GENETICS | INVESTIGATION

Lesion-Induced Mutation in the HyperthermophilicArchaeon Sulfolobus acidocaldarius and Its

Avoidance by the Y-Family DNA Polymerase DbhCynthia J. Sakofsky1 and Dennis W. Grogan2

Department of Biological Sciences, University of Cincinnati, Cincinnati, Ohio 45221-0006

ABSTRACT Hyperthermophilic archaea offer certain advantages as models of genome replication, and Sulfolobus Y-family poly-merases Dpo4 (S. solfataricus) and Dbh (S. acidocaldarius) have been studied intensively in vitro as biochemical and structural modelsof trans-lesion DNA synthesis (TLS). However, the genetic functions of these enzymes have not been determined in the native contextof living cells. We developed the first quantitative genetic assays of replication past defined DNA lesions and error-prone motifs inSulfolobus chromosomes and used them to measure the efficiency and accuracy of bypass in normal and dbh2 strains of Sulfolobusacidocaldarius. Oligonucleotide-mediated transformation allowed low levels of abasic-site bypass to be observed in S. acidocaldariusand demonstrated that the local sequence context affected bypass specificity; in addition, most erroneous TLS did not require Dbhfunction. Applying the technique to another common lesion, 7,8-dihydro-8-oxo-deoxyguanosine (8-oxo-dG), revealed an antimuta-genic role of Dbh. The efficiency and accuracy of replication past 8-oxo-dG was higher in the presence of Dbh, and up to 90% of theDbh-dependent events inserted dC. A third set of assays, based on phenotypic reversion, showed no effect of Dbh function onspontaneous 21 frameshifts in mononucleotide tracts in vivo, despite the extremely frequent slippage at these motifs documentedin vitro. Taken together, the results indicate that a primary genetic role of Dbh is to avoid mutations at 8-oxo-dG that occur when otherSulfolobus enzymes replicate past this lesion. The genetic evidence that Dbh is recruited to 8-oxo-dG raises questions regarding themechanism of recruitment, since Sulfolobus spp. have eukaryotic-like replisomes but no ubiquitin.

KEYWORDS trans-lesion DNA synthesis (TLS); abasic site; 7,8-dihydro-8-oxo-deoxyguanosine; oligonucleotide-mediated transformation

THE fact that DNA damage occurs in all living cells posesa threat to the accurate replication and partitioning of

their genomes. Cells counter this threat with an array ofdiverse damage-coping systems, some of which repair theDNA, whereas others enable replication to continue pastpersistent lesions. Lesion bypass, also termed “damage toler-ance,” can follow various alternatives, which are broadly dis-tinguished as error-free vs. error-prone (Lehmann et al.2007). The error-free pathways generally use recombination-associated functions to pair a strand, newly synthesized on

intact template, to the damaged DNA strand; the mecha-nisms for this include transient reversal of the replication forkand strand exchange at gaps left behind the fork (Sale 2012).These mechanisms bypass lesions accurately, although theycan promote other forms of genetic instability, such as ectopicrecombination between dispersed repeats (Izhar et al. 2013).

Error-prone mechanisms of lesion bypass, in contrast, usespecialized, trans-lesion synthesis (TLS) polymerases to con-tinue strand elongation using the damaged template; most ofthese enzymes belong to the Y family of DNA polymerases(Sale et al. 2012). Large catalytic sites, combined with theabsence of proofreading activity, allow these polymerases toinsert nucleotides opposite diverse DNA lesions, but also limitthe accuracy with which they replicate intact template (YangandWoodgate 2007; Pata 2010). This latter property createsa risk of mutagenesis, which is mitigated somewhat by otherfeatures of these enzymes, including low processivity anda bias toward insertion of the correct nucleotide oppositecertain DNA lesions (Jarosz et al. 2007). TLS polymerases

Copyright © 2015 by the Genetics Society of Americadoi: 10.1534/genetics.115.178566Manuscript received May 24, 2015; accepted for publication July 27, 2015; publishedEarly Online July 29, 2015.Supporting information is available online at www.genetics.org/lookup/suppl/doi:10.1534/genetics.115.178566/-/DC1.1Present address: Department of Biology, University of Iowa, Iowa City, IA 52242-1324.

2Corresponding author: Department of Biological Sciences, 614 Rieveschl Hall, CliftonCourt, Cincinnati, OH 45221-0006. E-mail: grogandw@ucmail.uc.edu

Genetics, Vol. 201, 513–523 October 2015 513

are nevertheless subject to mechanisms that limit their accessto template and coordinate TLS with other lesion-bypassstrategies. The potential complexity of this coordination,and its importance for achieving genetic stability, is illus-trated in human cells, which have an extensive repertoireof TLS polymerases (Waters et al. 2009).

Y-family DNA polymerases of hyperthermophilic archaeahave become valuable models for elucidating mechanisms ofTLS,due inpart to their favorable crystallizationproperties.Asthe third, deeply diverging, lineage of cellular organismsdistinct from bacteria and eukaryotes, archaea providea unique perspective on the diversity and evolution of DNAreplication and damage-coping mechanisms. The scheme ofDNA replication in archaea incorporates many eukaryoticfeatures but is simpler than that of eukaryotes (Ishino et al.2013). Archaeal replication origins are recognized by Cdc6/Orc1 homologs, and the replicative helicase is an MCM ho-molog that moves 39 to 59 on the leading-strand template(Barry and Bell 2006; Li et al. 2013). Two molecules ofa B-family polymerase, one for each arm of the fork, arecomplexed to corresponding rings of PCNA, which attach toarchaeal Replication Factor C and four GINS-like proteins toform a replisome (Li et al. 2013). Archaeal Okazaki fragmentsare short and are processed for ligation by a Fen1 homolog(Barry and Bell 2006; Li et al. 2013; O’Donnell et al. 2013;Raymann et al. 2014).

The systems bywhich archaea copewith DNA damage andreplication errors are less clear, however. Although severalhyperthermophilic archaea encode the components necessaryfor complete systems of base excision repair (BER), homolo-gous recombination, and TLS, all hyperthermophilic archaealack certain nucleotide excision repair and mismatch repair(MMR) proteins that are broadly conserved in other organ-isms, including mesophilic archaea (White and Grogan2008). For a few hyperthermophilic archaea, including Sul-folobus spp. (which grow optimally at �80� and pH 3), thefunctional properties of genome-maintenance systems havebeen investigated by genetic analyses. Homologous re-combination in S. acidocaldarius appears to rely heavilyon a short-patch, gene-conversion process that is not affectedby mismatches in the substrates and thus seems capable ofpromoting ectopic events (Grogan and Stengel 2008; Groganand Rockwood 2010; Rockwood et al. 2013).

Diverse DNA-damaging treatments induce mutation in Sul-folobus cells, providing functional evidence of error-prone TLS(Reilly andGrogan2002).Sulfolobus species eachhavea singleY-family polymerase; the enzyme from S. solfataricus (Dpo4)and its counterpart from S. acidocaldarius (Dbh) exhibit thelow fidelity typical of these enzymes, making them potentialsources of mutations. The S. acidocaldarius polymerase Dbhappears to be particularly mutagenic; when Dbh replicatedshort homopyrimidine tracts followed by G [i.e., 59G(Y)n tem-plate] in vitro, up to 50% of the extension products had single-nucleotide deletions within the tract (Potapova et al. 2002).

Despite the multiple threats to genome stability posed bygrowth temperatures that accelerate DNA damage, the pres-

ence of an error-prone DNA polymerase, the lack of MutS andMutL proteins, and promiscuous recombination, Sulfolobuscells achieve remarkably accurate genome replication. S.acidocaldarius, for example, exhibits an overall error rateper genome replication below that of most MMR-proficientmesophilic microorganisms (Grogan et al. 2001) and an in-traspecific sequence divergence far below that of S. islandicus(Mao and Grogan 2012a). The mechanistic basis of the ob-served replication fidelity remains unclear. In addition to theinability to identify certain repair genes in Sulfolobus genomes,the genetic consequences of unrepaired lesions and the specificroles played by TLS polymerases in determining these conse-quences have not been defined experimentally.

Two widely occurring DNA lesions—abasic, or “AP,” sitesand 7,8-dihydro-8-oxo-deoxyguanosine (8-oxo-dG)—areexpected to arise frequently in Sulfolobus chromosomes.The extremely high temperatures and mildly acidic condi-tions within actively dividing Sulfolobus cells (Meyer andSchäfer 1992) create abasic sites at high rates both directlyvia spontaneous depurination (Lindahl and Nyberg 1972)and indirectly via enzymatic removal of deaminated bases,which also form spontaneously at high temperatures (Lindahland Nyberg 1974). In vitro, chemically stabilized abasicsites impede Dbh progression (Gruz et al. 2001), and theresidual bypass that does occur tends to skip over the lesion,generating a21-bp deletion (Potapova et al. 2002). The cat-alytic properties of Dbh thus do not seem to implicate it spe-cifically in coping with unrepaired abasic sites in the S.acidocaldarius genome. Similarly, 8-oxo-dG forms in theDNA of all aerobes by spontaneous oxidation of guanine,which is predicted to be accelerated under aerobic conditionsby high temperature (Cadet et al. 1997). Unlike an abasicsite, 8-oxo-dG does not significantly alter the helical structureof DNA and does not block most polymerases (Freisingeret al. 2004), but its structure encourages insertion of dA, gen-erating G:C-to-T:A transversions (Hsu et al. 2004). In vitro,Dbh and Dpo4 preferentially insert dC opposite 8-oxo-dG(Gruz et al. 2001; Rechkoblit et al. 2006; Zang et al. 2006;Maxwell and Suo 2012); this predicts that these enzymeswould suppress transversion in vivo if recruited to 8-oxo-dGduring replication of Sulfolobus chromosomes. Consistentwith this prediction, disrupting the dbh gene (Saci_0554)resulted in increased rates of spontaneous G:C-to-T:A trans-versions in a chromosomal gene (pyrE) where forward muta-tions can be selected (Sakofsky et al. 2012).

The present study developed new genetic assays, based onexisting selections for loss or restoration of pyrE gene functionin S. acidocaldarius (Grogan and Stengel 2008), and usedthem to address two related questions: (i) What genetic con-sequences result from placing abasic sites and 8-oxo-dG inthe chromosome of an hyperthermophilic archaeon? and (ii)what roles do the Y-family polymerase and other DNA poly-merases of the organism play in determining these outcomes?The results provide evidence for lesion-specific recruitment ofa Y-family polymerase in archaea, mutagenesis by B-familySulfolobus polymerases, an influence of sequence context on

514 C. J. Sakofsky and D. W. Grogan

the accuracy of bypass, and avoidance of 8-oxo-dG-promotedmutation mediated by Dbh.

Materials and Methods

Strains and growth conditions

The strains and oligonucleotides used in this study are de-scribed in Supporting Information, Table S1, Table S2, andTable S3. S. acidocaldarius pyrE mutations were selected inwild-type and dbh2 backgrounds via spontaneous 5-fluoro-orotic acid resistance (Grogan and Gunsalus 1993), which issimilar to the selection of Saccharomyces cerevisiae ura3mutants (Boeke et al. 1984). Mutants were confirmed phe-notypically by pyrimidine auxotrophy, and the identity of themutation was confirmed by dye-terminator sequencing ofPCR products of the pyrE gene. Pyr2 strains were grown onxylose–tryptone (XT) medium supplemented with uracil (20mg/liter) (Grogan and Gunsalus 1993). Pyr+ revertants ortransformants were selected by plating on solid XT mediumlacking uracil. For genotyping, Pyr+ transformants were clon-ally purified on selective plates, followed by growth in liquidculture and extraction of genomic DNA.

Genetic assays

Rates of reversionweremeasured by fluctuation assays of 16–20 independent cultures (0.2 ml each), grown from inoculaof�104 cells to a final size of�108 cells. The average numberof viable cells per culture was determined by dilution andplating on nonselective medium, and the number of Pyr+

revertants was determined individually for each culture byharvesting the entire culture and plating on selectivemedium(xylose–tryptone without uracil). The rate of mutation wascalculated using the Ma–Sandri–Sarkar maximum-likelihoodestimator via the FALCOR web interface (Hall et al. 2009).

To analyze TLS, isogenic pairs of dbh+ and dbh2 strainswere prepared in which each strain contained a nonsynony-mous base-pair substitution (BPS) inactivating the pyrE genenext to a synonymous site in the coding sequence. Threealleles in the S. acidocaldarius pyrE gene satisfied these crite-ria andwere used in the study (Figure 1, E–G); a fourth site ina heterologous pyrE gene (S. solfataricus) was used to eval-uate 8-oxo-dG bypass only (Figure 1, H and I). Correspond-ing sets of commercially synthesized, single stranded (ss)oligonucleotides (Table S2) were prepared as 10- or 20-mMstock solutions and were electroporated into recipient cells aspreviously described (Grogan and Stengel 2008). All fourbases at the query sites were confirmed to yield transform-ants; a strand bias favoring transformation by antisense oli-gonucleotides, corresponding to that observed for other pyrEalleles (Grogan and Stengel 2008), was also confirmed(Table S4).

Except for the assays depicted in Figure 1, H and I, lesion-bearing oligonucleotides electroporated into pyrE recipientscarried a centrally located abasic site or 8-oxo-dG residuedirectly adjacent to the nucleotide used for selection (Table

S2). The abasic site was a tetrahydrofuran (THF) spacer in-corporated by synthesis (Integrated DNATechnologies, Cor-alville, IA). Oligonucleotides containing 8-oxo-dG lesionswere synthesized and purified by HPLC at the University ofUtah DNA/Peptide Core Facility.

To identify the outcome of bypass events, genomic DNAwas extracted from clonally purified transformants, and the S.acidocaldarius pyrE region was amplified by PCR (Table S4).The appropriate synonymous site within pyrE was thenscored by ligase chain reaction (LCR) (Wiedmann et al.1994) using the pyrE PCR product as template as follows. Aset of four upstream oligonucleotides were probed for each ofthe four nucleotides at the site of the lesion, and four corre-sponding LCR reactions were completed for each recombi-nant (Table S3). The ligation product was detected byanalyzing a melting curve from 65� to 95� of the DNA uponcompletion of the LCR cycles. All transformants were con-firmed to yield product in one, but only one, of the fournucleotide-specific LCR reactions.

AP endonuclease assays

S. acidocaldarius cells were suspended in 50 mM potassium2-(N-morpholino)ethanesulfonate (MES, pH 6.3) and dis-rupted by sonication; the resulting extracts were clarifiedby centrifugation (10 min, 13,000 3 g) and stored frozenuntil use. Each assay contained 5 ml extract (27 mg protein),40 pmol fluorescein-labeled oligonucleotide (59-FAM), 50mM MES buffer (as above), and 2 mM MgSO4. Sequencesof the substrate oligonucleotides are given in Table S3. Du-plex substrates were formed by annealing a fluorescently la-beled ssDNA with a 20% excess of unlabeled complement.

Reactions were started by adding cell extract to the chilledmixture, followedbymixingand immediate incubationat 70�.Reactions were stopped by rapid cooling to 25� and adding anequal volume of 90% formamide–50 mM EDTA, followed byheating 5 min at 100�. To detect strand scission products, theentire assay mixture was electrophoresed in a 15% polyacryl-amide gel containing 7 M urea in TE buffer. Electrophoresisstandards consisted of unmodified fluorescent oligonucleo-tide, combined with the cleavage product generated by treat-ment of the corresponding dU-containing oligonucleotidewith Escherichia coli endonuclease III (New England Biolabs)at 37� for 30 min, followed by chemical cleavage with piper-idine (90�, 30 min).

Quantitative analyses

Transformation efficiencies of oligonucleotides carrying aba-sic or 8-oxo-dG lesions are reported as medians in Dbh+ andDbh2 backgrounds and were calculated based on a minimumof six independent experiments. Statistical comparisons be-tween transformation efficiencies of damaged DNA intoDbh+ and Dbh2 at each nucleotide position were performedusing the Mann–Whitney U-test. Chi-square analyses wereused to determine statistical differences between the distri-butions of nucleotides at the query site; Yate’s correction wasused where appropriate. Frequencies of nucleotides at the

TLS in Hyperthermophilic Archaea 515

query positions of the S. acidocaldarius pyrE gene were cor-rected by subtracting the background reversion frequenciesfor the corresponding recipient strain.

Data availability

Strains described in this study are available from DWG onrequest. Supporting Information includes Table S1 (S. acid-ocaldarius strains used in this study), Table S2 (Oligonucleo-tides used in transformations), Table S3 (Oligonucleotidesused for analyses in vitro), Table S4 (Efficiencies of trans-formation by undamaged oligonucleotides carrying a non-native base at the target position) and File S1 (Assays of APendonuclease activity in S. acidocaldarius cell extract).

Results

Molecular assays of TLS in the Sulfolobus chromosome

Oligonucleotide-mediated transformation (OMT) methodshave been used to analyze the fate of DNA lesions at specificsites in yeast and bacterial chromosomes. In this approach,incorporation of a lesion-containing DNA is selected by res-toration or alteration of a chromosomal gene, and individualbypass events are documented by sequencing the region(Otsuka et al. 2002; Kroeger et al. 2004; Weiss 2008;Rodriguez et al.2013). Theproperties ofOMT inS. acidocaldarius(Kurosawa andGrogan 2005; Grogan and Stengel 2008;Maoand Grogan 2012b) suggested the feasibility of correspond-ing genetic assays that would enable both accurate and erro-

neous bypass events to be analyzed in vivo. In the method wedeveloped for Sulfolobus (Figure 1), a synthetic ssDNArestores the wild-type sequence at the site of a chromo-somal pyrEmutation that inactivates the encoded uridine 59-monophosphate-biosynthetic enzyme (orotate:phosphoribosyltransferase). If the oligonucleotide is incorporated into thechromosome and replicated, the recipient cell gains the abil-ity to grow in medium lacking uracil. A synonymous siteadjacent to the selected nucleotide in the transformingDNA contains the DNA lesion to be evaluated (Figure 1,A and B). Any base-pair substitution at this “query position”yields the same amino acid as in the wild type, so that pyrEgene function is restored, regardless of the base inserted op-posite the lesion at the first replication (Figure 1, C and D).

Eight S. acidocaldarius recipients, representing four allelesin a chromosomal pyrE gene (Figure 1, E–I), provided querysites in different positions and sequence contexts, thus allow-ing the generality of bypass patterns to be evaluated. Eachquery and selection site was also provided in both a Dbh+ andDbh2 background, allowing the function of Dbh to be evalu-ated independently at each site (Table S1). Control oligonu-cleotides confirmed that any base placed at the query sitesyielded transformants with high efficiency (Table S4). In ad-dition, phenotypic reversion (whether spontaneous or in-duced by the electroporation procedure) (Berkner andLipps 2008) was confirmed to be rare (Table 1), and thedistribution of nucleotides provided corrections for corre-sponding analyses of transformants (Table 2).

Figure 1 Transformation assays of TLS in theS. acidocaldarius chromosome. Diagrams A–D depictthe transfer of the lesion to the Sulfolobus chro-mosome by OMT and its subsequent bypass. Thetransforming ssDNA (A) represents the antisense(minus) strand of the S. acidocaldarius pyrE gene.Near its midpoint, one nucleotide (solid symbol)corrects a point mutation in the recipient cell, whilea DNA lesion replaces the adjacent nucleotide(“x”). This ssDNA is electroporated into recipientcells (B), where it anneals to a transient gap (Li et al.2003). The resulting heteroduplex (B) is then repli-cated (C), which requires some form of bypass ofthe DNA lesion. Replication produces two com-pleted chromosomes (i.e., sister chromatids) (D),but only daughter cells that retain the marker pro-vided by the transforming ssDNA generate a col-ony. The remaining panels show the centralsection of each transforming ssDNA (bottomstrand) opposite the recipient chromosome (topstrand); numbers indicate positions within thepyrE-coding sequence. (E–I) The mutant codon ofthe recipient is underlined, with the correspondingamino acid shown to the right in bracketed italictype; the corresponding WT codon provided by thetransforming DNA is given for the bottom strand.The selected nucleotide and query site (x) areshown in boldface type. (E–G) Sites in the pyrEgene of S. acidocaldarius. (H and I) The pyrE geneof S. solfataricus inserted into the S. acidocaldariuschromosome (see Table S1).

516 C. J. Sakofsky and D. W. Grogan

To enforce stringency in analyzing lesion bypass, the OMTassay (Figure 1) was designed to make transformation sensi-tive to both repair activities and polymerase blockage. Evenprecise removal of the lesion from the annealed oligonucle-otide by an endonuclease was expected to negate transfor-mation, because a 1-nt, 59 flap on the 39 side of the repair gapprovides a favorable substrate for removal by the SulfolobusFen1/XPG homolog (Horie et al. 2007; Hutton et al. 2008)but not for the highly selective Sulfolobus ligase (Lai et al.2002). We evaluated the feasibility of OMT as a probe oflesion bypass in Sulfolobus experimentally by placing a chem-ically stabilized abasic site (THF spacer) in three transform-ing oligonucleotides. Prior in vitro studies have shown thislesion to impede progression of the Y-family polymerase Dbhof S. acidocaldarius and its S. solfataricus counterpart Dpo4(Boudsocq et al. 2001, 2004; Gruz et al. 2001; Potapova et al.2002; Kokoska et al. 2003; Ling et al. 2004). In vivo, BERenzymes that act on ssDNA can also block OMT before therecombination step. Although THF spacers are not repairedby AP lyases (Kroeger et al. 2004), they are substrates for APendonucleases, which have been detected in archaea (Grassoand Tell 2014). To determine the relevance of these enzymesto OMT in S. acidocaldarius, we incubated fluorescently la-beled oligonucleotides with cell extracts andmonitored back-bone cleavage. The results confirmed that S. acidocaldariushas significant endonuclease activity on oligonucleotidescontaining a THF spacer (File S1). Under the assay condi-tions, the DNA backbone was cleaved more rapidly in duplexthan in single-stranded form, and the cleavage of dsDNAwasnot strongly influenced by the identity of the opposing base(File S1). In vivo, therefore, the observed repair activity couldbe expected to preclude OMT either before or after a trans-

forming oligonucleotide has annealed to its complement inthe recipient chromosome.

Genetic consequences of abasic sites

Consistent with all these properties, a THF spacer decreasedthe average transformant yield of the three oligonucleotidesby a factor of 200 to 700, yet the lowest observed frequenciesof transformation still remained nearly 10-fold higher thanphenotypic reversion (Table 1), suggesting that most of theselected clones were generated by some form of lesion by-pass. Identifying the nucleotide placed in the query site intransformants via LCR assays (see Materials and Methods)showed that the distributions of nucleotides placed oppositethe DNA lesion were nonrandom (P , 0.05 for expectedvalues of equal distribution of bases) and differed dramati-cally among the three sites tested (Table 2). The dominantoutcome at nucleotides 189 and 219 (A in the sense strand)maintained the base pair found at the query site in the re-cipient (Table 2). The pattern at these two sites thusremained formally consistent with three mechanistically dis-tinct alternatives: (i) single-nucleotide repair of the lesionthat preserved the selected nucleotide, (ii) error-free damagetolerance (typically due to strand-exchange processes), or(iii) TLS by one or more non-Dbh polymerases with a strongintrinsic bias toward insertion of dA. At the third site (bp348), neither (i) nor (ii) applied to the most common out-come, however, making the results more informative (Table2). At this position, fewer transformants retained the originalbase pair (reflecting either BER or error-free tolerance), andthe primary effect of Dbh was to decrease two erroneousinsertions (dA and dC; Table 3). The consistent recovery ofa nontemplated dA at position 348 is consistent with

Table 1 Effects of DNA lesions and Dbh function on overall efficiency of OMT

Transformation efficiency [median (range)]a Relative efficiencyb Effect of Dbhc

DNA lesion Position in pyrE Ddbh dbh+ Ddbh dbh+ Ratio P-value

None 189 1720 (196–2436) 1012 (227–1722) 100 100None 219 2280 (2120–2808) 1927 (1600–2790) 100 100None 348 547 (451–817) 692 (510–1918) 100 100None 443d 750 (317–1390) 484.5 (191–1200) 100 100Abasic site 189 9 (6–12) 5 (7–17) 0.52 0.49 0.94Abasic site 219 3 (1–5) 2 (1–5) 0.13 0.10 0.77Abasic site 348 3 (1–12) 1 (1–5) 0.55 0.14 0.25C duplicatione 443d 20 (7–41) 9 (6–34) 2.67 1.86 0.70 0.718-oxo-dG 189 38.5 (6–58) 45 (11–64) 2.24 4.45 1.99 0.0938-oxo-dG 219 23.5 (18–49) 133.5 (95–171) 1.03 6.93 6.73 0.0022*8-oxo-dG 348 14.5 (9–21) 29.5 (17–63) 2.65 4.26 1.61 0.045*8-oxo-dG 443d 6 (2–46) 18 (2–53) 0.80 3.72 4.64 0.0008*8-oxo-dG +Ce 443d 159 (62–376) 144 (41–389) 21.2 29.7 1.40 0.25a Transformants per electroporation, based on at least six independent experiments. Because the number of transformants did not correlate with amount of DNA perelectroporation over the ranges tested (20–100 pmol for normal ssDNAs and 50–200 pmol for lesion-containing ssDNAs), results were pooled for each combination of DNAand recipient strain.

b Calculated as 100 times the median transformation efficiency divided by the corresponding median for undamaged DNA in the same strain.c P-values for variation with Dbh status were from Mann–Whitney U-tests comparing transformant yields in Dbh2 and Dbh+ recipients, as corrected for differences intransformation efficiencies (by normalizing to the same cells transformed with undamaged DNA). Asterisks (*) denote statistical difference at the P , 0.05 level.

d This query position was in the pyrE sequence of S. solfataricus, used as a selectable cassette to construct S. acidocaldarius strains DG250 and DG251 (see Table S1).e The transforming DNAs contained an extra C between the query site and the selected nucleotide (see Results), thus requiring a 21 replication error for successfultransformation.

TLS in Hyperthermophilic Archaea 517

erroneous TLS but not error-free tolerance (Table 2 andTable 3). Furthermore, because this result was seen in Ddbhrecipients, it could be attributed to one or more of theB-family enzymes of S. acidocaldarius.

Genetic impact of 8-oxo-dG

Although replicative DNA polymerases can proceed past8-oxo-dG, they are prone to insert dA, which yields G:C-to-T:Atransversions. In contrast, certain Y-family polymerases, in-cluding E. coli DinB and human Pol k, insert dC opposite8-oxo-dG (Waters et al. 2009) and thus avoid thismutagenesis.To investigate whether Dbh plays the latter role in S. acid-ocaldarius, we repeated the OMT assay with oligonucleotidesthat placed 8-oxo-dG at the three pyrE locations used pre-viously. This lesion decreased genetic transformation relativeto undamaged DNAs, but the decrease (15- to 100-fold) wassmaller than that observed for abasic sites. Transformation byDNAs containing 8-oxo-dG at pyrE positions 219 and 348wassignificantly higher for Dbh+ recipients than for Dbh2, indi-cating that Dbh increased the overall success of strand incor-poration and replication (Table 1). In addition, the pattern ofnucleotide insertion opposite 8-oxo-dGwas distinct from thatobserved with abasic oligonucleotides, indicating that thesetransformants did not simply result from TLS past intermedi-ates formed during BER of 8-oxo-dG. In particular, insertionof dC was the most frequent outcome under all but one con-dition in Dbh+ cells (Table 2). Since none of the recipientshave C in the top strand at these sites, this result is consistentneither with repair nor error-free damage tolerance. Thespecificity of nucleotide insertion opposite 8-oxo-dG wasstrongly influenced by the functional status of Dbh at all tar-get positions within the pyrE gene (nucleotide 189, P ,0.0001; nucleotide 219, P , 0.0001; nucleotide 348, P =0.0032). The primary impact of functional Dbh was to in-crease the frequency of dC insertion opposite 8-oxo-dG. Thiswas accompanied by a decrease in insertion of dA (the nativenucleotide) at positions 189 and 219 (Table 3).

The strong bias toward insertion of dC opposite 8-oxo-dGcorrelated with Dbh function in three different contexts andconformed to the behavior predicted for accurate TLS. To testthe generality of this result, we evaluated a fourth set ofisogenic (Ddbh vs. dbh+) S. acidocaldarius recipients, whichplaced the selected nucleotide (defined by the pyrE muta-tion) on the 59 side of the lesion (Figure 1H) so thatpolymerases encountered 8-oxo-dG before the selectednucleotide. In further contrast to the previous assays, 1 bpseparated the selected and damaged sites, and the transform-ing oligonucleotide differed from the recipient at this inter-mediate position. This latter feature was designed to limit theefficiency of single-nucleotide repair of the lesion via BER andstrand-exchange processes, while providing a marker for anysuch events that did occur (Figure 1H). Normalized efficien-cies of transformation were similar to those of the previousTLS assays and were significantly elevated in the Dbh+ re-cipient (Table 1, entries for position 443). Correct insertion(dC opposite 8-oxo-dG) was about ninefold more frequent inDbh+ transformants than in Dbh2 transformants (Table 3).

No detectable contribution of Dbh to spontaneousframeshift mutation

In vitro, Dbh has a characteristic signature on undamagedtemplate, dominated by single-nucleotide deletions that areespecially frequent opposite 59G(Y)n motifs (Potapova et al.2002). Crystallography of putative intermediates, combinedwith single-nucleotide addition kinetics, indicate that thesedeletions occur when the nascent-strand terminus has ex-tended into the homopyrimidine tract of a G(Y)n template(Wilson and Pata 2008). The nascent strand realigns to ex-clude one of the template pyrimidines from the helix, andDbh extends these intermediates efficiently, particularly theone in which the extrahelical template pyrimidine is 3 bpback from the nascent-strand terminus (Wilson and Pata2008). The catalytic and structural data therefore predictthat about half of the Dbh molecules that gain access to

Table 2 Nucleotide specificity of lesion bypass

Ddbh dbh+

Positiona nb A (%) T (%) C (%) G (%) nb A (%) T (%) C (%) G (%)

Abasic 189 54 98 2 0 0 60 100 0 0 0219 60 98 2 0 0 54 96 2 2 0348 49 32c 38 5 25 49 22 30 2 46

8-oxo-dG 189 66 48 0 52 0 61 3 0 97 0219 69 36 0 63 1 63 2 0 98 0348 59 48c 26 24 2 62 29 13 56 2443d 15 0d 27 27 27 13 0d 0 69 15

The nucleotide found and the indicated position was identified by LCR (see Materials and Methods), except as noted below. Values for each base are the percentage ofoccurrence among the transformants. Boldface numerals indicate the native nucleotide at that position, i.e., the one that could be templated.a Nucleotide in the pyrE-coding sequence.b Number of transformants analyzed.c Values were corrected for the predicted contribution from spontaneous revertants in the indicated strain, as determined from DNA-less electroporation controls. Thiscorrection changed most entries �1% or less.

d The site and transforming oligonucleotides correspond to the pyrE gene of S. solfataricus (see Figure 1H). For these transformations, insertion of dA was precluded by theselection, whereas additional outcomes not listed in the table were possible. As a result, the transformants were scored by dideoxy sequencing of PCR products. The mostfrequent of the additional events not depicted in the table accounted for �13% of Ddbh and 8% of dbh+ transformants; this was a complex event yielding CTTCACAAA inthe coding strand, where the query site is underlined (see Figure 1H).

518 C. J. Sakofsky and D. W. Grogan

G(Y)n in vivo would relinquish back to the replicative poly-merase a substrate with a bulge several base pairs back fromthe 39 end. Such subterminal mismatches evade correction bypolymerase proofreading, which accounts for the pro-nounced length-dependence of mononucleotide-repeat in-stability seen in eukaryotic and bacterial cells and itsfurther enhancement by inactivation of postreplicationalMMR (Tran et al. 1997; Harfe and Jinks-Robertson 1999).

S. acidocaldarius appears to lack postreplicational MMRnaturally (White and Grogan 2008; Mao and Grogan2012b), and G(Y)n motifs are abundant in its chromosome.These two properties combine to argue that the S. acidocal-darius chromosome should be a particularly sensitive detec-tor of Dbh-mediated mutagenesis. At least two hotspots ofspontaneous frameshifts occur within the S. acidocaldariuspyrE gene (Grogan et al. 2001; Sakofsky et al. 2012). Onehotspot matches the Dbh deletogenic motif closely (59GCCCCC on the minus strand), whereas the other lacks thecharacteristic G (minus-strand 59 ATTTTTT). Both sites gen-erate approximately equal proportions of +1 and 21 frame-shifts in vivo (Grogan et al. 2001; Sakofsky et al. 2012),whereas purified Dbh makes 21 frameshifts almost exclu-sively (Potapova et al. 2002). Thus the deletogenic activityexhibited by Dbh on undamaged DNA in vitro is consistentwith some, but not all, of the observed properties of sponta-neous mutation at these sites.

To resolve thecontributionofDbhto thisprominent formofspontaneous mutation in S. acidocaldarius, we assembleda set of S. acidocaldarius pyrE mutants that allowed four fra-meshifts on homopyrimidine templates to be detected indi-vidually in both Dbh2 and Dbh+ backgrounds: (i) C added toGCCCC, (ii) T added to ATTTTT, (iii) C deleted fromGCCCCCC, or (iv) T deleted from ATTTTTTT (Table S1).Each of these events restored pyrE gene function and couldtherefore be measured by selecting revertants. This was donein side-by-side fluctuation assays that included multiplestrains with the same mutations to ensure that the only dif-ference between groups of cultures was the dbh genotype ofthe strains. Differences in the pyrE reversion rates for thecorresponding Dbh2 and Dbh+ strains could thus reveal the

contribution, if any, of the Dbh polymerase to the correspond-ing frameshift event.

Similar to the pattern observed in other systems (Tran et al.1997; Harfe and Jinks-Robertson 1999), the frameshift ratesgenerally increased with tract length (Table 4), but in everycase the rate measured in the dbh+ strain could not be dis-tinguished from that measured in the isogenic Ddbh strain.These assays therefore detected no contribution of Dbh tospontaneous frameshifts at motifs similar to those that it rep-licates with extremely high frameshift rates in vitro. This re-sult provided evidence that Dbh either does not havedeletogenic properties in vivo or normally does not gain ac-cess to this template during replication of the S. acidocaldar-ius chromosome.

A second test of Dbh-dependent21 events at G(Y)n motifswas designed to exploit the apparent specificity of Dbh for 8-oxo-dG in vivo (Table 1 and Table 2). We modified one of theOMT assays by designing two ssDNAs that contained an extranucleotide and thus required a 21-bp bypass event near theselected and query sites to generate transformants. One DNAcontained undamaged G at the query site, the other con-tained 8-oxo-dG (Figure 1I), and each was electroporatedinto corresponding isogenic Dbh+ and Dbh2 recipients. Con-sistent with the assay design, the undamaged oligonucleotideyielded Pyr+ clones at low efficiencies (Table 1), and all thetransformants examined contained intragenic suppressormutations in the form of 1-bp deletions uniformly distributedwithin �5 bp of the selected nucleotide. In all cases, thesedeletions occurred outside of the short homopyrimidine tractand thus did not represent the type of slipped-strand eventsmediated by Dbh in vitro (Potapova et al. 2002). Replacingthe G at the query site with 8-oxo-dG increased the yield oftransformants �10-fold, yielding a relative efficiency similarto that of in-frame OMT in both Dbh2 and Dbh+ recipients(Table 1). In addition, 15 of 16 transformants scored showedprecise deletion of the query position, not of a subsequentG:C base pair in the homopyrimidine tract. Thus, this assaydetected 8-oxo-dG-promoted 1-bp deletions in S. acidocaldar-ius that were both frequent and localized at a particular site,but not mediated by Dbh.

Table 3 Normalized frequencies of bypass events

dA insertion dT insertion dC insertion dG insertion

pyrE position Ddbh dbh+ Ratioa Ddbh dbh+ Ratioa Ddbh dbh+ Ratioa Ddbh dbh+ Ratioa

Abasic site 189 0.533 0.592 1.11 0.01 Und.b — Und.b Und.b — Und.b Und.b —

219 0.180 0.070 0.39 0.006 0.001 0.3 Und.b 0.001 — Und.b Und.b —

348 0.20 0.06 0.28 0.074 0.057 0.8 0.032 0.005 0.15 0.15 0.12 0.798-oxo-dG 189 1.0 0.1 0.12 Und.b Und.b — 1.11 3.91 3.52 Und.b Und.b —

219 0.29 0.07 0.22 Und.b Und.b — 0.90 6.47 7.19 Und.b Und.b —

348 1.4 1.3 0.97 0.18 0.34 1.8 0.71 2.5 3.5 0.050 0.08 2443c — — — 0.351 Und.b — 0.35 3.05 8.68 0.35 0.0068 1.9

Unless noted, numerical values are frequencies of the corresponding outcome, expressed as a percentage of the overall transformation efficiency of the correspondingundamaged oligonucleotide. Und., undetected; blanks indicate the corresponding outcome could not be selected, or the corresponding ratio could not be calculated.a Transformant yield in dbh+/yield in Ddbh, calculated to indicate the effect of Dbh function.b Events that were allowed by the selection but not detected (see Table 2).c Position in the pyrE gene of S. solfataricus (see Figure 1H).

TLS in Hyperthermophilic Archaea 519

Discussion

In archaea, DNA replication and responses to DNA damageoccur in the context of a relatively simple prokaryotic cell, yetthese processes involve proteins and othermolecular featureshomologous to those of eukaryotic cells, rather than bacteria(Ishino et al. 2013). This situation makes archaea strategicfor understanding the diversity and evolution of mechanismsthat preserve genome integrity, but the archaeal mechanismsremain largely unexplored in their cellular context. In partic-ular, despite extensive studies of SulfolobusDNA polymerasesin vitro, the contributions of Sulfolobus Y-family vs. B-familyDNA polymerases to mutagenesis by particular DNA lesionshave not been defined in molecular terms. The present studyis the first to investigate this question experimentally in vivo.

The genetic consequences ofDNA lesions transferred to theS. acidocaldarius chromosome differed as a function of DNAlesion, location within the gene sequence, and Dbh status(Table 2). Differences between the abasic-site and 8-oxo-dG patterns include a significant level of accurate bypass withlittle input from Dbh in the case of abasic sites vs. a strongdependence on Dbh for accurate bypass in the case of 8-oxo-dG.Both for abasic sites and 8-oxo-dG, the pattern of outcomesvaried with the location of the damage within the target gene.Although the accuracy of oligonucleotide synthesis may havecontributed to the site-specific differences, it does not accountfor the similarity seen for abasic and 8-oxo-dG oligonucleotidesat different sites and the differential impact of Dbh statusacross the sites (Table 2). The results thus suggest that S. acid-ocaldarius, and presumably other hyptherthermophilic ar-chaea, can use multiple mechanisms for lesion bypass andthat the identity of the lesion and its local sequence contextdetermine which mechanism predominates.

As depicted in the scheme of Figure 2, the most consistentand biologically significant function of the Y-family DNA po-lymerase Dbh evident in this studywas the avoidance of base-pair substitutions during replication past 8-oxo-dG. Dbhseems to be specialized in this respect; it did not contributeto TLS past abasic sites nor to spontaneous 21 events inframeshift hotspots. Both mutation avoidance at 8-oxo-dGand poor bypass of abasic sites are consistent with knownenzymological properties of Dbh (Gruz et al. 2001). In con-trast, the failure to promote 21 events at homo-pyrimidinetracts, which we documented in two distinct experimentalcontexts (normal growth and OMT), is not consistent with

the strong deletogenic propensity of Dbh demonstrated re-peatedly in vitro (Potapova et al. 2002; Wilson and Pata2008). The formal possibility remains that deletogenesis onintact template reflects some artifact of in vitro assays, butthis seems unlikely, as this property has been linked to spe-cific structural features of the polymerase (Boudsocq et al.2004; Pata 2010) and conformational dynamics of the tem-plate in the enzyme active site (Wilson and Pata 2008;Manjari et al. 2014). Conversely, deletogenesis seems unlikelyto bemasked in vivo by nonspecific factors, such as cytoplasmicsolutes or elevated temperature. Accordingly, we interpretthe irrelevance of Dbh to spontaneous frameshifts in the pyrEgene as genetic evidence that Dbh is normally prevented,with some specificity, from replicating undamaged DNA invivo. The extent to which Dbh promotes 1-nt deletions at per-sistent lesions in vivo remains unresolved, but the fact thatDbh function increases the rate of transformation by 8-oxo-dG-containing oligonucleotides argues that such lesion-triggereddeletions would be relatively rare. Since a frameshift nullifiesdetection of the TLS event in most of the assays used, anysuch21 events appear to be significantly outnumbered by in-frame TLS, for example.

Ironically, Dbh has been characterized biochemically as anextremely error-prone DNA polymerase, yet most of theerroneous bypass that we observed in S. acidocaldarius didnot respond to Dbh function. Sulfolobus spp. generally en-code four DNA polymerases: a replicative enzyme respon-sible for the bulk of DNA synthesis (B-family), a Y-family

Table 4 Rates of mononucleotide-repeat expansion and contraction at pyrE frameshift hotspots

(G:C)4 expansiona (A:T)5 expansiona (G:C)6 contractiona (A:T)7 contractiona

Rate (95% C.I.) Rate (95% C.I.) Rate (95% C.I.) Rate (95% C.I.)

Dbh2 2.6 (3.7–1.7) 1.5 (2.2–0.95) 33 (39–27) 43 (50–36)Dbh+ 2.3 (3.2–1.5) 1.8 (2.6–1.1) 32 (38–27 38 (45–32)

Values represent the number of the indicated mutational (i.e., pyrE reversion) events per 108 cell divisions. Each rate was measured using four sets of 15–20 independentcultures each (see Materials and Methods). Some of the pyrE mutations were represented by multiple strains (CS2.3 and CS2.5, for example; see Materials and Methods) asa means to control for any genetic differences that might have arisen during initial isolation. No differences in reversion rates between corresponding mutants were observed,however, so the data were pooled to yield the analyses shown above. C.I., confidence interval.a The base in the top (sense) strand is indicated first in each base pair.

Figure 2 Dbh and bypass of 8-oxo-dG. The diagram depicts the mostcommon responses to 8-oxo-dG (“oG” above) represented by bypassevents in normal and Dbh-deficient mutants of S. acidocaldarius. Individ-ual processes contributing to the bypass seen in dbh mutants were notresolved in this study and may include repair, error-free (recombinational)damage tolerance, or polymerase switching among B-family enzymes.

520 C. J. Sakofsky and D. W. Grogan

polymerase implicated in TLS, and two additional B-familyenzymes that remain relatively obscure. Biochemical studiesof the latter enzymes of S. solfataricus indicate limited affinityfor DNA substrate, limited processivity, and relatively lowrates of polymerization (Choi et al. 2011). More recently,the DNA primase of a distantly related hyperthermophilicarchaeon was reported to catalyze TLS in vitro (Jozwiakowskiet al. 2015). In vivo, we observed several distinct typesof mutagenesis by non-Dbh enzymes, including OMT-associated base substitution and single-base-pair deletion, andspontaneous frameshift mutation. The mechanism of the sec-ond mutagenic process has yet to be defined, but its efficiencyand specificity seems to pose an additional mutagenic threatto Sulfolobus genomes from 8-oxo-dG, which, to our knowl-edge, has not been predicted by other studies.

At the four sites that we evaluated, Dbhmediated 75–90%of the observed TLS past 8-oxo-dG, despite the ability of otherenzymes to perform bypass in its absence. This observationcomplements the evidence of Dbh exclusion from undam-aged template, indicating that some property favors Dbh overother alternative pathways in replicating 8-oxo-dG. Recruit-ment of TLS polymerases to unrepaired lesions is commonlyassociated with polymerase switching (Lehmann et al. 2007).Although this process occurs both in bacteria and in eukary-otic cells and involves corresponding replisome components(i.e., the sliding clamp), the bacterial and eukaryotic mecha-nisms differ dramatically. Bacterial polymerases appear tocompete for preferred binding sites on the dimeric b-clamp,where binding appears to be largely reversible, i.e., deter-mined by the relative concentrations of these enzymes(Friedberg et al. 2006; Lovett 2007; Andersson et al. 2010;Kath et al. 2014). In eukaryotes, however, different patternsof ubiquitination of the trimeric PCNA dictate which damage-tolerance pathways will be activated. A diversity of ubiquiti-nation patterns allows a range of distinct responses to bespecified; the possible choices encompass several TLS poly-merases and multiple error-free processes, including replica-tion-fork regression or Rad51-dependent strand exchange(Nick McElhinny et al. 2008; Yang et al. 2013).

The eukaryotic features of archaeal replisomes includetrimeric PCNAs instead of the dimeric b-clamps found in bac-teria. Since archaea encode no ubiquitin, however, it remainsunclear whether archaea switch DNA polymerases in re-sponse to covalent modification of their PCNA. Ubiquitinalternatives, with corresponding ligation systems, do occurin archaea, but they have been implicated so far only in otherprocesses, such as cofactor synthesis, transfer RNA modifica-tion, and proteolysis (Makarova and Koonin 2010). Con-versely, properties observed in vitro raise the possibility thatbiologically relevant switching could occur via passive ex-change among archaeal DNA polymerases, as has beenproposed for bacteria. For example, Dpo1, the replicativepolymerase of S. solfataricus, disengages from PCNA fre-quently (Bauer et al. 2013), and 8-oxo-dG in the templateblocks its progress, but increases the catalytic efficiency of theTLS polymerase Dpo4 (Maxwell and Suo 2012). In this con-

text, the present study demonstrates that genetic analysis ofTLS in S. acidocaldarius can provide important functional in-sight into mutation avoidance, polymerase recruitment, andother aspects of DNA damage tolerance modeled by theenzymes of hyperthermophilic archaea.

Acknowledgments

C.J.S. acknowledges Wieman-Wendel-Benedict awards fromthe Department of Biological Sciences, University of Cincin-nati. Initial stages of this work were supported by grant MCB0543910 from the National Science Foundation.

Literature Cited

Barry, E. R., and S. D. Bell, 2006 DNA replication in the archaea.Microbiol. Mol. Biol. Rev. 70: 876–887.

Bauer, R. J., I. D. Wolff, X. Zuo, H. K. Lin, and M. A. Trakselis,2013 Assembly and distributive action of an archaeal DNApolymerase holoenzyme. J. Mol. Biol. 425: 4820–4836.

Berkner, S., and G. Lipps, 2008 Mutation and reversion frequen-cies of different Sulfolobus species and strains. Extremophiles12: 263–270.

Boeke, J. D., F. LaCroute, and G. R. Fink, 1984 A positive selec-tion for mutants lacking orotidine-59-phosphate decarboxylaseactivity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen.Genet. 197: 345–346.

Boudsocq, F., S. Iwai, F. Hanaoka, and R. Woodgate,2001 Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4):an archaeal DinB-like DNA polymerase with lesion-bypass prop-erties akin to eukaryotic Pol eta. Nucleic Acids Res. 29: 4607–4616.

Boudsocq, F., R. J. Kokoska, B. S. Plosky, A. Vaisman, H. Ling et al.,2004 Investigating the role of the little finger domain ofY-family DNA polymerases in low fidelity synthesis and trans-lesion replication. J. Biol. Chem. 279: 32932–32940.

Cadet, J., M. Berger, T. Douki, and J. L. Ravanat, 1997 Oxidativedamage to DNA: formation, measurement, and biological signif-icance. Rev. Physiol. Biochem. Pharmacol. 131: 1–87.

Choi, J. Y., R. L. Eoff, M. G. Pence, J. Wang, M. V. Martin et al.,2011 Roles of the four DNA polymerases of the crenarchaeonSulfolobus solfataricus and accessory proteins in DNA replica-tion. J. Biol. Chem. 286: 31180–31193.

Freisinger, E., A. P. Grollman, H. Miller, and C. Kisker,2004 Lesion (in)tolerance reveals insights into DNA replica-tion fidelity. EMBO J. 23: 1494–1505.

Friedberg, E. C., A. R. Lehmann, and R. P. P. Fuchs, 2006 Tradingplaces: How do DNA polymerases switch during translesionDNA synthesis? Molec. Cell. 18: 499–505.

Grasso, S., and G. Tell, 2014 Base excision repair in archaea:back to the future in DNA repair. DNA Repair (Amst.) 21:148–157.

Grogan, D. W., and R. P. Gunsalus, 1993 Sulfolobus acidocaldariussynthesizes UMP via a standard de novo pathway: results ofbiochemical-genetic study. J. Bacteriol. 175: 1500–1507.

Grogan, D. W., and J. Rockwood, 2010 Discontinuity and limitedlinkage in the homologous recombination system of a hyperther-mophilic archaeon. J. Bacteriol. 192: 4660–4668.

Grogan, D. W., and K. R. Stengel, 2008 Recombination of syn-thetic oligonucleotides with prokaryotic chromosomes: sub-strate requirements of the Escherichia coli/lambdaRed andSulfolobus acidocaldarius recombination systems. Mol. Micro-biol. 69: 1255–1265.

TLS in Hyperthermophilic Archaea 521

Grogan, D. W., G. T. Carver, and J. W. Drake, 2001 Genetic fidel-ity under harsh conditions: analysis of spontaneous mutation inthe thermoacidophilic archaeon Sulfolobus acidocaldarius. Proc.Natl. Acad. Sci. USA 98: 7928–7933.

Gruz, P., F. M. Pisani, M. Shimizu, M. Yamada, I. Hayashi et al.,2001 Synthetic activity of Sulfolobus solfataricus DNA poly-merase Y1, an archaeal DinB-like DNA polymerase, is stimulatedby processivity factors proliferating cell nuclear antigen andreplication factor C. J. Biol. Chem. 276: 47394–47401.

Hall, B. M., C. X. Ma, P. Liang, and K. K. Singh, 2009 Fluctuationanalysis CalculatOR: a web tool for the determination of muta-tion rate using Luria-Delbruck fluctuation analysis. Bioinfor-matics 25: 1564–1565.

Harfe, B. D., and S. Jinks-Robertson, 1999 Removal of frameshiftintermediates by mismatch repair proteins in Saccharomyces cer-evisiae. Mol. Cell. Biol. 19: 4766–4773.

Horie, M., K. Fukui, M. Xie, Y. Kageyama, K. Hamada et al.,2007 The N-terminal region is important for the nuclease ac-tivity and thermostability of the flap endonuclease-1 from Sul-folobus tokodaii. Biosci. Biotechnol. Biochem. 71: 855–865.

Hsu, G. W., M. Ober, T. Carell, and L. S. Beese, 2004 Error-pronereplication of oxidatively damaged DNA by a high-fidelity DNApolymerase. Nature 431: 217–221.

Hutton, R. D., J. A. Roberts, J. C. Penedo, and M. F. White,2008 PCNA stimulates catalysis by structure-specific nucleasesusing two distinct mechanisms: substrate targeting and catalyticstep. Nucleic Acids Res. 36: 6720–6727.

Ishino, S., L. M. Kelman, Z. Kelman, and Y. Ishino, 2013 Thearchaeal DNA replication machinery: past, present and future.Genes Genet. Syst. 88: 315–319.

Izhar, L., O. Ziv, I. S. Cohen, N. E. Geacintov, and Z. Livneh,2013 Genomic assay reveals tolerance of DNA damage by bothtranslesion DNA synthesis and homology-dependent repair inmammalian cells. Proc. Natl. Acad. Sci. USA 110: E1462–E1469.

Jarosz, D. F., V. G. Godoy, and G. C. Walker, 2007 Proficient andaccurate bypass of persistent DNA lesions by DinB DNA poly-merases. Cell Cycle 6: 817–822.

Jozwiakowski, S. K., F. Borazjani Gholami, and A. J. Doherty,2015 Archaeal replicative primases can perform translesionDNA synthesis. Proc. Natl. Acad. Sci. USA 112: E633–E638.

Kath, J. E., S. Jergic, J. M. Heltzel, D. T. Jacob, N. E. Dixon et al.,2014 Polymerase exchange on single DNA molecules revealsprocessivity clamp control of translesion synthesis. Proc. Natl.Acad. Sci. USA 111: 7647–7652.

Kokoska, R. J., S. D. McCulloch, and T. A. Kunkel, 2003 Theefficiency and specificity of apurinic/apyrimidinic site bypassby human DNA polymerase eta and Sulfolobus solfataricusDpo4. J. Biol. Chem. 278: 50537–50545.

Kroeger, K. M., M. F. Goodman, and M. M. Greenberg, 2004 Acomprehensive comparison of DNA replication past 2-deoxyri-bose and its tetrahydrofuran analog in Escherichia coli. NucleicAcids Res. 32: 5480–5485.

Kurosawa, N., and D. W. Grogan, 2005 Homologous recombina-tion of exogenous DNA with the Sulfolobus acidocaldarius ge-nome: properties and uses. FEMS Microbiol. Lett. 253: 141–149.

Lai, X., H. Shao, F. Hao, and L. Huang, 2002 Biochemical charac-terization of an ATP-dependent DNA ligase from the hyperther-mophilic crenarchaeon Sulfolobus shibatae. Extremophiles 6:469–477.

Lehmann, A. R., A. Niimi, T. Ogi, S. Brown, S. Sabbioneda et al.,2007 Translesion synthesis: Y-family polymerases and the po-lymerase switch. DNA Repair (Amst.) 6: 891–899.

Li, X. T., N. Costantino, L. Y. Lu, D. P. Liu, R. M. Watt et al.,2003 Identification of factors influencing strand bias in oligo-nucleotide-mediated recombination in Escherichia coli. NucleicAcids Res. 31: 6674–6687.

Li, Z., L. M. Kelman, and Z. Kelman, 2013 Thermococcus kodakar-ensis DNA replication. Biochem. Soc. Trans. 41: 332–338.

Lindahl, T., and B. Nyberg, 1972 Rate of depurination of nativedeoxyribonucleic acid. Biochemistry 11: 3610–3618.

Lindahl, T., and B. Nyberg, 1974 Heat-induced deamination ofcytosine residues in deoxyribonucleic acid. Biochemistry 13:3405–3410.

Ling, H., F. Boudsocq, R. Woodgate, andW. Yang, 2004 Snapshots ofreplication through an abasic lesion: structural basis for base sub-stitutions and frameshifts. Mol. Cell 13: 751–762.

Lovett, S. T., 2007 Polymerase switching in DNA replication. Mol.Cell 27: 523–526.

Makarova, K. S., and E. V. Koonin, 2010 Archaeal ubiquitin-likeproteins: functional versatility and putative ancestral involve-ment in tRNA modification revealed by comparative genomicanalysis. Archaea 2010: pii: 710303.

Manjari, S. R., J. D. Pata, and N. K. Banavali, 2014 Cytosine un-stacking and strand slippage at an insertion-deletion mutationsequence in an overhang-containing DNA duplex. Biochemistry53: 3807–3816.

Mao, D., and D. Grogan, 2012a Genomic evidence of rapid, global-scale gene flow in a Sulfolobus species. ISME J. 6: 1613–1616.

Mao, D., and D. W. Grogan, 2012b Heteroduplex formation, mis-match resolution, and genetic sectoring during homologous re-combination in the hyperthermophilic archaeon Sulfolobusacidocaldarius. Front. Microbiol. 3: 192.

Maxwell, B. A., and Z. Suo, 2012 Kinetic basis for the differingresponse to an oxidative lesion by a replicative and a lesionbypass DNA polymerase from Solfolobus solfataricus. Biochem-istry 51: 3485–3496.

Meyer, W., and G. Schafer, 1992 Characterization and purificationof a membrane-bound archaebacterial pyrophosphatase fromSulfolobus acidocaldarius. Eur. J. Biochem. 207: 741–746.

Nick McElhinny, S. A., D. A. Gordenin, C. M. Stith, P. M. Burgers,and T. A. Kunkel, 2008 Division of labor at the eukaryoticreplication fork. Mol. Cell 30: 137–144.

O’Donnell, M., L. Langston, and B. Stillman, 2013 Principles andconcepts of DNA replication in bacteria, archaea, and eukarya.Cold Spring Harb. Perspect. Biol. 5: pii: a010108.

Otsuka, C., K. Kobayashi, N. Kawaguchi, N. Kunitomi, K. Moriyamaet al., 2002 Use of yeast transformation by oligonucleotides tostudy DNA lesion bypass in vivo. Mutat. Res. 502: 53–60.

Pata, J. D., 2010 Structural diversity of the Y-family DNA poly-merases. Biochim. Biophys. Acta 1804: 1124–1135.

Potapova, O., N. D. Grindley, and C. M. Joyce, 2002 The muta-tional specificity of the dbh lesion bypass polymerase and itsimplications. J. Biol. Chem. 277: 28157–28166.

Raymann, K., P. Forterre, C. Brochier-Armanet, and S. Gribaldo,2014 Global phylogenomic analysis disentangles the complexevolutionary history of DNA replication in archaea. GenomeBiol. Evol. 6: 192–212.

Rechkoblit, O., L. Malinina, Y. Cheng, V. Kuryavyi, S. Broyde et al.,2006 Stepwise translocation of Dpo4 polymerase during error-free bypass of an oxoG lesion. PLoS Biol. 4: e11.

Reilly, M. S., and D. W. Grogan, 2002 Biological effects of DNAdamage in the hyperthermophilic archaeon Sulfolobus acidocal-darius. FEMS Microbiol. Lett. 208: 29–34.

Rockwood, J., D. Mao, and D. W. Grogan, 2013 Homologous re-combination in the archaeon Sulfolobus acidocaldarius: effects ofDNA substrates and mechanistic implications. Microbiology159: 1888–1899.

Rodriguez, G. P., J. B. Song, and G. F. Crouse, 2013 In vivo bypassof 8-oxodG. PLoS Genet. 9: e1003682.

Sakofsky, C. J., P. L. Foster, and D. W. Grogan, 2012 Roles of theY-family DNA polymerase Dbh in accurate replication of theSulfolobus genome at high temperature. DNA Repair (Amst.)11: 391–400.

522 C. J. Sakofsky and D. W. Grogan

Sale, J. E., 2012 Competition, collaboration and coordination:determining how cells bypass DNA damage. J. Cell Sci. 125:1633–1643.

Sale, J. E., A. R. Lehmann, and R. Woodgate, 2012 Y-family DNApolymerases and their role in tolerance of cellular DNA damage.Nat. Rev. Mol. Cell Biol. 13: 141–152.

Tran, H. T., J. D. Keen, M. Kricker, M. A. Resnick, and D. A.Gordenin, 1997 Hypermutability of homonucleotide runs inmismatch repair and DNA polymerase proofreading yeast mu-tants. Mol. Cell. Biol. 17: 2859–2865.

Waters, L. S., B. K. Minesinger, M. E. Wiltrout, S. D’Souza, R. V.Woodruff et al., 2009 Eukaryotic translesion polymerases andtheir roles and regulation in DNA damage tolerance. Microbiol.Mol. Biol. Rev. 73: 134–154.

Weiss, B., 2008 Removal of deoxyinosine from the Escherichia colichromosome as studied by oligonucleotide transformation. DNARepair (Amst.) 7: 205–212.

White, M. F., and D. W. Grogan, 2008 DNA stability and re-pair, pp. 179–188 in Thermophiles: Biology and Technologyat High Temperatures, edited by F. T. Robb, G. Antranikian,

D. W. Grogan, and A. J. Driessen. CRC Press, Boca Raton,FL.

Wiedmann, M., W. J. Wilson, J. Czajka, J. Luo, F. Barany et al.,1994 Ligase chain reaction (LCR): overview and applications.PCR Methods Appl. 3: S51–S64.

Wilson, R. C., and J. D. Pata, 2008 Structural insights into thegeneration of single-base deletions by the Y family DNA poly-merase Dbh. Mol. Cell 29: 767–779.

Yang, K., C. P. Weinacht, and Z. Zhuang, 2013 Regulatory role ofubiquitin in eukaryotic DNA translesion synthesis. Biochemistry52: 3217–3228.

Yang, W., and R. Woodgate, 2007 What a difference a decademakes: insights into translesion DNA synthesis. Proc. Natl. Acad.Sci. USA 104: 15591–15598.

Zang, H., A. Irimia, J. Y. Choi, K. C. Angel, L. V. Loukachevitch et al.,2006 Efficient and high fidelity incorporation of dCTP opposite7,8-dihydro-8-oxodeoxyguanosine by Sulfolobus solfataricus DNApolymerase Dpo4. J. Biol. Chem. 281: 2358–2372.

Communicating editor: S. J. Sandler

TLS in Hyperthermophilic Archaea 523

GENETICSSupporting Information

www.genetics.org/lookup/suppl/doi:10.1534/genetics.115.178566/-/DC1

Lesion-Induced Mutation in the HyperthermophilicArchaeon Sulfolobus acidocaldarius and Its

Avoidance by the Y-Family DNA Polymerase DbhCynthia J. Sakofsky and Dennis W. Grogan

Copyright © 2015 by the Genetics Society of AmericaDOI: 10.1534/genetics.115.178566

2 SI  C. J. Sakofsky and D. W. Grogan 

 

Table S1 S. acidocaldarius strains used in this study

Designation  Genotypea  Source 

               Dbh‐  

 

CS2  pyrE+, dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.3  pyrE‐  199: GGGGGGC, dbh::Sso pyrE‐      Sakofsky et al., 2012 

CS2.5  pyrE‐  199: GGGGGGC, dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.6  pyrE‐  199: GGGGC dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.9  pyrE‐  28: AAAAAT dbh::Sso pyrE‐             Sakofsky et al., 2012 

CS2.14   pyrE‐  G188A (gly to glu), dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.25  pyrE‐  28: AAAAAT, dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.32  pyrE‐  28: AAAAAAAT, dbh::Sso pyrE‐   Sakofsky et al., 2012 

CS2.50   pyrE‐  28: AAAAAAAT, dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.59  pyrE‐  199: GGGGC, dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.78  pyrE‐  C218A (ser to stp), dbh::Sso pyrE‐  Sakofsky et al., 2012 

CS2.101  pyrE‐  C347T (thr to ile), dbh::Sso pyrE‐   Sakofsky et al., 2012 

DG250.85b  pyrEΔ(154‐171) dbh::Sso pyrE C445T  Sakofsky et al., 2012  

   

               Dbh+  

 

DG185  wild‐type  obtained as ATCC 33909c 

DG185.4      pyrE‐  G188A (gly to glu)  Sakofsky et al., 2011 

DG185.32  pyrE‐  28:AAAAAT  Sakofsky et al., 2012 

DG185.49  pyrE‐  C218A (ser to stp)    Sakofsky et al., 2011 

DG251.23b  pyrEΔ(154‐171) trpC::Sso pyrE C445T  Sakofsky et al., 2012 

JDS11  pyrE‐  199: GGGGGGC  Grogan et al., 2001 

JDS48  pyrE‐  28: AAAAAAAT  Grogan et al., 2001 

JDS52  pyrE‐  199: GGGGC  Grogan et al., 2001 

JDS79  pyrE‐  C347T (thr to ile)  Grogan et al., 2001 

JDS167  pyrE‐ 199: GGGGGGC  Grogan et al., 2001  

a Numbers followed by colons indicate the position of the indicated motif in the mutant pyrE gene 

b These recipients select restored function of a heterologous pyrE gene and are not isogenic. 

c American Type Culture Collection (Rockville, Maryland, U.S.A.) 

 

   

  C. J. Sakofsky and D. W. Grogan  3 SI  

Table S2 Oligonucleotides used in transformations

I. Undamaged The selected nucleotide is indicated in bold, and underlined letters mark the query position. Lowercase letters identify additional bp substitutions relative to the recipient chromosome.

G188A.T.top: AATTTTGATATGATATTGGGTGTTGTTACTGGGGGCGTTC

G188A.G.top: AATTTTGATATGATATTGGGGGTTGTTACTGGGGGCGTTC

G188A.C.top: AATTTTGATATGATATTGGGCGTTGTTACTGGGGGCGTTC

G188A.A.bot: GAACGCCCCCAGTAACAACACCCAATATCATATCAAAATT

C218A.T.top: GGGGGCGTTCCATTTGCCTCTTTTATTGCTTGTAAGTTGA

C218A.G.top: GGGGGCGTTCCATTTGCCTCGTTTATTGCTTGTAAGTTGA

C218A.C.top: GGGGGCGTTCCATTTGCCTCCTTTATTGCTTGTAAGTTGA

C218A.G.bot: TCAACTTACAAGCAATAAAGGAGGCAAATGGAACGCCCCC

C347T.A.top: GTTGTAGATGATGTAGCTACAACTGGTGGTTCAATTCTTA

C347T.G.top: GTTGTAGATGATGTAGCTACGACTGGTGGTTCAATTCTTA

C347T.C.top: GTTGTAGATGATGTAGCTACCACTGGTGGTTCAATTCTTA

C347T.C.bot: TAAGAATTGAACCACCAGTCGTAGCTACATCATCTACAAC

SsoPE474-416 A444G:

TAATTTGACTCCTAGTTTTTCCAATCTTTGcGAAGCCCCTTCTTGTCTATCTATGATTA

SsoPE474-416 A444GG:

TAATTTGACTCCTAGTTTTTCCAATCTTTGccGAAGCCCCTTCTTGTCTATCTATGATTA

4 SI  C. J. Sakofsky and D. W. Grogan 

 

II. Damaged

Bold letters indicate the location of the selectable marker, the symbol ‘_’ denotes an abasic lesion, and the ‘<8oG>’ denotes an 8-oxo-guanine. Lowercase letters identify additional bp substitutions relative to the recipient chromosome.

G188A.abs.bot: GAACGCCCCCAGTAACAAC_CCCAATATCATATCAAAATT

189.oxoG.bot: GGCAAATGGAACGCCCCCAGTAACAAC<8oG>CCCAATATCATATCAAAATTAATACCT

C218A.abs.bot: TCAACTTACAAGCAATAAA_GAGGCAAATGGAACGCCCCC

219.oxoG.bot: AGGTTTATTCAACTTACAAGCAATAAA<8oG>GAGGCAAATGGAACGCCCCCAGTAACA

C347T.abs.bot: TAAGAATTGAACCACCAGT_GTAGCTACATCATCTACAAC

347.oxoG.bot: CACTGCTTTAAGAATTGAACCACCAGT<8oG>GTAGCTACATCATCTACAACGATTACC

SsoPE443bot oGC:

TAATTTGACTCCTAGTTTTTCCAATCTTTGc<8oG>AAGCCCCTTCTTGTCTATCTATGATTA

SsoPE443bot oGCC:

TAATTTGACTCCTAGTTTTTCCAATCTTTGcc<8oG>AAGCCCCTTCTTGTCTATCTATGATTA

  C. J. Sakofsky and D. W. Grogan  5 SI  

Table S3 Oligonucleotides used for analyses in vitro

AP Endonuclease Assays

SaPE Fam218wt.abs.bot (“_” = tetrahydrofuran spacer)

[6-FAM]TCAACTTACAAGCAATAAA_GAGGCAAATGGAACGCCCCC

 

SaPE Fam218wt.dU.bot (“U” = deoxyuridine)

[6-FAM]TCAACTTACAAGCAATAAAUGAGGCAAATGGAACGCCCCC

 

FAM SaPE 238-199 (control DNA; query site underlined)

[6-FAM]TCAACTTACAAGCAATAAATGAGGCAAATGGAACGCCCCC

 

SaPE 199-238 (unlabelled bottom strand; query site underlined)

GGGGGCGTTCCATTTGCCTCATTTATTGCTTGTAAGTTGA

 

Ligase Chain Reaction (LCR)

Position 189

LCRSaPE189dstop: GTTGTTACTGGGGGCGTTC

LCRSaPE189dsbot: CCCAATATCATATCAAAATTAATACCT

LCRSaPE189Atop: AAGGTATTAATTTTGATATGATATTGGGA

LCRSaPE189Tbot: GCCCCCAGTAACAACT

LCRSaPE189Gtop: AAGGTATTAATTTTGATATGATATTGGGG

LCRSaPE189Cbot: CGCCCCCAGTAACAACC

LCRSaPE189Ttop: AAGGTATTAATTTTGATATGATATTGGGT

LCRSaPE189Abot: CGCCCCCAGTAACAACA

LCRSaPE189Ctop: AAGGTATTAATTTTGATATGATATTGGGC

LCRSaPE189Gbot: CGCCCCCAGTAACAACG 

6 SI  C. J. Sakofsky and D. W. Grogan 

 

Position 219

LCRSaPE219dntop: TTTATTGCTTGTAAGTTGAATAAACC

LCRSaPE219dnbot: GAGGCAAATGGAACGC

LCRSaPE219Atop: GCGTTCCATTTGCCTCA

LCRSaPE219Tbot: GGTTTATTCAACTTACAAGCAATAAAT

LCRSaPE219Ctop: GCGTTCCATTTGCCTCC

LCRSaPE219Gbot: GGTTTATTCAACTTACAAGCAATAAAG

LCRSaPE219Gtop: GCGTTCCATTTGCCTCG

LCRSaPE219Cbot: GGTTTATTCAACTTACAAGCAATAAAC

LCRSaPE219Ttop: GCGTTCCATTTGCCTCT

LCRSaPE219Abot: GGTTTATTCAACTTACAAGCAATAAAA

Position 348

LCRSaPE347dntop: ACTGGTGGTTCAATTCTTAAAG

LCRSaPE347dnbot: GTAGCTACATCATCTACAACGATTA

LCRSaPE347Atop: TAATCGTTGTAGATGATGTAGCTACA

LCRSaPE347Tbot: CTTTAAGAATTGAACCACCAGTT

LCRSaPE347Ctop: TAATCGTTGTAGATGATGTAGCTACC

LCRSaPE347Gbot: CTTTAAGAATTGAACCACCAGTG

LCRSaPE347Gtop: TAATCGTTGTAGATGATGTAGCTACG

LCRSaPE347Cbot: CTTTAAGAATTGAACCACCAGTC

LCRSaPE347Ttop: TAATCGTTGTAGATGATGTAGCTACT

LCRSaPE347Abot: CTTTAAGAATTGAACCACCAGTA

  C. J. Sakofsky and D. W. Grogan  7 SI  

Table S4 Efficiencies of transformation by undamaged oligonucleotides carrying a non-native base1 at the target position. Nt Position Strand Designation Non-Native Avg. No. transformants per electroporation2 in pyrE (Native Base) Base on Oligo ΔDbh- Dbh+ 189 sense strand (A) T 8 4 189 sense strand (A) G 10 8 189 sense strand (A) C 17 5 189 anti-sense strand (T) A 812 720 219 sense strand (A) T 14 22 219 sense strand (A) G 52 31 219 sense strand (A) C 8 36 219 anti-sense strand (T) G 509 413 348 sense strand (T) A 17 13 348 sense strand (T) G 5 7 348 sense strand (T) C 3 5 348 anti-sense strand (A) C 858 303 1 I.e., an undamaged base different from the one that occurs in the recipient sequence 2Transformant yield did not correlate with DNA amount over the range used (4 to 20 pmol)

8 SI  C. J. Sakofsky and D. W. Grogan 

 

File S1 Assays of AP Endonuclease activity in S. acidocaldarius cell extract

An overview of the methods appears in the main text; substrates are listed in Table S4. A1. Extract-depended degradation (single-stranded substrate)

1 2 3 4 5 6 7 8 9

Lane contents 1: dU oligo, 70° C 10 min, no extract 2: dU oligo plus extract, 22° C 3: dU oligo plus extract, 70° C 10 min 4: abasic-site oligo, 70° C 10 min, no extract 5: abasic-site oligo plus extract, 22° C 6: abasic-site oligo plus extract, 70° C 10 min 7: control oligo, 70° C 10 min, no extract 8: control oligo plus extract, 22° C 9: control oligo plus extract, 70° C 10 min Results indicate that all oligonucleotides are stable to 10 min incubation at 70° (lane 1 vs. 2, 4 vs. 5, 7 vs. 8), that added extract causes minor degradation of abasic-site substrate (lanes 5 & 6 vs. 4), and that this degradation is greater at 70° than at 22° (lane 6 vs. 5).

  C. J. Sakofsky and D. W. Grogan  9 SI  

A2. (repeat, single-stranded substrate) 1 2 3 4 5 6 7 8

Lane contents 1: Reference DNAs 2: dU oligo 3: dU oligo plus extract 4: Abasic-site oligo 5: Abasic-site oligo plus extract 6: Control oligo 7: Control oligo plus extract 8: Reference DNAs Reference DNAs are full-length contol oligo (40 nt) plus dU oligo cleavage product (19 nt); all other DNAs were incubated 10 min at 70°. Small amounts of cleavage product are visible in lanes 3 and 5 under these conditions.

40 nt 

19 nt 

10 SI  C. J. Sakofsky and D. W. Grogan 

 

B. Extract-dependent backbone cleavage (ds substrate) 1 2 3 4 5 6 7 8

Lane contents 1: Reference DNAs 2: dU oligo 3: dU oligo plus extract 4: Abasic-site oligo 5: Abasic-site oligo plus extract 6: Control oligo 7: Control oligo plus extract 8: Reference DNAs Reference DNAs are full-length contol oligo (40 nt) plus dU oligo cleavage product (19nt); all other DNAs are duplex (only one strand fluorescently labeled) and were incubated 10 min at 70°. Faint ‘shadow’ bands in lanes 2 and 3 represent limited re-annealing of dU oligonucleotide and its complement after denaturation in formamide-EDTA. Cleavage product is visible in lanes 3 and 5 under these conditions; note that the extent of the abasic-site cleavage reaction (lane 5) is much greater under these conditions than for ssDNA substrate (previous gel) or dU-containing duplex (lane 3).

40 nt 

19 nt 

  C. J. Sakofsky and D. W. Grogan  11 SI  

C. Test for influence of opposing base

1 2 3 4 5 6 7 8 9 10

Lane contents 1: Reference DNAs 2: Abasic site opposite dA 3: Abasic site opposite dA plus extract 4: Abasic site opposite dC 5: Abasic site opposite dC plus extract 6: Abasic site opposite dG 7: Abasic site opposite dG plus extract 8: Abasic site opposite dT 9: Abasic site opposite dT plus extract 10: Reference DNAs

Reference DNAs are full-length contol oligo (40 nt) plus dU oligo cleavage product (19 nt); all other DNAs are duplex (only one strand fluorescently labeled) and were incubated 10 min at 70°. Cleavage of abasic site (in labeled strand) is nearly quantitative in all four dsDNAs, with possible exception of dT.

40 nt

19 nt