APPROVED: Michael Allen, Major Professor Aaron Roberts, Committee Member Gerard ODonovan, Committee Member Art Goven, Chair of the Department of

Biology Mark Wardell, Dean of the Toulouse

Graduate School

CHANGES IN GENE EXPRESSION LEVELS OF THE ECF SIGMA FACTOR

BOV1605 UNDER PH SHIFT AND OXIDATIVE STRESS

IN THE SHEEP PATHOGEN Brucella ovis

Brittany Elaine Kiehler, BS

Thesis Prepared for the Degree of

MASTER OF SCIENCE

UNIVERSITY OF NORTH TEXAS

December 2012

Kiehler, Brittany Elaine. Changes in gene expression levels of the ECF sigma

factor bov1605 under pH shift and oxidative stress in the sheep pathogen Brucella ovis.

Master of Science (Molecular Biology), December 2012, 37 pp., 2 tables, 9 illustrations,

referenes, 89 titles.

Brucella ovis is a sexually transmitted, facultatively anaerobic, intracellular

bacterial pathogen of sheep (Ovis aries) and red deer (Cervus elaphus). Brucella spp.

infect primarily by penetrating the mucosa and are phagocytized by host macrophages,

where survival and replication occurs. At least in some species, it has been shown that

entry into stationary phase is necessary for successful infection. Brucella, like other

alphaproteobacteria, lack the canonical stationary phase sigma factor s. Research on

diverse members of this large phylogenetic group indicate the widespread presence of a

conserved four-gene set including an alternative ECF sigma factor, an anti-sigma factor,

a response regulator (RR), and a histidine kinase (HK). The first description of the

system was made in Methylobacterium extorquens where the RR, named PhyR, was

found to regulate the sigma factor activity by sequestering the anti-sigma factor in a

process termed sigma factor mimicry. These systems have been associated with

various types of extracellular stress responses in a number of environmental bacteria. I

hypothesized that homologous genetic sequences (Bov_1604-1607), which are similarly

found among all Brucella species, may regulate survival functions during pathogenesis.

To further explore the involvement of this system to conditions analogous to those

occurring during infection, pure cultures of B. ovis cells were subjected to environments

of pH (5 and 7) for 15, 30, and 45 minutes and oxidative (50mM H2O2) stress, or

Spermine NONOate for 60 minutes. RNA was extracted and converted to cDNA

andchanges in transcript levels of the sigma factor Bov1605 were measured using

qPCR. Preliminary results indicate that under the exposure to Spermine NONOate there

was little change in expression, but under oxidative stress expression of the sigma

factor Bov1605 was 4.68-fold higher than that expressed under normal conditions.

These results suggest that the sigma factor Bov1605 may be involved in oxidative

stress defense during infection. Under acid stress (pH5), Bov1605 was found to be

upregulated at 15 and 30 minutes, but after 45 and 60 minutes the time decreased.

ii

Copyright 2012

By

Brittany Elaine Kiehler

iii

ACKNOWLEDGMENTS

Special thanks to the University of North Texas, the University of North Texas

Office of Research for ROP grant funding to M.A., to my family for their encouragement

and support, Dr. Allen for his guidance during this project, Sarah Martinez and Leslie

Perry for their assistance with qPCR, and Dr. ODonovan and Dr. Roberts for their

insight.

iv

TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS ............................................................................................... iii

LIST OF TABLES ............................................................................................................ vi

LIST OF FIGURES ......................................................................................................... vii

Chapter

I. INTRODUCTION ....................................................................................... 1 II. LITERATURE REVIEW ............................................................................. 3

Organism ........................................................................................ 3 Infection Pathway ............................................................................ 4 Environmental Stressors ................................................................. 6 Stationary Phase ............................................................................. 9 Intracellular Survival ...................................................................... 10 Genetics ........................................................................................ 11 Significance of Research and Objectives ...................................... 15

III. METHODOLOGY .................................................................................... 17

Cell Line ........................................................................................ 17 Artemis .......................................................................................... 17 PCR .............................................................................................. 17 qPCR ............................................................................................ 18 Analysis ......................................................................................... 20

IV. DATA ....................................................................................................... 21

PCR .............................................................................................. 21 qPCR ............................................................................................ 21

V. RESULTS: qPCR ..................................................................................... 24

Oxidative Stress ............................................................................ 24 Nitric Oxide Stress ........................................................................ 24 Acidic pH Stress ............................................................................ 25 Stationary Phase ........................................................................... 25

v

VI. DISCUSSION .......................................................................................... 28

REFERENCES .............................................................................................................. 31

vi

LIST OF TABLES

Page

1. BLAST results showing the percent similarity of the sigma factors of several Brucella spp. and R. palustris to that of bov1605 in Brucella ovis ...................... 13

2. Designed primer sets for sigma factor bov1605 and GAPDH bov1670 to be used in qPCR trials ...................................................................................................... 20

vii

LIST OF FIGURES

Page

1. The Infection Pathway of Brucella abortus. Wild type Brucella spp. activate the virB gene that allows for survival within the host phagosome ............................... 5

2. Interaction of the Haber-Weiss and Fenton Reactions ......................................... 9

3. NCBI gene maps showing location of the two component response system in B. ovis, B. abortus, B. melitensis, and R. palustris .................................................. 14

4. Example of the Two Component Response Regulator and Histidine Kinase ..... 14

5. Efficiency of bov1605 Primer Set 2 ..................................................................... 23

6. Efficiency of bov1670 Primer Set 3 ..................................................................... 23

7. Gene Expression Levels of bov1605 Under Oxidative and Nitric Oxide Stress .. 26

8. Gene Expression Levels at Interval Times Under Acidic Stress ......................... 27

9. Gene Expression Levels of bov1605 Entering and During Stationary Phase ..... 27

1

CHAPTER I

INTRODUCTION

Brucella ovis is a Gram negative, coccobacillus, facultative intracellular pathogen

that primarily infects rams and sheep (Ovis aries). Infection of red deer (Cervus

elaphus) has also been shown. B. ovis is transmitted by venereal transmission from ram

to ewe, resulting in impaired fertility in rams and weak offspring in ewes. This bacterium

can cause high economic loss in infected populations due to loss of offspring or the

inability to produce viable sperm that will effectively impregnate the female. [1]

The mechanism of infection identified in some Brucella sp. involves penetration

of the mucosa followed by being phagocytized by host macrophages.[2] In the

macrophage phagosomes, Brucella bacteria inhibit the phagosome-lysosome fusion

through rapid acidification of the phagosome following uptake. [3] [4] [5] Within the

phagosome, the invading cells must adapt to several changes in the environment

including pH change, nutrition deprivation, reactive oxidative intermediates (ROIs),

reactive nitrogen intermediates (RNIs) and lysosomal enzymes.

Genetic and immunological evidence suggest all members of the family

Brucellaceae are closely related. These bacteria are classified within the order

Rhizobiales. Also included within this order are many species of interest, both

pathogenic and environmental. Among these free-living bacteria, Rhodopseudomonas

palustris and Caulobacter crescentus have been extensively studied.[6] [7] Specifically

four genes including a two component response regulator, sigma factor, histidine-kinase

receptor, and a possible anti-sigma factor are thought to be involved in the response to

oxidative and pH stress in these and related organisms. However, no research has yet

2

explored this aspect in pathogenic Brucella sp., where they may directly impact

virulence and survival.[8] It is known that resistance to oxidative stress and entry into

stationary phase are needed for virulence in Brucella. We hypothesized that the driving

factor of survival during infection and entry into stationary phase in Brucella may be the

sigma factor bov1605, which regulates these events. This study explores the

transcriptional response of this sigma factor under oxidative stress, pH stress, and

stationary phase designed to mimic conditions experienced within the macrophage to

assess the genes involvement in survival and virulence during infection.

3

CHAPTER II

LITERATURE REVIEW

Organism

Brucella ovis is a Gram negative coccobacillus, facultative intracellular pathogen

that primarily infects rams and sheep (Ovis aries). The organism has also been shown

to infect red deer (Cervus elaphus) following artificial inoculation.[1] While B. ovis has

not been shown to infect any other hosts, it is closely related to other species within the

Brucellaceae family, which consists of known pathogens that infect human hosts as well

as cattle and swine. Among these, Brucella abortus, Brucella suis, and Brucella

melitensis are known causative agents of human brucellosis, as well as the newly

discovered Brucella inopinata.[9] [10] In regards to human infection, brucellosis is

primarily an occupational hazard resulting from exposure to cattle, sheep, and pigs. In

humans, clinical treatment of brucellosis involves a combination of rifampicin and

doxycycline.[11] Brucella spp. are unusual in terms of pathogenic bacteria. They do not

exhibit the classic virulence factors seen in other pathogenic bacteria and rather survival

within the host depends on inhibition of programmed cell death by halting maturation of

the infected macrophage.[12]

Brucella ovis is transmitted by passive venereal transmission via ewes and non

venereal transmission via ram to ram. In cases of B. ovis infection, contaminated

pastures do not appear to be involved in spread of the disease.[13] In infected rams,

epididymitis and poor semen quality are noted, while in females impaired fertility,

placentitis, and weak offspring with high mortality occur. This bacterium can cause high

economic loss in infected populations due to loss of offspring or the inability to produce

4

viable sperm that will effectively impregnate the female.[14] [15] The disease, first

reported in New Zealand and Australia, has since been reported from other sheep-

raising areas of the world. Preventative measures, such as regular examinations of

rams before breeding, can help to reduce the spread of the disease. Rams infected by

B. ovis may display lesions or abnormalities of the scrotal tissues, mainly an enlarged

tail of the epididymis and a shrunken testicle.[16] For a definitive diagnosis, serological

tests or microscopic examination of stained semen smears may be necessary.

Susceptibility increases with age, and isolation of infected rams from the rest of the flock

is advised.[13] Though treatments of chlortetracycline and streptomycin are effective,

such measures are generally not economic as fertility in infected rams is likely

permanently impaired.[13] [17]

Infection Pathway

The general mechanism of infection for Brucella spp. involves penetration of the

mucosa of the nasal, oral, pharyngeal, or genital epithelium, where cells are

phagocytized by host macrophages.[18] [Figure 1] In the macrophage phagosome

Brucella bacteria inhibit the phagosome-lysosome fusion through rapid acidification of

the phagosome following uptake.[19] [20] [21] Normally, a host cell will use acidic pH,

oxidative stress, and nitric oxide stress to kill invading cells. A study by Porte et al. on

acidification of macrophages infected by B. suis described the survival of the bacteria

within the acidic compartments. In the murine macrophages, it was discovered that in

the phagosomes, the vacuoles containing live B.suis rapidly acidified to 4-4.5 pH. One

hypothesis proposed was that the bacteria required a low pH environment for survival

and multiplication within the macrophage and actively build a pathogen-specific niche

5

within the host cells. In B. suis, VirB, a virulence transcription gene, is induced under

acidic conditions and allows for the bacterium to reach certain bacterial compartments

where they are able to survive.[22] The acidic environment may be necessary to favor

a dissociation of iron from transferrin, a system described in the bacterium Francisella

tularensis.[23] Also, the lowered pH may act as an intracellular signal that regulates

genes involved in proliferation and survival within the host macrophage.

Figure 1: The Infection Pathway of Brucella abortus. Adapted from [24]. Wild type Brucella spp. activate the virB gene that allows for survival within the host phagosome.

Brucella

Phagocyte

Acquisition of early endosomal markers

Acquisition of late endosomal markers

Fusion with lysosomes

Mutant cells degraded Wild-type cell proliferation

6

Most Brucella are able to survive the intracellular acidification through the

production of ureases.[20]. Urease is a multi-subunit, nickel-containing enzyme that

catalyzes the hydrolysis of urea, which serves a role in the metabolism of nitrogen,

yielding ammonia and carbon dioxide. Bacteria can utilize the released ammonia as a

nitrogen source and some bacteria, such as Helicobacter pylori produce urease in order

to allow survival in highly acidic environments. B. melitensis, B. abortus, B. suis, and B.

canis are known to produce ureases.[25] [26] B. ovis are generally urease negative,

though have been shown to be urease positive 28.9 percent of the time.[27]

Environmental Stressors

Within the phagosome, the invading cells must adapt to several changes in the

environment including pH changes, nutrition deprivation, reactive oxidative

intermediates (ROIs), reactive nitrogen intermediates (RNIs) [24] [28], and lysosomal

enzymes.

Oxidative stress comes from an imbalance between the production of ROIs and a

biological systems ability to readily detoxify the reactive intermediates or repair the

resulting damage. The peroxides and free radicals cause damage to proteins, lipids,

and DNA. ROIs can be beneficial as they also assist the immune systems as a way to

attack and kill pathogens.[26] In bovine neutrophils, Brucella abortus has been shown to

release guanosine monophosphate (GMP) and adenine to inhibit myeloperoxidases

(MPO)-H2O2-halide antibacterial systems.[29] The inhibition of the MPO-H2O2-halide

system is believed to function due to a decrease in the availability of H2O2 or the

decreased capability of MPO to catalyze the iodination reaction necessary for

7

degranulation. Due to the small size of GMP, it is likely that the molecules escape

recognition of the immune system facilitating intracellular survival of Brucella.[30]

In the immune system, activated phagocytes produce both ROI and RNIs to fight

pathogenic invasion. These reactive compounds do cause some damage to host

tissues, as the oxidants destroy almost every part of the target cell due their

nonspecific, highly reactive nature. This generally prevents the pathogen from escaping

the immune response.[26] The bactericidal functions are induced by gamma interferon

(INF-) and tumor necrosis factor (TNF-), which are associated with protective

immunity.[31] As described above, an increase of iron within the infected host cells

activated by INF- has been shown to increase decimation of intracellular Brucella. The

Haber Weiss reaction is catalyzed by the iron, confirming the importance of ROIs.[32]

[33] [34] [35] [Figure 2]

The Haber-Weiss reaction generates hydroxyl radicals from hydrogen peroxide

and superoxide resulting in oxidative stress. The reaction in catalyzed by iron, the first

step involving the reduction of iron in from the ferric to the ferrous states when reacted

with superoxide radicals. The second step involves the Fenton reaction, which reacts

the ferrous iron with hydrogen peroxide resulting in a hydroxyl radical and the cycling of

ferrous iron back to its ferric state. The accumulation of hydroxyl radicals result in

oxidative stress within a cell.[32]

RNIs are also present within the cell, albeit at lower levels than ROIs. Nitric oxide

(NO), a kind of RNI, is a free radical that is generated by the phagocytes and activated

by interferon- (INF-) and tumor necrosis factor (TNF). Nitric oxide induces DNA

damage and degrades iron sulfur centers.[33] [36] Many bacterial pathogens have

8

evolved to resist nitric oxide. Paracoccus denitrificans, for example, possesses a nitric

oxide reductase regulator (NNR) and a nitrite reductase. The bacterium uses

denitrification to synthesize NO from nitrite and then further reduces the NO down into

nitrous oxide. This is thought to be a strategy to prevent the accumulation of the toxic

NO. There is evidence that the process is also activated by high amounts of NO.[37]

[38]

A study of B. melitensis, B. abortus, and B. suis reported that the

lipopolyssacharride (LPS) and O-antigen of Brucella spp. may induce NO production.

They reported that while reactive oxygen intermediates play a major role in antibacterial

activities, the NO plays a relatively minor role. They also found that B. abortus and B.

melitensis smooth- lipopolyssacharride (S-LPS) induce NO synthesis in rat peritoneal

macrophages.[37] In murine models infected with B. suis, when NO was combined with

IFN- and antibrucella antibodies, the favored outcome was elimination of Brucella.[39]

Another study of NO stress in B. abortus reported that NO can accelerate the killing of

intracellular Brucella but not to completion during the first 24 hours of infection. The

Authors also showed that while NO can induce apoptosis in host cells, effectually

eliminating intracellular pathogens, B. abortus was found to prevent apoptosis. After the

24 hour mark, any surviving Brucella were able to replicate.[40] The data suggest that

there may be genetic sequences that link to survival during NO stress, perhaps similar

to that see in P. denitrificans.

9

Figure 2: Interaction of the Haber-Weiss and Fenton reactions. Adapted from reference.[40]

Stationary Phase

Stationary phase is a period of cell growth where the growth rate slows due to

nutrient depletion and the accumulation of toxic by-products during metabolism. At this

stage, the rate of cell death equals the rate of cell growth resulting in a constant cell

number. Bacteria in stationary phase also become more resistant to environmental

stressors. Stationary phase in the E. coli model is regulated by the sigma factor RpoS

(S), which can be triggered by UV radiation, acidification, change in temperature,

oxidative stress, and nutrient deprivation.[41]

Unlike E. coli and other Proteobacteria, Brucella, and other members of the -

Proteobacteria do not encode an RpoS sigma factor. Instead they may rely on two

component stress regulator systems, which are discussed below. Brucella have been

found to exhibit behavior analogous to stationary phase during infection and intracellular

10

survival. In murine models, the growth curves of Brucella melitensis and Brucella

abortus plateau, showing little growth after 2 weeks postinfection. It has also been found

that Brucella displaying stationary phase-like physiology are less affected by

antibacterial drug treatments.[42] These findings suggest that a stationary phase

physiology is necessary for intracellular survival within the host macrophage.

Intracellular Survival

Brucella spp., as stated before, infect primarily by penetrating the mucosa of the

nasal, oral, pharyngeal, or genital epithelium and are phagocytized by host

macrophages, where survival and subsequent replication occur. If present among

natural oxidative stressors, how do the Brucella survive to replicate?

One means of survival is the lipopolysaccharide (LPS) coat. The

lipopolysaccharide consists of a core polysaccharide and the O-antigen. The core

polysaccharide is formed by ketodeoxyoctonate, various heptoses, glucose, galactose,

glucose, rhamnose, mannose, and a few dideoxyhexoses. This core is then covalently

attached to the O-antigen.[43] The lipid A fatty acids of the lipopolysaccharide are

connected to the cell wall by the amine groups from a disaccharide composed of

glucosamine phosphate, and the disaccharide is connected to the core polysaccharide

by the ketodeoxyoctonate.[44] Griffiths experiment, reported by Frederick Griffith

explored the LPS coats effect on virulence within a host and that bacteria are capable

of transferring genetic information through transformation. In his experiment, Griffith

used two strains of Streptococcus pneumonia, one the wild-type rough and the other the

virulent smooth. He found that the mice infected with the smooth pneumococcus or

those infected with both live rough and heat-killed smooth pneumococcus died, while

11

mice infected with the rough pneumococcus or heat-killed smooth pneumococcus

survived. This showed that the live rough bacteria could take in the genetic information

of the heat killed smooth bacteria and transform to be a smooth variant.[45]

B. ovis naturally generates a rough lipopolysaccharide (R-LPS) coat however,

LPS has been shown to be an important factor of other Brucella spp. virulence. In most

instances, smooth LPS coats are virulent and wild-type coats are much less virulent.[46]

This has been shown to be the case for B.ovis and B. canis, who are both rough yet still

virulent. However, these rough mutants have been shown to be more adherent and

invasive than smooth brucellae such as B. suis, B. abortus, and B. melitensis.[47] The

differentiation between a smooth and rough LPS designation depends on the presence

of O-antigen. Bacteria with a smooth LPS (such as B. abortus) display long chains of O-

antigen, while bacteria with a rough LPS display little to no O-antigen.[2] Rough mutants

are more susceptible to lysis, which is most likely the reason many rough mutants have

non virulent qualities in animal models. The capacity for rough mutants to replicate

intracellularily is not yet solved, though perhaps the answer lays within the genes that

code for virulence or in the difference in expression between the host and on agar.[2]

[48] [49] [50] [51] [52]

Genetics

Genetic and immunological evidence suggest all members of the family

Brucelleae are closely related. It is possible that similar linkage exists within the order

Rhizobiales, in which both Brucella species and Rhodopseudomonas species are

found.[53] [Table 1] [Figure 3] Specifically of interest are four primary stress response

genes (two component response regulator, sigma factor, histidine-kinase receptor, and

12

a possible anti-sigma factor) found in both Brucella spp. and Rhodopseudomonas spp,.

and their response to oxidative stress and the impact of that on the virulence of the

organism.[53] The first description of this system was made in Methylobacterium

extorquens, where two regulatory mechanisms controlled gene expression via

alternative sigma-antisigma factors and phosphorylation-dependent response

regulators.[54] [55]

The four genes in the system are the two component response regulator, sigma

factor, anti-sigma factor, and the sensor histidine kinase, as mentioned above. Each

part of the response regulator plays a part in gene expression. The key element in the

system is the membrane bound histidine kinase, which is responsible for the

autophosphorylation of the histidine with ATP, the phosphotransfer from the kinase to

an aspartate of the response regulation and the phosphotransfer from aspartyl

phosphate back to ADP or water. Once the aspartic acid residue is phosphorylated, the

conformation of the response regulator changes, activating an output domain which

leads to the expression of a target gene.[56] [57] [Figure 4] In this case, the activation of

the sigma factor would occur and the sigma factor would continue on to initiate the RNA

synthesis by the binding of the RNA polymerase to the gene promoters. The sigma

factor completes the RNA polymerase holoenzyme, and once transcription of the DNA

template strand commences, the sigma factor disassociates.[58] The anti-sigma factor

inhibits transcription by binding to the sigma factor. In this way, the anti-sigma factor

limits the ability of the sigma factor to direct expression of certain genes under stress or

another signal relieves its repression.[59]

13

Another factor in this system is the cyclases/histidine kinases associated sensory

extracellular (CHASE3) domain, located in extracellular or periplasmic locations

followed by an intracellular tail incorporating many enzymatic signaling domains such as

the histidine kinase. The CHASE3 domain binds ligands and mediates signal

transduction through the respective receptors.[60] [61]

In Rhodopseudomonas palustris, there is a gene network involving four

homologous [62] regulatory genes. The primary difference in pathogenic Brucella and

free living -proteobacteria is the substitution of a CHASE domain in the histidine kinase

of the latter for the CHASE3 domain of the former. The otherwise highly conserved four-

gene system may then be expected to respond to different signals consistent with life as

a facultative intracellular parasite. Never-the-less, the driving factor of virulence and the

entry into stationary phase in Brucella may involve this highly conserved four-gene

system, which regulates the events. This study intends to observe the response of the

sigma factor bov1605 transcription upon exposure to conditions analogous to that

expected during the infection process and phagocytosis.

Table 1: BLAST results showing the percent similarity of the sigma factors of several Brucella spp. and R. palustris to that of bov1605 in Brucella ovis.

Organism Score Expect Identities Gaps Percent Match B. canis 1059 0 573/573 0/573 100% B. suis 1059 0 573/573 0/573 100% B. melitensis 1053 0 572/573 0/573 99% B. abortus 1048 0 571/573 0/573 99% B. microti 1059 0 573/573 0/573 100% R. palustris 141 5.00E-38 289/424 4/424 68%

14

Figure 3: NCBI gene maps showing location of the conserved four-gene regulatoy system in B. ovis, B. abortus, B. melitensis, and R. palustris

Figure 4: Example of the Two Component Response Regulator and Histidine kinase.

15

Significance of Research and Objectives

The significance of this study is based on the genomic conservation among

Brucella species. While B.ovis does not have a dramatic impact on multiple host

species, B.ovis is closely related to B. abortus and B. melitensis, which are known

human pathogens.[63]

The major aim of this study is to determine the effect of stresses similar to those

that are expected to occur during infection and phagocytosis on transcription of the

sigma factor bov1605. In order to test this, four parameters were selected: oxidative

stress, nitric oxide stress, acidification, and conditions during stationary phase. Initially,

these parameters were to be compared to samples taken from infected rams, however

our collaborative lab at the Universidad Autonoma del Estado de Mexico, were not able

to produce the tissue samples in a timely manner.

To test the first parameter, B. ovis cultures were subjected individually to

oxidative stress using hydrogen peroxide. The RNA was extracted and converted to

cDNA for analysis by quantitative-Polymerase Chain Reaction (qPCR), the results of

which were analyzed to determine whether the gene was upregulated or down

regulated. To test the second parameter, the same process was used substituting

spermine NONOate, which releases controlled amounts of nitric oxide, as the source of

stress. The third parameter also uses the same process, however the samples were

subjected to acidic stress of pH 5 and were incubated at timed intervals of 15, 30, 45,

and 60 minutes, while for the first two parameters, the cells were incubated for 60

minutes each. For the final parameter unstressed cultures of B. ovis were incubated for

4, 7, and 9 days, then additional days to determine the onset of stationary phase-like

16

physiology prior to RNA extraction and processing as described. Our objective was to

test these parameters and determine if our gene of interest, bov1605, had any change

in regulation from what is seen under normal, unstressed conditions at pH 7 in mid-log

phase (OD600 = ~0.3)

We hypothesized that under the stressed conditions, we would see an

upregulation of the sigma factor bov1605. We further hypothesized that bov1605 was

similarly involved in entry into stationary phase. These parameters were tested and

analyzed using qPCR techniques and further described below.

17

CHAPTER III

METHODOLOGY

Cell Line

B. ovis cultures (strain designation 25840) was obtained from ATCC. Lyophilized

cells were reanimated and grown for 7 days (according to the previous literature) in 8%

CO2 at 37C. ATCC recommends growth in 5% CO2, though previous literature shows

growth in 5-10% CO2 for Brucella ovis to be suitable.[62] [63]

Artemis

The Artemis [64] program was used to view chromosome I of B. ovis. From there,

gene sequences of interest were located, specifically the bov1604-1607 region

encompassing the two component response regulator at bov1604, sigma factor at

bov1605, possible anti-sigma factor at bov1606, and the sensor histidine kinase at

bov1607. These sequences were also used to perform genetic matches using the Basic

Local Alignment Search Tool (BLAST) software on the NCBI database.[65] [66]

PCR

A genomic prep of B. ovis was performed using predesigned primers selected for

the 1604-1607 region. The primers (forward 5- AGGCACTTTT CTTTGAGGAAGCATA

reverse 5-TACCCGCTT GTCATCGCCC) were designed using Primer3 [67] and

OligoCalc [68] web programs. PCR reaction was then performed to amplify that specific

sequence which contains a two component response regulator, sigma factor, anti-sigma

factor, and a sensor histidine kinase. The PCR profile used was 30 cycles of 30

seconds of template denaturation at 95Celsius (C). 90 seconds of primer annealing at

54C, and 90 seconds of primer extension at 72C. The final extension was 6 minutes at

18

72C, and then the sample was stored at 4C.[69] [70] Gel electrophoresis was used to

separate the desired product, giving a band of 3252 bp. The DNA was extracted from

the gel and purified to be used in downstream applications. An attempt was made to

clone the sequence into E.coli competent cells, however the attempt failed.

qPCR

Primers for qPCR were designed using Primer 3 [67] and OligoCalc [68] for the

sigma factor bov1605 and GAPDH bov1670. [Table 2] In all, three primer sets were

designed for each target gene. Tests to determine the efficiencies of the primer sets

were performed in triplicate on dilutions of the genomic DNA sequence. Primer

efficiencies were determined using the equation found in the qPCR manual by

Trofimov.[71] [72]

= 10( 1

) 1 100

Four forms of environmental stress were tested: acidic, oxidative, nitric oxide,

and stationary phase stress conditions. Pure B.ovis cell cultures were grown for 4 days

to an optical density at 600nm (OD600) of 0.3. The cultures were then pelleted to

concentrate the cells and the supernatant decanted. The cells were then resuspended

in fresh medium at pH 5, pH 7, or amended with 50mM H2O2, or 6mM Spermine

NONOate. The Spermine NONOate provides a steady-state concentration of NO that is

sufficient to overcome the tendency of NO to auto-oxidize in the presence of oxygen

[73] [74]and has been found to be an efficient inducer of NO stress.[75] [76] The

samples were incubated at 37C shaking at r.p.m. with the exception of the 50mM H2O2

tubes, which were incubated stationary as the turbulent motion caused excessive

pressure to build in the tube. The pH samples were incubated at times of 15, 30, 45,

19

and 60 minutes. The 50mM H2O2 and 6mM Spermine NONOate samples were each

incubated for 60 minutes.[77] The cells were once again spun down and the

supernatant decanted. The cells were treated with RNAprotect [78] [79] then disrupted

following protocol 3 and 7 [79] for RNA extraction of the Qiagen RNeasy protocol. Once

the RNA was obtained, reverse transcription was performed to synthesize cDNA.

Resulting cDNA were stored at 0C prior to use.

qPCR was performed to quantify the amount of sigma factor bov1605 transcript

expressed under each condition.[80] [81] [82]Tests were done in triplicate qPCR reads

of each sample (technical replicates) with triplicate qPCR reads of GAPDH as a

normalizer and no-RT RNA as a negative control. GAPDH, glyceraldehydes 3-

phosphate dehydrogenase, catalyzes he sixth step of glycolysis and serves to

metabolize glucose for energy and carbon molecules.[83] GAPDH is used here as a

normalizer to set a baseline to measure any activity of bov1605 against due to its

relative constant expression during cell growth.

The protocol used was as follows:

Cycle 1: (1X)

Step 1: 95.0 C for 03:00.

Cycle 2: (40X)

Step 1: 95.0 C for 00:10.

Step 2: 53.9 C for 00:30.

Data collection and real-time analysis enabled.

Cycle 3: (81X)

Step 1: 55.0 C-95.0 C for 00:30.

20

Analysis

Results were analyzed using a modified Livak method.[84] A simple equation

was used to generate the data:

= CT(Target) CT(GAP) (CT)avg control

To generate the reference bar, the following equation was used:

= CT CTMean

The CT value was used to calculate the expression level of the target gene, as

described by the Livak method. A mean and standard deviation was taken from the

CT values generated and a standard error calculated to produce the error bars. One-

tailed T-tests were performed to generate p values. For the stationary phase time

course, ANOVA was performed to determine if there was significant change to the

bov1605 sigma factor during entry into and after stationary phase-like physiology was

reached.

Table 2: Designed Primer Sets for Sigma Factor bov1605 and GAPDH bov1670 to be used in qPCR trials.

Salt Adjusted PRIMER 1 (BOV1605)

PRIMER FWD: CCAAGCAGGAGTCCTTTGAA 58.4 PRIMER REV: TGAAGATCAAGCGTGCCATA 56.4

PRIMER 2 (BOV1605)

PRIMER FWD: GCAGGAGTCCTTTGAAGTGG 60.5 PRIMER REV: ATGAGGATGATTGCCTCACG 58.4

PRIMER 3 (BOV1605)

PRIMER FWD: GCAGGAGTCCTTTGAAAGTGG 61.2 PRIMER REV: CATATTGCGAGGGATGCAC 57.5

PRIMER 1 (BOV1670)

PRIMER FWD: TACGATCGATGTTGGCTACG 58.4 PRIMER REV: ACCAGATGGTCCTTCGTCAG 60.5

PRIMER 2 (BOV 1670)

PRIMER FWD: CGTGGAAGGAAGAAAACGTC 58.4 PRIMER REV: ACCAGATGGTCCTTCGTCAG 60.5

PRIMER 3 (BOV1670)

PRIMER FWD: TCTGCGTTATGACAGCGTTC 58.4 PRIMER REV: CAAGATGAAGTGCTGCCTTG 58.4

21

CHAPTER IV

DATA

PCR

The fragments generated via the PCR process were expected to be 3252 bp.

The first PCR profile setting resulted in two bands showing, one at the 3 kb region as

expected along with an equally bright band at the 1.5 kb region. The experiment was

run again at a higher annealing temperature to decrease the amount of 1.5 kb by-

product. 3 kb fragments were cut from the gel and DNA extraction was performed. The

four-gene sequence was to be cloned into competent E. coli cells, however the attempt

failed.

qPCR

Primer efficiency tests were performed to determine from three primer sets which

was the most efficient to use in the experimental tests. Using the qPCR primer

efficiency equation mentioned above in the methods, it was found that primer set 2 of

the designed bov1605 sigma primers [Figure 5] and primer set 3 of the designed

bov1670 GAPDH primers had the best efficiency. [Figure 6] Using the sigma primer 2

and GAPDH primer 3, the cDNA created from the stress induced pH, oxidative, and

nitric oxide samples were tested. The data were analyzed using the Livak method.[84]

[85]

The result of the Livak method calculations is a ratio of the target gene (CT(Target,

Test)) to the calibrator sample (CT(Target, Calibrator)) both normalized to the expression of the

same under a reference condition (CT(Referece, Test)). The sigma factor bov1605 was the

22

target gene, GAPDH bov1670 the calibrator, and unstressed sample at pH 7 was the

reference condition. [85] A simple equation was used to generate the data:

= CT(Target) CT(GAP) (CT)avg control

To generate the reference bar, the following equation was used:

= CT CTMean

The CT value was used to calculate the expression level of the target gene, as

described by the Livak method.

Using this method, the calculated data for the oxidative stress test showed an

upregulation 4.67-fold higher than that seen under normal conditions. The data for the

nitric oxide samples showed a very small down regulation 0.074-fold that seen under

normal conditions.

The data for the pH test showed a slight upregulation at 15 and 30 minutes at

1.04 and 1.62 respectively, with the optimal time being 30 minutes. This is however not

a significant value. At 45 and 60 minutes, decreases in transcripts were seen by 0.89-

fold at 45 minutes and 0.53-fold at 60 minutes. Stationary phase analysis showed a

decrease in transcripts at levels of 0.11-fold for 9 days, 0.09-fold for 10 days, 0.07-fold

for 11 days, 0.2-fold for 12 days, 0.11-fold for 13 days and 0.18-fold for 14 days.

23

Figure 5: Primer 2 of the bov1605 set. Efficiency 94.7%

Figure 6: Primer 3 of the bov1670 set. Efficiency 96.8%

y = -3.455x + 37.778

0

5

10

15

20

25

30

35

40

0 2 4 6 8

CT V

alue

Dilution

bov1605 Primer Set 2

y = -3.4x + 39.537

0

5

10

15

20

25

30

0 2 4 6 8

CT V

alue

Dilution by 10

bov1670 Primer Set 3

24

CHAPTER V

RESULTS: qPCR

Oxidative Stress

B. ovis cultures were grown for 4 days for an optical density of 0.3 at 600nm.

Individual samples from these cultures were taken and exposed to either 50mM H2O2 or

BHI broth at ph 7 for 60 minutes. Earlier tests incubated the samples for 30 minutes, but

levels of regulation did not yield results. RNA was extracted and cDNA synthesized as

described in the methodology. Samples were done in biological triplicate and analyzed

using qPCR with GAPDH bov1670 as the normalizer.

The results of the oxidative stress trial exhibited an upregulation of the sigma

factor gene 4.68-fold higher than that of the gene under normal conditions at pH 7 with

no stressors present. [Figure 7] A T-test was performed on the results giving a value of

p= 0.003. The values for the oxidative stress test were found to be statistically different.

Nitric Oxide Stress

B. ovis cultures were grown for 4 days to an optical density of 0.3 at 600nm.

Individual samples from these cultures were taken and exposed to either 6mM

Spermine NONOate or BHI broth at ph 7 for 60 minutes. RNA was extracted and cDNA

synthesized as described in the methodology. Samples were done in biological triplicate

and analyzed using qPCR with GAPDH bov1670 as the normalizer.

The results of the nitric oxide stress trial exhibited a minimal down regulation of

the sigma factor gene 0.074-fold that of the gene under normal conditions. [Figure 7] A

T-test was performed on these results giving values of p= 0.11. The results were not

statistically different.

25

Acidic pH Stress

B. ovis cultures were grown for 4 days for an optical density of 0.3 at 600nm.

Individual samples from these cultures were taken and exposed to either ph 5 or ph 7

for 15, 30, 45, or 60 minutes. An earlier test incubated the pH 5 samples for 60 minutes.

The results exhibited a down regulation of 0.53-fold. This test was to determine if a

certain time interval exhibited an upregulation of bov1605. RNA was extracted and

cDNA synthesized as described in the methodology. Samples were done in biological

triplicate and analyzed using qPCR with GAPDH bov1670 as the normalizer.

Cells incubated in broth of pH 5 showed down regulation of the sigma factor 0.59

times than that seen under normal conditions. Cells incubated in pH 5 for timed intervals

showed transcript numbers at the following levels: at 15 minutes an upregulation of

1.04-fold, at 30 minutes an upregulation of 1.62-fold, at 45 minutes a down regulation of

0.89-fold, and at 60 minutes a down regulation of 0.53-fold. [Figure 8] A T-test was

performed on these results giving values of p= 0.47 for the 15 minute interval, p= 0.16

for the 30 minute interval, p= 0.42 for the 45 minute interval, and p= 0.21 for the 60

minute interval. These values were not significant.

Stationary Phase

To determine whether bov1605 is involved in entry into a stationary phase

physiology, B. ovis cultures were grown up to 14 days in ph 7. Growth for 12 days

marked the beginning of a stationary phase growth. RNA was extracted and cDNA

synthesized as described in the methodology. Samples were done in biological triplicate

and analyzed using qPCR with GAPDH bov1670 as the normalizer.

26

Gene expression levels of bov1605 during stationary growth were tested at timed

intervals of 9 to 14 days with a control of 4 day growth. Transcript numbers were found

to be 0.11-fold at 9 days, 0.09-fold at 10 days, 0.07-fold at 11 days, 0.2-fold at 12 days,

0.11-fold at 13 days and 0.18-fold at 14 days. [Figure 9] These low values suggest that

during the stationary phase-like time period of the B. ovis growth curve, the bov1605

gene is down regulated. A t-test was performed comparing the results of the bov1605

target at 9-14 days with bov1605 reference at 4 days, giving values of p= 0.08 at 9

days, p= 0.08 at 10 days, p= 0.08 at 11 days, p= 0.10 at 12 days, p= 0.08 at 13 days,

and p= 0.09 at 14 days. ANOVA analysis across the 6 days gave a p value of 0.18. This

value was not statistically significant.

Figure 7: Gene expression levels of bov1605 under oxidative and nitric oxide stress.

-1

0

1

2

3

4

5

OX NO

2C

T Va

lue

bov1605 Under Oxidative and Nitric Oxide Stress

Tested

Reference

27

Figure 8: Gene expression levels at interval times under acidic stress.

Figure 9: Normalized expression ratios of bov1605 over 9 to 14 days of incubation.

0

0.5

1

1.5

2

2.5

3

3.5

4

15 30 45 60

2C

T Va

lue

Time (Minutes)

bov1605 Acidic pH Time Course

Tested

Reference

0

0.5

1

1.5

2

2.5

3

3.5

4

Day 9 Day 10 Day 11 Day 12 Day 13 Day 14

2C

T Va

lue

bov1605 Stationary Phase-like Time Course

Tested

Reference

28

CHAPTER VI

DISCUSSION

This research has shown that under oxidative stress the regulation of the sigma

factor bov1605 is upregulated under laboratory conditions. It is not known what this

particular sigma factor influences, however we hypothesize that it has something to do

with intracellular survival and may assist in survival under oxidative conditions such as

may be expected in the phagosome of a host cell. In regards to the nitric oxide stress,

from the data we can conclude that it has very little effect on this particular gene. While

RNIs are present in the infected cell and used to attack a pathogenic organism invading

the host cell, it is clear that oxidative stress caused by hydroxyl radicals has far more

effect on this regulatory system. This supports previous research in that while nitric

oxide is present and may cause some stress to the invading bacteria, the main cause of

stress for the cell is caused by oxidative species.[86] Experiments with nitric oxide as a

main stress did not have as much effect on the B. ovis samples as reported in B.

abortus, B. suis, and B. melitensis.[37] [87] [88]

Brucella species acidify their environment during the infection and proliferation

process. Usually acidification would kill the cells; however, Brucella have found a way to

use this to their advantage. Our research has shown that sigma bov1605 is upregulated

during acid stress up to 30 minutes, after which the sigma factor is down regulated. It

may be that after that time the cell has produced proteins needed to adapt and survive

in the acidic conditions and more production is unnecessary. Other studies have shown

that the acidic environment turns on certain survival genes, such as virB in Brucella

suis.[89] B. ovis does possess a virB gene on chromosome II of the genome. While the

29

sigma factor studied shows little response to acidic stress, it may be that it does not

specifically have anything to do with survival under acidic conditions.

For Brucella, entry into the stationary phase physiology is thought to be

necessary for infection.[42] Our findings of the timed interval stationary phase test

showed low transcript numbers for bov1605. We had hypothesized that after 9 days,

there would be some regulation of the gene as it was left in conditions that normally

would be expected to trigger stationary phase physiology. It was shown that after 12

days, the growth curve of B. ovis had reached a plateau, signaling stationary phase

growth. Previous studies reported stationary phase-like physiology after 2 weeks

incubation within a murine host.[42] The difference in time to reach stationary phase

may be due to incubation in an animal host versus incubation in prepared media. Our

results showed low transcript numbers for the sigma factor bov1605 across all 6 days

displaying a down regulation of the sigma factor under these conditions. It is possible

this particular gene has little to do with entry into and survival during stationary phase.

Future research on intracellular survival of B. ovis would include a full genomic

analysis using RNA-seq and the analysis of the infected sheep tissues using qPCR.

The data presented here can further be used as a comparison to the infected

tissue when it ultimately arrives. The infected tissue will be processed using the same

techniques as before and analyzed using qPCR. Our hypothesis is that the oxidative

stress data gathered from the individual stress tests will correlate with the data from the

infected tissue.

RNA-seq will be utilized to view upregulation of genes across the entire genome

to determine not only the upregulation of the ECF-sigma factor bov1605 but any genes

30

that may be activated by the sigma factor similarly upregulated during infection. RNA-

seq is a novel method of measuring transcriptomic data experimentally. While there is

not a strong correlation between the abundance of mRNA and the related proteins,

mRNA concentration measurements are useful in that they give light to the gene

regulation of the cell during exposure to varying environmental conditions.[87] [88] The

use of RNA-seq to study gene regulation of the entire genome, will solidify our

hypotheses that sigma factor bov1605 plays a role in oxidative stress defense and acid

stress tolerance during infection, as well as give information in regards to the

upregulation of additional genes within the genome that respond to the stresses

encountered by Brucella during the infection of the host pathogen.

31

REFERENCES

1. The Center for Food Security and Public Health, I.S.U., Insitite for International Cooperation in Animal Biologics. Ovine Epididymitis: Brucella ovis. 2007 July 29, 2009 [cited; Available from: http://www.cfsph.iastate.edu/Factsheets/pdfs/brucellosis_ovis.pdf.

2. Gomes Cardoso, P., et al., Brucella spp noncanonical LPS: structure, biosynthesis, and interaction with host immune system. Microbial Cell Factories, 2006. 5(13).

3. Ko, J. and G.A. Splitter, Molecular Host-Pathogen Interaction in Brucellosis: Current Understanding and Future Approaches to Vaccine Development for Mice and Humans. Clinical Microbiology Reviews, 2003. 16(1): p. 65-78.

4. Kohler, S., et al., Secretion of Listeriolysin by Brucella suis Inhibits Its Intramacrophagic Replication. Infection and Immunity, 2001. 69(4): p. 2753-2756.

5. Porte, F., J.P. Liautard, and S. Khler, Early Acidification of Phagosomes Containing Brucella suis Is Essential for Intracellular Survival in Murine Macrophages. Infection and Immunity, 1999. 67(8): p. 4041-4047.

6. Conlan, S., C. Lawrence, and L.A. McCue, Rhodopseudomonas palutris Regulons Detected by Cross-Species Analysis of Alphaproteobacterial Genomes. Appl. Environ. Microbiol, 2005. 71(11): p. 7442-7452.

7. Foreman, R., A. Fiebig, and S. Crosson, The LovK-LovR two-component system is a regulator of the general stress pathway in Caulobacter crescentus. Journal of Bacteriology, 2012. 194(16).

8. Lamontagne, J., et al., Intracellular Adaption of Brucella abortus. J Proteome Res, 2009. 8(3): p. 1594-1609.

9. Diagnosis and Management of Acute Brucellosis in Primary Care. Brucella Subgroup of the Northern Ireland Regional Zoonoses Group, 2004.

10. Scholz, H. and K. Nockler, Brucella inopinata sp. nov., isolated from a breast implant infection. International Journal of Systematic and Evolutionary Microbiology, 2010. 60: p. 801-808.

11. Robichaud, S., et al., Prevention of laboratory-acquired brucellosis. Clin Infect Dis., 2004. 38(12): p. 119-122.

12. Crasta, O.R., et al., Genome Sequence of Brucella abortus Vaccine Strain S19 Compared to Virulent Strains Yields Candidate Virulence Genes. PLoS ONE, 2008. 3(5).

http://www.cfsph.iastate.edu/Factsheets/pdfs/brucellosis_ovis.pdf

32

13. Brucellosis in Sheep. The Merck Veterinary Manual 2011 [cited; Available from: http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/110506.htm&word=brucella%2covis.

14. Lopez, G., et al., Use of Brucella canis antigen for detection of ovine serum antibodies against Brucella ovis. Veterinary Microbiology, 2005. 105: p. 181-187.

15. Chain, P.S.G., et al., Whole-Genome Analyses of Speciation Events in Pathogenic Brucellae. Infection and Immunity, 2005. 73(12): p. 8353-8361.

16. Plant, J.W. and J. Seaman. Ovine brucellosis. NSW DPI Primefacts 2007 [cited; Available from: http://www.dpi.nsw.gov.au/__data/assets/pdf_file/0006/145824/ovine-brucellosis.pdf.

17. Kohler, S., et al., The analysis of the intramacrophagic virulome of Brucella suis deciphers the enviroment encountered by the pathogen inside the macrophage host cell. Proc Natl Acad Sci USA, 2002. 99(24): p. 15711-15716.

18. Fortier, A., et al., Growth of Francisella tularensis LVS in Macrophages: the Acidic Intracellular Compartment Provides Essential Iron Required for Growth. Infection and Immunity, 1995. 63(4): p. 1478-1483.

19. Atluri, V.L., et al., Interactions of the Human Pathogenic Brucella species with Their Hosts. Annual Review Microbiology, 2011. 65: p. 523-541.

20. Paulsen, I.T., The Brucella suis genome reveals fundamental similarities between animal and plant pathogens and symbionts. PNAS, 2002. 99(20): p. 13148-13153.

21. Paixao, T.A., et al., Establishment of Systemic Brucella melitensis Infection through the Digestive Tract Requires Ureas, the Type IV Secretion System, and Lipopolysaccharide O Antigen. Infection and Immunity, 2009. 77(10): p. 4197-4208.

22. Sangari, F.J., et al., Characterization of the Urease Operon of Brucella abortus and Assessment of Its Role in Virulence of the Bacterium. Infection and Immunity, 2007. 75(2): p. 774-780.

23. Corbel, M.J. and D.M. Hendry, Urease activity of Brucella Species. Res Vet Sci., 1985. 38(2): p. 252-253.

24. Poole, R.K. and M.N. Hughes, New functions for the ancient globin family: bacterial responses to nitric oxide and nitrosative stress. Molecular Microbiology, 2000. 36(4): p. 775-783.

http://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/110506.htm&word=brucella%2covishttp://www.merckvetmanual.com/mvm/index.jsp?cfile=htm/bc/110506.htm&word=brucella%2covishttp://www.dpi.nsw.gov.au/__data/assets/pdf_file/0006/145824/ovine-brucellosis.pdfhttp://www.dpi.nsw.gov.au/__data/assets/pdf_file/0006/145824/ovine-brucellosis.pdf

33

25. Hutchings, M.I., N. Mandhana, and S. Spiro, The NorR Protein of Eschericia coli Activates Expression of the Flavorubredoxin Gene norV in response to Reactive Nitrogen Species. Journal of Bacteriology, 2002. 184(16): p. 4640-4643.

26. Boelsterli, U.A., Mechanistic Toxicology. Second ed, ed. T.a.F. Group. 2007, Boca Raton: CRC Press.

27. Canning, P.C., et al., Isolation of Components of Brucella abortus Responsible for Inhibition of Function in Bovine Neutrophils. The Journal of Infectious Diseases, 1985. 152(5).

28. Spera, J.M., et al., A B Lymphocyte mitogen is a Brucella abortus virulence factor required for persistent infection. PNAS, 2006. 103(44): p. 16514-16519.

29. Jiang, X. and C. Baldwin, Iron augments macrophage-mediated killing of Brucella abortus alone and in conjuction with interferon-gamma. Cell Immunol, 1993. 148(2): p. 397-407.

30. Baldwin, C.L., X. Jiang, and D.M. Fernandes, Macrophage control of Brucella abortus: influence of cytokines and iron. Trends Microbiol, 1993. 1(3): p. 99-104.

31. Hentze, M.W. and L.C. Kuhn, Molecular control of vertebrate iron metabolism: mRNA-based regulatory circuits operated by iron, nitric oxide, and oxidative stress. Proc. Natl. Acad. Sci. USA, 1996. 93: p. 8175-8182.

32. Koppenol, W.H., The Haber-Weiss cycle - 70 Years Later. Redox Report, 2001. 6(4): p. 229-234.

33. Wink, D.A., DNA Deaminating Ability and Genotoxicity of Nitric Oxide and Its Progenitors. Science, 1991. 254(5034): p. 1001-1003.

34. Hibbs, J.B., et al., Nitric Oxide: A Cytotoxic Activated Macrophage Effector Molecule. Biochem Biophys Res Commun, 1988. 157(1): p. 87-94.

35. Lee, Y., N. Shearer, and S. Spiro, Transcription Factor NNR from Paracoccus Denitrificans is a Sensor of Both Nitric Oxide and Oxygen: Isolation of nnr Alleles Encoding Effector-Independent Proteins and Evidence for a Haem-Based Sensing Mechanism. Microbiology, 2005. 152: p. 1461-1470.

36. Hutchings, M.I., et al., Heterologous NNR-Mediated Nitric Oxide Signalling in Escherichia coli. Journal of Bacteriology, 2000. 182: p. 6434-6439.

37. Lopez-Urrutia, L., et al., Lipopolyssaccharides of Brucella abortus and Brucella melitensis Induce Nitric Oxide Synthesis in Rat Peritoneal Macrophages. Infection and Immunity, 2000. 68(3): p. 1740-1745.

38. Gross, A., et al., Expression and Bactericidal Activity of Nitric Oxide Synthase in Brucella suis-Infected Murine Macrophages. Infection and Immunity, 1998. 66(4).

34

39. Wang, M., et al., High Levels of Nitric Oxide Production Decrease Early But Increase Late Survival of Brucella abortus in Macrophages. Elsevier, 2001. 31(5): p. 221-230.

40. Kell, D.B., Iron Behaving Badly: Inappropriate Iron Chelation as a Major Contributor to the Aetiology of Vascular and Other Progressive Inflmmatory and Degenerative Diseases. BMC Medical Genomics, 2009. 2(2).

41. Hengge-Aronis, R., et al., Trehalose Systhesis Genes are Controlled by the Putative Sigma Factor Encoded by RpoS and are Involved in Stationary-Phase thermotolerance in Esherichia coli. Journal of Bacteriology, 1991. 173: p. 7918-7924.

42. Roop, R.M., et al., Brucella Stationary-Phase Gene Expression and Virulence Annual Review Microbiology, 2003. 57: p. 57-76.

43. Robbins, P.W., A. Wright, and M. Dankert, Polysaccharide Biosynthesis. J Gen Physiol, 1966. 49(6): p. 331-346.

44. Wang, X. and P.J. Quinn, Lipopolysaccharide: Biosynthetic pathway and structure modification. Progress in Lipid Research, 2010. 49: p. 97-107.

45. Griffith, F., The Significance of Pneumococcal Types. Journal of Hygiene, 1928. 27(2): p. 113-159.

46. Rittig, M.G., et al., Smooth and Rough Lipopolysaccharide phenotypes of Brucella induce different intracellular trafficking and cytokine/chemokine release in human monocytes Journal of Leukocyte Biology, 2003. 74(6): p. 1045-1055.

47. Detilleux, P.G., B.L. Deyoe, and N.F. Cheville, Penetration and Intracellular Growth of Bruella abortus in Nonphagocytic Cells In Vitro. Infection and Immunity, 1990. 58(7): p. 2320-2328.

48. Moriyon, I. and I. Lopez-Goni, Structure and Properties of the Outer Membranes of Brucella abortus and Brucella melitensis. Internatl Microbiol, 1998. 1: p. 19-26.

49. Gamazo, C., et al., Comaprative Analyses of Proteins Extracted by Hot Saline or Released Spontaneously into Outer Membrane Blebs from Field Strains of Brucella ovis and Brucella melitensis. Infection and Immunity, 1989. 57(5): p. 1419-1426.

50. Cloeckaert, A., et al., Nucelotide Sequence and Expression of the Gene Encoding the Major 25-Kilodalton Outer Membrane Protein of Brucella ovis: Evidence for Antigentic Shift, Compared with Other Brucella Species, due to a Deletion in the Gene. Infection and Immunity, 1996. 64(6): p. 2047-2055.

51. Holland, J.J. and M.J. Pickett, A Cellular Basis of Immunity in Experimental Brucella Infection. J. Exp. Med., 1958. 108(3): p. 343-360.

35

52. Mancilla, M., et al., Spontaneous Excision of the O-Polysaccharide wbkA Glycosyltransferase Gene is a Cause of Dissociation of Smooth to Rough Brucella Colonies. Journal of Bacteriology, 2012. 194(8): p. 1860-1867.

53. Francez-Charlot, A., et al., Sigma factor mimicry involved in regulationof general stress response. PNAS, 2009. 106(9): p. 3467-3472.

54. Gourion, B., A. Francez-Charlot, and J.A. Vorholt, PhyR is involved in the general stress response of Methylobacterium extorquens AM1. Journal of Bacteriology, 2008. 190(3): p. 1027-1035.

55. Stock, A.M., V.L. Robinson, and P.N. Goudreau, Two Component Signal Transduction. Annual Review of Biochemistry, 2000. 69: p. 183-215.

56. Gao, R., et al., Consituitive Activation of Two-Component Response Regulators: Characterization of VirG Activation in Agrobacterium tumefaciens. Journal of Bacteriology, 2006. 188(14): p. 5204-5211.

57. Gruber, T.M. and C.A. Gross, Multiple Sigma Subunits and the Partitioning of Bacterial Transcription Space. Annual Review Microbiology, 2003. 57: p. 441-466.

58. Hofmann, N., R. Wagner, and R. Wurm, The E. coli Anti-Sigma Factor Rsd: Studies on the Specificity and Regulation of Its Expression. PLoS ONE, 2011. 6(5).

59. Mougel, C. and I.B. Zhulin, CHASE: an extracellular sensing domain common to transmembrane receptors from prokaryotes, lower eukaryotes and plants. Trends Biochem. Sci., 2001. 26(10): p. 582-584.

60. Anantharaman, V. and L. Aravind, The CHASE Domain: A Predicted Ligand-Binding Module in Plant Cytokinin Receptors and Other Eukaryotic and Bacterial Receptors. Trends Biochem. Sci., 2001. 26(10): p. 579-582.

61. Billard, E., et al., High Susceptibility of Human Dendritic Cells to Invasion by the Intracelluar Pathogens Brucella suis, B. abortus, and B. melitensis. Infection and Immunity, 2005. 73(12): p. 8418-8424.

62. Schnurrenberger, P.R., et al., Brucella abortus in wildlife on selected cattle farms in Alabama. Journal of Wildlife Diseases, 1985. 21(2): p. 132-136.

63. Marin, C.M., J.L. Alabart, and J.M. Blasco, Effect of antibiotics contained in two Brucella selective media on growth of Brucella abortus, B. melitensis, and B. ovis. Journal of Clinical Microbiology, 1996. 34(2): p. 426-428.

64. Rutherford, K., et al., Artemis: Sequence Visualization and Annotation. Bioinformatics (Oxford, England), 2000. 16(10): p. 944-945.

36

65. Altschul, S.F., et al., Basic local alignment search tool. Journal of Molecular Biology, 1990. 215: p. 403-410.

66. NCBI. BLAST. [cited; Available from: http://blast.ncbi.nlm.nih.gov/Blast.cgi.

67. Rozen, S. and H.J. Skaletsky, Primer3 on the WWW for general users and for biological programmers. Bioinformatics Methods and Protocols: Methods in Molecular Biology, 2000: p. 365-386.

68. Kibbe, W.A., E. Buehler, and Q. Cao. OligoCalc. [cited; Available from: http://www.basic.northwestern.edu/biotools/oligocalc.html.

69. Navarro, E., et al., Comparison of three different PCR methods for detection of Brucella spp. in human blood samples. FEMS Immunology and Medical Microbiology, 2006. 34(2): p. 147-151.

70. Manterola, L., et al., Evaluation of a PCR test for the diagnosis of Brucella ovis infection in semen samples from rams. Veterinary Microbiology, 2002. 92: p. 65-72.

71. Rebrikov, D.V. and D.Y. Trofimov, Real-Time PCR: A Review of Approaches to Data Analysis. Applied Biochemistry and Microbiology, 2006. 42(5): p. 455-463.

72. Bustin, S.A., et al., The MIQE guidelines: minimum information for the publication of quantitative real-time PCR experiments. Clin Chem, 2009. 55(4): p. 611-622.

73. Baeumle, M., Sensor Dyes. Sigma-Aldrich Biofiles, 2011. 6.3(23).

74. Diodati, J.G., A.A. Quyyumi, and L.K. Keefer, Complexes of Nitric Oxide with Nucelophiles as Agents for the Controlled Biological Release of Nitric Oxide: Hemodynamic Effect in the Rabbit. Journal of Cardiovascular Pharmacology 1993. 22: p. 287-292.

75. Poole, R.K., et al., Nitric Oxide, Nitrite, and Fnr Regulation of hmp (Flavohemoglobin) Gene Expression in Eschericia coli K-12. Journal of Bacteriology, 1996. 178(18): p. 5487-5492.

76. Bodenmiller, D.M. and S. Spiro, the yjeB (nsrR) Gene of Escherichia coli Encodes a Nitric Oxide-Sensitive Transcriptional Regulator. Journal of Bacteriology, 2006. 188(3): p. 874-881.

77. Teixeira-Gomes, A.P., A. Cloeckaert, and M.S. Zygmunt, Characterization of Heat, Oxidative, and Acid Stress Responses in Brucella melitensis. Infection and Immunity, 2000. 68(5): p. 2954-2961.

78. Qiagen. [cited; Available from: www.qiagen.com.

79. Qiagen, RNAprotect Bacteria Reagent Handbook. 2005.

http://blast.ncbi.nlm.nih.gov/Blast.cgihttp://www.basic.northwestern.edu/biotools/oligocalc.htmlhttp://www.qiagen.com/

37

80. Tomaso, H., et al., Comparison of commercial DNA preparation kits for the detection of Brucellae in tissue using quantitative real-time PCR. BMC Infectious Diseases, 2010. 10(100): p. 1-5.

81. Winchell, J.M., et al., Rapid Identification and Discrimination of Brucella Isolates by Use of Real-Time PCR and High-Resolution Melt Analysis. Journal of Clinical Microbiology, 2010. 48(3): p. 697-702.

82. Queipo-Ortuno, M.I., et al., Comparison of seven commercial DNA extraction kits for the recovery of Brucella DNA from spiked Human serum samples using real-time PCR. Eur J Clin Microbiol Infect Dis, 2008. 27: p. 109-114.

83. Tarze, A., et al., GAPDH, a Novel Regulator of the Pro-Apoptotic Mitochondrial Membrane permeabilization. Oncogene, 2007. 26(18): p. 2606-2620.

84. Livak, K.J. and T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 22DDCT Method. Methods, 2001. 25: p. 402-408.

85. BIO-RAD. Relative Quantification Normalized Against a Reference Gene. 2012 [cited; Available from: http://www3.bio-rad.com/B2B/vanity/gexp/content.do?language=English?language=English&ccatoid=-36539&pcatoid=-35468&com.broadvision.session.new=Yes&root=%2fProduct+Family%2fGX%2fHome&country=US#livak.

86. Jiang, X., et al., Macrophage Control of Brucella abortus: Role of Reactive Oxygen Intermediates and Nitric Oxide. Cellular Immunology, 1993. 151: p. 309-319.

87. Trapnell, C., et al., Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nature Protocols, 2012. 7(3): p. 562-578.

88. Greenbaum, D.O.V., et al., Comparing protein abundance and mRNA expression levels on a genomic scale. Genome Biology, 2003. 4(9).

89. Kohler S, F.V., Ouahrani-Bettache S, Bourg G, Teyssier J, Ramuz M, Liautard J.P., The analysis of the intramacrophagic virulome of Brucella suis deciphers the enviroment encountered by the pathogen inside the macrophage host cell. Proc Natl Acad Sci USA, 2002. 99(24): p. 15711-15716.

http://www3.bio-rad.com/B2B/vanity/gexp/content.do?language=English?language=English&ccatoid=-36539&pcatoid=-35468&com.broadvision.session.new=Yes&root=%2fProduct+Family%2fGX%2fHome&country=US#livakhttp://www3.bio-rad.com/B2B/vanity/gexp/content.do?language=English?language=English&ccatoid=-36539&pcatoid=-35468&com.broadvision.session.new=Yes&root=%2fProduct+Family%2fGX%2fHome&country=US#livakhttp://www3.bio-rad.com/B2B/vanity/gexp/content.do?language=English?language=English&ccatoid=-36539&pcatoid=-35468&com.broadvision.session.new=Yes&root=%2fProduct+Family%2fGX%2fHome&country=US#livakhttp://www3.bio-rad.com/B2B/vanity/gexp/content.do?language=English?language=English&ccatoid=-36539&pcatoid=-35468&com.broadvision.session.new=Yes&root=%2fProduct+Family%2fGX%2fHome&country=US#livakhttp://www3.bio-rad.com/B2B/vanity/gexp/content.do?language=English?language=English&ccatoid=-36539&pcatoid=-35468&com.broadvision.session.new=Yes&root=%2fProduct+Family%2fGX%2fHome&country=US#livak