andvarious brain regions in CMS rats, and increased brain 5-HTconcentrations in mouse FST, indicating the role of icariin inregulating hyperactivity of the HPA axis and hypo-function ofserotonergic system in animal models of depression (Panet al., 2005, 2007). Therefore, the present study was per-formed to investigate CMS-induced changes of CRF, CRFR1and CRFBP in hypothalamus, hippocampus and frontal cortexin male Wistar rats, and to examine the regulatory effects oficariin and known antidepressant fluoxetine (selective ser-otonin reuptake inhibitor) simultaneously. In brain regions ofthe same animals, we also evaluated alterations of GR and 5-HTR1A mRNA levels, as well as CREB pathway activity, focus-ing on their potential molecular mechanisms in the interac-tion of CRF and serotonergic systems within the LHPA stresscircuit after CMS procedure and chronic treatment withicariin or fluoxetine.

2. Materials and methods

2.1. Reagents

Icariin was purchased from Bio-sep Bio-technique Stock Co.,Ltd. Xi’an Jiaotong University (P.R. China). The purity oficariin was checked by high-performance liquid chromato-graphy to be at least 98% pure (Wang et al., 2003). Fluoxetinehydrochloride was from Changzhou Siyao PharmaceuticalsCo., Ltd. (P.R. China). Trizol reagent was purchased fromInvitrogen. Moloney Murine Leukemia Virus (M-MLV) reversetranscriptase kit used for cDNA synthesis was from Promega(USA). Taq DNA polymerase and polymerase chain reaction(PCR) buffer mixture were from Genescript Co. Ltd., P.R.China. Primary antibodies and the secondary antibody forWestern blotting were purchased from biotechnology com-panies described below. Other reagents were analyticalgrades made in P.R. China.

2.2. Animals

Male Wistar rats (inbred strain, Laboratory Animal Center,Zhejiang Province, P.R. China), weighing 220—250 g, wereused. They were individually housed and maintained at con-trolled temperature (�22 8C) and relative humidity (�55%).Water and dried laboratory food were provided ad lib. Thelight schedule was 12 h light/dark (lights on at 07:00 a.m.),except the procedure described below. Rats were allowed toacclimatize for at least 1 week before the experimentstarted. All protocols including CMS procedure and sacrificeoperation have been approved by the institutional AnimalCare and Use Committee at the Nanjing University and theChina council on Animal Care at Nanjing University.

2.3. CMS procedure and drug treatment

The CMS paradigm has been developed on laboratory animalsto model relatively minor and unanticipated irritations ofeveryday life and further used to predict potential antide-pressant actions of compounds in human depression (Grippoet al., 2005). CMS-induced decrease in sucrose intake (aspecific hedonic deficit), observed in some experimentalCMS animals, could be reversed by some antidepressanttreatments (Brady et al., 1992; Tacchi et al., 2008; Steinet al., 2009). This procedure is conducted by presenting achoice of water and sucrose solution to drink and then thepreference to chose sucrose over water is quantified (Tacchiet al., 2008).

In the present study, rats were individually trained toconsume 1% sucrose solution before CMS procedure. Trainingconsisted of initial 72 h sucrose solution exposure withoutany food or water available. And baseline tests of sucrosesolution intake were performed 6 times over 14 days for allsubjects. Sucrose tests involved a 14-h period of food andwater deprivation followed by offering sucrose/water for1 h. The placement (left and right) of sucrose/water bottleon the cage was randomly changed every time. At the end ofeach test, sucrose or water intake was measured by weight-ing pre-weighed bottles containing sucrose solution or water,and was expressed in relation to the animal’s body weight (g/kg), respectively. Subsequently, sucrose or water consump-

274 Y. Pan et al.

tion was monitored under similar condition in 1 h test(11:00—12:00 h) at weekly intervals for the next 10 weeks.On the basis of sucrose intake in the final baseline test, 6 outof 64 rats were discarded due to too high variations inbaseline. Remained 58 rats were randomly divided intotwo groups, each having similar average intake. One groupwas subjected to CMS procedure (CMS animals). The otherwas control group.

The CMS procedure in the present study was previouslydescribed by Katz et al. (1981) and modified by Willner et al.(1992). The weekly stress regime consisted of one period(12 h) of paired caging, two periods (14 and 18 h) of tiltedcage (458), two periods of water and food deprivation (14 and18 h), one 12-h period of wet cage (200 mL water in 100 gsawdust bedding), and two periods (12 and 12 h) of contin-uous light, three periods (6, 10 and 12 h) of low intensitystroboscopic illumination (150 flashes/min), one 12-h periodof intermittent illumination (2 h/2 h light/dark cycle), twoperiods of noise (6300 Hz tone, 10 and 12 h). All of thestressors were applied individually and continuously, havingno repetition between weeks and being unpredictable. Thecontrol group was housed in a separate room and had nocontact with stressed animals. These rats were deprived offood and water for 14-h proceeding at each sucrose test,otherwise food and water were freely available in homecages. Following 5-week CMS procedure, another 5 rats werediscarded again due to their resistance to the development ofanhedonia. Therefore, 24 rats were left in CMS group.

Upon establishment of a depressive-like state evidencedby sucrose intake reduction, CMS and control animals werefurther divided into matched subgroups. In order to make thenumber of rats stay the same in different groups, only 24 ratswere left in control group and further divided into 4 groups,each had 6 rats. Different groups of animals (n = 6 in everygroup) were daily administered with vehicle (water, 1 mL/kg), icariin (30 and 60 mg/kg), and fluoxetine (10 mg/kg),respectively. All drugs were suspended in water, and admi-nistered by gavage once daily at 13:00 h for the subsequent 5weeks. Stress was continued throughout the entire treatmentperiod. As we have previously seen (Pan et al., 2007), sucroseintake difference between CMS and control groups persistedduring the subsequent 5 weeks. Icariin or fluoxetine elicited agradual increase of sucrose intake in the present study.However, water intake showed no significant differencesbetween CMS and control groups treated with water, icariinor fluoxetine (data not shown). Two-bottle test confirmedthat sucrose intake reduction was induced by depressionrather than the diet habits. In addition, there existed atendency that body weight in CMS rats increased less fastthan that in control group, indicating decreased sucroseintake was exactly not a result of body weight change (Bekriset al., 2005; Grippo et al., 2005; Henningsen et al., 2009).Body weight also showed no significant difference betweenany two groups (data not shown).

2.4. Samples of blood and brain tissues

After CMS period and the last sucrose intake test, rats wereleft without any treatment until the following morning. Toavoid fluctuations of hormone concentrations, blood sampleswere collected from tail veins of rats between 09:00 and

10:00 h and were left to clot in pre-iced tubes with aprotinin(protease inhibitor) and then centrifuged at 3,000 � g, 4 8Cfor 20 min. The separated serum samples were stored at�80 8C until the assay.

After blood collection, rats were sacrificed quickly viadecapitation (Bowman et al., 2001) without any anesthesia.Hypothalamus, hippocampus and frontal cortex were rapidlyand carefully dissected according to the described brainsection locations in Paxinos and Watson’s book (1998). Thebrain regions were quickly frozen by liquid nitrogen and thenstored at �80 8C for RT-PCR and Western blotting analysis.The operating room was independent from where other ratsstayed to make sure that they did not hear other animalsduring blood and tissue collections before being sacrificed.

2.5. CRF and corticosterone concentrations inserum

Serum CRF concentrations in control and CMS rats weredetermined in duplicate by radioimmunoassay (RIA), usingcommercially available RIA kit manufacturing by TechniqueCenter of Radioimmunity of Navy in Beijing, P.R. China. Thesensitivity of the kit was 0.2 ng/mL. Intra- and inter-assaycoefficients of variation were less than 8% and 12%, respec-tively. The RIA procedure was performed as described by thekit’s manufacturer.

Serum corticosterone levels were measured using enzymeimmunoassay kit (Adlitteram Diagnostic Laboratories Inc.).The minimum detectable concentration of corticosteronewas estimated to be 0.1 nmol/L. Intra- and inter-assay coef-ficients of variation were less than 5% and 10%, respectively.The procedure was performed as described by the kit’smanufacturer.

2.6. RT-PCR of CRF, CRFR1, CRFBP, CREB, GR and5-HTR1A

Total RNA of CRF, CRFR1, CRFBP, CREB, GR and 5-HTR1A wereextracted from hypothalamus, hippocampus and frontal cor-tex, respectively, using Trizol reagent (Invitrogen) followingthe manufacturer’s protocol. Concentrations of total RNAwere determined by their absorbance at 260 nm. RNA integ-rity was evaluated by electrophoresis in 1.0% agarose gel.Only non-degraded RNA samples displayed clearly 28S and18S mRNA bands.

Equal amount of total RNA (1 mg) was added in the M-MLVreverse transcriptase kit for the cDNA synthesis following themanufacturer’s protocol. The synthesized cDNA was dilutedby adding 75 mL DNase free water and stored at �20 8C.

The sequences of gene-specific PCR primers were owndesigned using primer premier 5.0 software. All primersequences were checked in GenBank (National Center forBiotechnology Information, Bethesda, MD, USA) to avoidinadvertent sequence homologies. Annealing temperaturesand production lengths used in the experiments were sum-marized in Table 1. Amplification of cDNA by PCR was per-formed in 25 mL reactions containing 8 mL cDNA, 1 mLforward and 1 mL reverse primers (10 mM), 2.5 mL PCR � 10buffer containing 25 mM MgCl2, 0.5 mL dNTP mixture(10 mM), 0.5 mL Taq polymerase (2.5 U) and 11.5 mL sterileddH2O. As shown in Table 1, thermal cycling was performed

Table 1 Sequences of primers used for RT-PCR expression studies.

Gene Sense primer 50 ! 30 Antisense primer 50 ! 30 Products (bp) Tm (8C) Numbers ofthermal cycle

rCRF GAAGAGAAAGGGGAAAGGCAAAGA GCGGTGAGGGGCGTGGAGTT 403 58 35rCRFR1 GTGGATGTTCGTCTGCATTG ATGAGGATGCGGACAATGTT 201 56 40rCRFBP ACTTCAAACTCCAATGCCACTTC AGGTTGGGGTCTGTCTTTATGGT 529 56 35rCREB CCAGCCACAGATTGCCACATT CTGGGGAGGACGCCATAACA 731 58 35rGR AGACAGAAACAAAAGTGATGGG ATGAACAGAAATGGCAGACA 689 54 35r5-HTR1A GACCACGGCTACACCATCTACT CTGCCTCACTGCCCCATTA 276 58 35rGAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA 452 56 30

The neural-regulated effect of icariin on the LHPA stress circuit 275

in: one cycle at 95 8C, 2 min; followed by 30—40 cycles eachincluding denaturation at 94 8C 30 s, 40 s at appropriateanneal temperatures(Tm), extension 40 s at 72 8C, and onecycle at 72 8C, 8 min. Rat GAPDH, used as the externalstandard, did not change its mRNA expression in varioustissues and under different experimental conditions, suchas modeling and drug treatment (Dagnino-Subiabre et al.,2006; Bruzzone et al., 2008).

PCR products were separated by electrophoresis in a 1.5%agarose gel and visualized by staining with ethidium bromide.For semi-quantitative PCR, the gels were photographed todetermine the intensities of PCR-product bands, respec-tively.

2.7. Western blot analysis of CRF, CRFR1, CRFBP,CREB and pCREB

Frozen brain tissue samples, including hypothalamus, hippo-campus and frontal cortex, were homogenized in 1 mL RIPAbuffer [containing 50 mM Tris-base (pH 7.5), 1.0 mM EDTA,159 mM NaCl, 0.1% SDS, 1% Triton X-100, 1% sodium deox-ycholate and 1 mM PMSF], and then centrifuged at 10,000 � gfor 20 min to pellet protein fractions, respectively. Proteinconcentrations were measured by BCA protein assay reagent(Pierce, USA) with bovine serum albumin as standard. Totalproteins were incubated in boiling water for 5 min.

Equal amount (5 mg) of total proteins was separated on12% SDS-PAGE. Proteins were electrophoretically transferredto polyvinylidene difluoride (PVDF) membrane (0.45 mm poresize, Pall, USA) for 1 h. Membranes were blocked in TBST[Tris-buffered saline (TBS) containing 0.1% Tween-20] con-taining 2% bovine serum for 1 h at 37 8C, and incubated at 4 8Covernight with polyclonal rabbit anti-CRF antibody (1:500,Santa Cruz, USA, sc-10718), polyclonal rabbit anti-CRFR1antibody (1:300, Santa Cruz, USA, sc-5543), polyclonal rabbitanti-CRF-BP antibody (1:1000, Santa Cruz, USA, sc-20630),monoclonal rabbit anti-CREB antibody (1:2000, Cell signal-ing, USA, #9197), monoclonal rabbit anti-phospho-CREB (ser-133) antibody (1:1000, Cell signaling, USA, #9198) and mono-clonal rabbit anti-GAPDH antibody (1:5000, KangChen,China, KC-5G4) in TBST containing 1% bovine serum, respec-tively. Immunoreactive bands were detected using HRP-con-jugated goat anti-rabbit IgG as the secondary antibody(1:4000, JingMei Bio, China, SB200) in TBST. The proteinbands were visualized with enhanced chemiluminescenceand exposed to X-ray film (Kodak, New Haven, CT). Contentsof target proteins were analyzed densitometrically using thesensiansys software (Peiqing tech. company Ltd., Shanghai,

P.R. China) and normalized by respective blotting fromGAPDH, which did not change its protein levels in varioustissues and under different experimental conditions, such asmodeling and drug treatment (Dagnino-Subiabre et al., 2006;Bruzzone et al., 2008).

2.8. Data analysis

Data were presented as mean � standard error of the mean(S.E.M.). Data on body weights, sucrose and water intakeswere analyzed by a two-way analysis of variance (ANOVA)with drug treatment in control and CMS groups as between-subjects factors and stress week as within-subject factor. Fordata on biochemical parameters, a one-way ANOVA wasperformed and confirmed that S.E.M. between groups existedsignificant difference. Post-hoc comparison between twogroups used LSD test when equal variances assumed, or usedDunnett’s T3 test when equal variances not assumed. Photoimaging and analysis system were used in photo-densitome-try procedure to determine the intensities of PCR and Wes-tern blotting bands, respectively. A value of p � 0.05 wasconsidered to be statistically significant.

3. Results

3.1. The effects of CMS procedure andsubsequent icariin treatment on sucrose intakeand hormonal markers

In order to monitor the efficacy of CMS procedure and sub-sequent icariin treatment, sucrose intake, serum CRF andcorticosterone levels were measured at week 10, respec-tively (Fig. 1A—C). As we have previously seen (Pan et al.,2007), CMS procedure significantly reduced sucrose intake [F(1, 10) = 22.23, p < 0.001] and elevated serum levels of CRF[F (1, 10) = 10.45, p < 0.01] and corticosterone [F (1,10) = 35.58, p < 0.001] when compared to control + vehicleanimals. Icariin treatment increased sucrose intake [30 mg/kg: F (1, 10) = 8.22, p < 0.05; 60 mg/kg: F (1, 10) = 10.99,p < 0.01], decreased serum levels of CRF [30 mg/kg: F (1,10) = 3.60, p = 0.086; 60 mg/kg: F (1, 10) = 8.32, p < 0.05]and corticosterone [30 mg/kg: F (1, 10) = 37.76, p < 0.001;60 mg/kg: F (1, 10) = 4.90, p < 0.05] in CMS rats compared toCMS + vehicle animals (Fig. 1A—C). Fluoxetine treatment alsoattenuated CMS-induced abnormalities of rats. These dataconfirmed that CMS animals used here developed reductionof sucrose intake and hyperactivity of the HPA axis, whichwere blocked by icariin or fluoxetine treatment.

Figure 1 Effects of icariin and fluoxetine on sucrose intake (A), serum CRF (B) and corticosterone (C) levels at week 10 in CMS rats.Data were expressed as mean � S.E.M. (n = 6). +p < 0.05, ++p < 0.01, +++p < 0.001 compared to control + vehicle group; *p < 0.05,**p < 0.01, ***p < 0.001 compared to CMS + vehicle group.

Figure 2 Effects of icariin and fluoxetine on CRF mRNA and protein levels in hypothalamus, hippocampus and frontal cortex in CMSrats. Data were expressed as mean � S.E.M. (n = 4). +p < 0.05, ++p < 0.01 compared to control + vehicle group; *p < 0.05 compared toCMS + vehicle group. Veh, I1, I2, and Fwere short for vehicle, 30 mg/kg icariin, 60 mg/kg icariin and 10 mg/kg fluoxetine, respectively.

276 Y. Pan et al.

3.2. Icariin treatment regulates CRF mRNA andprotein levels in some of brain regions in CMS rats

As shown in Fig. 2, CMS procedure produced a significantincrease of CRF mRNA levels in hypothalamus [F (1,6) = 11.44, p < 0.05] and a slight but insignificant increasein hippocampus [F (1, 6) = 5.64, p = 0.055] compared tocontrol + vehicle group. Significant increases in CRF proteinlevels were observed in hypothalamus [F (1, 6) = 13.72,

p < 0.01], hippocampus [F (1, 6) = 12.03, p < 0.05] andfrontal cortex [F (1, 6) = 17.50, p < 0.01] in CMS rats. Icariintreatment down-regulated CRF mRNA levels in hypothalamus[60 mg/kg: F (1, 6) = 9.41, p < 0.05] and totally restoredincreased CRF protein levels in hypothalamus [60 mg/kg: F(1, 6) = 12.88, p < 0.05], hippocampus [60 mg/kg: F (1,6) = 7.96, p < 0.05] and frontal cortex [30 mg/kg: F (1,6) = 10.32, p < 0.05; 60 mg/kg: F (1, 6) = 10.67, p < 0.05]in CMS rats compared to CMS + vehicle animals. Fluoxetine

Figure 3 Effects of icariin and fluoxetine on CRFBP mRNA and protein levels in hypothalamus, hippocampus and frontal cortex in CMSrats. Data were expressed as mean � S.E.M. (n = 4). +p < 0.05, ++p < 0.01 compared to control + vehicle group; *p < 0.05, **p < 0.01compared to CMS + vehicle group. Veh, I1, I2, and F were short for vehicle, 30 mg/kg icariin, 60 mg/kg icariin and 10 mg/kg fluoxetine,respectively.

The neural-regulated effect of icariin on the LHPA stress circuit 277

treatment displayed significant reductions of CRF mRNAlevels in hypothalamus [F (1, 6) = 9.41, p < 0.05] and hippo-campus [F (1, 6) = 7.78, p < 0.05], and of CRF protein levelsin hypothalamus [F (1, 6) = 9.73, p < 0.05] and frontal cortex[F (1, 6) = 6.27, p < 0.05] in this model.

In control groups, neither icariin nor fluoxetine alteredCRF mRNA and protein levels except that fluoxetine signifi-cantly decreased CRF protein levels in hippocampus [F (1,6) = 8.56, p < 0.05].

3.3. Icariin treatment fails to alter CRFR1 mRNAand protein levels in hypothalamus, hippocampusand frontal cortex in CMS rats

CRFR1 mRNA and protein levels were similar between CMSand control rats treated with vehicle or icariin (data notshown). Only fluoxetine treatment slightly down-regulatedCRFR1 mRNA levels [F (1, 6) = 5.74, p = 0.054] in hypothala-mus of CMS rats compared to CMS + vehicle animals, however,this effect was not statistically significant (data not shown).

3.4. The CRFBP protein levels but not mRNAlevels are altered by icariin treatment inhypothalamus and frontal cortex of CMS rats

As shown in Fig. 3, CMS procedure did not significantly changeCRFBP mRNA expressions in hypothalamus; hippocampus andfrontal cortex compared to control + vehicle animals. CRFBP

protein levels were significantly increased in hippocampus [F(1, 6) = 9.12, p < 0.05] and frontal cortex [F (1, 6) = 28.11,p < 0.01] compared to control + vehicle animals.

Icariin treatment failed to alter CRFBP mRNA levels in thebrain regions, but significantly decreased CRFBP proteinlevels in hypothalamus [60 mg/kg: F (1, 6) = 9.78,p < 0.05] and frontal cortex [30 mg/kg: F (1, 6) = 26.02,p < 0.01; 60 mg/kg: F (1, 6) = 7.56, p < 0.05], with a slightdecrease in hippocampus [30 mg/kg: F (2, 9) = 3.764,p = 0.065] in CMS groups compared to CMS + vehicle animals.Fluoxetine treatment also had no effects on CRFBP mRNAlevels in the brain regions, but decreased CRFBP proteinlevels significantly in hypothalamus [F (1, 6) = 9.26,p < 0.05] and slightly in hippocampus [F (1, 6) = 5.50,p = 0.057] in CMS rats.

In control groups, neither icariin nor fluoxetine alteredCRFBP mRNA or protein levels in the brain regions.

3.5. Icariin treatment fails to alter CREB mRNAlevels in detected brain regions and down-regulates REB protein levels only inhippocampus, and increases CREB/CREB ratio inhippocampus and frontal cortex in CMS rats

As shown in Fig. 4, a slight but insignificant increase in CREBmRNA levels was observed in hippocampus [F (1, 6) = 4.21,p = 0.086] in CMS rats compared to control + vehicle animals.CMS procedure significantly increased CREB protein levels

Figure 4 Effects of icariin and fluoxetine on CREB mRNA and protein levels including pCREB/CREB ratio in hypothalamus,hippocampus and frontal cortex in CMS rats. Data were expressed as mean � S.E.M. (n = 4). +p < 0.05 compared to control + vehiclegroup; *p < 0.05 compared to CMS + vehicle group. Veh, I1, I2, and F were short for vehicle, 30 mg/kg icariin, 60 mg/kg icariin and10 mg/kg fluoxetine, respectively.

278 Y. Pan et al.

and unchanged pCREB protein levels, resulting in pCREB/CREB ratio reduction in hippocampus [F (1, 6) = 7.98,p < 0.05] in rats. And it also significantly decreasedpCREB/CREB ratio in frontal cortex [F (1, 6) = 13.20,p < 0.05].

Icariin treatment failed to alter CREB mRNA levels in thebrain regions, but decreased CREB protein levels (30 mg/kg),and increased pCREB/CREB ratio in hippocampus [30 mg/kg:F (1, 6) = 6.62, p < 0.05; 60 mg/kg: F (1, 6) = 9.60, p < 0.05]

Figure 5 Effects of icariin and fluoxetine on GRmRNA levels in hypoexpressed as mean � S.E.M. (n = 4). +p < 0.05 compared to control +I1, I2, and F were short for vehicle, 30 mg/kg icariin, 60 mg/kg icar

in CMS rats compared to CMS + vehicle animals. Icariin treat-ment also up-regulated pCREB/CREB ratio in frontal cortex[30 mg/kg: F (1, 6) = 12.60, p < 0.05; 60 mg/kg: F (1,6) = 4.65, p = 0.074]. Fluoxetine treatment significantly ele-vated pCREB/CREB ratio only in frontal cortex [F (1,6) = 7.76, p < 0.05] in CMS groups.

In control groups, icariin or fluoxetine showed no signifi-cant effects on CREBmRNA and protein levels or pCREB/CREBratio in the brain regions.

thalamus, hippocampus and frontal cortex in CMS rats. Data werevehicle group; *p < 0.05 compared to CMS + vehicle group. Veh,iin and 10 mg/kg fluoxetine, respectively.

Figure 6 Effects of icariin and fluoxetine on 5-HTR1AmRNA levels in hypothalamus, hippocampus and frontal cortex in CMS rats. Datawere expressed as mean � S.E.M. (n = 4). +p < 0.05, ++p < 0.01 compared to control + vehicle group; *p < 0.05 compared toCMS + vehicle group. Veh, I1, I2, and Fwere short for vehicle, 30 mg/kg icariin, 60 mg/kg icariin and 10 mg/kg fluoxetine, respectively.

The neural-regulated effect of icariin on the LHPA stress circuit 279

3.6. Icariin treatment up-regulates GR mRNAlevels in hippocampus in CMS rats

As shown in Fig. 5, CMS procedure exhibited a significantdecrease of GR mRNA levels in hippocampus [F (1, 6) = 9.72,p < 0.05] compared to control + vehicle animals. 30 mg/kgicariin and fluoxetine up-regulated GR mRNA levels in hip-pocampus of CMS rats [icariin: F (1, 6) = 7.34, p < 0.05;fluoxetine: F (1, 6) = 7.075, p < 0.05] compared to CMS + ve-hicle animals. However, no significant changes of GR mRNAlevels were observed in hypothalamus and frontal cortex inCMS rats treated with vehicle, icariin and fluoxetine.

There were no significant effects of icariin or fluoxetine onGR mRNA levels in control rats.

3.7. Icariin treatment up-regulates 5-HTR1AmRNA levels in hippocampus and frontal cortex inCMS rats

As shown in Fig. 6, CMS significantly decreased 5-HTR1AmRNA levels in hippocampus [F (1, 6) = 6.11, p < 0.05] andfrontal cortex [F (1, 6) = 18.73, p < 0.01] compared to con-trol + vehicle animals. Icariin treatment could up-regulate 5-HTR1A mRNA levels in hippocampus [60 mg/kg: F (1,6) = 9.17, p < 0.05] and frontal cortex [30 mg/kg: F (1,6) = 7.96, p < 0.05; 60 mg/kg: F (1, 6) = 13.40, p < 0.05] inCMS rats compared to CMS + vehicle animals. However, fluox-etine treatment failed to alter 5-HTR1A mRNA levels in thebrain regions of CMS rats.

There were no effects of icariin or fluoxetine in controlrats except that fluoxetine treatment decreased 5-HTR1AmRNA levels in frontal cortex [F (1, 6) = 11.86, p < 0.05] incontrol rats.

4. Discussion

Previous work from our laboratory demonstrated that icariinexerted its antidepressant-like effects through decreases ofCRF concentrations in serum and various brain regions in CMSrats, resulting in reduction of the HPA axis hyperactivity(Pan et al., 2007). This phenomenon has broad potential

implication in icariin treatment for depression associatedwith the LHPA stress circuit dysregulation. Moreover, CMSparadigm of rats might represent a model of sensitization tothe impairment of the HPA axis and to the efficacy of icariintreatment. Using this model in the present report, we foundthat CMS procedure induced complex changes of the reg-ulatory function of the LHPA stress circuit and serotonergicsystem, characterized by hyperactivity of CRF system (CRF,CRFBP). Decreased expression levels of GR and 5-HTR1A insome of brain regions, up-regulation of CREB protein levelsin hippocampus and reduction of pCREB/CREB ratio in hip-pocampus and frontal cortex in CMS rats aggravated CRFsystem dysfunction. In particular, we found that chronictreatment with icariin attenuated CMS-induced hyperactiv-ity of central CRF system, improving dysfunction within theLHPA stress circuit and serotonergic system in rats. Thus, thepresent study significantly confirmed and extended our pre-vious observations in the FST in mice (Pan et al., 2005) andCMS model in Sprague—Dawley (Pan et al., 2006) and Wistarrats (Pan et al., 2007) that icariin possessed antidepressant-like actions.

In the present study, CRF protein levels were significantlyincreased in hypothalamus, hippocampus and frontal cortexin CMS rats. However, CMS procedure elevated the expressionlevels of CRF mRNA only in rat hypothalamus, the mostprimary region for CRF synthesis. This result was in line withthe notion that electric footshock caused higher CRF mRNAlevels in the paraventricular nucleus of hypothalamus infemale rats (Iwasaki-Sekino et al., 2009). Chronic treatmentwith icariin attenuated CMS-induced hyper-synthesis of CRF,via reducing CRF protein levels in detected brain regions andCRF mRNA levels in hypothalamus in rats. These resultssuggested that central CRF system was sensitive to icariintreatment in CMS rats. Fluoxetine treatment also had sig-nificant down-regulatory effects on CRF protein and mRNAlevels in CMS rats, whichwas consistent with early report thatfluoxetine decreased CRF gene expression in rat brain (Bradyet al., 1992). But other antidepressants, such as venlafaxine(a dual 5-HT/norepinephrine reuptake inhibitor) or tranylcy-promine (a monoamine oxidase inhibitor) did not affectconcentrations of serum CRF and corticosterone, or stimu-lated HPA axis activity in chronic stress rats (Stout et al.,

280 Y. Pan et al.

2002). In the context of antidepressant-like action of icariin,the present findings could be interesting because central CRFdown-regulation was of importance in icariin treatment’sefficacy to reduce the HPA axis hyperactivity in CMS rats.

CRFR1 functions predominantly in emotional behaviorwhile CRFR2 is involved in the regulation of stress copingbehavior (Liebsch et al., 1999). CRFR1, rather than CRFR2,was suggested to be primarily involved in depression andanxiety disorders (Heinrichs et al., 1997). And CRFR1, notCRFR2, deficient mice, were confirmed to exhibit less anxi-ety-like behavior (Nielsen, 2006). Thus, the present studydetected CRFR1 in rat brain regions. Although CRFR1 antago-nists with antidepressant-like activity were observed in CMSmodel of depression (Ducottet et al., 2003; Overstreet andGriebel, 2004), chronic administration of antidepressantvenlafaxine had no detectable effect on CRFR1mRNA expres-sion in brain regions in chronic stressed rats (Stout et al.,2002). As demonstrated here, no significant or exact altera-tions of CRFR1 mRNA and protein levels were found afterhandling, indicating the uncertain role of CRFR1 expression inCMS procedure and icariin treatment in rats. In fact, sig-nificant decreases in CRF receptor binding sites wereobserved in prefrontal cortex of depressed suicide victims(Nemeroff et al., 1988; Arborelius et al., 1999). Therefore,CMS procedure was speculated to alter CRFR binding site andincrease CRF release as a compensatory consequence indetected brain regions of rats.

CRFBP is hypothesized to serve as an inducible factorregulating CRF system activity though intra- and inter-cel-lular mechanisms in CRF-related pathways in the centralnervous system (McClennen et al., 1998). In agreement withobservations showing alterations of CRFBP levels tightlyassociated with depressive disorders (Van Den Eede et al.,2005), we here demonstrated that CMS procedure also sig-nificantly elevated CRFBP protein levels in hippocampus andfrontal cortex of rats, indicating CRFBP as a self-regulatoryresponsor to hyperactivity of CRF system induced by CMSprocedure. Moreover, chronic icariin treatment eliciteddown-regulatory actions on CRFBP protein levels in hypotha-lamus and frontal cortex of CMS rats. These observationsindicated that CRFBP protein level, rather than the tran-scriptional level was more susceptible to CMS procedure andicariin treatment, thus CRFBP might play a secondary ratherthan a primary role in the regulation of central CRF system inicariin-treated CMS rats.

CREB, as a transcriptional regulator of many genes (Impeyet al., 2004), is activated by several other intracellularpathways and different receptors (Blendy, 2006), represent-ing itself a common target for antidepressant treatments. Inthe present study, CMS procedure up-regulated CREB proteinlevels only in hippocampus. However, it was seemingly con-tradicting that CREB signal pathway in CMS rats wasunchanged in hypothalamus, where central CRF is synthe-sized and regulated. Under normal conditions, hippocampusnegatively controls the HPA axis activity (Bao et al., 2008).Our results indicated that impairment of CREB pathway inhippocampus might cause the disinhibition of the HPA axisactivity, leading to CRF dysfunction in hypothalamus of CMSrats. Similarly, chronic but not acute stress slightly increasedCREB expression, whereas none of antidepressants alonesignificantly influenced CREB mRNA in hippocampus ofstressed rats (Butterweck et al., 2001). The present study

also found that fluoxetine treatment failed to change CREBprotein levels in CMS rats. However, it was early reportedthat long-term administration of several different types ofantidepressants including fluoxetine possessed up-regulationof CREB mRNA and protein levels in hippocampus of electro-convulsive seizure rats (Nibuya et al., 1996). CREB mightcontribute to its inhibitory effect of CRF on CRFR1 expressionin rat brain, leading to complicate molecular changes ofCRFR1 under the medical conditions.

pCREB, the phosphorylated product of CREB by activationof cAMP-protein kinase A (PKA) pathway, is considered as anindicator for CREB transcriptional activity (Tardito et al.,2006). This signaling pathway is involved in actions of chronictreatments with antidepressants and phosphodiesterase inhi-bitors that increased cAMP levels (Nestler et al., 2002;Tardito et al., 2006). Based on the finding reported herethat CREB protein levels in hippocampus were affected byCMS procedure and icariin treatment, and a relatively mildstimulus strongly increased pCREB in mammalian nervoussystem (De Cesare et al., 1999), we investigated that CMSprocedure significantly reduced pCREB/CREB ratio in hippo-campus and frontal cortex of rats. This down-regulation ofpCREB/CREB might be the symptom of function impairmentor neuron hypo-activity in hippocampus, the important reg-ulatory region of the LHPA stress circuit in CMS rats. Icariintreatment was able to attenuate CMS-induced hypoactivityof pCREB pathway in this important brain region of rats. Itwas noted that CMS procedure failed to change pCREB/CREBratio in rat hypothalamus, the primary region for CRF synth-esis. In acute ether stress rats, active CRF expression in theparaventricular nucleus of hypothalamus was compatiblewith pCREB (Kovacs and Sawchenko, 1996). Thus, the persis-tent hyper-synthesis of CRF including up-regulated mRNAtranscription induced by CMS procedure was speculatednot to result from cAMP-PKA-pCREB pathway activity in rathypothalamus in this study. However, there was no direct orexact correlation between active regulations of CREB path-way and CRF system in rat hypothalamus after CMS procedureor icariin treatment. Considering pCREB is not only a positiveregulator for CRF and CRFBP genes transcription but also anactive signal of CRFR1 by CRF, the regulation role of pCREBpathway might involve the interaction of hippocampus andhypothalamus’s functions of rats treated with CMS procedureand icariin.

The reduction in the corticosterone response to stress isdue to up-regulation of GR, confirming the key role of GR inthe regulation of the negative feedback control of the HPAaxis (Thomson and Craighead, 2008). It was early reportedthat different chronic stressors caused decreases in GR mRNAlevels in rat hippocampus (Kitraki et al., 1999). In the presentstudy, we observed that CMS procedure significantlyincreased corticosterone concentrations in serum anddecreased GR mRNA expression in hippocampus, which con-tains the highest density of GR (Bowman et al., 2001). Thedown-regulation of GR mRNA in hippocampus might be theresult of increased corticosterone levels and represent aprotective mechanism toward the impairment of CMS pro-cedure on rats. Thus, chronic stress might cause the failure ofthe negative feedback mechanism of the LHPA stress circuitin hippocampus (Thomson and Craighead, 2008). Further-more, we found that chronic treatment with icariin attenu-ated CMS-induced dysfunction of GR in hippocampus, as well

The neural-regulated effect of icariin on the LHPA stress circuit 281

as decreased serum corticosteroid concentrations, indicatingits repairing ability to restore glucocorticoid feedback reg-ulation of the LHPA stress circuit in depressed rats. In addi-tion, the GCs—GR complex can bind to CREB, preventing itsphosphorylation to regulate the expression of relative targetgene (Duman et al., 1997). These observations indicated thaticariin treatment could regulate CRF, CRFBP, CREB and GRexpressions in brain regions of CMS rats.

It was demonstrated that some depressed patients exhib-ited the condition combined with apparent hypoactivity ofserotonergic transmission (Sartorius and Henn, 2007) andhypercorticism, partially resulting from the LHPA stresscircuit dysfunction (Twardowska and Rybakowski, 1996).Pathological conditions of chronically elevated corticoster-oid concentrations impaired serotonergic neurotransmis-sion. Chronic corticosterone treatment attenuated 5-HTR1A density in rat hypothalamus (Leitch et al., 2003) oraltered the response elicited by 5-HTR1A activation in hip-pocampal subfield CA3 pyramidal cells (Okuhara and Beck,1998). Indeed, reduction of 5-HTR1A binding potential wasfound in hippocampus and frontal cortex of depressedpatients (Sargent et al., 2000) and in hippocampus of chronicrestraint rats (Watanabe et al., 1993). Increase in 5-HTR1Aafter treatment with 5-HTR1A antagonist was observed inadult rat hippocampus and cortex (Abbas et al., 2007). In thepresent study, CMS procedure significantly suppressed 5-HTR1A mRNA levels in hippocampus and frontal cortex ofrats, confirming regulatory role of 5-HTR1A in the HPA axissystem. Icariin was confirmed to elicit antidepressant-likeactions via reversing CMS-induced decrease in 5-HTR1AmRNA expression, consequently reducing the HPA axishyperactivity in rats.

The hippocampus, which is particularly vulnerable tostress and distributed with high density of 5-HTR1A and GR(Joels et al., 2003), has a unique role in mediating neuro-biological system (Lanfumey et al., 2008) and associates withboth the LHPA stress circuit and serotonergic system. Reg-ulation of hippocampal 5-HTR1A expression is one way bywhich the LHPA stress circuit may act to influence function ofcentral serotonergic system (Pitchot et al., 2001; Joels et al.,2003). In the present study, it was surprising to find thatserotonergic dysfunction was associated with decreasedexpression level of GR in hippocampus, resulting in dysregu-lation of negative feedback of the LHPA stress circuit in CMSrats. Similarly, chronic immobilization stress, which raisedcirculating levels of corticosterone, was consistentlyreported to decrease hippocampal 5-HT1A receptor binding(Lanfumey et al., 2008). Thus, the present data were inagreement with the evidence that 5-HT1A receptor functionwas under the influence of the HPA axis while corticosteroidsnegatively controlled 5-HT1A receptor gene transcription(Joels et al., 2003; Lanfumey et al., 2008).

The present study confirmed the hypothetical juncturerole of 5-HTR1A and GR in the regulation of the LHPA stresscircuit and serotonergic system in rats treated with CMSprocedure or icariin. Moreover, hippocampus is confirmedto play a particular role in the control of 5-HTergic system–—the HPA axis interactions among various brain areas involved(Lanfumey et al., 2008). These changes of the LHPA stresscircuit and serotonergic system on molecular levels, in turn,might influence sucrose intake in rats treated with CMSprocedure or icariin.

Additionally, decreased sucrose intake had been firmlyproved and repeatedly established in CMS rats and in thepresent study, however, there existed the phenomenon that agroup of rats were stress resistant or resilient (Bergstromet al., 2008; Krishnan and Nestler, 2008). The resilient beha-vior of rats might also represent a distinct, active neurobio-logical process, which raises some hot issues to investigateCMS procedure involving its anti-vulnerability process andprovide knowledge of the pathophysiology of depression inthe future study (Krishnan and Nestler, 2008).

In conclusion, the present study revealed that icariintreatment reduced CRF system hyperactivity and regulatedserotonergic system within the LHPA stress circuit in CMSrats, providing the potential molecular mechanisms of anti-depressant-like actions of icariin. Moreover, our data demon-strated that normal function of hippocampus was emphasizedas the negative control of CRF system in hypothalamus inicariin-treated CMS rats. Finally, our findings could also helpto understand the pathological mechanism of depression andbe useful in indicating a new strategy in the treatment ofdepression with icariin.

Role of funding sources

This study has been supported by co-grants from NSFC(30371755), NCET-06-0442, 07-C-016 and JSNSF (BK2007143) to Ling-Dong Kong (L.D. Kong).

Conflict of interest

None declared.

Acknowledgement

The authors thank Jian-Mei Li, Ph.D. for her excellent tech-nical assistance on the RT-PCR and western blotting experi-ments and animal cares.

References

Abbas, S.Y., Nogueira, M.I., Azmitia, E.C., 2007. Antagonist-inducedincrease in 5-HT1A-receptor expression in adult rat hippocampusand cortex. Synapse 61, 531—539.

Arborelius, L., Owens, M.J., Plotsky, P.M., Nemeroff, C.B., 1999. Therole of corticotropin-releasing factor in depression and anxietydisorders. J. Endocrinol. 160, 1—12.

Bao, A.M., Meynen, G., Swaab, D.F., 2008. The stress system indepression and neurodegeneration: focus on the human hypotha-lamus. Brain Res. Rev. 57, 531—553.

Behan, D.P., Maciejewski, D., Chalmers, D., De Souza, E.B., 1995.Corticotropin releasing factor binding protein (CRF-BP) isexpressed in neuronal and astrocytic cells. Brain Res. 698,259—264.

Bekris, S., Antoniou, K., Daskas, S., Papadopoulou-Daifoti, Z., 2005.Behavioural and neurochemical effects induced by chronic mildstress applied to two different rat strains. Behav. Brain Res. 161,45—59.

Bergstrom, A., Jayatissaa, M.N., Mørk, A., Wiborg, O., 2008. Stresssensitivity and resilience in the chronic mild stress rat model ofdepression; an in situ hybridization study. Brain Res. 1196, 41—52.

Blendy, J.A., 2006. The role of CREB in depression and antidepressanttreatment. Biol. Psychiatry 59, 1144—1150.

282 Y. Pan et al.

Bowman, R.E., Zrull, M.C., Luine, V.N., 2001. Chronic restraint stressenhances radial arm maze performance in female rats. Brain Res.904, 279—289.

Brady, L.S., Gold, P.W., Herkenham, M., Lynn, A.B., Whitfield Jr.,H.J., 1992. The antidepressants fluoxetine, idazoxan and phe-nelzine alter corticotropin-releasing hormone and tyrosine hydro-xylase mRNA levels in rat brain: therapeutic implications. BrainRes. 572, 117—125.

Bruzzone, C.M., Belcher, J.D., Schuld, N.J., et al., 2008. Quantita-tive real-time polymerase chain reaction (qRT-PCR) restrictionfragment length polymorphism (RFLP) method for monitoringhighly conserved transgene expression during gene therapy.Transl. Res. 152, 290—297.

Butterweck, V., Winterhoff, H., Herkenham, M., 2001. St John’swort, hypericin, and imipramine: a comparative analysis of mRNAlevels in brain areas involved in HPA axis control following short-term and long-term administration in normal and stressed rats.Mol. Psychiatry 6, 547—564.

Carlezon Jr, W.A., Duman, R.S., Nestler, E.J., 2005. The many facesof CREB. Trends Neurosci. 28, 436—445.

Cubala, W.J., Landowski, J., 2006. Serotoninergic system and limbic-hypothalamic-pituitary-adrenal axis (LHPA axis) in depression.Psychiatr. Pol. 40, 415—430.

Dagnino-Subiabre, A., Zepeda-Carreno, R., Diaz-Veliz, G., Mora, S.,Aboitiz, F., 2006. Chronic stress induces upregulation of brain-derived neurotrophic factor (BDNF) mRNA and integrin alpha5expression in the rat pineal gland. Brain Res. 1086, 27—34.

De Cesare, D., Fimia, G.M., Sassone-Corsi, P., 1999. Signaling routesto CREM and CREB: plasticity in transcriptional activation. TrendsBiochem. Sci. 24, 281—285.

Drevets, W.C., Thase, M.E., Moses-Kolko, E.L., Price, J., Frank, E.,Kupfer, D.J., Mathis, C., 2007. Serotonin-1A receptor imaging inrecurrent depression: replication and literature review. Nucl.Med. Biol. 34, 865—877.

Ducottet, C., Griebel, G., Belzung, C., 2003. Effects of the selectivenonpeptide corticotropin-releasing factor receptor 1 antagonistantalarmin in the chronic mild stress model of depression in mice.Prog. Neuropsychopharmacol. Biol. Psychiatry 27, 625—631.

Duman, R.S., Heninger, G.R., Nestler, E.J., 1997. A molecular andcellular theory of depression. Arch. Gen. Psychiatry 54, 597—606.

Dunn, A.J., Swiergiel, A.H., 2008. Effects of acute and chronicstressors and CRF in rat and mouse tests for depression. Ann.N. Y. Acad. Sci. 1148, 118—126.

Egliston, K., McMahon, C., Austin, M., 2007. Stress in pregnancy andinfant HPA axis function: conceptual and methodological issuesrelating to the use of salivary cortisol as an outcome measure.Psychoneuroendocrinology 32, 1—13.

Grippo, A.J., Sullivan, N.R., Damjanoska, K.J., Crane, J.W., Car-rasco, G.A., Shi, J., Chen, Zh., Garcia, F., Muma, N.A., Van de Kar,L.D., 2005. Chronic mild stress induces behavioral and physiolo-gical changes, and may alter serotonin 1A receptor function, inmale and cycling female rats. Psychopharmacology (Berl.) 179,769—780.

Heinrichs, S.C., Lapsansky, J., Lovenberg, T.W., De Souza, E.B.,Chalmers, D.T., 1997. Corticotropin-releasing factor CRF1, butnot CRF2, receptorsmediate anxiogenic-like behavior. RegulatoryPeptides 71, 15—21.

Henningsen, K., Andreasen, J.T., Bouzinova, E.V., Jayatissa, M.N.,Jensen, M.S., Redrobe, J.P., Wiborg, O., 2009. Cognitive deficitsin the rat chronic mild stress model for depression: relation toanhedonic-like responses. Behav. Brain Res. 198, 136—141.

Impey, S., McCorkle, S.R., Cha-Molstad, H., Dwyer, J.M., Yochum,G.S., Boss, J.M., McWeeney, S., Dunn, J.J., Mandel, G., Good-man, R.H., 2004. Defining the CREB regulon: a genome-wideanalysis of transcription factor regulatory regions. Cell 119,1041—1054.

Iwasaki-Sekino, A., Mano-Otagiri, A., Ohata, H., Yamauchi, N., Shi-basaki, T., 2009. Gender differences in corticotropin and corti-

costerone secretion and corticotropin-releasing factor mRNAexpression in the paraventricular nucleus of the hypothalamusand the central nucleus of the amygdala in response to footshockstress or psychological stress in rats. Psychoneuroendocrinology34, 226—237.

Joels, M., Verkuyl, J.M., Van Riel, E., 2003. Hippocampal andhypothalamic function after chronic stress. Ann. N. Y. Acad.Sci. 1007, 367—378.

Katz, R.J., Roth, K.A., Carroll, B.J., 1981. Acute and chronic stresseffects on open field activity in the rat: implications for a modelof depression. Neurosci. Biobehav. Rev. 5, 247—251.

Kemp, C.F., Woods, R.J., Lowry, P.J., 1998. The corticotrophin-releasing factor-binding protein: an act of several parts. Peptides19, 1119—1128.

Kitraki, E., Karandrea, D., Kittas, C., 1999. Long-lasting effects ofstress on glucocorticoid receptor gene expression in the rat brain.Neuroendocrinology 69, 331—338.

Kovacs, K.J., Sawchenko, P.E., 1996. Sequence of stress-inducedalterations in indices of synaptic and transcriptional activationin parvocellular neurosecretory neurons. J. Neurosci. 16, 262—273.

Krishnan, V., Nestler, E.J., 2008. The molecular neurobiology ofdepression. Nature 455, 894—902.

Lanfumey, L., Mongeau, R., Cohen-Salmon, C., Hamon, M., 2008.Corticosteroid—serotonin interactions in the neurobiologicalmechanisms of stress-related disorders. Neurosci. Biobehav.Rev. 32, 1174—1184.

Leitch, M.M., Ingram, C.D., Young, A.H., McQuade, R., Gartside,S.E., 2003. Flattening the corticosterone rhythm attenuates 5-HT1A autoreceptor function in the rat: relevance for depression.Neuropsychopharmacology 28, 119—125.

Liebsch, G., Landgraf, R., Engelmann, M., Lorscher, P., Holsboer, F.,1999. Differential behavioural effects of chronic infusion of CRH 1and CRH 2 receptor antisense oligonucleotides into the rat brain.J. Psychiatr. Res. 33, 153—163.

McClennen, S.J., Cortright, D.N., Seasholtz, A.F., 1998. Regulation ofpituitary corticotropin-releasing hormone-binding protein mes-senger ribonucleic acid levels by restraint stress and adrenalect-omy. Endocrinology 139, 4435—4441.

Mizoguchi, K., Ishige, A., Aburada, M., Tabira, T., 2003. Chronic stressattenuates glucocorticoid negative feedback: involvement of theprefrontal cortex and hippocampus. Neuroscience 119, 887—897.

Nemeroff, C.B., Owens, M.J., Bissette, G., Andorn, A.C., Stanley, M.,1988. Reduced corticotropin releasing factor binding sites in thefrontal cortex of suicide victims. Arch. Gen. Psychiatry 45, 577—579.

Nestler, E.J., Gould, E., Manji, H., Buncan, M., Duman, R.S., Gre-shenfeld, H.K., Hen, R., Koester, S., Lederhendler, I., Meaney, M.,Robbins, T., Winsky, L., Zalcman, S., 2002. Preclinical models:status of basic research in depression. Biol. Psychiatry 52, 503—528.

Nibuya, M., Nestler, E.J., Duman, R.S., 1996. Chronic antidepressantadministration increases the expression of cAMP response ele-ment binding protein (CREB) in rat hippocampus. J. Neurosci. 16,2365—2372.

Nickel, T., Sonntag, A., Schill, J., Zobel, A.W., Ackl, N., Brunnauer,A., Murck, H., Ising, M., Yassouridis, A., Steiger, A., Zihl, J.,Holsboer, F., 2003. Clinical and neurobiological effects of tianep-tine and paroxetine in major depression. J. Clin. Psychopharma-col. 23, 155—168.

Nielsen, D.M., 2006. Corticotropin-releasing factor type-1 receptorantagonists: the next class of antidepressants? Life Sci. 78, 909—919.

Nikisch, G., Mathe, A.A., Czernik, A., Thiele, J., Bohner, J., Eap,C.B., Agren, H., Baumann, P., 2005. Long-term citalopram admin-istration reduces responsiveness of HPA axis in patients withmajor depression: relationship with S-citalopram concentrationsin plasma and cerebrospinal fluid (CSF) and clinical response.Psychopharmacology (Berl.) 181, 751—760.

The neural-regulated effect of icariin on the LHPA stress circuit 283

Okuhara, D.Y., Beck, S.G., 1998. Corticosteroids alter 5-hydroxy-tryptamine1A receptor-effector pathway in hippocampal subfieldCA3 pyramidal cells. J. Pharmacol. Exp. Ther. 284, 1227—1233.

Overstreet, D.H., Griebel, G., 2004. Antidepressant-like effects ofCRF1 receptor antagonist SSR125543 in an animal model ofdepression. Eur. J. Pharmacol. 497, 49—53.

Pan, Y., Kong, L.D., Xia, X., Zhang, W.Y., Xia, Z.H., Jiang, F.X., 2005.Antidepressant-like effect of icariin and its possiblemechanism inmice. Pharmacol. Biochem. Behav. 82, 686—694.

Pan, Y., Zhang, W.Y., Xia, X., Kong, L.D., 2006. Effects of icariin onhypothalamic-pituitary-adrenal axis action and cytokine levelsin stressed Sprague—Dawley rats. Biol. Pharm. Bull. 29, 2399—2403.

Pan, Y., Kong, L.D., Li, Y.C., Xia, X., Kung, H.F., Jiang, F.X., 2007.Icariin from Epimedium brevicornum attenuates chronic mildstress-induced behavioral and neuroendocrinological alterationsin male Wistar rats. Pharmacol. Biochem. Behav. 87, 130—140.

Paxinos, G., Watson, C., 1998. The Rat Brain, Stereotaxic Coordi-nates. Academic Press, San Diego.

Pitchot, W., Herrera, C., Ansseau, M., 2001. HPA axis dysfunction inmajor depression: relationship to 5-HT(1A) receptor activity.Neuropsychobiology 44, 74—77.

Sargent, P.A., Kjaer, K.H., Bench, C.J., Rabiner, E.A., Messa, C.,Meyer, J., Gunn, R.N., Grasby, P.M., Cowen, P.J., 2000. Brainserotonin1A receptor binding measured by positron emissiontomography with [11C]WAY-100635: effects of depression andantidepressant treatment. Arch. Gen. Psychiatry 57, 174—180.

Sartorius, A., Henn, F.A., 2007. Deep brain stimulation of the lateralhabenula in treatment resistant major depression. Med. Hypoth-eses 69, 1305—1308.

Stein, E.J., da Silveira Filho, N.G., Machado, D.C., Hipolide, D.C.,Barlow, K., Nobrega, J.N., 2009. Chronic mild stress induceswidespread decreases in thyroid hormone alpha(1) receptormRNA levels in brain–—Reversal by imipramine. Psychoneuroen-docrinology 34, 281—286.

Stout, S.C., Owens, M.J., Nemeroff, C.B., 2002. Regulation of corti-cotropin-releasing factor neuronal systems and hypothalamic-pituitary-adrenal axis activity by stress and chronic antidepres-sant treatment. J. Pharmacol. Exp. Ther. 300, 1085—1092.

Tacchi, R., Ferrari, A., Loche, A., Bertolini, A., 2008. Sucrose intake:increase in non-stressed rats and reduction in chronically stressedrats are both prevented by the gamma-hydroxybutyrate (GHB)analogue, GET73. Pharmacol. Res. 57, 464—468.

Tardito, D., Perez, J., Tiraboschi, E., Musazzi, L., Racagni, G., Popoli,M., 2006. Signaling pathways regulating gene expression, neuro-plasticity, and neurotrophic mechanisms in the action of anti-depressants: a critical overview. Pharmacol. Rev. 58, 115—134.

Thomson, F., Craighead, M., 2008. Innovative approaches for thetreatment of depression: targeting the HPA axis. Neurochem. Res.33, 691—707.

Twardowska, K., Rybakowski, J., 1996. Limbic-hypothalamic-pitui-tary-adrenal axis in depression: literature review. Psychiatr. Pol.30, 741—755.

Van Den Eede, F., Van Broeckhoven, C., Claes, S.J., 2005. Cortico-tropin-releasing factor-binding protein, stress and major depres-sion. Ageing Res. Rev. 4, 213—239.

Wang, M.Q., Bi, Zh.M., Li, P., Ji, H., Cheng, F.L., 2003. Determinationof epimedin C and icariin in Herba Epimedii by HPLC. ZhongguoZhong Yao Za Zhi 28, 1025—1027.

Watanabe, Y., Sakai, R.R., McEwen, B.S., Mendelson, S., 1993. Stressand antidepressant effects on hippocampal and cortical 5-HT1Aand 5-HT2 receptors and transport sites for serotonin. Brain Res.615, 87—94.

Webster, M.J., Knable, M.B., O’Grady, J., Orthmann, J., Weickert,C.S., 2002. Regional specificity of brain glucocorticoid receptormRNA alterations in subjects with schizophrenia and mood dis-orders. Mol. Psychiatry 7, 985—994.

Willner, P., Muscat, R., Papp, M., 1992. Chronic mild stress-inducedanhedonia: a realistic animal model of depression. Neurosci.Biobehav. Rev. 16, 525—534.