Article No. jmbi.1999.3441 available online at http://www.idealibrary.com on J. Mol. Biol. (2000) 296, 1±5

COMMUNICATION

Lead is Unusually Effective in Sequence-specificFolding of DNA

Ivan Smirnov and Richard H. Shafer*

Department of PharmaceuticalChemistry, School of PharmacyUniversity of California at SanFrancisco, San Francisco, CA94143-0446, USA

E-mail address of the correspondshafer@socrates.ucsf.edu

Abbreviations used: CD, circularthrombin aptamer sequence d(GGTTOCSY, total correlation spectroscoOverhauser effect spectroscopy.

0022-2836/00/60001±5 $35.00/0

DNA quadruplex structures based on the guanine quartet are typicallystabilized by monovalent cations such as K�, Na�, or NH�3 . Certain diva-lent cations can also induce quadruplex formation, such as Sr2�. Here weshow that Pb2� binds with unusually high af®nity to the thrombin bind-ing aptamer, d(GGTTGGTGTGGTTGG), inducing a unimolecular foldedstructure. At micromolar concentrations the binding is stoichiometric,and a single lead cation suf®ces to fold the aptamer. The lead-inducedchanges in UV and CD spectra are characteristic of folded quadruplexes,although the long wavelength CD maximum occurs at 312 nm ratherthan the typical value of 293 nm. The one-dimensional exchangeable pro-ton NMR spectrum shows resonances expected for imino protonsinvolved in guanine quartet base-pairing. Furthermore, two-dimensionalNMR experiments reveal NOE contacts typically seen in folded structuresformed by guanine quartets, such as the K� form of the thrombin apta-mer. Only sequences capable of forming guanine quartets appear to bindPb�2 tightly and change conformation. This sequence-speci®c, tight DNAbinding may be relevant to possible genotoxic effects of lead in theenvironment.

# 2000 Academic Press

Keywords: lead cation; DNA quadruplex stabilization

*Corresponding author

Introduction

Both DNA and RNA are capable of formingstructures based on the guanine quartet. Thesequadruplex structures typically require runs ofguanine on four separate strands, which canassociate into linear quadruplexes, or repeats ofseveral guanine bases, separated by thymine, forexample, which can fold into bimolecular or uni-molecular structures (Williamson, 1993, 1994).DNA quadruplexes may play a role in a variety ofbiological processes. For example, the ends of line-ar chromosomes, or telomeres, are composed ofmany repeats of sequences such as T4G4 or T2AG3,resulting in tracts capable of folding, unimolecu-larly into guanine quadruplex structures(Blackburn, 1991; Blackburn & Greider, 1995). Suchunimolecular structures are often observed in DNA

ing author:

dichroism; TBA, theTGGTGTGGTTGG);py; NOESY, nuclear

aptamers, which are oligonucleotide sequencesidenti®ed by in vitro selection, or SELEX, tech-niques as having high af®nity for a particular tar-get (Ellington & Szostak, 1990; Tuerk & Gold,1990). These aptamers may be useful in pharma-ceutical applications. In addition, certain DNA tri-plet repeat diseases involve sequences that canform unusual structures based on guanine quartets(Pearson & Sinden, 1998).

Formation of guanine quadruplex structuresrequires the presence of certain metal cations, oftenmonovalent species such as K� or Na�, which donot usually bind speci®cally to nucleic acid struc-tures (Guschlbauer et al., 1990). While other cationshave been shown to stabilize quadruplexes, suchas NH4

� (Hud et al., 1998; Nagesh & Chatterji,1995) and Sr2� (Chen, 1992; Guschlbauer et al.,1990; Nagesh & Chatterji, 1995) it has long beenthought that K� is the most effective biologicallyavailable cation in this regard. This has been attrib-uted to properties such as ionic radius(Guschlbauer et al., 1990) as well as hydrationeffects (Hud et al., 1996). Here we show that Pb2�

is signi®cantly more potent than K� at inducingfolded DNA structures based on the thrombin

# 2000 Academic Press

2 Lead-stabilized DNA Aptamer

aptamer sequence (d(GGTTGGTGTGGTTGG),TBA) (Bock et al., 1992; Macaya et al., 1993; Wanget al., 1993), and does so with different stoichi-ometry than K�.

The effect of adding Pb(NO3)2 or KCl to a sol-ution of TBA can be followed by circular dichroism(CD) measurements, as displayed in Figure 1. Inthe absence of metal ion, the CD spectrum is ofrelatively low amplitude, characteristic of oligonu-cleotides possessing little or no structure. Additionof either metal ion results in a signi®cant change inthe CD spectra. The spectrum in the presence ofKCl is typical of folded quadruplexes stabilized byeither K� or Na�, exhibiting a long wavelengthmaximum near 293 nm (Lu et al., 1993; Williamson,1994). The results obtained with Pb(NO3)2 differ intwo signi®cant ways: (i) the long wavelength maxi-mum is shifted by almost 20 nm to 312 nm and (ii)

Figure 1. CD spectra of the thrombin aptamer in thepresence of (a) 0 (*), 2 (&), 4 (~) or 8 (}) mMPb(NO3)2 or (b) 0 (*), 15 (&), 60 (~) or 500 (}) mMKCl. DNA strand concentration is 7.5 mM in (a) and4 mM in (b) in 10 mM Tris-acetate (pH 6.8) at 15 �C.Lead concentrations were veri®ed by atomic absorptionspectroscopy.

much less Pb2� is needed to complete the tran-sition. This unusual CD spectrum was notobserved when Pb(NO3)2 was added to duplexesor other sequences incapable of forming foldedquadruplexes. A smaller, bathochromic shift in theCD peak for the folded quadruplex formed byd(G4T2G4T2G4T2G4) in the presence of Sr2� hasbeen reported (Chen, 1992). We have found thatSr2� is less effective than Ph2� but more effectivethan K� at folding TBA, and yields a CD maxi-mum positioned approximately midway betweenthat produced by Pb2� and K� (data not shown).

This high af®nity of Pb2� for TBA is illustratedin Figure 2, where it can be seen that the bindingof Pb2� is virtually stoichiometric under the con-ditions employed, while that of K� is much weak-er. The CD spectra of TBA stabilized by the twocations are similar at wavelengths below 275 nm.Further examination of Figure 2(a) reveals the stoi-chiometry of Pb2� binding to TBA to be 1:1, i.e.TBA contains a single, strong binding site involved

Figure 2. CD titration of the thrombin aptamer byaddition of KCl in buffer alone (a), Pb(NO3)2 in the pre-sence of 150 mM NaCl (b), or Pb(NO3)2 in buffer alone(c). Same conditions as in Figure 1. Note the differentscales for the R (metal:DNA ratio) axes. Continuous linein (b) is best ®t to a single binding site model, yieldinga binding constant of 1.5 � 106 Mÿ1.

Lead-stabilized DNA Aptamer 3

in quadruplex formation. We estimate the bindingconstant for Pb2� to TBA is �107 or greater in theabsence of other salt. Figure 2 also includes atitration with Pb2� in the presence of 150 mMNaCl, which yields a binding constant of 1.5 � 106

Mÿ1 under these conditions. This lead-inducedfolding is reversible in that addition of Li2EDTAyields a CD spectrum similar to that observed inTris alone, and subsequent addition of KCl resultsin the CD spectrum displayed in Figure 1(b) (datanot shown). Due to the substantially weaker bind-ing of K� to TBA, the titration curve is muchbroader and although it is dif®cult to extract thestoichiometry from such a curve, it is consistentwith the weaker binding of one or more potassiumcations. Indeed, NMR data have recently beenreported indicating that TBA requires the bindingof two potassium cations to form the completelyfolded quadruplex (Marathias & Bolton, 1999).

Although the CD spectrum of TBA in the pre-sence of Pb(NO3)2 is similar to that observed forTBA in the presence of KCl at wavelengths below275 nm, it differs substantially in the position ofthe long wavelength maximum. In order to pro-vide additional evidence for the presence of gua-nine quartets, several approaches were followed.In the presence of Pb(NO3)2, TBA exhibited a highelectrophoretic mobility in native polyacrylamidegels, consistent with a unimolecular, folded struc-ture (data not shown). More de®nitive structuraldata were obtained from one- and two-dimen-sional NMR experiments on TBA followingaddition of Pb(NO3)2 at a metal:TBA ratio of 1:1.The one-dimensional spectrum shown in Figure 3demonstrates the presence of exchangeable protonsin the chemical shift range characteristic of guaninequartet imino protons as well as exchangeable pro-tons from the loop residues (Macaya et al., 1993;Wang et al., 1993). Due to the presence of the leadcation, these chemical shifts differ somewhat fromthose reported in the presence of potassium(Schultze et al., 1994). These chemical shifts, alongwith the small linewidths, are typical of unimole-

Figure 3. Low®eld 600 MHz 1H NMR spectrum (90 %H2O/10 % 2H2O) of the thrombin aptamer (2.4 mMstrand) in the presence of 2.4 mM Pb(NO3)2 at 3 �C in10 mM Tris-acetate (pH 6.8). Spectrum was obtained in16 scans with 2.6 seconds recycle time with jump andreturn for solvent suppression.

cular, folded quadruplexes. Very little changeoccurs in the 1H spectrum upon addition of asecond equivalent of Pb(NO3)2, in agreement withthe CD titration, indicating that binding of a singlePb2� cation suf®ces to fold the oligonucleotide(data not shown).

Results from NOE experiments are shown inFigure 4, highlighting contacts between exchange-able and non-exchangeable protons, which arecharacteristic of guanine quartet formation. Forexample, within a quartet, the imino and aminoprotons of one base are in close proximity to theH8 proton of the adjacent base. Examples of NOEcross-peaks between such pairs of protons are illus-trated in Figure 4(a). NOE contacts between the T9methyl group and imino protons from G1, G6, G10and G15, which have been reported for TBA foldedin the presence of K� (Schultze et al., 1994; Wanget al., 1993), are shown in Figure 4(b). These con-tacts indicate that T9 is stacked over these fourguanines. Also shown in Figure 4(b) are contactsbetween the sugar protons of T4 and T13 withimino protons from a different set of guaninebases, G5 and G14, representing the second quar-tet. Similarly, in Figure 4(c), contacts can be seenbetween T4 and T13 methyl groups with the aro-matic protons of T3 and T12 as well as those fromG2 and G11. In the aromatic-H10 region, there aresequential contacts which yield an interruptedwalk identical to that described previously; allother signi®cant NOEs described previously(Macaya et al., 1993; Wang et al., 1993) are presentin our sample.

Several studies have appeared using analyticalmethods to examine the interaction of Pb2� withDNA. A laser Raman study of Pb2� binding to calfthymus DNA indicated that at a metal:phosphateratio of 1 there was little sign of deviation from theB conformation (Tajmir-Riahi et al., 1988). Electro-chemical studies on the binding of Pb2� to calf thy-mus DNA demonstrated DNA stabilization at lessthan one cation per phosphate while higher ratiosled to signi®cant destabilization (Swiatek &Gulanowski, 1990). These higher ratios resulted incompact DNA structures in the case of Pb2�, butnot for other metals, such as Mg2�, Mn2�, Cd2�

and Zn2�, suggesting that the Pb2�-DNA inter-action is speci®c and may affect the organization ofDNA structure in cells. Effects of Pb2� on the UVspectrum of the synthetic polynucleotide poly-(dGdC) �poly(dGdC) were observed to be coopera-tive in the range of 0.5 to 2 metal cation-to-DNAphosphate ratios (Rossetto & Nieboer, 1994),indicative of a conformational change attributed tobinding directly to DNA bases. The strength ofDNA binding for Pb2� was reported to be inter-mediate between stronger (e.g. Hg2� and Pd2�)and weaker (e.g. Al3� and Ce3�) binding cations.The results presented here demonstrate very tightbinding together with structure formation at con-siderably lower metal:phosphate ratios.

The toxicity of lead is well documented, includ-ing effects related to nucleic acid function (Dhar &

Figure 4. Results from a 600 MHz NOESY spectrum (300 ms mixing time) carried out in 90 % H2O/10 % 2H2O ona 1:1 Pb�2:aptamer sample (10 mM) in 10 mM deuterated Tris (pH 6.8), 1 �C using symmetrically shaped pulses forwater suppression (Smallcombe, 1993). Assignments were made based on TOCSY data (50 ms mixing time), NOESYdata collected at three mixing times and the very strong similarity in the pattern of cross-peaks to that reported forthe aptamer in the presence of K� (Schultze et al., 1994; Wang et al., 1993) and are completely self-consistent. Cross-peaks are labeled by their nucleosides, according to the scheme d(G1G2T3T4G5G6T7G8T9G10G11T12T13G14G15). (a)Region showing contacts between guanine H8 protons and H1 (imino) or H21 (hydrogen-bonded amino) protons. (b)Region showing contacts between T9 methyl group and four imino protons, along with contacts between H20/H200sugar protons, indicated by 0, and imino protons. (c) Region showing contacts between the methyl groups of T4/T13and their own H6 protons, the H6 protons of T3/T12 and the H8 protons of G2/G11.

4 Lead-stabilized DNA Aptamer

Banerjee, 1983; Gerber et al., 1980; Hitzfeld et al.,1989; Johnson, 1998). Here we have shown thatsequence-speci®c binding of Pb2� to single-stranded DNA induces a major conformationalchange, resulting in a folded structure. A combi-nation of CD and NMR data provides compellingevidence that this structure is not only based onguanine quartets, but also closely resembles thatdescribed for TBA in the presence of K�. Thisstable, metal-induced DNA folding contrasts shar-ply with the well-known hydrolysis of RNA bylead (Farkas, 1968; Farkas et al., 1972; Pan et al.,1994). Although most cellular DNA exists in thedouble-helical form, this phenomenon may be ofimportance in telomere regions or in slipped DNAstructures involved in certain triplet repeat dis-eases. Examples of the latter include fragile X syn-drome involving expansion of CGG repeats, whichpossess the potential for folding into unimolecularquadruplex. structures (Usdin & Woodford, 1995).

In summary, we have shown that the Pb2� cat-ion is extremely effective at binding to TBA andinducing it to fold unimolecularly. The unusually

long wavelength maximum in the resulting CDspectrum may re¯ect particularly strong coordi-nation of the metal to the bases. We have observedsimilar behavior upon addition of Pb(NO3)2 to oli-gonucleotide sequences related to TBA as well asto the human telomere repeat oligonucleotide,d(AGGGTTAGGGTTAGGGTTAGGG). In contrast,this unusually strong binding was not seen witholigonucleotides that form hairpin dimer quadru-plexes. Additional studies are underway to charac-terize this interaction further and to locate theposition of the tightly bound cation in the foldedstructure. The ability of Pb2� to bind tightly to cer-tain DNA sequences may be important in under-standing its genotoxic effects.

Acknowledgments

We thank Dr N. Ulyanov, UCSF, for assistance withthe 1H NMR measurements and Dr Graham Bench,Lawrence Livermore National Laboratory, for makingatomic absorption measurements. This work was sup-

Lead-stabilized DNA Aptamer 5

ported by NIH grant AI39152. We also acknowledge theComputer Graphics Laboratory at the University ofCalifornia, San Francisco for the use of their facilities,supported by grant RR01081 from the Division ofResearch Resources, National Institutes of Health.

References

Blackburn, E. H. (1991). Structure and function of telo-meres. Nature, 350, 569-573.

Blackburn, E. H. & Greider, C. W. (1995). Telomeres. ColdSprings Harbor Monograph, Cold Spring Harbor Lab-oratory Press, Plainview, New York.

Bock, L. C., Grif®n, L. C., Latham, J. A., Vermaas, E. H.& Toole, J. J. (1992). Selection of single-strandedDNA molecules that bind and inhibit humanthrombin. Nature, 355, 564-566.

Chen, F. M. (1992). Sr2� facilitates intermolecular G-quadruplex formation of telomeric sequences. Bio-chemistry, 31, 3769-3776.

Dhar, A. & Banerjee, P. K. (1983). Impact of lead onnucleic acids and incorporation of labelled aminoacid into protein. Int. J. Vitam. Nutr. Res. 53, 349-354.

Ellington, A. D. & Szostak, J. W. (1990). In vitro selectionof RNA molecules that bind speci®c ligands. Nature,346, 818-822.

Farkas, W. R. (1968). Depolymerization of ribonucleicacid by plumbous ion. Biochim. Biophys. Acta, 155,401-409.

Farkas, W. R., Hewins, S. & Welch, J. W. (1972). Effectsof plumbous ion on some functions of transferRNA. Chem. Biol. Interact. 5, 191-200.

Gerber, G. B., Leonard, A. & Jacquet, P. (1980). Toxicity,mutagenicity and teratogenicity of lead. Mutat. Res.76, 115-141.

Guschlbauer, W., Chantot, J. F. & Thiele, D. (1990). 4-Stranded nucleic acid structures 25 years later-fromguanosine gels to telomere DNA. J. Biomol. Struct.Dynam. 8, 491-511.

Hitzfeld, B., Planas-Bohne, F. & Taylor, D. (1989). Theeffect of lead on protein and DNA metabolism ofnormal and lead- adapted rat kidney cells in cul-ture. Biol. Trace Elem. Res. 21, 87-95.

Hud, N. V., Smith, F. W., Anet, F. A. & Feigon, J.(1996). The selectivity for K� versus Na� in DNAquadruplexes is dominated by relative free energiesof hydration: a thermodynamic analysis by 1HNMR. Biochemistry, 35, 15383-15390.

Hud, N. V., Schultze, P. & Feigon, J. (1998). Ammoniumion as an NMR probe for monovalent cation coordi-nation sites of DNA quadruplexes. J. Am. Chem.Soc. 120, 6403-6404.

Johnson, F. M. (1998). The genetic effects of environmen-tal lead. Mutat. Res. 410, 123-140.

Lu, M., Guo, Q. & Kallenbach, N. R. (1993). Thermodyn-amics of G-tetraplex formation by telomeric DNAs.Biochemistry, 32, 598-601.

Macaya, R. F., Schultze, P., Smith, F. W., Roe, J. A. &Feigon, J. (1993). Thrombin-binding DNA antamerforms a unimolecular quadruplex structure in sol-ution. Proc. Natl Acad. Sci. USA, 90, 3745-3749.

Marathias, V. M. & Bolton, P. H. (1999). Determinantsof DNA quadruplex structural type: sequence andpotassium binding. Biochemistry, 38, 4355-4364.

Nagesh, N. & Chatterji, D. (1995). Ammonium ion atlow concentration stabilizes the G-quadruplex for-mation by telomeric sequence. J. Biochem. Biophys.Methods, 30, 1-8.

Pan, T., Dichtl, B. & Uhlenbeck, O. C. (1994). Propertiesof an in vitro selected Pb2� cleavage motif. Biochem-istry, 33, 9561-9565.

Pearson, C. E. & Sinden, R. R. (1998). Trinucleotiderepeat DNA structures: dynamic mutations fromdynamic DNA. Curr. Opin. Struct. Biol. 8, 321-330.

Rossetto, F. E. & Nieboer, E. (1994). The interaction ofmetal ions with synthetic DNA-induction of confor-mational and structural transitions. J. Inorg. Biochem.54, 167-186.

Schultze, P., Macaya, R. F. & Feigon, J. (1994). Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG).J. Mol. Biol. 235, 1532-1547.

Smallcombe, S. H. (1993). Solvent suppression with sym-metrically-shifted pulses. J. Am. Chem. Soc. 115,4776-4785.

Swiatek, J. & Gulanowski, B. (1990). Some aspects oflead(II) DNA interactions. Acta Biochim. Pol. 37, 7-20.

Tajmir-Riahi, H. A., Langlais, M. & Savoie, R. (1988). Alaser Raman spectroscopic study of the interactionof calf-thymus DNA with Cu(II) and Pb(II) ions:metal ion binding and DNA conformationalchanges. Nucl. Acids Res. 16, 751-762.

Tuerk, C. & Gold, L. (1990). Systematic evolution ofligands by exponential enrichment - RNA ligandsto bacteriophage-t4 dna polymerase. Science, 249,505-510.

Usdin, K. & Woodford, K. J. (1995). CGG repeats associ-ated with DNA instability and chromosome fragi-lity form structures that block DNA synthesisin vitro. Nucl. Acids Res. 23, 4202-4209.

Wang, K. Y., McCurdy, S., Shea, R. G., Swaminathan, S.& Bolton, P. H. (1993). A DNA aptamer whichbinds to and inhibits thrombin exhibits a new struc-tural motif for DNA. Biochemistry, 32, 1899-1904.

Williamson, J. R. (1993). Guanine quartets. Curr. Opin.Struct. Biol. 3, 357-362.

Williamson, J. R. (1994). G-quartet structures in telo-meric DNA. Annu. Rev. Biophys. Biomol. Struct. 23,703-730.

Edited by I. Tinoco

(Received 26 August 1999; received in revised form 6 December 1999; accepted 6 December 1999)