This file is part of the following reference:

Jaroenram, Wansadaj (2015) New insight into detection

and evolution of Australian Penaeus stylirostris

densovirus. PhD thesis, James Cook University.

Access to this file is available from:

http://researchonline.jcu.edu.au/41272/

The author has certified to JCU that they have made a reasonable effort to gain

permission and acknowledge the owner of any third party copyright material

included in this document. If you believe that this is not the case, please contact

ResearchOnline@jcu.edu.au and quote

http://researchonline.jcu.edu.au/41272/

ResearchOnline@JCU

New insight into detection and evolution of Australian Penaeus

stylirostris densovirus

Thesis submitted by

Wansadaj Jaroenram (MSc),

James Cook University, Townsville, QLD

In September 2015

For the Degree of Doctor of Philosophy

in College of Public Health, Medical and Veterinary Sciences

James Cook University

i

STATEMENT OF ACCESS DECLARATION

I, the undersigned, author of this work, understand that James Cook University will

make this thesis available for use within the University Library and, via the

Australian Digital Theses network, for use elsewhere.

I understand that, as an unpublished work, a thesis has significant protection under

the Copyright Act and;

I do not wish to place any further restriction on access to this work.

Signature Date: September 1, 2015

STATEMENT OF SOURCES DECLARATION

I declare that this thesis is my own work and has not been submitted in any form for

another degree or diploma at any university or other institution of tertiary education.

Information derived from the published or unpublished work of others has been

acknowledged in the text and a list of references is given.

Signature Date: September 1, 2015

ii

STATEMENT OF SOURCES ELECTRONIC COPY DECLARATION

I, the undersigned, the author of this work, declare that the electronic copy of this

thesis provided to the James Cook University Library is an accurate copy of the print

thesis submitted, within limits of the technology available.

Signature Date: September 1, 2015

DECLARATION OF ETHICS

The research presented and reported in this thesis was conducted within the

guidelines for research ethics outlined in the National Statement on Ethics Conduct

in Research Involving Human (1999), the Joint NHMRC/AVCC Statement and

Guidelines on Research Practice (1997), the James Cook University Policy on

Experimentation Ethics. Standard Practices and Guidelines (2001), and the James

Cook University Statement and Guidelines on Research Practice (2001). The

proposed research methodology received clearance from the James Cook University

Experimentation Ethics Review (Approval number A1836)

Signature Date: September 1, 2015

iii

ACKNOWLEDGEMENTS

This thesis work is dedicated first to Assoc. Prof. Leigh Owens (my supervisor), and

Dr. Jennifer Elliman (my co-supervisor). Without their guidance and support, this

thesis work would not have been possible. Second, I dedicate this work to JCU

International Postgraduate Research Scholarship. Without this scholarship, I would

not be able to study here. Third, I would like to thank Dr. Constantin Constantinoiu,

Dr. Ellen Ariel and Aquapath members for their help and suggestions which enabled

me to complete this thesis successfully. Last, and most of all, I dedicate this work to

my parents, Kan Jaroenram and Wijit Jaroenram. All I have and will accomplish are

only possible due to their love and sacrifices.

iv

ABSTRACT

Penaeus stylirostris densovirus (PstDV) has caused high mortality in Penaeus

stylirostris and runt deformity syndrome in Penaeus vannamei and Penaeus

monodon. This study aims to 1) develop a practical diagnostic approach to separate

infectious PstDV from endogenous viral elements, and 2) to determine the factors

that underlie molecular evolution of the Australian PstDV. Regarding the first, we

mapped the PstDV insertion patterns in the genome of Australian P. monodon. A

detection platform based on recombinase polymerase amplification (RPA) and a

lateral flow dipstick (LFD) was developed for detecting PstDV based on the DNA

region that is least likely to be endogenized. Under the optimal conditions, 30 min at

37 °C for RPA followed by 5 min at room temperature for LFD, the platform was 10

times more sensitive than the Saksmerphrome et al’s interim 3-tube nested PCR and

showed no cross-reaction with other shrimp viruses. It also reduced false positive

results arising from viral inserts to ~5% compared to 76–78% by the IQ2000TM

nested PCR kit and the 309F/R PCR protocol currently recommended by World

Organization for Animal Health for PstDV detection. Together with simplicity and

portability, the protocol serves as an alternative tool to PCR for screening PstDV.

As for the second objective, A 1-bp deletion (1305delA) within the nuclear

localization signal-encoding sequence of open reading frame 1 (ORF1; NS1) of

Australian PstDV was identified as a cause of 199-amino acid shortened NS1

protein and production of a second protein, C-terminal NS1. This mutation is

believed to reduce virulence as it strongly modifies the characteristics of NS1, which

is responsible for the majority of enzymatic activities in PstDV. This finding

supports a hypothesis regarding accommodation of PstDV in Australian prawns in

relation to viral genetics. However, a high degree of evolution (1.55 × 10−3

substitutions/site/year) for the virus, which was attributable to the viral

recombination, was observed with 10 potential genomic breakpoints identified. With

this finding, we suggest that awareness of the emergence of new virulent strains

should be increased as a preventative measure against future outbreaks of PstDV in

the Australian Indo-Pacific.

v

TABLE OF CONTENTS

Statement of Access Declaration........................................................................... i

Statement of Sources Declaration......................................................................... i

Statement of Sources Electronic Copy Declaration............................................. ii

Declaration of Ethics.............................................................................................. ii

Acknowledgments.................................................................................................. iii

Abstract................................................................................................................... iv

List of Tables.......................................................................................................... x

List of Figures......................................................................................................... xi

List of Abbreviations.............................................................................................. xiii

List of Publications................................................................................................. xx

CHAPTER 1: General Introduction..................................................................... 1

CHAPTER 2: Review of Literature...................................................................... 3

2.1. Introduction........................................................................................................ 3

2.2. PstDV information............................................................................................. 3

2.2.1. Classification and genome characterization............................................ 3

2.2.2. Occurrence and geographical distribution............................................... 5

2.2.3. Clinical signs and mode of transmission................................................. 8

vi

2.2.4. Prevalence and host ranks....................................................................... 9

2.3. Current factors hampering the success of control for PstDV............................. 12

2.3.1. Current problems in diagnostics: viral inserts in shrimp genome……… 12

2.3.1.1. PstDV endogenous viral elements in shrimp……...................... 12

2.3.1.2. Insertion pattern of PstDV elements in shrimp genome……… 13

2.3.1.3. PCR detection and false positive results arising from viral inserts

………………………………………………………………… 15

2.3.1.4. Recombinase polymerase amplification and lateral flow dipstick

assay: alternative approaches for PstDV detection.................... 15

2.3.2. Current problems in control of PstDV outbreaks: Lack of understanding

of the diversity and population dynamics of PstDV................................ 20

2.4. Concluding remarks........................................................................................... 23

CHAPTER 3: General Materials and methods................................................... 24

3.1. Preparation of total DNA extract....................................................................... 24

3.2. Preparation of total RNA extract....................................................................... 25

3.3. PCR amplification and gel electrophoresis........................................................ 25

3.4. Cloning and sequencing..................................................................................... 26

CHAPTER 4: Profiling of Endogenous Viral Elements in the Genome

of Australian Penaeus monodon.................................................. 27

4.1. Introduction....................................................................................................... 27

4.2. Materials and Methods...................................................................................... 28

vii

4.2.1. Shrimp samples and DNA temple preparation....................................... 28

4.2.2. PCR detection of PstDV-related sequences in shrimp genome.............. 28

4.3. Results................................................................................................................ 29

4.4. Discussion.......................................................................................................... 31

CHAPTER 5: Recombinase Polymerase Amplification Combined with a Lateral

Flow Dipstick for Detection of Infectious Penaeus stylirostris

Densovirus...................................................................................... 33

5.1. Introduction........................................................................................................ 33

5.2. Materials and Methods....................................................................................... 35

5.2.1. Samples infected with PstDV.................................................................. 35

5.2.2. Total DNA temple preparation................................................................ 35

5.2.3. Recombinant plasmid construction......................................................... 35

5.2.4. RPA primer and probe design................................................................. 36

5.2.5. RPA conditions and optimization............................................................ 37

5.2.6. Lateral flow dipstick (LFD) assay........................................................... 37

5.2.7. Molecular specificity of RPA–LFD........................................................ 38

5.2.8. Molecular sensitivity of PRA by LFD and AGE.................................... 38

5.2.9. Molecular sensitivity of one-step PCR and nested PCR by AGE…….. 38

5.2.10. Reliability of RPA–LFD by statistical sensitivity and specificity

analysis……………………………………………………………… 39

5.3. Results................................................................................................................ 40

5.3.1. Determination of the RPA–LFD conditions............................................ 40

viii

5.3.2. Molecular specificity of RPA–LFD........................................................ 41

5.3.3. Comparative molecular sensitivity of the RPA/AGE, RPA/LFD,

PCR/AGE and nested RT-PCR/AGE..................................................... 42

5.3.4. Reliability of RPA–LFD by statistical sensitivity and specificity

analysis………………………………………………………............... 45

5.4. Discussion.......................................................................................................... 49

CHAPTER 6: Viral Accommodation, Evolution and Phylodynamics of

Australian Penaeus stylirostris Densovirus.................................. 51

6.1. Introduction........................................................................................................ 51

6.2. Materials and Methods....................................................................................... 52

6.2.1. Shrimp samples and DNA temple preparation........................................ 52

6.2.2. PCR amplification, cloning and genome sequencing of Australian

PstDV..................................................................................................... 52

6.2.3. Bioinformatical analysis of PstDV genome............................................ 54

6.2.4. Point mutation analysis............................................................................ 54

6.2.5. Phylogenetic analysis.............................................................................. 54

6.2.6. Recombination and selection analysis..................................................... 55

6.2.7. Inference of the nucleotide substitution rate and the demographic

history…………………………………………………..…………….. 55

6.3. Result................................................................................................................. 57

6.3.1. Retrospective analysis of data from 1993............................................... 57

6.3.2. Whole genome analysis of Australian PstDV......................................... 57

ix

6.3.3. Mutation analysis..................................................................................... 61

6.3.4. Phylogenetic tree analysis....................................................................... 64

6.3.5. Recombination and selection analysis..................................................... 65

6.3.6. Inference of the nucleotide substitution rate and the demographic

history..................................................................................................... 68

6.4. Discussion.......................................................................................................... 70

CHAPTER 7: General Discussion......................................................................... 76

REFERENCES........................................................................................................ 80

APPENDIX A: Reagents and bacteriological media............................................... 91

APPENDIX B: A preliminary study on PstDV status in Australian and imported

prawns by Krabsetsve and Owens (unpublished)……………..... 94

APPENDIX C: Detail of PstDV insertion patterns in the genome of shrimp from

Farm A (Table B.1) and B (Table B.2) and the background of

prawn (Table B.3) examined in Chapter 4……………………... 103

APPENDIX D: The genome sequence of Australian PstDV (AUS-PstDV2012)

reported in this article (GenBank No. KM593913).................... 107

APPENDIX E: The host origins of Australian endemic PstDVs……………… 109

APPENDIX F: Detail of natural selection analysis using SLAC, FEL, and REL

approaches.................................................................................... 110

APPENDIX G: List of oral presentations and workshop....................................... 122

APPENDIX H: List of publications....................................................................... 123

x

LIST OF TABLES

Table 2.1 The geographical distribution of PstDV .......................................... 7

Table 2.2 Known host species of PstDV and the prevalence of the virus…… 11

Table 4 Positive (+) and negative (−) PCR results obtained with DNA

templates from P. monodon (130 samples) using 8 overlapping

primer sets that targeted the whole genome of PstDV..................... 30

Table 5.1 Geographical origin, year of collection, species and number of

shrimp, and PstDV status of shrimp as determined by the

reference assay (an interim 3-tube nested PCR), and the

RPA-LFD protocol............................................................................ 47

Table 5.2 Diagnostic performance of the RPA-LFD protocol.......................... 48

Table 6.1 Primers used to sequence the complete genome of PstDV in this

study.................................................................................................. 53

Table 6.2 Comparison of nucleotide and predicted amino acid sequences of

the AUS-PstDV2012 (lineage II) and other sequenced PstDVs

from different geographical regions.................................................. 60

Table 6.3 The penaeid host, geographical location and the likely NLS of

PstDV in NS1 protein....................................................................... 63

Table 6.4 Number of positive (+) and negative (̶ ) selected codons on each

ORF of the genome of PstDVs circulating outside Australia

(nAus Grp 1) and inside Australia (Aus Grp 2) as analyzed by

SLAC, FEL and REL........................................................................ 67

Table 6.5 Evolutionary models compared by marginal likelihoods obtained

from the harmonic smoothed mean estimator performed under

different clock models: Strict (S), Relaxed lognormal (RL) and

Relaxed exponential (RE)................................................................. 69

xi

LIST OF FIGURES

Figure 2.1 Genomic organization of coding sequences of PstDV genome....... 5

Figure 2.2 Size variations observed in 50 days old P. monodon infected by

PstDV................................................................................................ 8

Figure 2.3 Mechanism of recombinase polymerase amplification (RPA)......... 17

Figure 2.4 The working principle of the Milenia® HybriDetect LFD................ 19

Figure 5.1 Schematic representation of RPA–LFD principle for the detection

of PstDV........................................................................................... 34

Figure 5.2 Optimization of RPA reaction using 10-fold serially diluted PstDV-

recombinant plasmid DNA as template............................................. 40

Figure 5.3 Molecular specificity of RPA–LFD carried out using shrimp

viruses as template............................................................................ 41

Figure 5.4 Comparison between the LFD assay and AGE for detecting

PstDV-RPA products........................................................................ 42

Figure 5.5 Molecular sensitivity test results of RPA using 10-fold serially

diluted total DNA extracted from PstDV-infected shrimp as

template…………………………………………………………… 43

Figure 5.6 Molecular sensitivity test results of RPA using 10-fold serially

diluted plasmid DNA as templates................................................... 44

Figure 5.7 Molecular sensitivity of PCR and nested-PCR carried out using

various amounts of PstDV-DNA as template................................... 45

Figure 6.1 (A) Genome organization of Australian PstDV obtained from this

study. (B) Genome organization of infectious PstDV representative

taken from GenBank database........................................................... 59

xii

Figure 6.2 Comparison of the 1305delA-containing ORF1 (NS1) sequences

obtained from various sources........................................................... 62

Figure 6.3 Phylogenetic relationships of the Australian PstDV isolate and

other geographical isolates as analysed using the maximum

likelihood method implemented in the PhyML 3.0.......................... 64

Figure 6.4 Recombination breakpoint (BP) placement support of: (A)

ORF1 Fr1, (B) ORF1 Fr2, (C) ORF2 and (D) ORF3....................... 66

Figure 6.5 Bayesian skyline plot........................................................................ 69

xiii

LIST OF ABBREVIATIONS

FAO Food and Agriculture Organization

aa Amino acid

AaeDNV Aedes aegypti densovirus

AalDNV Aedes albopictus densovirus

AGE Agarose gel electrophoresis

A. longinaris Artemesia longinaris

Aus Grp 2 Australian PstDV endemic strains (Group 2)

BEAST Bayesian evolutionary analysis by sampling trees

BLAST Basic Local Alignment Search Tool

Bp Base pair

BPs Breakpoints

BPS Bayesian skyline plot

Bst Bacillus stearothermophilus

C. angulatus Cyrtograpsus angulatus

°C Degree Celsius

CP Capsid protein

Da Dalton

Δc-AIC Changes in Akaike information criteria

1305delA Base A is deleted at the nt position 1305 of ORF1

xiv

1305insA Base A is inserted at the nt position 1304 of ORF1

dN Non-synonymous substitutions

DNA Deoxyribonucleic acid

DNase Deoxyribonuclease

DNV Densovirus

dS Synonymous substitution

dsDNA Double-stranded DNA

E.coli Escherichia coli

ESS Effective sample sizes

EST Expressed sequence taq

EVEs Endogenous viral elements

FAM Fluorescein amidite

FAO Food and Agriculture Organization

FEL Fixed Effects Likelihood

FITC Fluorescein isothiocyanate

FN False negative

FP False positive

FPLV Feline panleukopenia parvovirus

Fr1 Fragment 1 of ORF1

Fr2 Fragment 2 of ORF1

g Gravitational force

GARD Genetic Algorithms for Recombination Detection

xv

GAV Gill-associated virus

ΔG Gibbs free energy

h Hour

HPD Highest posterior density

H. penicillatus Hemigrapsus penicillatus

IHHNV Infectious hypodermal and hematopoietic necrosis virus

Inc. Incorporated

i.e. id est

K Lysine

kbp Kilo base pair

kcal Kilocalorie

kDa Kilo Dalton

LAMP Loop mediated DNA isothermal amplification

LB Lysogeny broth

LFD Lateral flow dipstick

MCMC Markov chain Monte Carlo

MCMS Midcrop Mortality Syndrome

min Minute

MrNV Macrobrachium rosenbergii nodavirus

M. rosenbergii Macrobrachium rosenbergii

µl Microlitre

xvi

µM Micromolar

mg Milligram

MgCl2 Magnesium chloride

ml Millilitre

mM Millimolar

MUSCLE Multiple sequence comparison by log-expectation

MW Molecular weight

− Negative

NCBI National Centre for Biotechnology Information

Ne Effective population size

Nfo Endonuclease IV

ng Nanogram

NLS Nuclear localization signal

nm Nanometre

nt Nucleotide

NTP Nucleoside triphosphate

NS1 Non-structural protein 1

NS2 Non-structural protein 2

nAus Grp 1 Non-Australian PstDV strains (Group 1)

OIE Office International des Epizooties

ORF Open reading frame

P. aztecus Penaeus aztecus

xvii

P. californiensis Penaeus californiensis

P. esculentus Penaeus esculentus

P. japonicus Penaeus japonicus

P. macrodactylus Palaemon macrodactylus

PmeDV Penaeus merguiensis densovirus

P. monodon Penaeus monodon

P. setiferus Penaeus setiferus

PstDV Penaeus stylirostris densovirus

P. stylirostris Penaeus stylirostris

P. subtilise Penaeus subtilise

P. vannamei Penaeus vannamei

PCR Polymerase chain reaction

pg Picogram

PL Postlarvae

+ Positive

% Percentage

R Arginine

RDS Runt deformity syndrome

RE Relaxed exponential clock model

REL Random Effects Likelihood

RL Relaxed lognormal clock model

xviii

RNA Ribonucleic acid

RPA Recombinase polymerase amplification

s Second

S Strict clock model

SSB Single-strand DNA binding protein

ssDNA Single-stranded DNA

SE South East

Sau Staphylococcus aureus

SLAC Single Likelihood Ancestor Counting

$ Dollar

TAE Tris-acetate-EDTA

Taq Thermus aquaticus

THF Tetrahydrofuran

TN True negative

TP True positive

TSV Taura syndrome virus

TYLCV Tomato yellow leaf curl virus

U Unit

UK United Kingdom

USA United State of America

UV Ultraviolet

xix

VP Viral capsid protein

WSSV White spot syndrome virus

YHV Yellow head virus

xx

LIST OF PUBLICATIONS

1. Jaroenram W, Owens L (2014). Separation of endogenous viral elements from

infectious Penaeus stylirostris densovirus using recombinase polymerase

amplification. Mol Cell Probe 28: 284-287

2. Jaroenram W, Owens L (2014). Recombinase polymerase amplification combined

with a lateral flow dipstick for discriminating between infectious Penaeus

stylirostris densovirus and virus-related sequences in shrimp genome. J Virol

Methods 208:144-151

3. Jaroenram W, Chaivisuthangkura P, Owens L (2015). One base pair deletion and

high rate of evolution: Keys to viral accommodation of Australian Penaeus

stylirostris densovirus. Aquaculture 443:40-48

1

CHAPTER 1

GENERAL INTRODUCTION

At present, shrimp (mostly penaeids) are viewed as a major trade fishery species due

to the increase in consumer demand for these animals. This demand has driven the

global shrimp industry to grow continuously at 9% a year since the 1970s (Zabbey et

al., 2010). According to the Food and Agriculture Organization of United Nations

(FAO), global shrimp production is approximately six million metric tonnes a year,

60% of which enters the international market and is worth more than US$10 billion

annually (Gillett R, 2008; http://www.fao.org/docrep/011/i0300e/i0300e00.htm). This

great market value contributes extensive benefits to economies especially in Asia

where most of the shrimp farming occurs. Unfortunately, an increase in the numbers

of diseases induces significant losses for the shrimp industry. Between 1990 and

2005, for example, the global shrimp production losses due to diseases were

approximately US$ 15 billion, 60% of which were attributed to viruses (Flegel,

2012). White spot syndrome virus (WSSV) and yellow head virus (YHV) have been

marked as the most dangerous pathogens for shrimp aquaculture due to their lethal

effect on Penaeus monodon (black tiger shrimp) and Penaeus vannamei (Pacific

white shrimp), the major cultivated shrimp species (Flegel, 2012).

Penaeus stylirostris densovirus (PstDV), commonly called infectious hypodermal

and hematopoietic necrosis virus (IHHNV), is also of importance as it causes mass

mortality in Penaeus stylirostris (blue shrimp), and Runt deformity syndrome (RDS)

in P. vannamei and P. monodon (Brock et al., 1983; Browdy et al., 1993; Bray et

al., 1994; Primavera and Quinitio, 2000; Khawsak et al., 2008; Rai et al., 2012). It is

also reported to be associated with slow growth in P. monodon (Rai et al., 2009; Rai

et al., 2012). Despite several approaches to viral disease prevention such as good on-

farm management practice (Xiang, 2001), the presence of PstDV has been reported.

2

Success in circumvention of outbreaks of PstDV requires efficient control measures

which constitutes detection, containment and control. To achieve this, proper

consideration and fulfilment of areas including the following issues are needed. 1)

Requirement for more efficient diagnostic systems. Such systems are required for

seed screening program and biosecurity. 2) Requirement for the understanding of the

population dynamics and evolution of PstDV (Robles-Sikisaka et al., 2010). This

issue is crucial for implementation of effective measures to control outbreaks/restrict

movement of the virus, for example, from geographical hotspots for the virus. This

thesis aims to address these two issues with the hope that integration of such outputs

and knowledge will help contribute toward better strategies to counter PstDV.

3

CHAPTER 2

REVIEW OF LITERATURE

2.1. Introduction

Penaeus stylirostris densovirus (PstDV) is a virus that causes mass mortality in P.

stylirostris and Runt deformity syndrome (RDS) in P. vannamei and P. monodon

(Brock et al., 1983; Browdy et al., 1993; Bray et al., 1994; Primavera and Quinitio,

2000; Khawsak et al., 2008; Rai et al., 2012). Although RDS is not fatal for shrimp,

the wide distribution in size it causes, reducing the value of affected crops to 50%,

also devastates crop production because shrimp market value depends mainly on the

body weight/size of shrimp (Bell and Lightner, 1984; Lightner, 1996a). This review

provides brief information of PstDV and highlights some relevant issues that need

proper consideration and fulfilment in order to circumvent outbreaks of PstDV.

2.2. PstDV information

2.2.1. Classification and genome characterization

PstDV is a non-enveloped icosahedral virus with an estimated size of 22 nm,

smallest of all known penaeid shrimp viruses. Its genome contains a single-stranded

linear DNA (ssDNA) of approximately 3.9 kilo base pairs (kbp), and shares a

common structure and organization with the genome of mosquito brevidensoviruses

(Aedes albopictus densovirus, AalDNV, and Aedes aegypti densovirus, AaeDNV).

Therefore, it is classified as a tentative species in the family Parvoviridae, genus

Brevidensovirus (Fauquet et al., 2005).

The genome of PstDV contains 3 main open reading frames (ORFs) arranged from

the left to the right on plus strand DNA: ORF2, ORF1; and ORF3 (Figure 2.1) (Rai

et al., 2011). Based on the Indian isolate reported recently (GenBank No.

GQ411199) (Rai et al., 2011), ORF2 comprises of 1092 bp with the sequence

4

overlaps with ORF1, but in a different reading frame. ORF2 starts with an ATG

codon at nucleotide (nt) 591 and terminates with a TAG codon at nt 1681. If

functional, this ORF would encode a protein of 363 amino acids (aa) corresponding

to a molecular mass of 42.11 kDa. As speculated for brevidensoviruses, this protein

may be a non-structural protein 2 (NS2), the function of which, as with other

parvoviruses, is currently unknown (Shike et al., 2000).

ORF1 comprises of 2001 nt, approximately 50% of the genome. It starts at nt 648

and terminates with a TAA codon at nt 2648. This ORF encodes a 666-aa protein

with a molecular weight of 75.77 kDa. The predicted protein of ORF1 shares the

highest homology with two conserved motifs presented in the major non-structural

protein 1 (NS1) of mosquito brevidensoviruses: replication initiator domain and

NTP-binding and helicase domains (Shike et al., 2000; Rai et al., 2011; Rai et al.,

2012). Thus, it is believed to encode essential NS1 proteins functioning in rolling-

circle replication process.

ORF3 is the smallest (990 nt) amongst the three ORFs. It starts with ATG at nt

2590, and terminates with the TAA codon at nt 3577 (62 nt overlapped with

ORF1). It shares the same reading frame (+2) with ORF2. This ORF encodes a 329-

aa capsid protein corresponding to a molecular mass of 37.48 kDa.

Short palindromic sequences capable of forming DNA hairpin structures, a

characteristic shared by all parvoviruses, have also been found in PstDV genome

extremities (i.e. 5’ and 3’ ends). They are presumed to be primers for rolling-cycle

replication process (Astell, 1990; Shike et al., 2000; Vega-Heredia et al., 2012).

Three putative potential transcriptional promoters designated as P2, P11 and P61

have also been characterized. P2 controls the transcription of ORF1 while P11 and

P61 control those of ORF2 and ORF3, respectively (Dhar et al., 2007).

5

Figure 2.1: Genomic organization of coding sequences of PstDV genome (Rai et

al., 2012). The genome is shown in plus strand. The three open reading

frames designated as ORF1, ORF2 and ORF3 are indicated in boxes.

ORF2 and ORF3 are in reading frame 1 (+1) and ORF1 is in reading

frame 3 (+3).

2.2.2. Occurrence and geographical distribution

PstDV has been reported in many regions around the world including North, South,

Central America, the Caribbean and the Indo-Pacific region and is now considered

cosmopolitan in distribution (Rai et al., 2012). PstDV was first reported in P.

stylirostris cultured in the early 1980s in Hawaii (Lightner et al., 1983a; Rai et al.,

2012) where it was believed to have been introduced by importation of live

experimental P. monodon from the Philippines during the early development of

shrimp aquaculture (Tang et al., 2003; Flegel, 2006). Then, it was found distributed

in every country of the Americas in which P. vannamei was cultivated (Lightner,

1996a) and in Asia and Africa (Tang and Lightner, 2006; Rai et al., 2009;

Saksmerprome et al., 2010). In South East (SE) Asia, it is believed to be introduced

from Thailand to Taiwan as both live and frozen shrimp in Taiwan are frequently

imported from Thailand. This assumption is supported by the high similarity in

DNA sequence (99.7%) of the virus amongst the 2 countries (Tang et al., 2003).

PstDV has also been reported in India, and it is also believed to have come from SE

Asia as these 2 geographical isolates are phylogenetically closely related (Rai et al.,

2009). Besides infectious PstDV, non-infectious sequence, mostly referred to virus-

related DNA fragments presenting in the genome of P. monodon, have been reported

in some parts of the world such as East Africa, western Indo-Pacific region (Tang

and Lightner, 2006; Tang et al., 2007) and SE Asia (Saksmerprome et al., 2011) (see

section 2.3.1.1).

6

Based on its distinct genotypes in both infectious and non-infectious groups, PstDV

has been separated into three types (Tang and Lightner, 2006; Tang et al., 2007):

Type 1 from the Americas and East Asia (principally the Philippines); Type 2 from

SE Asia (i.e. Thailand); Type 3A from East Africa (Mozambique but mainly

Madagascar), Australia and India; and Type 3B from the western Indo-Pacific

countries including Mauritius but mainly Tanzania and Mozambique, and Malaysia.

The first two genotypes are infectious to penaeid shrimp while the latter two genetic

variants, 3A and 3B, are not infectious even though their genomes contain all 3

ORFs similar to those labelled as infectious (Tang and Lightner, 2002a; Tang et al.,

2003; Tang and Lightner, 2006; Tang et al., 2007). Type 3A was later been found to

be integrated into the genome of P. monodon from East Africa, Tanzania and

Mozambique (Tang and Lightner, 2006; Tang et al., 2007). Although the PstDV

integrated sequences are reported as not infectious to host species, this has never

been tested experimentally and whether or not they encode proteins remains unclear.

Table 2.1 summarizes the geographical distribution of PstDV to date.

7

Table 2.1: The geographical distribution of PstDV

Continent Country References

America Argentina (Martorelli et al., 2010)

Peru (Alfaro Aguilera et al., 2010)

Brazil (Braz et al., 2009; Coelho et al., 2009)

Venezuela (Boada, 2008)

Colombia (Tang et al., 2003)

Mexico (Unzueta-Bustamante et al., 1998; Nunan et al., 2000; Tang and

Lightner, 2001)

Ecuador (Jiménez et al., 1999; Nunan et al., 2000)

USA (Kalagayan et al., 1991; Nunan et al., 2000; Shike et al., 2000;

Tang et al., 2007)

Panama (Nunan et al., 2000; Tang and Lightner, 2001)

Belize (Tang et al., 2007)

Asia China (Yang et al., 2007; Zhang et al., 2007)

India (Rai et al., 2009; Rai et al., 2011)

Philippines (Nunan et al., 2000; Tang et al., 2003; Tang et al., 2007)

Korea (Kim et al., 2011; Kim et al., 2012)

Thailand (Tang et al., 2003; Chayaburakul et al., 2004; Tang et al., 2007)

Taiwan (Tang et al., 2003)

Brunei (Claydon et al., 2010)

Africa Madagascar (Tang et al., 2003; Tang and Lightner, 2006)

Mozambique (Tang and Lightner, 2006)

Tanzania Tang and Lightner, 2006, Tang et al., 2003

Mauritius (Tang et al., 2003)

Oceania Australia (Krabsetsve et al., 2004; Saksmerprome et al., 2010; Jaroenram and

Owens, 2014)

New Caledonia (Krabsetsve et al., 2004)

Tahiti (Owens and Hall-Mendelin, 1989)

8

2.2.3. Clinical signs and mode of transmission

PstDV infection does not produce any specific clinical signs of disease (Lightner et

al., 1983b). In P. stylirostris, acute infected juveniles and sub-adults show reduced

food consumption, becoming motionless then rolling over and slowly sinking to the

pond bottom, then they die (Rai et al., 2012). In P. vannamei and P. monodon,

PstDV typically causes chronic disease (Lightner et al., 1983b) and the infection

results in development and growth abnormalities (i.e. deformed rostrum, wrinkled

antennal flagella, cuticular roughness, ‘bubble-heads’ and deformation of 6th

abdominal segment and tail fan) known as RDS (Brock et al., 1983; Browdy et al.,

1993; Bray et al., 1994; Primavera and Quinitio, 2000; Khawsak et al., 2008; Rai et

al., 2012). PstDV is also associated with slow growth in P. monodon (Figure 2.2)

(Rai et al., 2009; Rai et al., 2012).

Figure 2.2: Size variations observed in 50 days old P. monodon infected by PstDV

(Rai et al., 2009; Rai et al., 2012).

Like all other parvoviruses, PstDV do not encode a DNA polymerase; its replication

and multiplication processes depend on host cell machinery. It therefore needs

rapidly proliferating cells of the host for its replication (Rai et al., 2012). Since

postlarvae (PL) and juvenile shrimps have more actively dividing cells than adult

shrimp, they are more susceptible to PstDV infection (Kalagayan et al., 1991;

Lightner, 1996b). The target organs for PstDV infection include tissues of

9

ectodermal (cuticular epidermis, hypodermal epithelium of the fore and hind gut,

nerve cord and nerve ganglia) and mesodermal (hematopoietic organs, antennal

gland, tubule epithelium, gonads, lymphoid organ, connective tissue and striated

muscle) origin (Lightner, 1996b; Rai et al., 2012).

2.2.4. Prevalence and host ranks

PstDV can spread both horizontally and vertically (Lightner et al., 1983a; Motte et

al., 2003). Horizontal transmission occurs when individual shrimp eat dead infected

shrimp or are in the water contaminated with the virus. Several studies regarding the

successful horizontal transmission by ingestion of PstDV-infected shrimp support

this observation (Bell and Lightner, 1987; Tang and Lightner, 2006; Coelho et al.,

2009). Shrimp surviving PstDV become carriers for life even though they show no

signs of the disease (Bell and Lightner, 1987). Vertical transmission occurs due to

transfer of this virus from mother to offspring. This could be through the shedding

of viral particles at the time of spawning and then ingestion by larvae at first

feeding, or by the transmission of virus from oocytes to larvae (Lotz, 1997). The

vertical transmission of PstDV through female P. vannamei was confirmed by

nested-PCR analysis of embryos and larvae produced by PstDV-infected females

fertilized by PstDV-free males (Motte et al., 2003). Zhang and Sun also reported

PstDV in ovarian tissues and fertilized egg of Penaeus chinensis (Zhang and Sun,

1997).

The prevalence of PstDV can range from low to very high but 90-100% is typical in

farmed shrimp (Lightner et al., 1983a; Lightner et al., 1992; Martínez-Cordova,

1992; Chayaburakul et al., 2004). A prevalence as high as 51.5% was reported in P.

vannamei collected from culture areas of the northern China during 2001 and 2004

(Yang et al., 2007). PstDV was also reported to cause RDS and high mortalities

(80%) in PL and sub-adults of Macrobrachium rosenbergii cultured in Taiwan but

the prevalence was not presented (Hsieh et al., 2006). For wild captured shrimp, the

mean values of prevalence were: 100% in female P. stylirostris collected from the

mid-region of the Gulf of California, Mexico (Morales-Covarrubias et al., 1999);

10

51-63% in P. vannamei captured from the Pacific coast of Ecuador (Motte et al.,

2003); 18%-50% in Penaeus californiensis collected from the upper Gulf of

California, Mexico (Pantoja et al., 1999); 4.4% in Penaeus aztecus and Penaeus

setiferus from the East Coast of Mexico (Guzmán-Sáenz et al., 2009; Vega-Heredia

et al., 2012); 56% in Artemesia longinaris and 40% in Palaemon macrodactylus

collected from the Bahı´a Blanca Estuary, Argentina (Martorelli et al., 2010).

Another survey revealed 20% prevalence in Malaysian wild female berried M.

rosenbergii broodstock which showed no gross signs of disease (Hazreen Nita et al.,

2012). PstDV was also detected in crabs. Low prevalence (8.3%) was reported in

Hemigrapsus penicillatus (Hairy-clawed shore crabs) collected from the culture

areas of the northern China during the year 2001-2004 (Yang et al., 2007). In

contrast, a high prevalence of 67% was observed with Cyrtograpsus angulatus

collected from the Bahı´a Blanca Estuary, Argentina (Martorelli et al., 2010). In

Australia, a survey of 328 wild caught prawns (7 species), crabs and lobsters

revealed that only P. monodon were positive for PstDV or PstDV-like amplicons

(Krabsetsve and Owens, unpublished). In addition to natural infection, experimental

infection with no clinical signs of disease was observed with Penaeus subtilis

(Coelho et al., 2009).

Obviously, several shrimp species and arthropods commonly found in shrimp

culture areas (i.e. crabs) are susceptible to PstDV. It would appear that the most

dangerous scenario would be for a PstDV outbreak to occur in shrimp ponds and for

wild crustaceans such as crabs to have the opportunity to eat infected shrimp

carcasses. They would have a high chance of becoming infected and could possibly

carry the virus to an uninfected pond where the risk of transmission would be high if

they were eaten by shrimp (horizontal transmission). Therefore, the practice of

eliminating wild crustaceans from rearing ponds should constitute an effective

control measure for PstDV. Current known host species of PstDV and the

prevalence of the virus are listed in Table 2.2

11

Table 2.2: Known host species of PstDV and the prevalence of the virus

Phylum Order Family Species Prevalence References

Arthropoda Decapoda Penaeidae P. stylirostris 100% (Morales-Covarrubias et al., 1999)

P. vannamei 51-63% (Motte et al., 2003)

P. monodon 25% (Rai et al., 2009)

P. setiferus and P.

aztecus

4.4% (Guzmán-Sáenz et al., 2009; Vega-

Heredia et al., 2012)

A. longinaris 56% (Martorelli et al., 2010)

P. californiensis 18-50% (Pantoja et al., 1999)

P. japonicus N/A (Tang et al., 2007)

P. subtilis N/A (Coelho et al., 2009)

Arthropoda Decapoda Palaemonidae M. rosenbergii 20% (Hazreen Nita et al., 2012)

P. macrodactylus 40% (Martorelli et al., 2010)

Arthropoda Decapoda Varunidae C. angulatus 67% (Martorelli et al., 2010)

H. penicillatus 8.3% (Yang et al., 2007)

12

2.3. Current factors hampering the success of control for PstDV

2.3.1. Current problems in diagnostics: viral inserts in shrimp genome

To date, retroviruses have been the only known eukaryotic viruses that require host

genomic integration for completion of their life cycle (Feschotte and Gilbert, 2012).

However, several recent reports have revealed countless non-retroviral sequences

that are integrated or ‘endogenized’ in the genomes of eukaryotes, for instance,

caulimovirus (Staginnus and Richert-Pöggeler, 2006; Iskra-Caruana et al., 2010) and

baculovirus (Lin et al., 1999) have been identified in plant genomes and insect

genomes respectively for some time. The discovery of endogenous viral elements

(EVEs) derived from non-retroviruses suggests that all major types of eukaryotic

viruses could give rise to EVEs (Feschotte and Gilbert, 2012).

2.3.1.1. PstDV endogenous viral elements in shrimp

PstDV was first reported to integrate into shrimp genome by Tang and Lightner

(2006). By screening P. monodon collected from various geographical areas using

PCR with primers MG831F/R designed for the type 3A viral sequence and DNA

sequencing, P. monodon from Madagascar (collected in 2001) and Australia

(collected in 2004) revealed the viral insert sequences linked with various shrimp

DNA markers including P. monodon clone AFE20M24 (GenBank No.

AY654006.1), P. vannamei microsatellite TUMXLV 6.114 (GenBank No.

AY46620.1), P. monodon clone AFE49M19.1 (GenBank No. AY654020.1), and P.

monodon microsatellite PM2334 (GenBank No. AY500859.1). Amongst these

samples, Australian P. monodon carried the type A viral sequence as high as 80%

(16 samples out of 20). Histological examination of P. monodon or P. vannamei

challenged with the Australian P. monodon carrying the viral inserts showed no

gross pathology of PstDV infection (i.e. Cowdry A inclusion bodies). Unfortunately,

these shrimp species were a poor choice for the 2-week bioassay as RDS changes

are chronic, not acute, and are unlikely to manifest within 2 weeks. The occurrence

of endogenous PstDV elements was also recently reported in Indian shrimp (Rai et

al., 2009). Of 177 P. monodon screened by the MG831F/R primers and the other

three recommended by OIE [IHHNV392F/R (Tang et al., 2000), IHHNV389F/R

13

(Tang and Lightner, 2006) and 309F/R (Tang et al., 2007)], 33.7% PL and 31.7%

adult shrimp possessed only type A-PstDV viral sequence while 22.8% PL and

10.5% adults had both type A and infectious type. DNA sequence analysis of PCR

products derived from the MG831F/R primers (832 bp) revealed linkage between

the PstDV sequences and various shrimp DNA microsatellites.

Recently, Krabsetsve and Owens (unpublished) screened 196 shrimp samples by

PCR using 3 OIE primers (IHHNV392F/R, IHHNV389F/R and 309F/R). The

samples made up of 158 shrimp (mainly P. monodon) collected from farms and

research institutes in northern Queensland between 1993 and 2009, 3 shrimp

imported from Brunei, and 35 shrimp (imported from New Caledonia, China,

Malaysia and Indonesia) purchased from fish shops in northern Queensland, during

2002 and 2009 (Table B.1, Appendix B). According to the results (Table B.2,

Appendix B), 124/158 samples (78.48%) of Australian shrimp, and 2/38 (5.26%) of

imported shrimp (only from Brunei) show positive result by the MG831F/R primers

indicating that they contain viral fragments in their genome. All samples from

Malaysia (10 shrimp) neither contain infectious type nor non-infectious type of

PstDV. By contrast, those from China and New Caledonia were most likely to carry

infectious PstDV as they give positive amplicons by all the 3 ORF primer sets

above. However, it is also possible that they just possessed independent inserts that

cover the target regions for all the 3 primers. Further assays to prove this hypothesis

are required.

2.3.1.2. Insertion pattern of PstDV elements in shrimp genome

Scattered reports of PstDV-related sequences inserted in shrimp (Tang and Lightner,

2006; Tang et al., 2007; Rai et al., 2009) opened up the question as to whether it

forms only one way or in a variety of ways (Saksmerprome et al., 2011) To answer

the question, Saksmerprome et al. (2011) screened 99 shrimp (P. monodon) using

PCR employing 7 overlapping primer pairs designed to cover 90% of the PstDV

genome (GenBank No. AF273215). All shrimp were collected from a shrimp

hatchery in Thailand. PCR failure with some pairs indicated sequence gaps that

14

revealed a random pattern of putative viral inserts in the genomes of individual

shrimp. Genome walking with one putative insert showed that the insert was

associated with the host microsatellites (thrombospondin-like expressed sequence

taq, EST of P. monodon: CF805583). The microsatellites reported differed from

those previously identified for the other PstDV inserts in P. monodon (Tang and

Lightner, 2006; Tang et al., 2007). This finding together with no pattern in the

number and length of inserts support the hypothesis that the insertion of viral DNA

may occur autonomously in a random manner and mostly likely occurs in repetitive

or transposon-like elements of the host chromosome (Flegel, 2009). PstDV-related

sequences have also been found in the genome of Cherax quadricarinatus

(Australian redclaw crayfish) (Rusaini et al., 2013).

A recent search for homologs of parvoviral proteins in publicly available eukaryotic

genome databases followed by experimental verification and phylogenetic analysis

revealed that several parvovirus-related DNA sequences were presented in the germ

lines of diverse animal species, including mammals, birds, fishes, arthropods, and

flatworms. Some of them were expressed, suggesting that these viral DNA

fragments are also functional in the host genomes (Liu et al., 2011).

As for PstDV, rather than causing mortality to P. monodon, it survives persistently

and becomes endogenized (see above). Although the reasons behind this

phenomenon remains unclear, accumulating evidence regarding the EVEs suggests

that the PstDV endogenized sequences, may be involved in viral control mediated

by a host RNA interference mechanism (Flegel, 2009). However, this hypothesis

needs further studies to prove. The multiple hosts of endogenous PstDV are similar

to those of other non-retroviruses including parvoviruses. This phenomenon

supports the assumption stating that “almost any major type of eukaryotic virus may

be endogenized, sometime in multiple hosts independently and over wide

evolutionally periods” (Feschotte and Gilbert, 2012).

15

2.3.1.3. PCR detection and false positive results arising from viral inserts

As almost all parts of the PstDV genome have been found integrated, many PCR

primers have inevitably given false positive results and this includes the 309F/R

primers (Tang et al., 2007) which are currently being recommended by OIE. Tthe

widely used IQ2000TM

detection kit (Intelligene, Taiwan) also shows a high

prevalence of 76% for shrimp collected from Thailand (Saksmerprome et al., 2011),

and a low prevalence with 5 % to 8% for shrimp sampled from Africa and Australia

(http://www.iq2000kit.com/news_detail.php?gid=1&nid=1). Since the nested

primers for the IQ2000 TM

kit are designed in the same region of the 309F/R primers,

the same level of false positive results with the samples tested would probably occur

(Saksmerprome et al., 2011).

False positives caused by the inserts occurred with the OIE primers and the

IQ2000TM

kit could lead to a negative impact on international shrimp trade and

disease quarantine management. Thus, more reliable and specific detection protocols

are required.

2.3.1.4. Recombinase polymerase amplification and lateral flow dipstick assay:

alternative approaches for PstDV detection

Recombinase polymerase amplification (RPA) is a novel approach for rapid and

specific DNA amplification. Unlike standard PCR, RPA amplifies DNA under

single temperature range (37–42 °C) (Piepenburg et al., 2006). Therefore,

sophisticated thermal cyclers are not required. Unlike other DNA isothermal

technologies including loop mediated DNA isothermal amplification (LAMP) which

use 4–6 primers working with Bacillus stearothermophilus (Bst) DNA polymerase

to synthesize various sizes of DNA amplicons comprising concatenated inverted

repeats of target DNA (Notomi et al., 2000), RPA employs phage-derived

recombinase working with single-strand DNA binding protein (SSB) to direct two

primers to a homologous target sequence in a DNA template. This is coupled to a

Staphylococcus aureus-derived DNA polymerase (Sau DNA polymerase) possessing

16

strand displacement activity to generate double-stranded DNA (dsDNA) in a similar

way to PCR (Figure. 2.3) (Shibata et al., 1979; Yonesaki et al., 1985; Formosa and

Alberts, 1986; Piepenburg et al., 2006). The RPA protocol reduces complications

associated with reaction preparation found in PCR and LAMP. To illustrate this

point, the RPA reaction system is provided in a stabilized dried format which

permits transportation and limited storage without refrigeration

(http://www.twistdx.co.uk/our_technology/). In addition, the reaction can be set up

at room temperature, with no requirement for cooling. Together with the

requirement of only a simple heating block for maintaining the reaction, RPA

provides qualitative DNA testing without the need of a laboratory (Jaroenram and

Owens, 2014). RPA products can be detected by acrylamide gel electrophoresis

(AGE) or in real-time (Euler et al., 2012; Boyle et al., 2013; Euler et al., 2013).

Alternatively, they can be visualized simply by a lateral flow dipstick (LFD) assay

(Milenia Biotec, Giessen, Germany).

17

Figure 2.3: Mechanism of recombinase polymerase amplification (RPA). The RPA

mechanism is driven by the three core proteins (recombinase, single-

strand DNA binding protein (SSB) and strand-displacing polymerase)

working under isothermal temperature with no requirement for an initial

chemical or thermal melting step. This diagram was created by TwistDx

Ltd (http://www.twistdx.co.uk/our_technology/) and is licensed under a

Creative Commons Attribution 3.0 United States License.

18

The lateral flow dipstick (LFD) assay is a technique intended to detect the presence

or absence of a target analyte in samples using the principle of hybridization and

chromatography in membrane strips without the need for specialized and costly

equipment (Milenia Biotec, Giessen, Germany). The assay can be applied to detect

any DNA of interest, and the read-out is visualised by eye (Jaroenram et al., 2009).

For the Milenia® HybriDetect LFD which was used in this study, it is a universal test

dipstick designed to develop qualitative test systems for several analytes. However,

to use this dipstick format, the user needs to develop an analyte-specific solution,

which contains a first detector (e.g. antibody, specific probe) labelled with

fluorescein isothiocyanate (FITC), and a second one (e.g. antibody, primers) labelled

with biotin. The working principle of the Milenia®

HybriDetect LFD is depicted in

Figure 2.4. Briefly, a ready-to-use strip precoated with nanogold particles, anti-FITC

antibody and biotin ligand is prepared (Step 1). The sample to be determined (e.g.

protein, gene amplicons) is mixed with the developed analyte-specific solution (Step

2). The dipstick is dipped into the solution, and the result is read after a 5-min

incubation (Step 3-4). In these steps, the complexed analyte carrying FITC and

biotin binds first to the gold-labeled FITC-specific antibodies in the sample

application area of the dipstick. By capillary force, the gold complexes diffuse over

the membrane. Only the analyte-captured gold particles will bind when they

overflow the immobilized biotin-ligand molecules at the test band and generate a

visible red-purple colour. Unbound gold particles further migrate then to be fixed at

the control band by species-specific antibodies resulting in a read as a control line.

This technique can be carried out within 10 min, about 5-10 times faster than gel

electrophoresis (including gel preparation). Its additional advantage is confirmation

of DNA identity by hybridization. This feature could help eliminating the false

positive results arising from nonspecific amplification (Jaroenram et al., 2009).

Altogether, combining LFD with RPA would further increase the simplicity and

efficiency of detection protocols.

To date, the combined protocol has been reported to detect only two pathogens:

Plasmodium falciparum (Kersting et al., 2014) and methicillin-resistant

Staphylococcus aureus (Piepenburg et al., 2006). Thus, exploring the possibility of

19

using the combined protocol to detect other pathogens including PstDV is

interesting.

Figure 2.4: The working principle of the Milenia®

HybriDetect LFD.

20

2.3.2. Current problems in control of PstDV outbreaks: Lack of understanding

of the diversity and population dynamics of PstDV

Understanding the genetic diversity of PstDV is significantly important as it helps to

gain insights into evolution and population dynamics, and consequently may help

contribute toward better strategies to counter the virus.

In 2003, a test to evaluate the level of genetic diversity of PstDV genome was

conducted using 14 isolates collected from penaeid shrimp in SE Asia (Philippines,

Thailand and Taiwan), the Americas (Hawaii, Mexico, Colombia, Ecuador and

Panama) and Africa (Tanzania, Madagascar and Mauritius) during the year 1996-

2001 (Tang et al., 2003). Based on the sequence analysis of a 2.9-kb fragment of

PstDV DNA covering ORF1, ORF2 and ORF3, the Hawaii isolate showed a very

high nt identity to the Philippine (99.8%) and the Thai isolates (96.2%). This

observation supports the assumption that the PstDV circulating in the USA had

originated from Philippines (Lightner, 1996a; Tang et al., 2003). In contrast, the

Hawaii isolate showed great divergence to the Tanzanian (8.2%) and the

Madagascan isolates (14.1%). The notably high sequence divergences observed with

the Tanzania and the Madagascar isolates might result from the virus-related

sequences which were later found in the genome of P. monodon from these two

countries (Tang and Lightner, 2006) (see section 2.3.1.1).

At roughly the same time, a similar study (in terms of methodology and analysis)

was conducted by the same research group (Tang and Lightner, 2002b). By using 14

PstDV isolates collected from cultured shrimp stocks in only the Americas (USA;

Hawaii and Texas, Mexico, Colombia, Ecuador and Panama) between 1982 and

1997, less than 0.5% nt sequence divergence was observed (i.e. 99.6 - 100%

similarity) (Tang and Lightner, 2002b). Although 14 out of 25 nt substitutions

observed resulted in aa changes, there was no significant association between

clinical outcomes and any particular aa substitutions. According to the authors, the

results therein lead to the suggestion that the high stability of the PstDV genome

among the 14 isolates over the period examined is due to “the development of a

21

more balanced host-pathogen relationship”. This suggestion was supported by the

observation that no high mortalities of cultivated shrimp caused by PstDV have been

recorded on the Pacific coast of USA and Mexico after the epizootics of 1990s

(Morales-Covarrubias et al., 1999). They stated that “L. stylirostris has developed

resistance to IHHNV and/or the virus has reached an equilibrium with the host in

terms of genes related to virulence” (Morales-Covarrubias et al., 1999; Tang and

Lightner, 2002b; Robles-Sikisaka et al., 2010).

However, the Tang and Lightner (2002b) conclusion was based on only 14 samples

from the one genetic lineage. Additionally, quantitative measurement of a current

degree of genetic variation in terms of the underlying evolutionary processes i.e.

mutation, genetic drift, gene flow was not conducted. Recently, Robles-Sikisaka et

al. (2010) have presented contrasting results to the Tang and Lightner’s study

(2002b). By comparing the capsid protein (CP) gene sequence of 89 penaeid shrimp

(P. stylirostris, P. vannamei and Farfantepenaeus californiensis) collected from

locations in the north-western Pacific coast of Mexico between 2004 and 2005 with

14 published sequences of PstDV CP gene (P. stylirostris and P. monodon from

different geographic locations) using Bayesian coalescent approaches, an

unexpected high mean rate of nt substitution (1.39x10-4

substitutions/site/year) was

discovered. This was comparable to nt substitution rate of RNA viruses. The degree

of nt diversity was also high, almost 5 times greater than those reported previously

(Tang et al., 2003), and not uniform across geographic regions. The presence of

several quickly evolving lineages in the north-western Pacific coast of Mexico might

be viewed as geographic ‘‘hotspots’’ of PstDV diversity that could lead to the

emergence of virulent strains following changes in the host or environmental

conditions (Robles-Sikisaka et al., 2010).

In Australia, PstDV has been reported officially since 1991 (Owens et al., 1992)

despite this country being geographically isolated with strict quarantine policies to

control/avoid the importation of live shrimp from overseas. Comparison of the PCR

fragment derived from the Australian PstDV strain isolated from P. monodon from a

22

farm in northern Queensland in 1993 (GenBank No. AY590120) with other

geographical isolates revealed that the PCR fragment shared the highest nt similarity

(96.2%) to the Madagascar isolate, and it shared the highest nt divergence to the

Hawaiian and New Caledonian strains (90.1% and 90.3%, respectively (Krabsetsve

et al., 2004). In contrast to these results, comparison of the maximum possible

portion of PCR fragments (2814 bp) generated from the Australian PstDV

(GenBank No. GQ475529) isolated from the same area but in 2008 with 8 GenBank

records of PstDV isolates reported from Asia revealed 94–95% identity in nt

sequence and 96 to 97% identity in aa sequence (Saksmerprome et al., 2010). This

result indicates that sequence of this isolate (GenBank No. GQ475529) has high

identity to those of PstDV from nearby areas in SE Asia. Based on the contradictory

reports by the two research groups, it may be able to conclude that there are two

different PstDV lineages in Australia: one has a geological time frame and one has a

contemporary time frame. This is based on a high nt variation between the

Australian and Hawaii isolates reported by Krabsetsve et al. (2004) which is

geologically endemic in Australian P. monodon, and the other is a new SE Asian

strain introduction which has been recently reported by Saksmerprome et al (2010).

It unlikely the endemic strain was an endogenous viral element (EVE) as its whole

genome was later sequenced and submitted to GenBank database with an accession

No. EU675312.

As the two PstDV genetic variants mentioned above have been circulating in the

same region (northern Queensland), it led to the question as to whether or not their

genetic compositions reciprocally affect each other’s evolution. If they do, do they

lead to viral recombination and/or emergence of new virulent strains? Answering

these questions is important as it can pave the way to uncover the underlying

evolution and population dynamics of PstDV in Australia. This knowledge is

essential for implementing the monitoring and control measures to limit the spread

of the pathogen (i.e. restrict shrimp movement or transportation), particularly in

Australia and Indo-Pacific region where the marine environment and fauna are

shared. Understanding the impact that evolutionary processes have on the patterns of

genetic variation within and among PstDV populations, and understanding the

23

consequences of these patterns of genetic variation for various evolutionary

processes is also important and need to be studied.

2.4. Concluding remarks

The shrimp aquaculture industry is a major business carried out worldwide.

Unfortunately, it is under the serious threat of viral diseases including that caused by

PstDV. PstDV causes mass mortality in P. stylirostris, and RDS-associated stunted

growth in P. vannamei and P. monodon, resulting in a huge devastation in each

cycle of production. Despite several approaches to viral disease prevention,

outbreaks of PstDV have occurred. Success in circumvention of PstDV outbreaks

requires proper consideration and fulfillment of several areas which include, but not

limited to 1) Requirement for more reliable diagnostic approaches for seed screening

and biosecurity. 2) Requirement for the understanding of PstDV evolution and

population dynamics for effective implementation of monitoring and control

measures. This study aims to address two issues with the hope that the knowledge

will contribute toward better strategies to counter PstDV.

24

CHAPTER 3

GENERAL MATERIALS AND METHODS

The methods and materials described in this chapter were common and used in more

than one experimental chapter of the thesis. Those used only in one experiment were

described in the chapter to which they belong.

3.1. Preparation of total DNA extract

Total DNA extracts were prepared from PstDV-infected shrimp using Isolate II

Genomic DNA Kit (Bioline, London, UK) according to the manufacturer's protocol

with minor modification. Briefly, approximately 25 mg of samples (e.g. pleopods or

gills) was homogenised in 180 µl Lysis Buffer GL mixed with 25 µl Proteinase K

solution. After incubation at room temperature for 3 h, the homogenate was added

with 200 µl of Lysis Buffer G3 then incubated at 70 °C for 10 min followed by

adding 210 µl of 95% ethanol and mixing vigorously. Then, the homogenate-ethanol

mixture was transferred into reservoir of a combined spin column–collection tube

assembly and centrifuged at 11,000 × g for 1 min. After the column was emptied, it

was washed twice with 500 µl of wash buffer and dried by spinning at 11,000 × g

for 2 min to remove ethanol residue. The spin column was assembled to a new

microcentrifuge tube then was added with 100 µl of 70° C preheated elution buffer.

After 2 min incubation at room temperature, the column was centrifugation at

11,000 × g for 1 min, and then the flow-through containing total DNA was stored at

-20° C until use. To measure the quality and quantity of DNA extract, 2 µl of the

extract was spectrophotometrically analysed at 260 nm and 280 nm using

Nanophotometer (Implen GmbH, Germany). The concentration of the DNA was

adjusted to 50 ng/µl by nuclease-free water, and the DNA solution was subject to

further experiments as appropriate.

25

3.2. Preparation of total RNA extract

Total RNA extracts used in this study were extracted from shrimp infected with

viruses of interest (e.g. gill-associated virus, GAV; Taura syndrome virus, TSV;

Macrobrachium rosenbergii nodavirus, MrNV) using SV total RNA isolation

system (Promega, Madison, USA) with minor modifications. Briefly, approximately

50 mg of samples (either pleopods or gills) were homogenised in 175 µl RNA lysis

buffer followed by addition of 350 µl RNA dilution buffer. After centrifugation for

10 min at 12,000 × g, the supernatant was transferred to a 1.5-ml microcentrifuge

tube containing 200 µl of 95% ethanol. The mixture was mixed vigorously, and

transferred into reservoir of a combined spin column–collection tube assembly

which was subsequently centrifuged at 12,000 × g for 1 min. The column was then

added with freshly prepared DNase incubation mix (40 µl of yellow core buffer, 5 µl

of 90 mM MgCl2 and 5 µl of DNase I), and incubated for 15 min at room

temperature followed by the addition of 200 µl of DNase stop solution, and 1-min

centrifugation at 12,000 × g, respectively. After the column was emptied, it was

washed twice with 500 µl RNA wash solution then dried by spinning at 12,000 × g

for 2 min to remove ethanol residue. The spin column was assembled to a new

microcentrifuge tube, and was added with 100 µl of nuclease free water. After 1-min

centrifugation at 12,000 × g, the flow-through containing total RNA was

quantitatively and qualitatively analysed in the same manner of DNA, then stored at

-20˚C until used.

3.3. PCR amplification and gel electrophoresis

Unless otherwise stated, a standard PCR protocol for amplifying any target DNA

described in this thesis was performed as follows: 1) Prepare PCR mixture

containing 1× MyFi PCR buffer, 2U MyFiTM

Taq DNA Polymerase (Bioline,

London, UK), 0.4 µM each forward and reverse primer, , the specified amount of

DNA template and DNase-free water to a final concentration of 25 μl. 2) Amplify

target DNA under the thermal profile consisting of 3-min initial denaturation at

94°C, followed by 39 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 90 s, with

26

a final extension at 72°C for 5 min. 3) Visualize PCR products by 1% TAE agarose

gel electrophoresis (AGE).

3.4. Cloning and sequencing

To perform DNA cloning and sequencing, after DNA sequences were amplified and

analysed by AGE, the PCR amplicons were extracted and purified from agarose gels

using Wizard® SV Gel and PCR Clean-Up system and ligated directly into plasmid

pGEM®-T Easy Vector (Promega, Madison, USA) according to the manufacturer's

protocol. The recombinant plasmid was cloned into JM109 Escherichia coli

competent cells (Promega, Madison, USA), and further amplified for 16 h in

Lysogeny broth (LB) (2 ml) containing 100 µg/ml of ampicillin following the

manufacturer’s protocol. The plasmid was extracted using Wizard® Plus SV

Minipreps DNA Purification System (Promega, Madison, USA). Sequencing of both

strands of DNA plasmids (5-6 clones/PCR fragment) was performed by Macrogen

Inc. (South Korea) using T7 and SP6 universal primers. The obtained sequences

were subject to further analysis as appropriate.

27

CHAPTER 4

PROFILING OF ENDOGENOUS VIRAL ELEMENTS IN THE GENOME

OF AUSTRALIAN PENAEUS MONODON

4.1. Introduction

The main objective of this study was to develop a novel molecular approach for

detecting PstDV. In general, selecting target DNA sequences is a key aspect for

developing any DNA detection system, as it is central to determining the specificity

of a diagnostic assay. It is known that the selection process can be done simply by

detecting appropriate DNA sequences which truly represent the living organism of

interest. However, this concept is exceptionally difficult for PstDV due to the

presence of its non-infectious forms, i.e. PstDV-related sequences, which are part of

shrimp genome (endogenous viral elements, EVEs). PstDV-related sequences

caused false positive results in many PCR detection protocols, including the

commonly accepted and widely used IQ2000TM

PCR detection kit (Intelligene,

Taiwan) (See Chapter 2.3.1.3).

A recent study by Saksmerprome et al. (2011) revealed that all parts of the PstDV

genome (except for hairpin ends which were not examined) were found to be

endogenised, suggesting that they may lead to false positive results for infectious

PstDV using not only the IQ2000TM

kit but also any other DNA-based detection

protocols reported thus far. It also revealed that the capsid gene of PstDV at the nt

position 3031–3625 (hereafter call the “3031-3625” region) (Mexican isolate,

GenBank No. AF273215) was least likely to produce inserts (only ~4% of false

positive rate was detected). However, the mechanism underling this phenomenon

remains unclear. Moreover, this finding was based on P. monodon collected only

from Thailand. This information stimulates the question as to whether or not such an

insertion pattern is common and consistent across different geographical lines of the

shrimp. If it is, the “3031-3625” region would be an alternative, promising target

28

DNA sequence for designing a more specific detection protocol for PstDV. To

answer the question, the experiments herein were conducted.

4.2. Materials and methods

4.2.1. Shrimp samples and DNA temple preparation

Shrimp samples (P. monodon) were obtained from 2 farms in northern Queensland

in October 2012. These farms showed no sign of PstDV infection i.e. RDS

associated slow growth syndrome. All prawns were progeny from wild caught

broodstock; 75% from the eastern coast of Queensland and 25% from Northern

Territory (personal communication with the farms). Most ponds have the progeny of

2-4 female broodstock to fill them. They were frozen and shipped to College of

Public Health, Medical and Veterinary Sciences, James Cook University. A total of

130 individual shrimp: 80 from four ponds of farm A (26, 25, 25 and four

prawns/pond), and 50 from two ponds of farm B (25 prawns each) were randomly

selected for DNA extraction. Total DNA was prepared according to the protocol

mentioned in Chapter 3.1. Two microliters of the template (50 ng/µl) were used in

the following experiments.

4.2.2. PCR detection of PstDV-related sequences in shrimp genome

All of the 130 shrimp samples were screened by PCR assays (See Chapter 3.3)

employing 8 overlapping primer pairs designed to cover the whole genome of

PstDV (minus the hairpin ends). Pairs 1-7 and 8 (ihhnA_3168/ihhnA_R3759) were

adopted from two studies by Saksmerprome et al., 2011 and 2012, respectively

29

4.3. Results

The results of PstDV insert screening are summarized in Table 4 (see Table C.1-C.3,

Appendix C, for detail of each farm and background of shrimp examined). Based on

the criteria, adopted from Saksmerprome et al. (2011), that shrimp with positive

results for amplicons using all 8 primer pairs were considered to be positive for

infectious PstDV (the whole genome was amplified), whereas those showing

incomplete results (for only some primer pairs, reflecting “gaps”) were considered

as false test positive (the whole viral genome could not be amplified), probably

arising from viral inserts, 13 of the 130 samples (all from Farm A) produced

amplicons for all of 8 primer pairs, suggesting that they contained infectious PstDV.

These samples were further subject to the evolutionary study in Chapter 6. The

remaining 117 samples gave negative results for one or more of the primer pairs

(Table 4), suggesting that the shrimp were not infected with PstDV but carried 1–7

partial fragments of the PstDV DNA, probably inserted into their genomic DNA. Of

the 117 samples, region 2 was found to insert in most of samples (111 shrimp),

accounting for 94.9% or approximately 5% greater than region 1, while the rest were

found in < 10 samples (< 6%). Interestingly, region 7 (the “3031–3625” region) was

detected in only one sample (0.85%) suggesting that it is least likely to be

endogenized. Further analysis was carried out on 20 arbitrarily selected samples

possessing gaps in the PstDV genome using PCR with the MG831F/R primers

specific for PstDV DNA-linked shrimp genomic DNA (Tang and Lightner, 2006).

Eight samples showed positive test results, indicating the presence of EVEs in their

genome, while the rest gave negative test results, which can be explained as PstDV-

related sequences may be associated with other regions on shrimp genomes which

the primers cannot anneal to (data not shown). However, further analysis of these

samples was not conducted as the aim of this study is to identify the sequence that

least likely to produce inserts only.

30

Table 4: Positive (+) and negative (−) PCR results obtained with DNA templates from 130 P. monodon using 8 overlapping primer sets that

targeted the whole genome of PstDV. In column 1, the number in brackets indicates the number of shrimp with the same pattern of

positive and negative results. For example, in “Pattern 8”, 3 samples have an identical pattern of positive and negative results.

Isolate (#)

Primer pairs used and positions relative to Mexican PstDV isolate (AF273215)

1 2 3 4 5 6 7 8

158-723 702-1260 1059-1507 1451-2027 2002-2569 2544-3100 3031-3625 3168-3759

Infective PstDV (total 13 samples)

Pattern 1 (13) + + + + + + + +

Seven inserts (1 gap) (total 1 sample)

Pattern 2 (1) + + - + + + + +

Six inserts (2 gaps) (total 4 samples)

Pattern 3 (4) + + + + + + - -

Four inserts (4 gaps) (total 2 samples)

Pattern 4 (1) + + - - - + - +

Pattern 5 (1) + + - + - + - -

Three inserts (5 gaps) (total 6 samples)

Pattern 6 (1) + - - - - + - +

Pattern 7 (1) + + + - - - - -

Pattern 8 (3) + + - - - - - +

Pattern 9 (1) + + - + - - - -

Two inserts (6 gaps) (total 91 samples)

Pattern 10 (91) + + - - - - - -

One insert (7 gaps) (total 9 samples)

Pattern 11 (8) - + - - - - - -

Pattern 12 (1) + - - - - - - -

No insert (total 4 samples)

Pattern 13 (4) - - - - - - - -

% Total positive results by each primer pair

118/130 = 90.8 124/130 = 95.4 18/130 = 13.6 20/130 = 15.4 18/130 = 13.9 21/130 = 16.2 14/130 = 10.8 19/130 = 14.6

% Total inserts by each primer pair

105/117 = 89.7 111/117 = 94.9 5/117 = 4.3 7/117 = 6.0 5/117 = 4.3 8/117 = 6.8 1/117 = 0.9 6/117 = 5.1

31

4.4. Discussion

Scattered reports of viral inserts in the genome of shrimp (De la Vega, 2006; Tang

and Lightner, 2006; Huang et al., 2008), crayfish (Rusaini et al., 2013) and insect

(Lin et al., 1999; Crochu et al., 2004; Koyama et al., 2010) genomes led to the

hypothesis that random, autonomous insertion of such sequences occurs in these

organisms and leads to specific, heritable immunity (Flegel, 2009). To test a

prediction of that hypothesis regarding random insertion of viral sequences into the

shrimp genome, Saksmerprome et al (2011) examined Thai P. monodon for random

genomic insertions of PstDV. By PCR analysis using multiple overlapping primer

pairs to cover the whole PstDV genome, PCR failure with some pairs indicated

sequence gaps that revealed a random pattern of putative viral inserts in the genomes

of individual shrimp occurred in a variety of ways (i.e. insertion). Using the same

PCR detection methodology with 130 P. monodon collected from farms in northern

Queensland, Australia, in 2012 (this study), only 13 samples were successfully

amplified by all primers, suggesting that a random pattern of gaps was present in all

the remaining samples (Table 4).

It is unlikely that the high frequency of putative gaps that we found resulted from

mismatches between primers and target templates as the primers used accommodate

the Australian PstDV (GenBank No. GQ475529 and EU675312). It was also very

unlikely that these putative gaps were from DNA degradation, since it should occur

randomly and be probabilistically distributed evenly over the whole genome in any

template DNA from a viral population; it would be unlikely for degradation to occur

selectively in specific regions of the PstDV genome in different individual shrimp

samples. Based on the arguments above and on the accumulating evidence regarding

EVEs in more recent publications (Tang and Lightner, 2006; Tang et al., 2007;

Flegel, 2009; Saksmerprome et al., 2011), together with the consistency of the PCR

results for the 8 PstDV genome regions for 13 of the shrimp, the simplest

explanation for random failures with the other 117 specimens was that they

indicated gaps or absences of portions of the PstDV genome.

32

Clearly seen in Table 4, region 7 (the “3031–3625” region) was detected in only one

sample (0.85%) suggesting that it is least likely to be endogenised. This finding is in

accordance with a recent study on the profiling of PstDV insertion examined in Thai

P. monodon (Saksmerprome et al., 2011). It indicates the common characteristics of

the insertion pattern across different geographical isolates of the shrimp, and offers

the opportunities for developing a more specific approach for PstDV detection. To

illustrate this point, the design of primers or DNA probes for a PCR detection

method focused on this area would be least likely to give a false test positive result

for the samples that we examined i.e., 1/117 (0.9%) instead of 105/117 (~90%) and

111/117 (~95%) for regions 1 and 2, respectively. In addition, using a multiplexed

method focused on regions 3 and 7 would theoretically eliminate false positives.

However, this concept was based on the insertion profile found in P. monodon. To

apply it to other species of shrimp (i.e. P. vannamei) or other species of animals (i.e.

crab and crayfish), which may possess different patterns of EVEs, constructing “gap

maps”, such as that shown in Table 4, may be needed to aid the selection of the most

suitable target DNA sequence that represents only the infectious PstDV. Another

way to eliminate false positive test results arising from EVEs is to detect the whole

genome of the virus by using, but not limited to, the 8-overlapping PCR primer

method described herein. However, the complexity and cost of 8 separate PCR

reactions is not attractive. Thus, having simple and robust methods suitable for

routine diagnosis such as LAMP (Jaroenram et al., 2009; Arunrut et al., 2011;

Jaroenram et al., 2012) and RPA (Piepenburg et al., 2006; Euler et al., 2012; Boyle

et al., 2013) would be useful.

In conclusion, we have explored and mapped the insertion patterns of PstDV-related

sequences inserted in the genome of Australian P. monodon, and we have found a

particular region in the PstDV capsid gene that is least likely to be endogenised (the

“3031–3625” region). We speculated that the capsid gene is largely cytoplasmic and

has little opportunity to interact with the shrimp genome and therefore integrates less

often. Further researches to elucidate the insertion mechanism would be particularly

informative. The “3031–3625” region was used as a target sequence to develop a

novel PstDV detection platform described in the next chapter.

33

CHAPTER 5

RECOMBINASE POLYMERASE AMPLIFICATION COMBINED WITH A

LATERAL FLOW DIPSTICK FOR DETECTION OF INFECTIOUS

PENAEUS STYLIROSTRIS DENSOVIRUS

5.1. Introduction

It is known that current PCR protocols including the OIE method detect non-

infectious PstDV-inserts found in P. monodon (Saksmerprome et al., 2011) (See

Chapter 2.3.1.3). The implications of false positives by using the method leads to a

negative impact on international shrimp trade and disease quarantine management.

Thus, more reliable detection platforms are required. Referring to the previous

Chapter, the sequence on the PstDV capsid gene at the nt position 3031–3625

(Genbank No. AF273215) is least likely to produce inserts (only 0.85% of false

positive rate was detected). This region offers opportunities for developing a more

specific approach for PstDV detection. In addition to specific detection systems,

having simple and robust methods suitable for routine and on-site diagnosis is also

crucial to provide appropriate control measures for the virus, especially for an early

response to an outbreak.

RPA-LFD is an alternative to PCR for disease diagnosis (Piepenburg et al., 2006;

Kersting et al., 2014) (see Chapter 2.3.1.4). To the best of our knowledge, the RPA-

LFD has not been used to detect any shrimp pathogen. Together with the serious

issue of viral insertions mentioned previously (Chapter 2.3.1.3), the approach was

examined here to determine whether it would detect PstDV rapidly and reduce

efficiently false positive results arising from viral inserts. The approach focuses the

PstDV capsid gene described above. Its working principle is illustrated in Figure

5.1.

34

Figure 5.1: Schematic representation of RPA–LFD principle for the detection of

PstDV. The strategy was inspired by Piepenburg et al. (2006).

Our RPA-LFD protocol was illustrated (Figure 5.1) in a stepwise approach: (A)

amplifying fluorescein amidite (FAM)-biotin-linking PstDV-derived DNA

amplicons. In the presence of target DNA template (nt position 3094–3214 on

PstDV ORF3, dark gray filled box), recombinase driven primers (Biotin labeled

RPA1F/RPA1R) first generate templates for the annealing of the nfo probe (see

Section 5.2.4). In the resulting double strand context, nfo endonuclease presented in

the TwistAmp nfo kit (TwistDX, Cambridge, UK) recognizes the double-strand

hybridization complex and cuts the tetrahydrofuran (THF) residue, allowing the

probe to transform into an active reverse primer which subsequently works with the

biotinylated primer in generating RPA products under the autocycling strand

displacement activity of Sau DNA polymerase. The DNA amplicons produced

effectively co-join the two antigenic residues (FAM and biotin) in one DNA

molecule. (B) Detecting the RPA amplicons by LFD assay. In this step, the resulting

amplicons are mixed with the appropriate buffer (see Section 5.2.6). Upon dipping

35

the generic LFD strips (Milenia Biotec, Giessen, Germany) into the mixture, the

RPA amplicons are complexed with invisible gold-labeled anti-FAM antibodies

coated on the sample pad, then travel in a buffer stream to be trapped at the test line

by biotin-ligands, resulting in an appearance of red-pink color indicative of a

positive result. Non-captured gold particles move through the test line to be fixed at

the control line by anti-rabbit antibodies, and then produce colour serving as a flow

control for the strip. In the absence of PstDV target amplicons, colour will appear at

a control line only.

5.2. Materials and methods

5.2.1. Samples infected with PstDV

Frozen P. vannamei imported from China in 2012 were purchased from a local

supermarket in northern Queensland, Australia. The muscles collected from 10

individual arbitrarily selected shrimp were screened for the presence of PstDV using

the interim 3-tube nested PCR protocol designed to detect the whole genome of

PstDV (Saksmerprome et al., 2011). Samples with positive results were considered

to be positive for infectious PstDV (the entire genome was amplified). They were

subjected to the following experiments.

5.2.2. Total DNA temple preparation

Total DNA was extracted from muscles of PstDV-infected shrimp following the

protocol described in Chapter 3.1. Two microliters (50 ng/μl) of the DNA template

were used in RPA assays and recombinant plasmid construction.

5.2.3. Recombinant plasmid construction

The DNA sequences located between the nt positions 2544 and 3759 (1216 bp) of

the PstDV genome (GenBank No. AF273215) were amplified by PCR using

ihhnA_F2544/ihhnA_R3759 (Saksmerprome et al., 2010). The recombinant plasmid

36

containing the DNA fragment of interest was constructed, and purified according to

the standard protocol described in Chapter 3.4. The plasmid was diluted in 10-fold

serial dilutions to prepare stocks containing 5 × 109–0.5 copies/μl. Two microliters

of the template was used in optimized RPA–LFD reaction.

5.2.4. RPA primer and probe design

According to the appendix in the TwistAmp™ reaction kit manuals

(http://www.twistdx.co.uk/images/uploads/docs/Appendix.pdf), predicting the

amplification performance of a given oligonucleotide primer based purely on its

sequence is not yet possible for RPA, possibly due to a non-fully understood

mechanism of RPA. This is unlike PCR or LAMP. Therefore, it is recommended to

carry out a simple assay development process including the design and the screening

of a series of candidate primers and selection of a preferred primer pair. However,

we omitted this step as our RPA primers met our requirements satisfactorily. The

primers were manually designed following the TwistAmp™ reaction kit manuals

with additional criteria to PCR primer design as follows: (1) Primers typically are

30–35 nt long. Those shorter than 30 nt (i.e. PCR primers) or longer than 45 nt (i.e.

LAMP inner primers) do not work well. (2) Long tracks of guanines at the 5′ end

should be avoided, possibly because they are detrimental for the formation of

recombinase filaments. (3) Guanines and cytosines at the 3′ end are preferred as they

provide a more stable ‘clamped’ target for the polymerase. (4) Gibbs free energy

(ΔG) should be lower than −4 kcal/mol for both 5′ and 3′ ends of the primers.

Following these guidelines, the forward primer RPA1F with a 5′-biotine label (5′-

biotin-CAACAGCAGCAAACTATGAAGACCCAATCC-3′), and the normal

reverse primer RPA1R (5′-ATTTCTCCGCCATACCAATTTCTAGTGTCA-3′) for

the detection of PstDV were designed from the conserved sequence (nt 3094–3214)

within the “3031–3625” region of PstDV capsid gene (Mexican isolate, GenBank

No. AF273215) (see Table 4 and Section 4.4). A DNA probe used for the LFD assay

(hereafter called nfo probe) was designed from the sequence between RPA primers.

The probe consists of an upstream stretch (30 nt) carrying a 5′-FAM antigenic label,

which is connected via a THF spacer to an adjacent downstream oligonucleotide (15

nt) carrying a C3-spacer (polymerase extension blocking group) at its 3′ end (5′-

37

FAM-ACAATTTGGATTCATGGAACAAATGCGAAC-THF-

GGTGACAGAAAAGCCTATAC-C3-spacer-3′). The primers and the probe were

synthesized by Bio Basic, Canada.

5.2.5. RPA conditions and optimization

RPA was performed in a 50-μl volume using a TwistAmp nfo kit (TwistDX,

Cambridge, UK), 0.42 μM each RPA primer, 0.1 μM nfo probe, 14 mM magnesium

acetate, 1× rehydration buffer and DNase-free water. All reagents, except for DNA

template and magnesium acetate, were prepared in a master mix, which was

distributed into each 0.2-ml reaction tube containing a dried enzyme pellet.

Magnesium acetate was pipetted into the tube lids. Subsequently, 2 μl DNA

template was added to the tubes. The lids were closed, the magnesium acetate was

centrifuged into the tubes to initiate the RPA mechanism, and then the tubes were

incubated at the given conditions immediately.

To determine the optimum amplification temperature, the RPA reactions were

carried out on a heating block set at 35, 37 and 40 °C for 45 min using 100 copies

and 10 copies of plasmid DNA as temples followed by heat inactivation at 93 °C for

3 min. A reaction mixture without DNA template was included as a negative control.

The products were purified using Wizard® SV Gel and PCR Clean-Up System

(Promega, Madison, USA) then analyzed by 2% AGE. To define the optimum time

for amplification, the reactions were conducted at the optimal temperature for 20,

30, 45 and 60 min using various amounts of plasmid DNA as templates followed by

product purification and AGE analysis as mentioned above.

5.2.6. Lateral flow dipstick (LFD) assay

To detect RPA amplicons by LFD, 2 μl of RPA product was added to 120 μl of the

assay buffer (1X phosphate buffered saline with 0.1%Tween 20) in a new tube.

Then, the LFD strip (Milenia Biotec, Giessen, Germany) was dipped into the

38

mixture for 2 min to visualize the test result. The entire LFD assay was done at room

temperature.

5.2.7. Molecular specificity of RPA–LFD

The molecular specificity of RPA primers and probe was examined under the

optimal conditions using 100 ng of total DNA prepared from shrimp infected with

PstDV, Penaeus merguiensis densovirus (PmeDV) and WSSV, 100 ng of total RNA

extracted from shrimp infected with GAV, TSV, MrNV, and 100 ng of DNA

extracted PstDV-free shrimp as templates. The resulting products were analyzed by

LFD and AGE.

The ability of the LFD assay and AGE to discriminate PstDV-RPA products from

non-related DNA was also explored. RPA reactions containing various amounts of

PstDV-DNA (1 ng, 100 pg, 10 pg and 1 pg) were carried out at non-optimised

conditions (35 °C for 1½ h) to ensure that non-specific amplicons were produced.

Reactions with PstDV-free DNA and with no DNA were also included as negative

controls. The results by LFD and AGE were compared.

5.2.8. Molecular sensitivity of PRA by LFD and AGE

Ten fold serial dilutions of total DNA extracted from PstDV-infected shrimp (10 ng,

1 ng, 100 pg and 10 pg) and plasmid DNA (105, 10

4, 10

3, 10

2 and 10 copies) were

used as templates for RPA. The resulting DNA products analyzed by LFD and by

AGE were compared.

5.2.9. Molecular sensitivity of one-step PCR and nested PCR by AGE

Unless otherwise stated, only two commonly accepted, standard PCR protocols for

detection of infectious PstDV were used here. One was the one-step method

39

employing 309F/R primers (Tang et al., 2007) which was certified by OIE in the

Manual of Diagnostic Tests for Aquatic Animals 2010

(http://www.oie.int/international-standard-setting/aquatic-manual/access-online/)

which states, “Primer set 309F/R amplifies only a segment from IHHNV types 1 and

2 (the infectious forms of IHHNV), but not types 3A and 3B, which are non-

infectious and part of the P. monodon genome.” The other was the interim 3-tube

nested PCR by Saksmerprome et al. (2011) who claim that, “This method employed

3 overlapping primer sets designed to cover 89.5% of the IHHNV genome such that

positive result for the all three sets from a shrimp specimen would indicate the

presence of infectious IHHNV”. To determine the detection sensitivity, the same set

of total DNA dilutions tested by RPA–LFD was amplified by the two PCR protocols

mentioned above. The results by AGE were compared to those by RPA–LFD.

5.2.10. Reliability of RPA–LFD by statistical sensitivity and specificity analysis

Screening shrimp with unknown PstDV status by RPA–LFD and the interim 3-tube

nested PCR (reference method) was conducted using 96 frozen samples obtained

from shrimp farms in northern Queensland, Australia, and 21 samples arbitrarily

selected from imported shrimp purchased from local fish shops in Townsville,

Australia, between 2002 and 2013 (117 samples in total). The reason to use the

interim 3-tube nested PCR as a reference is because it detects the entire genome of

PstDV such that positive result from a shrimp specimen would indicate the presence

of infectious PstDV. Table 5.1 summarizes the test results by both assays relative to

background of the shrimp tested (i.e. origin, year of collection, and species of

shrimp). The results were used to evaluate the diagnostic performance of the RPA–

LFD protocol following equations given in Table 5.2.

40

5.3. Results

5.3.1. Determination of the RPA–LFD conditions

The optimal temperature for RPA reaction as determined using 100 copies and 10

copies of plasmid DNA as templates revealed no differences in amplification at 35,

37 or 40 °C (Figure 5.2A). Thus, 37 °C was selected arbitrarily as the standard assay

temperature. For RPA reactions performed at 37 °C for 20, 30, 45 and 60 min, DNA

quantity at 30 min was similar to that at 45 and 90 min but higher than that at 20 min

(Figure 5.2B). A reaction time of 30 min was thus selected as optimal.

Figure 5.2: Optimization of RPA reaction using 10-fold serially diluted PstDV-

recombinant plasmid DNA as template. (A) Optimization of reaction

temperature. (B) Optimization of reaction time. Lanes M and N:

molecular marker and negative control (DNase-free water), respectively.

41

5.3.2. Molecular specificity of RPA–LFD

For RPA primer and probe specificity testing at the optimal conditions, reactions

were performed using DNA or RNA from other important viruses of shrimp.

Clearly, no cross-reactions were found by LFD (Figure 5.3). The result was similar

to that by AGE (data not shown) indicating that the primers and the probe were

specific for PstDV detection. The ability of the LFD assay to discriminate its target

DNA from non-related DNA was also examined. AGE analysis of RPA products

yielded under non-optimal conditions identified ladder-like DNA patterns for both

PstDV DNA (1 ng–1 pg) and PstDV-free DNA (lane N1) (Figure 5.4A). In contrast,

the LFD assay gave strong positive results only for its target DNA as determined by

a 121-bp expected size of DNA on AGE (1 ng and 100 pg). With all other non-

specific amplicons, the LFD strips gave red-purple color at only the control line

(Figure 5.4B).

Figure 5.3: Molecular specificity of RPA–LFD carried out using shrimp viruses as

template. N: total DNA extracted PstDV-free shrimp (negative control).

42

Figure 5.4: Comparison between the LFD assay and AGE for detecting PstDV-RPA

products. (A) AGE results for RPA amplicons amplified under non-

optimal conditions using various amounts of DNA as template. M:

molecular marker, P: positive control (100 ng DNA extracted

from PstDV-infected shrimp), 1 ng, 100 pg, 10 pg and 1 pg: dilution

series of DNA prepared from PstDV-infected shrimp, N1: negative

control sample (100 ng of DNA extracted from PstDV-free shrimp from

Brunei), N2: no-template control (DNase-free water). (B) LFD assay

results for the same RPA amplicons as in (A) except the positive control

reaction.

5.3.3. Comparative molecular sensitivity of the RPA/AGE, RPA/LFD,

PCR/AGE and nested RT-PCR/AGE

RPA–LFD using 10-fold serial DNA dilutions (total DNA extracts) identified a

detection limit of 100 pg shrimp total DNA (Figure 5.5A). This was comparable to

the detection limit of RPA-AGE (Figure 5.5B) and 10 times greater than that of one-

step PCR (Figure 5.7A) and nested PCR (Figure 5.7B) (See figure caption for

interpretation of results). Using the recombinant plasmids as templates, the RPA–

LFD revealed a detection limit with strong positive signal at 100 copies (Figure

43

5.6A) while the AGE gave a faint band (Figure 5.6B). This result indicated that LFD

detection could confirm the RPA products when the detection by AGE was not

clear.

Figure 5.5: Molecular sensitivity test results of RPA using 10-fold serially diluted

total DNA extracted from PstDV-infected shrimp as template. (A)

Results by LFD. (B) Results by AGE for the same RPA amplicons as in

(A). Lanes M and N: molecular marker and negative control (DNase-

free water), respectively.

44

Figure 5.6: Molecular sensitivity test results of RPA using 10-fold serially diluted

plasmid DNA as templates. (A) Results by LFD. (B) Results by AGE

for the same RPA products as in (A). Lanes M and N: molecular marker

and negative control (DNase-free water), respectively.

45

Figure 5.7: Molecular sensitivity of PCR and nested-PCR carried out using various

amounts of PstDV-DNA as template. (A) One-step PCR using the 309F/R

primer method. (B) Interim 3-tube nested PCR employing three

overlapping primer pairs covering the whole PstDV genome. To

determine the detection limit of this protocol, all the 3 primer sets must be

taken into consideration. As the lowest detection limit of the primer pair 1

and pair 3 was 1 ng, the detection sensitivity of the whole system was

therefore given to 1 ng. Lanes M and N: molecular marker and negative

control (DNase-free water), respectively.

5.3.4. Reliability of RPA–LFD by statistical sensitivity and specificity analysis

The number of shrimp, and PstDV status of shrimp as determined by the reference

assay (an interim 3-tube nested PCR), and the RPA-LFD protocol (Table 5.1) were

used to evaluate the diagnostic performance of the RPA-LFD assay. The results

were shown in Table 5.2, among 117 samples with unknown PstDV status, 32 were

identified as positive and 85 identified as negative for PstDV by the reference

method. For the 32 PCR–positive samples, RPA–LFD agreed 100% with the PCR

results, indicating a statistical sensitivity of 100% (i.e. the ability of the RPA–LFD

to identify correctly the actual PstDV-positive shrimp tested is 100%). Among the

85 PCR-negative samples, 80 were negative with RPA–LFD, indicating a statistical

46

specificity of 94.12% (i.e. the ability of the RPA–LFD to identify correctly the

actual PstDV-negative samples tested is 94.12%). Re-testing was made with the five

samples showing false positive by RPA–LFD and the similar results were obtained

(data not shown). Assuming the reference assay is correct, overall, the accuracy of

the RPA–LFD protocol to produce test result is 95.73%.

47

Table 5.1: Geographical origin, year of collection, species and number of shrimp, and PstDV status of shrimp as determined by the reference

assay (an interim 3-tube nested PCR), and the RPA-LFD protocol. The data provided here were used to evaluate the diagnostic performance of

the RPA-LFD assay shown in Table 5.2.

Origin

Year

Species

Number of

sample

PstDV status

Positive by:

reference /RPA-LFD

Negative by:

reference /RPA-LFD

New Caledonia 2002 P. stylirostris 2 2/2 0/0

Brunei 2009 P. monodon 1 0/0 1/1

Malaysia 2012 P. vannamei 6 6/6 0/0

China 2005 P. vannamei 2 2/2 0/0

China 2012 P. vannamei 10 10/10 0/0

Australia 2012 P. monodon 96 12/12 84/79

48

Table 5.2: Diagnostic performance of the RPA-LFD protocol

PstDV status by reference assay

RPA-LFD Positive Negative

Positive 32 (TP)a 5 (FP)

Negative 0 (FN) 80 (TN)

% 100 (sensitivity) 94.12 (specificity)

% 95.73 (accuracy of RPA-LFD test result)

aTP, true positive; FP, false positive; FN, false negative; TN, true negative.

Sensitivity = [TP/(TP + FN)]*100, Specificity = [TN/(TN + FP)]*100

Accuracy = [(TP+TN)/(TP+TN+FN+FP)]*100

49

5.4. Discussion

The detection platform described employs RPA for sensitive and specific

amplification of a target nucleic acid fragment followed by a LFD assay for rapid

visualization of the amplified DNA (Figure 5.1).

Temperature optimization (Sections 5.3.1) indicated that the assay was robust to

temperature changes and 37 °C was chosen for further work as being between two

equally effective temperatures (35 °C and 37 °C) (Figure 5.2A). Time analysis

indicated that no improvement in yield occurred after 30 min (Figure 5.2B) so this

was used in all analyses. The total analysis time including AGE was approximately

1 ½ h (excluding gel preparation). This time compares favourably to one-step PCR

times of 2-3 h and nested PCR times of 4-5 h. However, at a very low concentration

of target DNA, the RPA assay yielded nonspecific products occasionally (Figure

5.5B at 10 pg). This phenomenon may have arisen from unexpected amplification or

primer-dependent artifact as suggested by Piepenburg et al. (2006).

In order to increase the specificity of test results and further speed up the total time

for the RPA assay, we explored the possibility of using LFD format rather

electrophoresis for detection of RPA amplicons. It was obvious that the LFD assay

possesses high selectivity against mismatched DNA target sequences (Figure 5.4B).

The high degree of specificity demonstrated by this assay was attributed to a use of

gold-labeled anti-FAM antibodies to capture RPA product specifically. Clearly, the

LFD assay could confirm the identity of RPA amplicons. As a result, it increased the

overall specificity of the RPA–LFD over RPA combined with AGE and decreased

time from 2 ½ h (30 min for RPA and 2 h for AGE including gel preparation) to

approximately 35 min.

Detection of RPA products by LFD is simple, can be achieved within 1–2 min at

room temperature. Visual detection of test results by this method abrogates the need

50

for post-amplification hybridization step for DNA products and probes required for

LFD methods previously combined with LAMP for shrimp virus detection

(Kiatpathomchai et al., 2008; Jaroenram et al., 2009; Puthawibool et al., 2009;

Nimitphak et al., 2010; Arunrut et al., 2011).

In conclusion, combining RPA amplification with an LFD technique resulted in a

total assay time of approximately 35 min, about a quarter that of RPA-AGE and 6–8

times faster than the interim 3-tube nested PCR-AGE detection of PstDV. The

combined method also provided 10 times greater sensitivity than the nested PCR

mentioned. High sensitivity and specificity, the relatively short detection time, and

amplicon confirmation by hybridization are key advantages of this protocol.

Although the protocol cannot eliminate false positive results (by viral inserts)

completely, reducing those to ∼5% (Table 5.2) compared to 76–78% by the

IQ2000™ kit and the 309F/R PCR protocol reported previously (Saksmerprome et

al., 2011) presents RPA–LFD as an alternative to PCR for primary screening of

PstDV. As the protocol requires no other equipment than a simple heating block, it

makes qualitative DNA testing potentially accessible in a non-laboratory, point-of-

care environment. In addition, it serves as a model platform that could be adapted

easily to detect other pathogens or genetic markers of interest using basic laboratory

equipment.

51

CHAPTER 6

VIRAL ACCOMMODATION, EVOLUTION AND PHYLODYNAMICS OF

AUSTRALIAN PENAEUS STYLIROSTRIS DENSOVIRUS

6.1. Introduction

Implementation of monitoring and control measures for viral epizootic outbreaks

requires an understanding of the factors that underlie molecular evolution and

population dynamics (Robles-Sikisaka et al., 2010). This is also true for PstDV

circulating in Australia. Evidence for PstDV existing in Australian penaeids has

been accruing. Owens (1987) demonstrated histological and epidemiological

evidence for the presence of PstDV in prawns in northern Australia (Owens, 1987).

In 1991, the presence of this virus, as indicated by histopathological evidence and

high mortality, approaching 100%, in hybrid prawns (Penaeus esculentus x P.

monodon) of northern Queensland was officially reported (Owens et al., 1992).

Genomes of PstDV were subsequently sequenced from these hybrid prawns and

from other Australian Penaeus sampled in the following 14 years (1992-2005), and

submitted to GenBank database directly by Kjersti Krabsetsve and her colleagues

(GenBank No. KM593908, EU675312, KM593909, KM593910, KM593911 and

KM593912). In 2006, Tang and Lightner reported the presence of PstDV-related

sequences in the genome of P. monodon broodstock originating from Australia

during 2004 (Tang and Lightner, 2006). These endogenous viral elements (EVEs)

were assigned as a non-infectious form of PstDV (GenBank No. EU675312).

Recently, an infectious type of the virus was rediscovered in this region in 2008

(Saksmerprome et al., 2010). Interestingly, high mortalities and obvious gross

pathology i.e. RDS caused by PstDV in prawn have not been recorded in this

country since the first official report in 1991 despite the virus existing here, as

demonstrated by positive results of PCR tests (Krabsetsve et al., 2004;

Saksmerprome et al., 2010; Jaroenram and Owens, 2014). Our hypothesis is that

prawns have developed resistance to PstDV and/or the virus has mutated to reach

equilibrium with the host in terms of virulence genes. To test this hypothesis, in this

Chapter, we sequenced and analysed the genome of Australian PstDV, and

52

determined its genetic recombination and molecular evolution in relation to other

geographical isolates of PstDV.

6.2. Material and methods

6.2.1. Shrimp samples and DNA temple preparation

PstDV-related sequences inserted in the genome of P. monodon (EVEs) can cause

false positive results for infectious PstDV using any single primer pair based PCR

protocol (Tang and Lightner, 2006; Saksmerprome et al., 2011; Jaroenram and

Owens, 2014). To ensure that our results were not derived from EVEs, we took

PstDV-infected P. monodon reported in from Chapter 4 (Jaroenram and Owens,

2014). Briefly for the Chapter 4, 130 prawns with no signs of PstDV infection i.e.

RDS-associated stunt growth were sampled from 2 farms in northern Queensland in

2012. They were used to examine the insertion pattern PstDV-related sequences

using multiple overlapping primers pairs designed to detect the whole PstDV

genome. Thirteen samples were positive for all the primers (i.e. whole genome was

amplified) indicating that they carried infectious PstDV. Among these, 9 showing

strong and specific PCR bands were chosen for further studies in this chapter. The

positive shrimp were divided arbitrarily into 3 groups. Gills or pleopods from each

group were pooled for DNA extraction following the protocol described in Chapter

3.1.

6.2.2. PCR amplification, cloning and genome sequencing of Australian PstDV

Each DNA pool was subject to a standard PCR amplification (see Chapter 3.3) using

multiple overlapping primers (Table 6.1). The recombinant plasmids containing

PCR fragments of interest were constructed and purified. Sequencing of both strands

of DNA plasmids (5-6 clones/PCR fragment/DNA pool) was performed (see

Chapter 3.4).

53

Table 6.1: Primers used to sequence the complete genome of PstDV in this study.

Primer pair Designation Sequence (5′-3′) Nucleotide

start position

Product

size (bp)

Reference

1 ihhnAF158 ATGGAAGATACGAACAACCAC 158 566 (Saksmerprome et al., 2010)

ihhnAR723 GGACCTGGGGTGAGAAGGCT 723 (Saksmerprome et al., 2010)

2 F570 CGACGAAGAATGGACAGAAA 507 437 Present study

R1006 GGAATCTGATGTGTCACTGATGT 1006 Present study

3 ihhnAF702 CAAGCCTTCTCACCCCAGG 702 877 (Saksmerprome et al., 2010)

R1578 ATGGCGTGGCCAAGAC 1578 (Molthathong et al., 2013)

4 ihhnAF1451 GTTACCTTTGCTGCCAGAGC 1451 905 (Saksmerprome et al., 2010)

mihhnAR2355 GGTGGTACCCAGTAGTCTATATCa 2355 Modified from (Saksmerprome et al.,

2010)

5 ihhnAF2002 AGCTTGGATAATCATCGTAGCAG 2002 568 (Saksmerprome et al., 2010)

ihhnAR2569 GGGCTTGCTCTTGTTGAATCGG 2569 (Saksmerprome et al., 2010)

6 F2436 CAGCCAGTACGACATCAACCCT 2436 703 Present study

R3138 CTCCTGTTCGCATTTGTTCCAT 3138 Present study

7 mihhnAF3031 CTAAGGAAGCCGACGTAACAa 3031 727 Modified from (Saksmerprome et al.,

2010)

ihhnAR3759 GACTCTAAATGACTGACTGACG 3759 (Saksmerprome et al., 2010)

aUnderlined nt replaces an original base A to make the primer accommodate the Australian isolate (GenBank No. EU675312)

54

6.2.3. Bioinformatical analysis of PstDV genome

The overlapping sequences (above) were analysed using Sequencer 4.9, and the

presence of potential ORFs was determined using the AlignX tool in the Vector NTI

program (Invitrogen, California, USA). The predicted amino acids and the molecular

weights of any potential proteins in an ORF were determined using proteomic tools

at ExPASy (http://us.expasy.org). The genome sequence of Australian PstDV

reported in this article (hereafter called AUS-PstDV2012) has been submitted into

GenBank database with the reference number KM593913 (Appendix D).

Comparative analyses of the genome and the encoded ORFs of this PstDV isolate

were performed using a BLAST search against the National Centre for

Biotechnology Information (NCBI) database.

6.2.4. Point mutation analysis

To prove that any point mutation found in ORF1 of the Australian PstDV (GenBank

No. EU675312) was real and inheritable, ORF1 was re-amplified from individual

PstDV-positive shrimp obtained as above and then sequenced. The sequences were

compared against the reported PstDV sequences (Table 6.2) using Vector NTI.

6.2.5. Phylogenetic analysis

Our entire DNA sequence was aligned the sequences of 19 worldwide distributed

PstDV representatives (Table 6.2) using MUSCLE 3.7 (Edgar, 2004). After

refinement using Gblocks 0.91b (Castresana, 2000; Talavera and Castresana, 2007),

all sequences with a standardized length of 2988 bp (except EU675312 and our

sequence having 2987 bp in length due to a single base deletion, see below),

covering ORF1 (NS1 herein), ORF2 (NS2), and ORF3 (VP) were used to construct

a phylogenetic tree under 1000 bootstrapping replicates using the maximum

likelihood method implemented in the PhyML 3.0 (Guindon et al., 2010). Graphical

representation and editing of the phylogenetic tree were performed with TreeDyn

198.3 (Chevenet et al., 2006).

55

6.2.6. Recombination and selection analysis

Prior to analysis, the 20 PstDV sequences (Table 6.2) were first aligned, 2 sequences

containing gaps and/or incomplete ORFs (GenBank No. GQ411199 and

DQ228358), were excluded from analysis as they were not recognized by the

programmes described herein. The remaining sequences were divided into 2 groups

according to their origin: 1) outside Australia (AF218266, EF633688, AF273215,

AY362548, KF214742, JX840067, AY355308, JN377975, AY102034, AY362547),

and 2) inside Australia (KM593908, KM593909, KM593910, KM593911,

KM593912, GQ475529, EU675312 and this study). The host origins of the

Australian endemic strains were given in Appendix E. ORFs of each group were

analysed for evidence of genetic recombination breakpoints (BPs) using the Genetic

Algorithms for Recombination Detection (GARD) undertaken under 4 nt

substitution bias models (F81, TrN93, HKY85 and REV) (Pond et al., 2006). Site-

specific signatures of positive and negative selections acting on each sequence were

also evaluated using three different codon-based maximum likelihood methods:

Single Likelihood Ancestor Counting (SLAC), Fixed Effects Likelihood (FEL) and

Random Effects Likelihood (REL) (Pond and Frost, 2005). Briefly, the first method

estimates the non-synonymous substitutions (dN) and synonymous substitution (dS)

values from reconstructed ancestral sequences and compares them against the

expected corresponding values. The second method estimates dN and dS directly

from the data at each codon site, while the last method estimates these parameters

across sites according to a predefined distribution. Signatures of natural selection

can then be inferred using the ratio of dN and dS, with ratio values less than 1

consistent with negative selection acting on aa-altering mutations, and values greater

than 1 suggesting positive selection to increase the number of replacements.

6.2.7. Inference of the nucleotide substitution rate and the demographic history

The rate of nt substitution was estimated using the computer software package called

Bayesian evolutionary analysis by sampling trees (BEAST) version 2.1.3 (Bouckaert

et al., 2014). The program uses a Bayesian Markov chain Monte Carlo (MCMC)

approach to evaluate evolutionary hypotheses without conditioning to a tree

56

topology, and it has been used to estimate the rate of evolution, divergence times

and temporal changes in effective population size (Cordellier and Pfenninger, 2008;

Duffy and Holmes, 2008; Fontanella et al., 2008). The substitution rate per site per

year for PstDVs circulating in Australia was estimated from an independent data set

that included a total of 8 dated PstDV DNA sequences: one was from this study

(Table 6.2, row 3) and the rest were taken from GenBank database (Table 6.2, row 1

and 7-12). The sampling time interval of these sequences was 22 years (1991 to

2012). After trimming incomplete ends that were unavailable for some isolates, all

sequences with a standardized length of 2988 bp (except those from 1993 and 2012,

this study, having 2987 bp in length due to the 1305delA), covering ORF1 (NS1

herein), ORF2 (NS2), and ORF3 (VP), were aligned using ClustalX 2.1 (Larkin et

al., 2007). The aligned output file was further analysed using BEAST 2.1.3.

Evolutionary model parameters incorporated in this analysis were as follows: 1) the

nt substitution and the site heterogeneity models were specified as HKY + G (4

categories) as suggested by jModeltest 0.1.1 (Posada, 2008), 2) the coalescent tree

prior was set to a constant population size as suggested elsewhere (Kim et al., 2012).

The MCMC chains (1.7× 108 generations, with the sampling frequency of 1,000)

were performed separately under 3 molecular clock assumptions: strict clock;

relaxed clock exponential; and relaxed clock log normal. The output files were

analysed by Tracer 1.4 (Rambaut and Drummond, 2007) to verify chain

convergence and recognized when the effective sample sizes (ESS) exceeded 200.

The best-fit model was determined by comparing the marginal likelihood estimate

value of each model using the harmonic smoothed mean estimator implemented in

Tracer 1.4. The nt substitution rate of PstDV was determined using the best-fit

model. Parallel estimation for the 20 dated cosmopolitan PstDV (Table 6.2) was

undertaken and compared.

Population history of Australian endemic PstDV was investigated using Bayesian

skyline plot (BSP), which estimates changes in effective population size (Ne)

through time (T) from a sample of gene sequences (Strimmer and Pybus, 2001;

Drummond et al., 2005); as PstDV is a virus, we interpreted this parameter as the

effective number of infections in units of generations/year as suggested elsewhere

57

(Robles-Sikisaka et al., 2010). Given that the PstDV generation time is unknown,

we did not attempt to translate this parameter into the actual number of infections.

The analysis was performed under the best-fit clock model with additional

parameters including a constant skyline plot, and a uniform prior population size

with an upper bound of 107. The MCMC algorithm was run for 2.5×10

7 generations,

with sampling every 1000 generations. Visualization of parameters and BSP plots

were examined in Tracer 1.4.

6.3. Results

6.3.1. Retrospective analysis of data from 1993

In the thesis work of Krabsetsve, 2005 (unpublished), a number of P. monodon

collected from farms in northern Queensland, Australia, in 1993 were screened for

the presence of PstDV using PCR employing multiple overlapping primers designed

to cover the whole genome sequence of the virus. The objective was to obtain the

complete sequence of many Australian PstDV isolates for epidemiological analysis.

The complete genomic DNA of the virus was obtained and submitted to GenBank

database with a given reference number EU675312. We preliminarily analysed the

genome sequences of this viral strain, and we found a base A deletion at the nt

position 1305 (1305delA) in ORF 1 which is relative to position 1949 in its genome.

As this unexpected mutation is not found in other geographical isolates (see below

for detail of analysis), it opens up the question as to whether the1305delA mutation

is real, i.e. not a result from technical issues such as sequencing error. If it is real, is

it consistently inherited over time? To answer these questions, subsequently

experiments were conducted.

6.3.2. Whole genome analysis of Australian PstDV

According to the sequence analysis, the genome of our PstDV isolate (AUS-

PstDV2012) is 3604 nt in length and has a base composition of A (36.93%), T

(20.48%), G (19.26%) and C (23.34%). The G/C and A/T content of the genome

58

was calculated to be 42.59% and 57.41%, respectively. Unlike any other infectious

PstDV including the Hawaii isolate (AF218266), our isolate has ORF1 fragmented

into 2 smaller ORFs, and for the purpose of analysis, they are designated as ORF1

fragment 1 (ORF1 Fr1) and ORF1 fragment 2 (ORF1 Fr2). Their sizes are 1404 bp

and 654 bp, respectively) (Figure 1A). DNA sequences of these fragments

overlapped and they are in different reading frames (+1 and +3, respectively),

indicating the presence of frame-shift deletion. If functional, the ORF1 Fr1 (nt 442-

1845) would encode a non-structural fragment 1 (NS1 Fr1) protein of 467 amino

acids (aa) in length, which corresponds to a molecular weight (MW) of 52.83 kDa.

This NS1 Fr1 protein contains the highly conserved replication initiator motifs,

located between the aa position 257-315, which are common to all other infectious

PstDV. ORF1 Fr2 (nt 1788-2441) would encode a NS1 fragment 2 (NS1 Fr2)

protein of 217 aa in length, which corresponds to a MW of 24.75 kDa. This aa

sequence contains 3 highly conserved NTP-binding and helicase domains, located

between aa position 35-128 relative to the aa position 480-578 of the Hawaii isolate

(GenBank No. AF218266). Similar to other infectious PstDV, ORF2 (nt 386-1477,

1092 bp in length), our isolate encodes a 363-aa non-structural protein 2 (NS2) with

a MW of 42.15 kDa, while the ORF3 (nt 2383-3372, 990 bp in length) encodes a

329-aa viral capsid protein (VP) with a MW of 37.43 kDa. These 2 ORFs are in

reading frames +2 and +1, respectively. Figure 6.1 depicts the overall genome

organization of our isolate in comparison with that of the Hawaiian strain.

We compared our entire sequence with matching regions of PstDV sequence records

at GenBank (Table 6.2) and found that our sequence (Table 6.2, row 3) had 92.5%

and 93.9% identity to sequences of PstDV previously reported from Australia

(EU675312) and Madagascar (DQ228358), respectively (lineage I). Interestingly, it

shared slightly lower identity (~92%) with several other sequences originating from

the Americas and some parts of Asia (lineage III). Focusing on each ORF, ORF1

Fr1 showed the highest degree of similarity (~95%) to PstDVs in lineage I. ORF1

Fr2 and ORF2 were most similar to those in lineage IV, while ORF3 showed

comparable identity to all lineages (~93%). These observations were in accordance

with that of aa comparison (Table 6.2).

59

Figure 6.1: (A) Genome organization of Australian PstDV obtained from this study.

(B) Genome organization of infectious PstDV representative taken

from GenBank database. Fr1 and Fr2 are referred to as fragment 1 and

2 of ORF1, respectively. Plus sign followed by the numbers in

parentheses indicates the reading frame of that ORF.

60

Table 6.2: Comparison of nucleotide and predicted amino acid sequences of the AUS-PstDV2012 (lineage II) and other sequenced PstDVs from

different geographical regions. The similarity was estimated based on the full length sequences of respective ORFs or partial

sequences available. For the purpose of illustration in the Table, Fr1 and Fr2 are referred to as ORF1 fragment 1 and 2, respectively.

For convenience, they are shown sequentially but actually overlap.

61

6.3.3. Mutation analysis

From Figure 6.2A (top), A at the nt position 1305 is missing (1305delA) in ORF1 of

the Australian PstDV from 1993 (EU675312) and 2012 (this study). To verify this

finding, PstDV-ORF1 was re-amplified from 9 individual infected shrimp then

sequenced. Clearly seen in Figure 2A (bottom), the ORF1 from all samples were

homozygous for the 1305delA mutation when compared to other infectious isolates

listed in Figure 6.2B. Examples of sequence chromatograms of the 1305delA

containing PstDV-ORF1 are shown in Figure 6.2C, demonstrating that the 1305delA

is not a technical error.

Further inspection revealed that the 1305delA occurs at the nuclear localization

signal (NLS) encoding sequence which is conserved among different geographical

isolated PstDV genomes (Owens, 2013). ORF1 has many potential NLSs with

embedded Chelsky sequences (4 aa, three of which are basic, starting dibasic e.g.,

K-K/R-x-K/R where K, R, x represent arginine, lysine and any aa, respectively).

One NLS starts at aa position 423 (KKK-16aa-KRK). As pointed out by Owens

(2013), our investigation confirms that the 1305delA causes an aa frame-shift in the

second half of NLS for both Australian PstDV isolates reported in 1993 (Table 6.3,

row 1) and 2012, the present study, (Table 6.3, row 2). This out-of-frame region

destroyed the KRK sequence at the C terminal. When a base A was artificially added

into the 1305delA position (i.e. 1304insA) of the above isolate, (Table 6.3, row 3), it

put the reading back in-frame, turning ORF1 Fr1 into a complete putative ORF1

which could generate the NLS with functional characteristics (22 aa in length with

KKK and KRK towards the N terminal and C terminal, respectively) of infectious

PstDV-derived NLSs (Table 6.3, row 4-11). Also of considerable interest is that this

frame shift straddles the site of the OIE diagnostic IHHNV309 primers (Tang and

Lightner, 2006) that are reported to separate infectious PstDV from endogenous

viral element PstDV of Australia and Madagascar.

62

Figure 6.2: Comparison of the 1305delA-containing ORF1 (NS1) sequences obtained from various sources. (A) The Australian PstDV isolated

from P. monodon cultured in 1993 (GenBank No. EU675312) and 2012 (AUS-PstDV2012) (top), and nine individual PstDV-

infected shrimp from which the AUS-PstDV2012 originated (bottom). (B) Infectious PstDV sequences from the Genbank database.

(C) Examples of sequence chromatograms corresponding to PstDV sample isolated from shrimp No. 1 – 5 listed in (A, bottom).

63

Table 6.3: The penaeid host, geographical location and the likely NLS of PstDV in NS1 protein. Bolded aa are potential NLS joined by 16 aa.

Superscripted number in front of the listed NLS sequences indicates the starting position of NLS in NS1 protein sequence.

Row GenBank No. Host species Origin/year of isolation Pattern of putative NLS (KKK – 16 aa – KRK)

1 EU675312 P. monodon Australia/1993 423

KKKFSQSQLSLITIYTIYQKGNa

2 This study P. monodon Australia/2012 with 1305delA 423

KKKFSQSQLSLITIYTIYQKGNb

3 This study P. monodon Australia/2012 with 1304insA 423

KKKFSQSQLSLITNLHNISKRKc

4 AF218266 P. stylirostris Hawaii/1986 423

KKKSNQSQLSLITNLQNISKRKa

5 AY362548 P. vannamei Ecuador/2003 423

KKKSNQSQLSLITNLQNISKRKa

6 AF273215 P. stylirostris Mexico/1998 423

KKKSNQSQLSLITNLQNISKRKa

7 AY355307 P. vannamei Taiwan/2001 423

KKKSNQSQLSLITNLQNISKRKa

8 GQ411199 P. vannamei Korea/2010 423

KKKSNQSQLSLITNLQNISKRKa

9 EF633688 P.vannamei China/2007 423

KKKSNQSQLSLITNLQNISKRKa

10 AY362547 P. monodon Thailand/2003 423

KKKSNQSQLSLITNLQNISKRKa

11 GQ475529 P. monodon Australia/2008 423

KKKSNQSQLSLITNLQNISKRKa

aAdopted from Owens’ study (2013) (Owens, 2013)

bNLS sequence of the AUS-PstDV2012 with 1305delA. It shows 54.6% identity to NLS of infectious isolates (row4-11).

cNLS sequence of the AUS-PstDV2012 with an ‘A’ artificially inserted after nt 1304 in ORF1. It shows 86.4% identity to NLS of infectious isolates (row 4-

11).

64

6.3.4. Phylogenetic tree analysis

The relationship of our PstDV sequence was examined in a phylogenetic analysis

with the other 19 cosmopolitan PstDV representatives (Table 6.2). The cluster tree

(Figure 6.3) suggested that the PstDVs were divided into four lineages: I, II, III and

IV with 100% bootstrap value support, indicating potential genetic differences

between lineages. Our isolate was clustered in lineage II which was newly formed

here.

Figure 6.3: Phylogenetic relationships of the Australian PstDV isolate and other

geographical isolates as analysed using the maximum likelihood method

implemented in the PhyML 3.0. The numbers shown at branch point

indicate 1000 bootstrap values which determined the confidence indices

within the tree.

65

6.3.5. Recombination and selection analysis

When GARD was performed, 10 recombination breakpoints (BPs) were detected in

only the Australian PstDVs (see Section 6.2.6, Group 2 dataset), 4 in ORF1 Fr1 (nt

139, 475, 846 and 1026) (Figure 6.4A), 1 in ORF1 Fr2 (nt 93) (Figure 6.4B), 2 in

ORF2 (nt 523 and 903) (Figure 6.4C) and 3 in ORF3 (nt 258, 357 and 690) (Figure

6.4D). The detail of BPs associated with their placement support, and a brief

description on how to interpret the results for the respective ORFs above is given in

insets and caption of Figure 6.4

For SLAC, FEL and REL analysis (Table 6.4), non-Australian isolates (Group 1)

contained 23 positive selected codons, detected only by REL (2 in ORF1 and 21 in

ORF3), and 74 negatively selected codons (33 in ORF1, 10 in ORF2 and 31 in

ORF3) with 3 recognized by all methods (ORF1 only). Australian isolates (Group 2)

presented 7 positively selected codons, detected by REL only (4 in ORF1 Fr1 and 3

in ORF2), and 213 negatively selected codons with 6 found by consensus of all

methods. The overall mean dN/dS ratio as estimated by SLAC for ORF1, 2 and 3 of

Group 1 dataset was 0.259, 0.459 and 0.147, respectively. The dN/dS ratio for the

respective ORF1 Fr1 and Fr2, ORF2, and ORF3 of the Group 2 dataset was 0.442,

0.032, 0.438 and 0.076. The dN/dS ratio values less than 1 for both groups are

consistent with negative selection acting on aa-altering mutations. The numbers and

locations with details of all possible selected codons for both groups are in Table F.1

and F.2 of Appendix F.

66

Figure 6.4: Recombination breakpoint (BP) placement support of: (A) ORF1 Fr1, (B) ORF1 Fr2, (C) ORF2 and (D) ORF3. Support probability

for inferred BPs is shown on the left side of the figures. The nt position in the alignment is shown on the x-axis. Insets:

corresponding BPs and Akaike Information Criterion score (c-AIC) for the best model assigned to infer BPs. Δc-AIC: improvement

relative to the model with one fewer breakpoint. Given the maximum number of BPs, the method searched for all possible locations

for BPs, inferring phylogenies for each putative non-recombinant fragment and assessed goodness of fit by using c-AIC. On ORF1

Fr1 (Figure 6.4A), for example, 4 BPs (inset), corresponding to peaks from left to right, located respectively at the nt 139, 475, 846

and 1026 were found, and the sequences were divided into 5 non-recombination split partitions.

67

Table 6.4: Number of positive (+) and negative (̶ ) selected codons on each ORF of the genome of PstDVs circulating outside Australia

(nAus Grp 1) and inside Australia (Aus Grp 2) as analyzed by SLAC, FEL and REL. For the purpose of analysis in relation

to the genome organization of the AUS-PstDV2012, ORF1 of Group-2 samples were divided into 2 fragments: ORF1 Fr1

and ORF1 Fr2. They were analysed and shown separately. Significance level: SLAC p-value: 0.1; FEL p-value: 0.1; REL

Bayes Factor: 50.

Sample Fragment

analysed

SLAC FEL REL Two methods consensus Three methods consensus

+ ̶ + ̶ + ̶ + ̶ + ̶

nAus Grp 1 ORF1 - 4 - 33 2 3 - 1 - 3

ORF2 - 1 - 10 - - - 1 - -

ORF3 - 1 - 31 21 - - 1 - -

Total - 6 - 74 23 3 - 3 - 3

Aus Grp 2 ORF1 Fr1 - 3 - 37 4 - - 3 - -

ORF1 Fr2 - 6 - 58 - 82 - 52 - 6

ORF2 - 3 - 20 3 - - 1 - -

ORF3 - 3 - 72 - - - 3 - -

Total - 15 - 187 7 82 - 59 - 6

68

6.3.6. Inference of the nucleotide substitution rate and the demographic history

To select the best-fit clock model, the marginal likelihood estimate of different

models (strict, relaxed lognormal and relaxed exponential) were compared (Table

6.5). Using the harmonic smoothed mean estimator, the relaxed exponential model

had the largest marginal likelihood (-9905.31). This model was favoured over other

tested clocks according to the Bayes factors comparison (103.71; strict clock and

106.92; relaxed lognormal clock). Under this model (with a constant population

size), the nt substitution rates were estimated to be 1.55× 10-3

substitutions/site/year

(95% highest posterior density, HPD: 6.93 × 10-4

– 2.46 × 10-3

, standard error of

mean: 2.42 × 10-5

). Parallel estimation for all 20 dated sequences (Table 6.2)

revealed the rate of 1.90× 10-4

substitutions/site/year; approximately 12 times lower

than that for the data set above.

Historical PstDV population demography in the northern Queensland was inferred

from Bayesian Skyline Plot (BPS). The analysis suggested that the PstDV

population decreased slowly after 1991, and reached the bottom in around 1996

prior to a gradual increase and leveled off since 2003 (Figure 6.5). A similar

qualitative pattern of BSP was observed with individual ORF analyzed (data not

shown). These results indicate that the population of PstDV has reached an

equilibrium state, supporting our hypothesis regarding viral accommodation.

69

Table 6.5: Evolutionary models compared by marginal likelihoods obtained from the

harmonic smoothed mean estimator performed under different clock

models: Strict (S), Relaxed lognormal (RL) and Relaxed exponential

(RE).

Bayes factora

Trace ln P(data | model)b S.E. S RL RE

S -10009.02 +/-0.09 - 3.21 -103.71

RL -10012.23 +/-0.14 -3.21 - -106.92

RE -9905.31 +/-0.17 103.71 106.92 -

aThe Bayes factor is the difference between the marginal likelihoods of the two models

being compared. Positive values indicate better relative model fit of the row’s model

compared to the column’s model, while negative values indicate better relative model fit of

the row’s model compared to the column’s model. bMarginal likelihood of model data

Figure 6.5: Bayesian skyline plot. The Y axis represents the effective number of

infections, Ne*T, where Ne is the effective number of infections and T

is the generation time. The black line represents the mean estimate of

the effective number of PstDV infections through time, and the solid

interval represents the 95% highest posterior density, HPD. The arrow

indicates 1991, the year of PstDV epizootic in Australia.

70

6.4. Discussion

The initial discovery of the 1305delA mutation within ORF1 of the Australian

PstDV genomes (Figure 6.2A, top) posed the question whether it is real or an

artefact of technology. If it was real, was it consistently inherited over time?

Sequencing of the genome of PstDV from northern Queensland in 2012 found that

all 9 samples examined were homogenous for the 1305delA mutation (Figure 6.2A,

bottom). The sequence chromatograms showed clear DNA patterns, no overlapping

peaks or noise at the A-missing nt for all the sequences examined (Figure 6.2C,

highlighted). We discount polymerase errors since we used high fidelity enzymes

and sequenced amplicons in both directions. Furthermore, this point mutation was

also found in the other Australian PstDV sequence (GenBank No. EU675312)

collected from cultured shrimp in 1993; 19 years before this study. The sampling

period, the sampling area, the research methodology and researchers for these viral

isolates were independent. These facts combined with the number of individual

PstDV samples that possesses the mutation led to a logical conclusion that the A-

deletion was real.

The 1305delA occurs at the NLS encoding sequence (Table 6.3, rows 1-2). As the

NLS is involved with mediating proteins entry through the nuclear pore to be

functional in the host cell nucleus (Jans et al., 2000; Owens, 2013), incorrectly

translated NLS caused by the 1305delA may compromise its NL signature,

consequently affecting the DNA replication process of PstDV. The mutation also

creates a premature termination codon within ORF1 which leads to the predicted

NS1 protein being shortened by 199 aa with 2 putative minor proteins (NS1 Fr1 and

NS1 Fr2) produced instead, and separation of the replication initiator motifs from

NTP-binding and helicase domains (see Section 6.3.2). This change possibly

strongly modifies the characteristics of the NS1, and consequently affects the growth

of PstDV as NS1 was responsible for the majority of enzymatic activities involved

in viral transcription and replication. However, if both NS1 Fr1 and Fr2 are

associated post-translation, then some functionality would be returned with some

considerable loss in speed and efficiency. Further research that elucidates the basis

PstDV NS1 malfunction would be particularly informative. The 1305delA does not

71

cause any frame shift or premature stop codon in other ORFs as its location does not

overlap with those ORFs. The 1305delA has not been reported as responsible for

ORF1 frame-shift and can therefore be regarded as novel. As it is unique for the

Australian PstDV strain, it serves as a genetic marker for identifying this viral strain.

Both Australian PstDV strains isolated in 2012 (this study) and 1993 (GenBank No.

EU675312) contain this genomic marker. Therefore, they are assumed to originate

from the same ancestor. The marker can also be useful in studying the relationship

between the degree of virulence of PstDV and the genetic causes as it is associated

with defective NS1 production. This knowledge may be an important clue regarding

viral accommodation and genes related to virulence. As this sequence information is

from full length transcripts, it is clear that PstDVs with the 1305delA are circulating

in Australian prawn populations.

With PstDV genome analysis, our sequence shared a comparable degree of identity

with those in both lineage I (~93-94%) which originated from Australia and

Madagascar, and lineage III (~91-92%) from some parts of Asia (Table 6.2) When a

phylogenetic tree was constructed, AUS-PstDV2012 clustered in lineage II, a

different lineage to the isolate reported in 1993 (Figure 6.3). Both strains were

discovered from prawn farms in the same geographic area separated by only a 19-

year interval. In addition, they were assumed to originate from the same ancestor

due to the presence of the genetic marker in their genomes (see above). Interestingly,

several isolates from prawns cultured in northern Queensland were classified into

lineage III. Hence, it can be concluded that different lineages of PstDV have been

co-circulating in Australia, one originated from Asia (GenBank No. KM593910,

KM593912, GQ475529, KM593911, KM593909, and KM593908) and other

endemic strains (this study and GenBank No. EU675312) (Figure 6.3).

With GARD analysis, 10 break points in the genome of Australian PstDVs were

revealed: 4 in ORF1 Fr1 (Figure 6.4A), 1 in ORF1 Fr2 (Figure 6.4B), 2 in ORF2

(Figure 6.4C) and 3 in ORF3 (Figure 6.4D). This indicated the exchange of genetic

information between different isolates found in Australia, consequently contributing

72

to increased genetic diversity. This might be the reason for the two Australian

isolates sampled from the same geographical area but in different years (1993 and

2012) are less similar in DNA sequence than expected and are in different lineages.

The data herein are consistent with there being an older Australian endemic PstDV

(AUS-PstDV2012) and an introduction of an Asian PstDV around 1991 (GenBank

No. KM593908). Signals of natural selection (both positive and negative) as

analyzed using SLAC, FEL and REL were also found in many codons in PstDV

genomes both endemic (Table 6.4, Aus Grp2) and outside Australia (Table 6.4,

nAus Grp1). SLAC and FEL detected only negative selection signals, while REL

detected both positive and negative signals. It is known that different approaches to

inferring the same effect can lead to slightly different conclusions, never with 100%

accuracy (Poon et al., 2009). SLAC is the most conservative; it may miss some sites,

but it does not identify many neutral sites. Hence, the actual rate of false positives

can be much lower than the significance level. FEL detects more sites, while REL

selects most sites but yields the highest error rate (Pond and Frost, 2005; Poon et al.,

2009). With this in mind, we attempted not to translate our results into the actual

signature of selection, but inferred the overall number of possible events instead.

Thus, there are possible trends for both increasing the prevalence of adaptive traits

in PstDV populations, and decreasing prevalence of traits that diminish individual

viruses’ capacity to succeed reproductively. However, the latter case seems highly

likely due to the negative consensus values across all three methods.

Using Bayesian coalescent approaches to evaluate the evolutionary rate of PstDV

circulating in Australia, the nt substitution rate was estimated to be 1.55 × 10-3

substitutions/site/year, which is unexpectedly high for a dsDNA virus but perhaps

not for single-stranded (ss) DNA virus (see Robles-Sikisaka et al., 2010) and

comparable to RNA viruses which evolve at a rate of 10-3

to 10-5

substitutions/site/year (Scholtissek, 1995; Jenkins et al., 2002). It is generally

assumed that dsDNA viruses evolve at a similar rate to that of their hosts due to viral

dependence on the host’s cellular machinery for replication (Shackelton and

Holmes, 2006; Duffy and Holmes, 2008). This data set provides a good

approximation of the rate of evolution due to the length of the sequences that cover

73

all ORFs, the range of sampling dates (from 1991 to 2012; the first year of an

official record of PstDV existence in Australia until the latest, a 22-year interval).

We attribute this unexpectedly high estimate to the DNA recombination, a major

evolutionary mechanisms driving diversity and adaptation in parvoviruses

(Shackelton et al., 2007). Our estimate is approximately 12 times and 9 times higher

than that computed from 20 worldwide distributed isolates (this study) and the 18

isolates of a previous study (Robles-Sikisaka et al., 2010). However, note that the

study of Robles-Sikisaka et al. (2010) only looked at the capsid gene whilst we

looked at all ORFs and what effect this had on this comparison is unknown. We also

note that a number of other parvoviruses infecting mammals and begomoviruses

infecting plants have been reported to evolve at roughly the same rate. These include

human B19 erythrovirus (1x10-4

) (Shackelton and Holmes, 2006), human parvovirus

B19 (Parsyan et al., 2007), porcine circovirus 2 (Firth et al., 2009), canine

parvovirus (CPV) (1.7x10-4

), feline panleukopenia parvovirus (FPLV) (9.4x10-5

)

(Shackelton et al., 2005), and the ssDNA containing begomovirus, tomato yellow

leaf curl virus (TYLCV) (2.88x10-4

) (Duffy and Holmes, 2008).

Regarding the history of PstDV outbreak in Australia, high mortalities and obvious

gross pathology caused by the virus in farmed prawn were not recorded since 1991

despite the virus existing here. When a BPS-derived PstDV population growth was

inferred, the effective number of infections of PstDV decreased slowly after 1991,

prior to recovery in 1996 and remained stable from 2003 onwards (Figure 6.5). Of

considerable interest is that this time corresponded to the severe outbreaks of

Midcrop Mortality Syndrome (MCMS) in Australia (Anderson and Owens, 2001) of

which PstDV was a component. Electron microscopy demonstrated a parvovirus

was involved from March 1994 onwards and MCMS was nationwide by 1996 when

the upturn in the BSP started to occur. MCMS continued unabated until 2003 when

a combination of broodstock from the Northern Territory, restriction to one crop per

year, longer dry-outs of ponds and partial harvests returned predictable production to

the industry. We hypothesize that the high mortality rates in prawns infected with

MCMS put selective pressure for “fit” biotypes to replicate before prawns

succumbed (Figure 6.5). The apparent stability of the PstDV population does not

74

correlate with the high substitution rate we found. The simple explanation to this

contradiction is that mutation mostly produced negative traits (Table 6.4), resulting

in a trend for decreasing prevalence of traits that diminished individual virions

capacity to succeed reproductively and its genes to be present in the next generation.

Therefore, the effective viral population (Ne*T) did not increase much. Altogether,

we interpret reduction in virulence across northern Queensland primarily in terms of

pathogen evolution. Specifically, we hypothesize an inherent trade-off between

transmission rate and virulence that has changed over time as PstDV evolved. Future

research that elucidates the basis of this trade-off in association with the effect of

fragmented ORF1 caused by the 1305delA mutation would be particularly

informative.

For clarification on awareness of PstDV outbreaks in Australia, large amounts of

commodity prawns from South East Asia (Krabsetsve et al., 2004) have been

imported into Australia which is believed to be the source of Asian-originated

PstDV currently spreading in northern Queensland. Recombination of this strain

with an endemic strain could, in the worst case, lead to the emergence of virulent

strains following changes in the host or environmental conditions. Furthermore,

northern Australia shares the marine environment and fauna with the Indo-Pacific

region. In conjunction with the fact that shrimp farms are generally located in

coastal regions that also provide a natural habitat for wild shrimp, there are

opportunities for admixture of wild and captive shrimp populations. Consequently, a

lethal strain of PstDV originating in the wild or derived from the Indo-Pacific region

can also potentially be introduced into cultured populations, and vice versa. Routine

genetic monitoring of PstDV in both wild and cultured shrimp might aid

management efforts in this regard.

In 1999–2000, a new strain of Taura syndrome virus (TSV Mx2000), one of the

most serious shrimp pathogens, emerged in Mexican shrimp culture. It was reported

to have escaped detection since it did not react with the monoclonal antibody (MAb)

used for the routine screening of TSV by immunohistochemistry (ISH). Subsequent

75

cloning and sequencing showed that it contained distinctive capsid gene mutations

that contributed to detection failure in the ISH method (Robles-Sikisaka et al.,

2002). For PstDV, use of the BS4.5 DNA gene probe designed to specifically detect

the virus also failed to react with Australian isolate (Owens et al., 1992; Lightner,

1996c). A view was forming that the Australian isolate also has unique mutations

that contributed to the dot-blotting detection failure. This suggestion is highly likely

due to the presence of genetic recombination among Australian isolates (this study).

Genetic screens may allow the identification of otherwise undetectable strains, as

well as shed light on the unknown determinants of changes in virulence such as the

discovered point mutation in ORF1.

In conclusion, Australian prawns have developed resistance to PstDV and/or the

virus has reached equilibrium with the host in terms of genes related to virulence. A

1-bp deletion (1305delA) within ORF1 has been identified as being responsible for

199-aa shortened NS1 synthesis in Australian PstDV. Alteration of such a big aa

portion may modify the characteristics of the NS1, consequently affecting the

growth of PstDV. Thus, the 1305delA mutation is believed to be associated with the

reduction of virulence in the Australian strain. However, to experimentally prove

this concept is exceptionally difficult at present due to the lack of in vitro cell

cultures to support the growth of PstDV and to facilitate intensive studies. In

addition, the complete genome of the virus (including both hairpin ends) has not

been reported. The 1305delA serves as a genetic marker to identify this Australian

viral strain. The constant growth of Australian PstDV population and signs of viral

accommodation have also been revealed herein. However, we should not assume

that PstDV is a stable or static virus, and understate the potential for new virulence

stains to arise. This is because of a high degree of evolutionary and genetic variation

for PstDV attributable to the viral recombination has been observed. Thus,

awareness on the emergence of new virulent strains should be raised as preventative

measures for future outbreaks of PstDV in Australia and the Australian Indo-Pacific.

76

CHAPTER 7

GENERAL DISCUSSION

Penaeus stylirostris densovirus (PstDV) is an important shrimp pathogen that

contributes to the poor health and production losses of prawns across the globe (Rai

et al., 2012; Owens, 2013). Recently, PstDV-related sequences were found in the

genome of P. monodon and P. vannamei (Tang and Lightner, 2006; Saksmerprome

et al., 2011). This led to false positive results by PCR-based detection systems

including those recommend by the World Organization for Animal Health (OIE)

(the 309F/R PCR primer protocol and the IQ2000TM

PCR detection kit)

(Saksmerprome et al., 2011). Here, we examined and mapped the PstDV insertion

profile in the genome of Australian P. monodon. A DNA sequence which is likely to

represent infectious PstDV was also identified and used as a target sequence for

RPA-LFD, developed for specifically detecting PstDV. The protocol at 37 °C for 30

min followed by 5 min at room temperature showed no cross-reaction with other

shrimp viruses, and was 10 times more sensitive than both the OIE protocols

mentioned above. The major benefit of this protocol is that it could reduce false

positive results arising from viral inserts to ~5%, compared to 76-78% by the OIE

protocols above (Saksmerprome et al., 2011). Its total assay time is approximately

35 min, about 6–8 times faster than the Saksmerphrome et al.’s interim 3-tube

nested PCR-AGE detection of PstDV.

The estimated cost for a single assay using the RPA–LFD protocol (excluding DNA

extraction) is approximately US$ 8 or comparable to that of LAMP-LFD and the

IQ2000TM

kit which we estimated for standard nested PCR using a DNA extraction

kit, a nested PCR detection kit and gel electrophoresis followed by UV detection

(Jaroenram et al., 2009). This estimate does not include capital costs for equipment

(i.e. heating block). The RPA–LFD cost could probably be further reduced by

production-scale savings. The market force may also make it be more affordable in

the future, similar to PCR reagents and relevant equipment (i.e. thermal cycler)

77

which were more expensive in the early days of the technology than they are now.

Our RPA protocol reduced complications associated with reaction preparation found

in PCR or LAMP as the RPA reaction system is provided in a stabilized dried

format which permits transportation and limited storage without refrigeration

(http://www.twistdx.co.uk/our_technology/). In addition, the reaction can be

completely set up at room temperature. Together with the requirement of only a

simple heating block for maintaining the reaction, our protocol provides qualitative

DNA testing without the need of a laboratory, and that indicates the applicability for

onsite detection. However, our protocol is a prototype and to use it in field,

evaluation of its efficiency on a larger scale is first required. In addition, a simple

but efficient-and-compatible DNA extraction method has to be established and

combined in order to make the RPA-LFD described truly practical and robust. As

our protocol is the first RPA-based method for the detection of a shrimp pathogen, it

serves as a model platform that could be adapted easily to detect other pathogens or

genetic markers of interest using basic laboratory equipment.

Implementation of monitoring and control measures for viral epizootic outbreaks

requires an understanding of the factors that underlie molecular evolution and

population dynamics (Robles-Sikisaka et al., 2010). This is also true for PstDVs that

have been circulating in Australia. By screening P. monodon sampled from farms of

northern Queensland in 2012 using our RPA-LFD, several shrimp were positive for

infectious PstDV. When whole genome of the virus from these shrimp was

sequenced and analyzed, a single base deletion (1305delA) within the NLS-encoding

sequence of ORF1; NS1 was detected and identified as being responsible for 199-aa

shortened NS1 synthesis. This mutation is believed to reduce virulence as it strongly

modifies the characteristics of NS1, a protein that plays major roles in PstDV

replication and transcription. This suggestion correlates with the constant growth of

the Australian PstDV population examined using Bayesian skyline plot (BPS),

supporting our hypothesis regarding accommodation of PstDV in Australian P.

monodon in relation to viral genetics. Future research that elucidates the basis of

PstDV-NS1 malfunction in association with the viral accommodation would be

particularly informative. Identification of the co-presence of a completely functional

78

genotype whose virions would be able to encapsidate the non-functional mutant

genome, and understanding the consequences of these patterns of genetic variation

for various evolutionary processes is interesting and should be further studied.

The 1305delA we found is unique for an Australian PstDV strain. Therefore, it

serves as a genetic marker for this viral strain, and provides usefulness in studying

the relationship between the degree of virulence of PstDV and the genetic causes. It

is also beneficial for international seafood trade and quarantine management system.

To illustrate this point, if any country having encountered an outbreak of PstDV

claims that the PstDV is distributed from Australia via frozen seafood imported, this

claim can be proven right or wrong using the marker described for this strain. With

this approach, economic tension including trade restriction or sanction against

Australia can be prevented. Having research on developing a protocol to specifically

detect the 1305delA mutation would be of interest in this regard.

For clarification of awareness of PstDV outbreaks in Australia, although the

constant growth of Australian PstDV population and signs of viral accommodation

have been revealed herein, we should not assume that the PstDV is a stable, and

understate the potential for new virulence stains to arise. This is because of a high

degree of evolution for the virus, which was attributable to the viral recombination,

was also observed. With this finding, we primarily suggest that awareness of the

emergence of new virulent strains should be raised as a preventative measure against

future outbreaks of PstDV in Australia and the Australian Indo-Pacific where fauna

and marine environment are shared. However, analysis of a much larger number of

native, wild samples of P. monodon would be particularly useful, and required to

prove that the hypothesis regarding a faster rate of evolution and viral

accommodation proposed herein are consistent and represent the evolution of PstDV

in the Australia Indo-Pacific region in general.

79

In conclusion, a more practical and efficient protocol to specifically detect PstDV,

and the factors that underlie the evolution of the Australian PstDV have been

established and identified here, respectively. Integration of such outputs and

knowledge can help contribute toward better strategies to counter PstDV.

80

REFERENCES

Alfaro Aguilera, R., Guevara Torres, M. and Gonzales Chávez, I. (2010) Prevalencia

y distribución de los principales agentes etiológicos que afectan los

langostinos silvestres en Tumbes, Perú. Rev. peru biol 17: 359-364

Anderson, I.G. and Owens, L.G. (2001) The diagnosis and prevention of the mid-

crop mortality syndrome of pond-reared black tiger prawns (Penaeus

monodon), 56 pp. Oonoonba Veterinary Laboratory, Department of Primary

Industries.

Arunrut, N., Prombun, P., Saksmerprome, V., Flegel, T.W. and Kiatpathomchai, W.

(2011) Rapid and sensitive detection of infectious hypodermal and

hematopoietic necrosis virus by loop-mediated isothermal amplification

combined with a lateral flow dipstick. Journal of virological methods 171:

21-25

Astell, C. (1990) Terminal hairpins of parvovirus genomes and their role in DNA

replication. Handbook of parvoviruses 1: 59-80

Bell, T.A. and Lightner, D.V. (1984) IHHN virus: infectivity and pathogenicity

studies in Penaeus stylirostris and Penaeus vannamei. Aquaculture 38: 185-

194

Bell, T. and Lightner, D. (1987) IHHN disease of Penaeus stylirostris: effects of

shrimp size on disease expression. Journal of fish diseases 10: 165-170

Boada, M. (2008) Detection of the Infectious Hypodermal and Hematopoietic

Necrosis Virus (IHHNV) in Asymtomatic Cultured White Shrimp,

Litopenaeus vannamei (Boone), in Venezuela. REVISTA CIENTIFICA 18: 7-

11

Bouckaert, R., Heled, J., Kühnert, D., Vaughan, T., Wu, C.-H., Xie, D., Suchard,

M.A., Rambaut, A. and Drummond, A.J. (2014) BEAST 2: a software

platform for Bayesian evolutionary analysis. PLoS computational biology

10: e1003537

Boyle, D.S., Lehman, D.A., Lillis, L., Peterson, D., Singhal, M., Armes, N., Parker,

M., Piepenburg, O. and Overbaugh, J. (2013) Rapid detection of HIV-1

proviral DNA for early infant diagnosis using recombinase polymerase

amplification. MBio 4: e00135-13

Bray, W.A., Lawrence, A.L. and Leung-Trujillo, J.R. (1994) The effect of salinity

on growth and survival of Penaeus vannamei, with observations on the

interaction of IHHN virus and salinity. Aquaculture 122: 133-146

Braz, R.F.S., Rodrigues de Oliveira da Silva, C.P., Reis, L.G., Martins, P.C.C.,

Pereira de Sales, M. and Meissner, R.V. (2009) Prevalence of infectious

81

hypodermal and hematopoietic necrosis virus (IHHNV) in Penaeus vannamei

cultured in northeastern Brazil. Aquaculture 288: 143-146

Brock, J.A., Lightner, D.V. and Bell, T.A. (1983) A review of four virus (BP, MBV,

BMN and IHHNV) diseases of penaeid shrimp with particular reference to

clinical significance, diagnosis and control in shrimp aquaculture.

Proceedings of the 71st International. Council for the Exploration of the Sea,

CM: 1-18

Browdy, C.L., Holloway, J.D., King, C.O., Stokes, A.D., Hopkins, J.S. and Sandifer,

P.A. (1993) IHHN virus and intensive culture of Penaeus vannamei: effects

of stocking density and water exchange rates. Journal of Crustacean Biology

13: 87-87

Castresana, J. (2000) Selection of conserved blocks from multiple alignments for

their use in phylogenetic analysis. Molecular biology and evolution 17: 540-

552

Chayaburakul, K., Nash, G., Pratanpipat, P., Sriurairatana, S. and

Withyachumnarnkul, B. (2004) Multiple pathogens found in growth-retarded

black tiger shrimp Penaeus monodon cultivated in Thailand. Diseases of

aquatic organisms 60: 89-96

Chevenet, F., Brun, C., Bañuls, A.-L., Jacq, B. and Christen, R. (2006) TreeDyn:

towards dynamic graphics and annotations for analyses of trees. BMC

bioinformatics 7: 439

Claydon, K., Tahir, R.A.H., Said, H.M., Lakim, M.H. and Tamat, W. (2010)

Prevalence of shrimp viruses in wild Penaeus monodon from Brunei

Darussalam. Aquaculture 308: 71-74

Coelho, M.G.L., Silva, A.C.G., Vila Nova, C., Neto, J.M.O., Lima, A.C.N., Feijó,

R.G., Apolinário, D.F., Maggioni, R. and Gesteira, T.C.V. (2009)

Susceptibility of the wild southern brown shrimp (Farfantepenaeus subtilis)

to infectious hypodermal and hematopoietic necrosis (IHHN) and infectious

myonecrosis (IMN). Aquaculture 294: 1-4

Cordellier, M. and Pfenninger, M. (2008) Climate‐driven range dynamics of the

freshwater limpet, Ancylus fluviatilis (Pulmonata, Basommatophora).

Journal of Biogeography 35: 1580-1592

Crochu, S., Cook, S., Attoui, H., Charrel, R.N., De Chesse, R., Belhouchet, M.,

Lemasson, J.-J., de Micco, P. and de Lamballerie, X. (2004) Sequences of

flavivirus-related RNA viruses persist in DNA form integrated in the genome

of Aedes spp. mosquitoes. Journal of general virology 85: 1971-1980

De la Vega, E. (2006) A molecular approach to study the interaction between

environmental stress, immune response and disease in the black tiger prawn

(Penaeus monodon). Ph.D. Thesis. University of Queensland.

82

Dhar, A.K., Lakshman, D.K., Natarajan, S., Allnutt, F. and van Beek, N.A.M.

(2007) Functional characterization of putative promoter elements from

infectious hypodermal and hematopoietic necrosis virus (IHHNV) in shrimp

and in insect and fish cell lines. Virus Research 127: 1-8

Drummond, A.J., Rambaut, A., Shapiro, B. and Pybus, O.G. (2005) Bayesian

coalescent inference of past population dynamics from molecular sequences.

Molecular biology and evolution 22: 1185-1192

Duffy, S. and Holmes, E.C. (2008) Phylogenetic evidence for rapid rates of

molecular evolution in the single-stranded DNA begomovirus tomato yellow

leaf curl virus. Journal of virology 82: 957-965

Edgar, R.C. (2004) MUSCLE: multiple sequence alignment with high accuracy and

high throughput. Nucleic Acids Research 32: 1792-1797

Euler, M., Wang, Y., Heidenreich, D., Patel, P., Strohmeier, O., Hakenberg, S.,

Niedrig, M., Hufert, F.T. and Weidmann, M. (2013) Development of a panel

of recombinase polymerase amplification assays for detection of biothreat

agents. Journal of clinical microbiology 51: 1110-1117

Euler, M., Wang, Y., Nentwich, O., Piepenburg, O., Hufert, F.T. and Weidmann, M.

(2012) Recombinase polymerase amplification assay for rapid detection of

Rift Valley fever virus. Journal of Clinical Virology 54: 308-312

Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A.X. (2005)

Virus taxonomy: VIIIth report of the International Committee on Taxonomy

of Viruses. Academic Press.

Feschotte, C. and Gilbert, C. (2012) Endogenous viruses: insights into viral

evolution and impact on host biology. Nature Reviews Genetics 13: 283-296

Firth, C., Charleston, M.A., Duffy, S., Shapiro, B. and Holmes, E.C. (2009) Insights

into the evolutionary history of an emerging livestock pathogen: porcine

circovirus 2. Journal of virology 83: 12813-12821

Flegel, T.W. (2006) The special danger of viral pathogens in shrimp translocated for

aquaculture. Science Asia 32: 215-221

Flegel, T.W. (2009) Hypothesis for heritable, anti-viral immunity in crustaceans and

insects. Biol Direct 4: 32

Flegel, T.W. (2012) Historic emergence, impact and current status of shrimp

pathogens in Asia. Journal of Invertebrate Pathology 110: 166–173

Fontanella, F.M., Feldman, C.R., Siddall, M.E. and Burbrink, F.T. (2008)

Phylogeography of Diadophis punctatus: Extensive lineage diversity and

repeated patterns of historical demography in a trans-continental snake.

Molecular phylogenetics and evolution 46: 1049-1070

83

Formosa, T. and Alberts, B.M. (1986) Purification and characterization of the T4

bacteriophage uvsX protein. Journal of Biological Chemistry 261: 6107-

6118

Gillett R. (2008) Global study of shrimp fisheries. FAO Fisheries Technical Paper

No. 475. Rome, FAO. 331p

Guindon, S., Dufayard, J.-F., Lefort, V., Anisimova, M., Hordijk, W. and Gascuel,

O. (2010) New algorithms and methods to estimate maximum-likelihood

phylogenies: assessing the performance of PhyML 3.0. Systematic biology

59: 307-321

Guzmán-Sáenz, F.M., Molina-Garza, Z.J., Pérez-Castañeda, R., Ibarra-Gámez, J.C.

and Galavíz-Silva, L. (2009) Virus de la necrosis hipodérmica y

hematopoyética infecciosa (IHHNV) y virus del síndrome de Taura (TSV) en

camarón silvestre (Farfantepenaeus aztecus Ives, 1891 y Litopenaeus

setiferus Linnaeus, 1767) de La Laguna Madre, Golfo de México. Revista de

biología marina y oceanografía 44: 663-672

Hazreen Nita, M., Kua, B., Bhassu, S. and Othman, R. (2012) Detection and genetic

profiling of infectious hypodermal and haematopoietic necrosis virus

(IHHNV) infections in wild berried freshwater prawn, Macrobrachium

rosenbergii collected for hatchery production. Molecular Biology Reports 39

3785-3790

Hsieh, C.Y., Chuang, P.C., Chen, L.C., Tu, C., Chien, M.S., Huang, K.C., Kao,

H.F., Tung, M.C. and Tsai, S.S. (2006) Infectious hypodermal and

haematopoietic necrosis virus (IHHNV) infections in giant freshwater prawn,

Macrobrachium rosenbergii. Aquaculture 258: 73-79

Huang, S.W., Lin, Y.Y., Yu, E.M., Liu, T.T., Shu, H.Y., Wu, K.M., Tsai, S.F., Lo,

C.F., Kou, G.H. and Ma, G.C. (2008) A first glimpse into he genome of he

tiger shrimp, Penaeus monodon, Handbook and abstracts, 58.

Iskra-Caruana, M.L., Baurens, F.C., Gayral, P. and Chabannes, M. (2010) A Four-

Partner Plant-Virus Interaction: Enemies Can Also Come from Within.

Molecular plant-microbe interactions 23: 1394-1402

Jans, D.A., Xiao, C.Y. and Lam, M.H.C. (2000) Nuclear targeting signal

recognition: a key control point in nuclear transport? Bioessays 22: 532-544

Jaroenram, W., Arunrut, N. and Kiatpathomchai, W. (2012) Rapid and sensitive

detection of shrimp yellow head virus using loop-mediated isothermal

amplification and a colorogenic nanogold hybridization probe. Journal of

virological methods 186: 36-42

Jaroenram, W., Kiatpathomchai, W. and Flegel, T.W. (2009) Rapid and sensitive

detection of white spot syndrome virus by loop-mediated isothermal

amplification combined with a lateral flow dipstick. Molecular and cellular

probes 23: 65-70

84

Jaroenram, W. and Owens, L. (2014) Separation of endogenous viral elements from

infectious Penaeus stylirostris densovirus using recombinase polymerase

amplification. Molecular and Cellular Probes 28: 284-287

Jenkins, G.M., Rambaut, A., Pybus, O.G. and Holmes, E.C. (2002) Rates of

molecular evolution in RNA viruses: a quantitative phylogenetic analysis.

Journal of molecular evolution 54: 156-165

Jiménez, R., Barniol, R., De Barniol, L. and Machuca, M. (1999) Infection of IHHN

virus in two species of cultured penaeoid shrimp Litopenaeus vannamei

(Boone) and Litopenaeus stylirostris (Stimpson) in Ecuador during El Niño

1997–98. Aquaculture research 30: 695-705

Kalagayan, H., Godin, D., Kanna, R., Hagino, G., Sweeney, J., Wyban, J. and

Brock, J. (1991) IHHN Virus as an Etiological Factor in Runt-Deformity

Syndrome (RDS) of Juvenile Penaeus vannamei Cultured in Hawaii. Journal

of the World Aquaculture society 22: 235-243

Kersting, S., Rausch, V., Bier, F.F. and von Nickisch-Rosenegk, M. (2014) Rapid

detection of Plasmodium falciparum with isothermal recombinase

polymerase amplification and lateral flow analysis. Malaria journal 13: 99

Khawsak, P., Deesukon, W., Chaivisuthangkura, P. and Sukhumsirichart, W. (2008)

Multiplex RT-PCR assay for simultaneous detection of six viruses of penaeid

shrimp. Molecular and cellular probes 22: 177-183

Kiatpathomchai, W., Jaroenram, W., Arunrut, N., Jitrapakdee, S. and Flegel, T.W.

(2008) Shrimp Taura syndrome virus detection by reverse transcription loop-

mediated isothermal amplification combined with a lateral flow dipstick.

Journal of virological methods 153: 214-217

Kim, J.H., Choresca Jr, C.H., Shin, S.P., Han, J.E., Jun, J.W., Han, S.Y. and Park,

S.C. (2011) Detection of infectious hypodermal and hematopoietic necrosis

virus (IHHNV) in Litopenaeus vannamei shrimp cultured in South Korea.

Aquaculture 313: 161–164

Kim, J.H., Kim, H.K., Nguyen, V.G., Park, B.K., Choresca, C.H., Shin, S.P., Han,

J.E., Jun, J.W. and Park, S.C. (2012) Genomic sequence of infectious

hypodermal and hematopoietic necrosis virus (IHHNV) KLV-2010-01

originating from the first Korean outbreak in cultured Litopenaeus vannamei.

Archives of virology 157: 369-373

Koyama, T., Asakawa, S., Katagiri, T., Shimizu, A., Fagutao, F.F., Mavichak, R.,

Santos, M.D., Fuji, K., Sakamoto, T. and Kitakado, T. (2010) Hyper-

expansion of large DNA segments in the genome of kuruma shrimp,

Marsupenaeus japonicus. BMC genomics 11: 141

Krabsetsve, K., Cullen, B.R. and Owens, L. (2004) Rediscovery of the Australian

strain of infectious hypodermal and haematopoietic necrosis virus. Diseases

of aquatic organisms 61: 153-158

85

Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A.,

McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A. and Lopez, R. (2007)

Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948

Lightner, D., Poulos, B., Bruce, L., Redman, R., Mari, J. and Bonami, J. (1992) New

developments in penaeid virology: application of biotechnology in research

and disease diagnosis for shrimp viruses of concern in the Americas.

Diseases of Cultured Penaeid Shrimp in Asia and the United States, Fulks W.

& Main K., Eds. The Oceanic Institute, Makapuu Point, Honolulu, Hawaii,

USA: 233-253

Lightner, D., Redman, R. and Bell, T. (1983a) Infectious hypodermal and

hematopoietic necrosis, a newly recognized virus disease of penaeid shrimp.

Journal of invertebrate pathology 42: 62-70

Lightner, D., Redman, R., Bell, T. and Brock, J. (1983b) Detection of IHHN virus in

Penaeus stylirostris and P. vannamei imported into Hawaii. Journal of the

World Mariculture Society 14: 212-225

Lightner, D.V. (1996a) Epizootiology, distribution and the impact on international

trade of two penaeid shrimp viruses in the Americas. Revue scientifique et

technique (International Office of Epizootics) 15: 579-601

Lightner, D.V. (1996b) The penaeid shrimp viruses IHHNV and TSV:

epizootiology, production impacts and role of international trade in their

distribution in the Americas. Rev. Scient. et Techni. Office Internat. des

Epizoo 15: 579-601

Lightner, D.V. (1996c) The penaeid shrimp viruses IHHNV and TSV:

epizootiology, production impacts and role of international trade in their

distribution in the Americas. Rev. sci. tech. Off. int. Epiz 15: 579-601

Lin, C.L., Lee, J.C., Chen, S.S., Wood, H.A., Li, M.L., Li, C.F. and Chao, Y.C.

(1999) Persistent Hz-1 virus infection in insect cells: evidence for insertion

of viral DNA into host chromosomes and viral infection in a latent status.

Journal of virology 73: 128-139

Liu, H., Fu, Y., Xie, J., Cheng, J., Ghabrial, S.A., Li, G., Peng, Y., Yi, X. and Jiang,

D. (2011) Widespread endogenization of densoviruses and parvoviruses in

animal and human genomes. Journal of virology: 9863-9876

Lotz, J.M. (1997) Viruses, biosecurity and specific pathogen-free stocks in shrimp

aquaculture. World Journal of Microbiology and Biotechnology 13: 405-413

Martínez-Cordova, L.R. (1992) Cultured blue shrimp (Penaeus stylirostris) infected

with infectious hypodermal and hematopoietic necrosis virus in

Northwestern Mexico. The Progressive Fish-Culturist 54: 265-266

Martorelli, S.R., Overstreet, R.M. and Jovonovich, J.A. (2010) First report of viral

pathogens WSSV and IHHNV in Argentine crustaceans. Bulletin Of Marine

Science 86: 117-131

86

Molthathong, S., Jitrakorn, S., Joyjinda, Y., Boonchird, C., Witchayachamnarnkul,

B., Pongtippatee, P., Flegel, T. and Saksmerprome, V. (2013) Persistence of

Penaeus stylirostris densovirus delays mortality caused by white spot

syndrome virus infection in black tiger shrimp (Penaeus monodon). BMC

veterinary research 9: 33

Morales-Covarrubias, M., Nunan, L., Lightner, D., Mota-Urbina, J., Garza-Aguirre,

M. and Chavez-Snachez, M. (1999) Prevalence of IHHNV in wild

broodstock of Penaeus stylirostris from the upper Gulf of California, Mexico.

J. Aquat. Anim. Health 11: 296-301

Motte, E., Yugcha, E., Luzardo, J., Castro, F., Leclercq, G., Rodrı́guez, J., Miranda,

P., Borja, O., Serrano, J. and Terreros, M. (2003) Prevention of IHHNV

vertical transmission in the white shrimp Litopenaeus vannamei.

Aquaculture 219: 57-70

Nimitphak, T., Meemetta, W., Arunrut, N., Senapin, S. and Kiatpathomchai, W.

(2010) Rapid and sensitive detection of Penaeus monodon

nucleopolyhedrovirus (PemoNPV) by loop-mediated isothermal

amplification combined with a lateral-flow dipstick. Molecular and cellular

probes 24: 1-5

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N.

and Hase, T. (2000) Loop-mediated isothermal amplification of DNA.

Nucleic Acids Research 28: e63-e63

Nunan, L., Poulos, B. and Lightner, D. (2000) Use of polymerase chain reaction for

the detection of infectious hypodermal and hematopoietic necrosis virus in

penaeid shrimp. Marine Biotechnology 2: 319-328

Owens, L. (1987) Histological evidence for a IHHNV-like virus in Australia, First

Australian Prawn Farming Research Workshop. NSW Department of

Agriculture, Salamander Bay, New South Wales, Australia

Owens, L. (2013) Bioinformatical analysis of nuclear localisation sequences in

penaeid densoviruses. Marine genomics 12: 9-15

Owens, L., Anderson, I.G., Kenway, M., Trott, L. and Benzie, J.A.H. (1992)

Infectious Hypodermal and Hematopoietic Necrosis Virus (Ihhnv) in a

Hybrid Penaeid Prawn from Tropical Australia. Diseases of aquatic

organisms 14: 219-228

Owens, L. and Hall-Mendelin, S. (1989) Recent advances in Australian penaeid

diseases and pathology. Advances in Tropical Aquaculture, Tahiti. Actes

Colloq 9:103–112

Pantoja, C.R., Lightner, D.V. and Holtschmit, K.H. (1999) Prevalence and

geographic distribution of infectious hypodermal and hematopoietic necrosis

virus (IHHNV) in wild blue shrimp Penaeus stylirostris from the Gulf of

California, Mexico. Journal of Aquatic Animal Health 11: 23-34

87

Parsyan, A., Szmaragd, C., Allain, J.-P. and Candotti, D. (2007) Identification and

genetic diversity of two human parvovirus B19 genotype 3 subtypes. Journal

of general virology 88: 428-431

Piepenburg, O., Williams, C.H., Stemple, D.L. and Armes, N.A. (2006) DNA

detection using recombination proteins. PLoS biology 4: e204

Pond, S.L.K. and Frost, S.D.W. (2005) Not so different after all: a comparison of

methods for detecting amino acid sites under selection. Molecular biology

and evolution 22: 1208-1222

Pond, S.L.K., Posada, D., Gravenor, M.B., Woelk, C.H. and Frost, S.D.W. (2006)

Automated phylogenetic detection of recombination using a genetic

algorithm. Molecular biology and evolution 23: 1891-1901

Poon, A.F.Y., Frost, S.D.W. and Pond, S.L.K. (2009) Detecting signatures of

selection from DNA sequences using Datamonkey, Bioinformatics for DNA

Sequence Analysis, pp. 163-183. Springer.

Posada, D. (2008) jModelTest: phylogenetic model averaging. Molecular biology

and evolution 25: 1253-1256

Primavera, J.H. and Quinitio, E.T. (2000) Runt-deformity syndrome in cultured

giant tiger prawn Penaeus monodon. Journal of Crustacean Biology 20: 796-

802

Puthawibool, T., Senapin, S., Kiatpathomchai, W. and Flegel, T.W. (2009)

Detection of shrimp infectious myonecrosis virus by reverse transcription

loop-mediated isothermal amplification combined with a lateral flow

dipstick. Journal of virological methods 156: 27-31

Rai, P., Pradeep, B. and Karunasagar, I. (2009) Detection of viruses in Penaeus

monodon from India showing signs of slow growth syndrome. Aquaculture

289: 231-235

Rai, P., Safeena, M.P., Karunasagar, I. and Karunasagar, I. (2011) Complete nucleic

acid sequence of Penaeus stylirostris densovirus (PstDNV) from India. Virus

Research 158: 37-45

Rai, P., Safeena, M.P., Krabsetsve, K., La Fauce, K., Owens, L. and Karunasagar, I.

(2012) Genomics, Molecular Epidemiology and Diagnostics of Infectious

hypodermal and hematopoietic necrosis virus. Indian Journal of Virology 23:

203-214

Rambaut, A. and Drummond, A.J. (2007) Tracer v1. 4. Available from

http://beast.bio. ed.ac.uk/Tracer.

Robles-Sikisaka, R., Bohonak, A.J., McClenaghan Jr, L.R. and Dhar, A.K. (2010)

Genetic signature of rapid IHHNV (Infectious hypodermal and

hematopoietic necrosis virus) expansion in wild Penaeus shrimp populations.

PloS one 5: e11799

88

Robles-Sikisaka, R., Hasson, K.W., Garcia, D.K., Brovont, K.E., Cleveland, K.D.,

Klimpel, K.R. and Dhar, A.K. (2002) Genetic variation and

immunohistochemical differences among geographic isolates of Taura

syndrome virus of penaeid shrimp. Journal of general virology 83: 3123-

3130

Rusaini, L.F., Kathy A., Elliman, J., Bowater, R.O. and Owens, L. (2013)

Endogenous Brevidensovirus-like elements in Cherax quadricarinatus:

Friend or foe? Aquaculture 396: 136-145

Saksmerprome, V., Jitrakorn, S., Chayaburakul, K., Laiphrom, S., Boonsua, K. and

Flegel, T.W. (2011) Additional random, single to multiple genome fragments

of Penaeus stylirostris densovirus in the giant tiger shrimp genome have

implications for viral disease diagnosis. Virus Research 160: 180-190

Saksmerprome, V., Puiprom, O., Noonin, C. and Flegel, T.W. (2010) Detection of

infectious hypodermal and haematopoietic necrosis virus (IHHNV) in

farmed Australian Penaeus monodon by PCR analysis and DNA sequencing.

Aquaculture 298: 190-193

Scholtissek, C. (1995) Molecular evolution of influenza viruses. Virus genes 11:

209-215

Shackelton, L.A., Hoelzer, K., Parrish, C.R. and Holmes, E.C. (2007) Comparative

analysis reveals frequent recombination in the parvoviruses. Journal of

general virology 88: 3294-3301

Shackelton, L.A. and Holmes, E.C. (2006) Phylogenetic evidence for the rapid

evolution of human B19 erythrovirus. Journal of virology 80: 3666-3669

Shackelton, L.A., Parrish, C.R., Truyen, U. and Holmes, E.C. (2005) High rate of

viral evolution associated with the emergence of carnivore parvovirus.

Proceedings of the National Academy of Sciences of the United States of

America 102: 379-384

Shibata, T., Cunningham, R.P., DasGupta, C. and Radding, C.M. (1979)

Homologous pairing in genetic recombination: complexes of recA protein

and DNA. Proceedings of the National Academy of Sciences 76: 5100-5104

Shike, H., Dhar, A.K., Burns, J.C., Shimizu, C., Jousset, F.X., Klimpel, K.R. and

Bergoin, M. (2000) Infectious hypodermal and hematopoietic necrosis virus

of shrimp is related to mosquito brevidensoviruses. Virology 277: 167-177

Staginnus, C. and Richert-Pöggeler, K.R. (2006) Endogenous pararetroviruses: two-

faced travelers in the plant genome. Trends in plant science 11: 485-491

Strimmer, K. and Pybus, O.G. (2001) Exploring the demographic history of DNA

sequences using the generalized skyline plot. Molecular biology and

evolution 18: 2298-2305

89

Talavera, G. and Castresana, J. (2007) Improvement of phylogenies after removing

divergent and ambiguously aligned blocks from protein sequence alignments.

Systematic biology 56: 564-577

Tang, K. and Lightner, D.V. (2001) Detection and quantification of infectious

hypodermal and hematopoietic necrosis virus in penaeid shrimp by real-time

PCR. Diseases of aquatic organisms 44: 79-85

Tang, K. and Lightner, D.V. (2002a) Low sequence variation among isolates of

infectious hypodermal and hematopoietic necrosis virus (IHHNV)

originating from Hawaii and the Americas. Diseases of aquatic organisms

49: 93-97

Tang, K.F. and Lightner, D.V. (2002b) Low sequence variation among isolates of

infectious hypodermal and hematopoietic necrosis virus (IHHNV)

originating from Hawaii and the Americas. Diseases of aquatic organisms

49: 93-97

Tang, K.F., Poulos, B.T., Wang, J., Redman, R.M., Shih, H.-H. and Lightner, D.V.

(2003) Geographic variations among infectious hypodermal and

hematopoietic necrosis virus (IHHNV) isolates and characteristics of their

infection. Diseases of aquatic organisms 53: 91-99

Tang, K.F.J., Durand, S.V., White, B.L., Redman, R.M., Pantoja, C.R. and Lightner,

D.V. (2000) Postlarvae and juveniles of a selected line of Penaeus stylirostris

are resistant to infectious hypodermal and hematopoietic necrosis virus

infection. Aquaculture 190: 203-210

Tang, K.F.J. and Lightner, D.V. (2006) Infectious hypodermal and hematopoietic

necrosis virus (IHHNV)-related sequences in the genome of the black tiger

prawn Penaeus monodon from Africa and Australia. Virus Research 118:

185-191

Tang, K.F.J., Navarro, S.A. and Lightner, D.V. (2007) PCR assay for discriminating

between infectious hypodermal and hematopoietic necrosis virus (IHHNV)

and virus-related sequences in the genome of Penaeus monodon. Diseases of

aquatic organisms 74: 165

Unzueta-Bustamante, M.L., Holtschmit, K., Olivas-Valdez, J., Martínez-Córdova,

L., Porchas-Cornejo, M. and Lizárraga-Partida, M. (1998) Infectious

Hypodermal And Hematopoietic Necrosis Virus (Ihhnv) In Wild Parent

Stocks Of Blue Shrimp, Penaeus Styfirostris (Stimpson), In Guaymas Bay,

Sonora, Mexico. Ciencias Marinas 24: 491-498

Vega-Heredia, S., Mendoza-Cano, F. and Sánchez-Paz, A. (2012) The Infectious

Hypodermal and Haematopoietic Necrosis Virus: A Brief Review of What

We Do and Do Not Know. Transboundary and Emerging Diseases 59: 95-

105

Xiang, J. (2001) Recent advance of research and development on marine

biotechnology in China, 6-8. In Postgraduate conference on marine biology and

biotechnology, June, pp. 6-8

90

Yang, B., Song, X.L., Huang, J., Shi, C.Y. and Liu, L. (2007) Evidence of existence

of infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp

cultured in China. Veterinary microbiology 120: 63-70

Yonesaki, T., Ryo, Y., Minagawa, T. and Takahashi, H. (1985) Purification and

some of the functions of the products of bacteriophage T4 recombination

genes, uvs X and uvs Y. European Journal of Biochemistry 148: 127-134

Zabbey, N., Erondu, E. and Hart, A. (2010) Nigeria and the prospect of shrimp

farming: critical issues. Livestock Res Rural Dev. 22

Zhang, C., Yuan, J. and Shi, Z. (2007) Molecular epidemiological investigation of

infectious hypodermal and hematopoietic necrosis virus and Taura syndrome

virus in Penaeus Vannamei cultured in China. Virologica Sinica 22: 380-388

Zhang, J.X. and Sun, X.Q. (1997) A preliminary study on the virus in the eggs of

Penaeus chinensis. J Oceanogr Huanghai and Bohai Seas 15: 48-51

91

APPENDIX A

Reagents and bacteriological media

1. Reagents for bacterial cell transformation

1.1. 20 mM Isopropyl thio-β-D-galactoside (IPTG)

Isopropyl thio-β-D-galactoside 0.0477 g

Deionized water 10 ml

Mix homogenously and filter through 0.2 µm filter paper. Then, keep

at -20 oC in a foil-wrapped tube until use.

1.2. 50 mg/ml 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal)

X-Gal 100 mg

Dimethylformamide 2 ml

Mix homogenously and filter through 0.2 µm filter paper. Then keep

at -20 oC in a foil-wrapped tube until use.

1.3. Ampicillin stock solution (100 mg/mL)

Dissolve 1 g of sodium ampicillin (MW: 371.40 g/mol) in sufficient

distilled water to make a final volume of 10 ml. Mix homogenously

and filter through 0.2 or 0.45 µm filter paper. Then, store the

ampicillin in aliquots at -20°C for 1 year or at 4 °C for 3 months.

2. Reagents for agarose gel electrophoresis

2.1. 0.5M EDTA

EDTA.Na2.2H2O 186.12 g

Deionized water 800 ml

Stir well and adjust pH to 8.0 using NaOH pellet or 10N NaOH

solution. Then, add distilled water up to 1 L followed by autoclaving

at 121oC, 15 lb pressure for 15 min. Keep at room temperature

92

2.2. 50X TAE Buffer, pH 8.3

Trizma® Base 242 g

Glacial acetic acid 57.1 ml

0.5M EDTA 100 ml

Deionized water 750 ml

Stir well and adjust pH to 8.3 if required. Then, add distilled water up

to 1 L followed by autoclaving at 121oC, 15 lb pressure for 15 min.

Dilute Stock buffer to 1X final concentration before use.

3. LFD Buffer (Phosphate Buffered Saline containing 0.1% Tween20)

NaC 18 g

KCl 0.2 g

Na2HPO4 1.44 g

KH2PO4 0.24 g

Deionized water 800 ml

Stir well and adjust pH to 7.4. Then, add deionized water up to 1 l

followed by autoclaving at 121oC, 15 lb pressure for 15 min. Then,

add Tween 20 to a final concentration of 0.1% (v/v) then keep at 4 o

C

until use.

4. Bacterial cell culture media

4.1. LB Broth solution

Difco™ LB Broth Miller powder 25 g

Deionized water 1 l

Mix thoroughly and then autoclave at 121oC, 15 lb pressure for 15

min. Keep at 4oC until used.

93

4.2 LB agar plate

Difco™ LB Broth Miller powder 25 g

Difco™ Solidifying agent 15 g

Deionized water 1 l

Mix thoroughly and then autoclave at 121oC, 15 lb pressure for 15

min. Pour plates then keep at 4oC until use.

94

APPENDIX B

A preliminary study on PstDV status in Australian and imported prawns by

Krabsetsve and Owens (unpublished)

Table B.1: Details of shrimp used for PstDV screening by PCR using multiple

primers

Year Species Stage of shrimp/ type of

shrimp (farmed/caught) Origin

Number of

Samples

Australian sample

1991 P.monodon/P.

esculentus

Hybrids AIMS 3

1993 P. monodon Wild caught (B) AIMS 10

1994 P. monodon Broodstock AIMS 12

1995A P. monodon Broodstock AIMS 7

1995B P. monodon Farmed/Juveniles Mossman/AIMS 3*

1996 P. monodon Farmed/Wild caught AIMS 7

1997 P.monodon Farmed Seafarm 5

1997 P. monodon Juveniles Burdekin 10

1999 P. monodon Wild caught (B) Jan Glade 10

2001 P. monodon Farmed QLD Farm, Cardwell 10

2003 P. monodon Farmed QLD Farm, Cardwell 10

2003/2004 P. monodon N/A AIMS 10

2004

2004

P. monodon

P. semisulcatus

Adults/Wild caught

Adult/Wild caught

Wild caught, QLD

Wild caught, QLD

9

1

2005 March P. monodon Grow-out QLD Farm, Cardwell 6

95

2005 July P. monodon Grow-out QLD Farm, Cardwell 20

2009 P. monodon Post larvae QLD Farm, Ayr 6

2009 P. monodon Grow-out QLD Farm, Ayr 12

2009 P. monodon Broodstock QLD Farm, Ayr 7

Imported samples

2002 P. stylirostris Adults New Caledonia 5

2005 P. vannamei Adults China I 5

2005 P. vannamei Adults China II 5

2009 P. vannamei Adults Malaysia 10

2009 P. vannamei Adults Indonesia 10

2009 P. monodon Broodstock Brunei 3

Table B.2: PCR results corresponding to the samples listed in Table B.1. Plus (+)

and minus (-) signs denote positive and negative result, respectively.

Year Sample

No.

Primers

392F/R 389F/R 309F/R MG831F/R

1991

1A +ve +ve +ve +ve -ve

1B +ve -ve -ve -ve -ve

2 +ve +ve +ve +ve -ve

1993

1 to 3 +ve -ve -ve -ve -ve

96

4 to 10 +ve +ve -ve -ve -ve

1994

1 -ve -ve -ve -ve -ve

2 +ve -ve -ve -ve -ve

3 +ve +ve -ve -ve -ve

4 +ve +ve -ve -ve -ve

5 +ve -ve -ve -ve -ve

6 +ve -ve +ve -ve -ve

7 +ve +ve -ve -ve + very weak/double band

8 +ve -ve -ve -ve -ve

9 +ve +ve -ve -ve + very weak/double band

10 +ve +ve -ve -ve -ve

11 +ve -ve -ve -ve + very weak/double band

12 +ve +ve -ve -ve -ve

1995 A

1 +ve +ve -ve -ve -ve

2 +ve +ve +ve +ve -ve

3 +ve -ve -ve -ve -ve

4 +ve +ve -ve -ve -ve

5 +ve +ve -ve -ve -ve

97

1995 B

6* +ve +ve -ve -ve + weak/double bands

(Pooled *) 7* +ve +ve -ve -ve + weak/double bands

8* +ve +ve +ve +ve + double bands

1996

1 +ve +ve -ve -ve + very weak/double bands

2 +ve +ve -ve -ve + very weak/double bands

3 +ve +ve +ve +ve + very weak/double bands

4 +ve -ve -ve -ve + very weak/double bands

5 +ve +ve -ve -ve + very weak/double bands

6 +ve +ve -ve -ve + very weak/double bands

7 +ve +ve -ve -ve + very weak/double bands

1997 A

1 +ve +ve -ve -ve + weak/double bands

2 +ve -ve -ve -ve + weak/double bands

3 +ve -ve -ve -ve + weak/double bands

4 +ve +ve -ve -ve + weak/double bands

5 +ve +ve -ve -ve + weak/double bands

1997 B

98

6 +ve +ve +ve -ve -ve, only 600 bp band

7 +ve +ve -ve -ve +ve double bands

8 +ve +ve -ve -ve +ve double bands

9 +ve +ve +ve -ve +ve double bands

10 +ve +ve +ve -ve +ve double bands

11 +ve +ve +ve -ve +ve double bands

12 +ve +ve -ve -ve +ve double bands

13 +ve +ve +ve -ve +ve double bands

14 +ve -ve -ve -ve +ve double bands

15 +ve +ve -ve -ve +ve

1999

1 to 4 +ve +ve -ve -ve +ve double bands, very weak

5 +ve +ve +ve -ve +ve double bands

6 +ve -ve -ve -ve +ve double bands

7 +ve -ve -ve -ve -ve

8 +ve -ve -ve -ve +ve double bands

9 +ve +ve +ve -ve +ve

10 +ve -ve -ve -ve -ve

2001

1 to 10 +ve +ve -ve -ve +ve double bands

99

2003

1 +ve +ve -ve -ve +ve double bands

2 +ve -ve -ve -ve +ve double bands

3 +ve +ve -ve -ve +ve double bands

4 +ve +ve -ve -ve +ve double bands

5 +ve -ve -ve -ve +ve double bands

6 +ve -ve -ve -ve +ve double bands

7 +ve -ve -ve -ve +ve double bands

8 +ve +ve -ve -ve +ve double bands

9 +ve +ve -ve -ve +ve double bands

10 +ve +ve -ve -ve +ve double bands

2003/

2004 Aims

1 to 9 +ve +ve -ve -ve + very weak/double bands

10 +ve -ve -ve -ve + very weak/double bands

2004 wild

1 +ve +ve -ve -ve +ve double bands

2 +ve +ve -ve -ve -ve

3 +ve -ve -ve -ve +ve double bands

4 +ve -ve -ve -ve +ve double bands

100

5 +ve +ve -ve -ve +ve double bands

6 +ve +ve +ve +ve +ve double bands

7 +ve -ve -ve -ve +ve double bands

8 +ve +ve -ve -ve +ve double bands

9 +ve +ve +ve -ve +ve double bands

Semisulcatus S10 +ve -ve -ve -ve -ve

2005 A

M1 to

M5 +ve +ve -ve -ve

+ve double bands

M6 +ve +ve +ve -ve +ve

M7 to

M9 +ve +ve -ve -ve

+ve double bands

M10 +ve +ve +ve +ve +ve double bands

M11 +ve +ve -ve -ve +ve double bands

M12 +ve +ve -ve -ve +ve double bands

M13 +ve +ve -ve -ve +ve double bands

M14 +ve +ve +ve +ve +ve double bands

M15 +ve +ve -ve -ve +ve double bands

M16 +ve +ve -ve -ve +ve double bands

M17 +ve +ve +ve -ve +ve

M18 +ve +ve -ve -ve +ve double bands

101

M19 +ve +ve +ve -ve +ve

M20 +ve +ve -ve -ve +ve double bands

2005 B

5 +ve +ve -ve -ve +ve double bands

275 +ve +ve -ve -ve + very weak

276 +ve +ve +ve -ve +ve

277 +ve +ve +ve -ve +ve

278 +ve +ve -ve -ve + very weak

271 +ve +ve -ve -ve +ve double bands

2009

Postlarvae

Pl1 to

Pl5 +ve +ve +ve -ve +ve

Pl6 +ve +ve -ve -ve +ve

Runts/Stunts 1 +ve +ve -ve -ve +ve double bands

-Ayr 2 +ve -ve -ve -ve +ve double bands

3 to 4 +ve -ve -ve -ve +ve double bands

5 to 12 +ve +ve -ve -ve +ve double bands

Spawners 1 to 4 +ve +ve -ve -ve -ve

5 +ve -ve -ve -ve -ve

102

6 +ve -ve -ve -ve +ve

7 +ve -ve -ve -ve -ve

Imported shrirmp

P. stylirostris

New

Caledonia STY1 +ve +ve +ve +ve -ve

STY2 +ve +ve +ve +ve -ve

STY3 +ve +ve +ve +ve -ve

STY4 +ve +ve +ve +ve -ve

STY5 +ve +ve +ve +ve -ve

P. vannamei

China

CV1 to

CV5 +ve +ve +ve +ve -ve

TV1 to

TV5 +ve +ve +ve +ve -ve

Malaysia 1-10 -ve -ve -ve -ve -ve

Indonesia 1-10 +ve -ve -ve -ve -ve

P. monodon

Brunei B1 +ve +ve -ve -ve +ve

B2 +ve -ve -ve -ve +ve

B3 +ve +ve +ve +ve -ve

103

APPENDIX C

Detail of PstDV insertion patterns in the genome of shrimp from Farm A

(Table C.1) and B (Table C.2) and the background of prawn (Table C.3)

examined in Chapter 4.

Table C.1: Detail of PstDV insertion patterns examined from shrimp from Farm A.

In column 1, the number in brackets indicate the number of shrimp

samples with the same pattern of positive (+) and negative (-) results as

that for the sample number given. For example, in ''3 inserts or 5 gaps (5

samples)", a sample in Pond 53 has an identical pattern to that of Pond

61.

Isolate (#) Primer pairs used, position and expected size relative to Mexican PstDV isolate (AF273215)

80 samples in total: Pair 1 Pair 2 Pair 3 Pair 4 Pair 5 Pair 6 Pair 7 Pair 8

-Pond 66: 25 shrimp

-Pond 53: 25 shrimp

-Pond 41: 26 shrimp

-Pond 48: 4 shrimp 158-723

702-

1260

1059-

1507

1451-

2027

2002-

2569

2544-

3100

3031-

3625

3168-

3759

566 bp 559 bp 449 bp 577 bp 568 bp 557 bp 595 bp 592 bp

Infective PstDV (13 samples) + + + + + + + +

-Pond 41: 11 samples

-Pond 53: 2 samples

7 inserts or 1 gap (1 sample) + + - + + + + +

-Pond 53

6 inserts or 2 gaps (4 samples) + + + + + + - -

-Pond 41

4 inserts or 4 gaps (2 samples)

-Pond 41: 1 sample + + - - - + - +

104

-Pond 41: 1 sample + + - + - + - -

3 inserts or 5 gaps (5 samples)

-Pond 41: 1 sample + - - - - + - +

-Pond 53: 1 sample + + + - - - - -

-Pond 53 & 66: 1 each + + - - - - - +

-Pond 66: 1 sample + + - + - - - -

2 inserts or 6 gaps (48 samples) + + - - - - - -

-Pond 41: 6 samples

-Pond 48: 4 samples

-Pond 53: 17 samples

-Pond 66: 21 samples

1 insert or 7 gaps (6 samples) - + - - - - - -

-Pond 41: 2 samples

-Pond 53: 2 samples

-Pond 66: 2 samples

No insert (1 sample): Pond 53 - - - - - - - -

105

Table C.2: Detail of PstDV insertion patterns examined from shrimp from Farm B.

In column 1, the number in brackets indicate the number of shrimp

samples with the same pattern of positive (+) and negative (-) results as

that for the sample number given. For example, in “1 insert (7 gaps) (3

samples)", 2 samples share an identical pattern (pattern 1) and that

differs from pattern 2 which also has 1 insert.

Isolate (#)

50 samples in total:

-Pond 22A: 25 shrimp

-Pond 33A: 25 shrimp

Primers used, position and expected size relative to Mexican PstDV isolate (AF273215)

Pair 1 Pair 2 Pair 3 Pair 4 Pair 5 Pair 6 Pair 7 Pair 8

158-723

702-1260

1059-1507

1451-2027

2002-2569

2544-3100

3031-3625

3168-3759

566 bp 559 bp 449 bp 577 bp 568 bp 557 bp 595 bp 592 bp

Infective PstDV (0 sample)

4-7 inserts or 1-4 gaps (0 sample)

3 inserts or 5 gaps (1 sample) + + - - - - - +

-Pond 22A

2 inserts or 6 gaps (43 samples) + + - - - - - -

-Pond 22A: 22 samples

-Pond 33A: 21 samples

1 insert or 7 gaps (3 samples)

-Pond 33A (pattern1): 2 samples - + - - - - - -

-Pond 33A (pattern2): 1 sample + - - - - - - -

No insert (3 samples) - - - - - - - -

-Pond 22A: 2 samples

-Pond 33A: 1 sample

106

Table C.3: Details of shrimp used for PstDV random insert examination as

determined by the 8-overlapinng PCR primer method (see Table C.1 and

C.2). The shrimp were collected in October 2012.

Farm

Pond name Origin of seed size Number of

shrimp tested

Number of PstDV

infected shrimp

%

Prevalence

A 66 East Coast Wild caught broodstock 5.7 g 25 0 0.00

53 East Coast Wild caught broodstock 5.9 g 25 2 8.00

48 North Territory Wild caught broodstock 1.0 g 4 (all we have) 0 0.00

41 North Territory Wild caught broodstock 0.5 g 26 (all we have) 11 42.31

Total: 80 13 16.25

B 22A Wild caught broodstock 10.0 g 25 0 0.00

33A Wild caught broodstock 8.0 g 25 0 0.00

Total: 50 0 0.00

107

APPENDIX D

The genome sequence of Australian PstDV (AUS-PstDV2012) reported in this

thesis (GenBank No. KM593913)

ATGGAAGATACGAACAACCACCCATGGCAATCAATACCTAGTCCGTCAT

TATTTGGATCATCAAGTAACAGTGAACCAACAGAAGTCTTTGAAAACGT

CTTCGGGGAAAGACAAACCCAAGGATACAAATGTAAGTACAAGTGACTG

ACTAAGTGACGATCCGTTAAATTCCTGATTGACGCAAATGACGACGTCA

TATGCGTCACTTACAAAAGACGTAACCGCTTTCGTCCATCACTCACTTAA

ATCTTTCTCTACCTTTCAGACGACATACCCCAACAAATATCGCTGCGCTA

CTGCCCAGATCACATTCTACCGTGGTGCTTCATAGGGAACAGACCCGTTC

TCTACTGCCTCTGCAACGAGTGTTTTATAGACAATCTCAATGTCAACGGA

CAGTGTCAACACTGTCATCCCGACGACGAAGAATGGACAGAAAATATGG

CCAAGAACGTACTGCATACATGTGAGGGCAAACCAGACTCACTTAGTGA

AATGCTTCGACGAAGCACGGAATCGACTGACTCCAGCCAGGGAATTTCT

CCAAGCCTTCTCACCCCAGGTCCAAATCAAGAGCCTGGACCCACTACCG

AACAACTTCTTAATATGTCTGAAGAATTGTTCCAGTTTTCAGACGAGGAA

GACAATTCTCAAACTCCTCCAAGAACTTCAACACCAGAACAAACTGATC

CTAAGGTCTGCGTGGATAACCTGGGAATACGAGAGGGAACAGGAAACG

GAACAATTCAACTTGGAAGTGAATCAGAAACCTCCCTTGGAAGTGTTGG

AAACAGTAATAACAGGCGTCAAAAGAGACAGAGAGGAATTACTTACAT

CAGTGACACATCAGATTCCTCTGGATCAGATGACGAAAATCTGGGTGCA

TCACATAGAAATAAAAGAAGCAAACACTCCGACACCACAAAAGAGACA

GGCGGAGGAGACGACCGACGACATCAGGAAAGCGATCAAGGAAGCAAT

GGAAATCGACTGGAACCTACCGATGGAGGAGAGAGCTATAGTAGCGGA

ACACAACCCGACTTTATTGAAGGGACTCCCGACGGACCGGACGAAATGG

ACGGAAGGCGACTGGAAGAGAGTGAGATTGAAAAACAAGTGGAAAGTA

CAACATGGTACACCTTCGTCATCAGAGAAAAACCACAACCAAGAAGACT

CTCCGGACGAACGCCAAACTTCACCATTACAGATCATGGTGACCACTGG

CACATCACATACTCCGGACACCCAACCAATAAGACCAGACATAGAGCTA

CAATCCTCGCCTATTTGGGAGTTACCTTTGCTGCCAGAGCCGAAGCTGAA

GCGACTACGGTACTTATTAAAGATATCAAGAGATGGATACTCTATCTTAT

CAGATACGGTATTGAACGGCTTTCGTATTTTGGTCTTGGCCACACCATTT

TTAGAAGAATCATCAAGTACTTCCAACAATACCGAAGAGAAGAGGACAC

CATAGACGGACCATGTCCATACATGTCCAGCACAAGAGATGAAAGAGGA

GAAGAAAAATCCAAAGAAAACAGTGCTGAATACGACTACCTGAGGCAC

CTCGTCAAAAGTAAAGCAGCAAGAACAGTACAAGAACTGGTTAATAAAC

TAGACGATGAAGAATACAAACAACTCTGGACACGTACAAGGGGACAAT

ATAAAGACAAATTAAGAGGAATCCTCACTTACTACAACAACAAGAAGAA

ATTCAGTCAAAGTCAACTATCACTCATTACAATCTACACAATATATCAAA

AAGGAAACCAGACTTCGAAAACATGCAATGGCTCAAGTACATGTTCGCC

AACAATGACATCCGTGTACCAGAAATCTTAGCATGGATAATTATAGTTG

CTGACAAGAAACTTGATAAAATTAACACTCTAGTTCTACAAGGACCAAC

AGGAACAGGCAAATCTCTGACCATTGGAGCATTACTCGGCAAGTTAAAC

ACTGGCTTAGTAACAAGAACAGGAGATTCAAACACCTTCCATCTTCAAA

ACCTCATCGGAAAATCCTATGCACTATTCGAAGAACCAAGAATTAGTCA

AATAACAGTGGACGACTTCAAACTCCTTTTCGAAGGATCAGACTTAGAA

108

GTAAACATAAAACACCAAGAGTCAGAAATTATGGGACGAATACCAATCT

TCATATCAACAAACAAGGACATAGACTACTGGGTACCTCCAGCTGATGG

TAAAGCTCTACAAACAAGAACAATAACCTTCCACCTGACAAGACAAATA

AAAGGCCTCTCAGACAGGATGAACAGCCAGTACGACATCAACCCTCCAC

CAGACAAGATCACCAGCGACGACTTCCTAGGACTCTTCCAAGAATACGA

AAAGGAAATCGACGACATCATAGACAACCATGTGCGCCGATTCAACAAG

AGCAAGCCCAAGGAAAAGATCCAGGAGGGATGCACATAATGAAGACGA

AGAACACGCCGAAGGATCAAGTGGACCAGACCCACACAGATGTCTACA

ATTCAATACTGGAGACTCAATACATATTACTTTCCAAACAAGAAGATACT

TCGAATTCGACGCTGCCAATGATGGAAACTTCGACGGAAAAAATTTATA

CTGCCTCCCACTACATTGGATGAACTTATATCTCTATGGTCTAAAGAGCA

GCGACAGTTCAGCATCAGAAACACAACGATATAAAATGGTAAAATCAAT

GATGAAGACCTACGGATGGAAAGTACACAAAGCAGGCGTAGTGATGCA

CTCGATGGTACCCCTTATGAAAGACTTAAAAGTATCAGGGGGAACATCA

TTTGAGACTCTCACATTTACAGACACCCCATATTTAGAAATATTTAAGGA

TACTACTGGACTACATAATCAACTATCAACTAAGGAAGCCGACGTAACA

TTGGCTAAATGGATTCAAAATCCCCAACTTGTAACGGTACAATCCACAG

CTGCAAATTATGAAGACCCTCTCCAACAATTTGGCTTCATGGAACAAATG

CGAACAGGAGATAGAAAGGCTTATACAATCCATGGTGATACAAGAAACT

GGTATGGAGGAGAAATAGCTACAACTGGACCGATCTTTATTCCAAAGTG

GGGAGGCCAAATCAAATGGGACAAACCATCCCTTGGAAACCTTGTCTAC

CCAGCGGAACATCATACCAACGATTGGCAACAAATCTTCATGAGAATGT

CACCAATCAAAGGACCATCCGGAGAAGAACTAAAGCTAGGCTGCAGAG

TACAAGCAGACTTCTTCCTACACCTAGAAGTTCGACTCCCACCGCAAGG

ATGTGTAGCAAGTCTGGGGATGCAGCAATATCTCCATAAACCATGTTCA

GGACAACTTAACAAATGTTATGTTATGCATACTAACTAATATACTTAATC

TGTGCAATATGTAACCAACTATAACCTGCTTTATACCAATAAAAACCCAC

AAAAAGCAAATATATCTCACTATCCTTTACACAAACCGGCTACCCAGGC

ATGGTGGGAAACCTGCTACCCAGGCAAGGTGGGACAATAATCTCATAAT

GACAAAATAAGTCAGTCATATAAGTCATTCACAAAAGACTCGTAACTCC

ACCGTCAGTCAGTCATTTAGAGTC

109

APPENDIX E

The host origins of Australian endemic PstDVs

Table E.1: Detail of the host origins of Australian endemic PstDVs

GenBank No. Year of isolation Host origin

KM593908 1991 P. esculentus/ P. monodon hybrid obtained

from research facility in northern

Queensland

EU675312 1993 P. monodon from East Coast prawn farm

KM593909 1995 Farmed P. monodon broodstock

KM593910 1996 Farmed P. monodon originated from wild

captured broodstock (personal

communication with prawn farm)

KM593911 2004 Wild captured P. monodon broodstock

KM593912 2005 Wild captured P. monodon broodstock

GQ475529 2008 Farmed P. monodon

KM593913

(this study)

2012 Farmed P. monodon originated from wild

captured P. monodon broodstock

110

APPENDIX F

Detail of natural selection analysis using SLAC, FEL, and REL approaches

Table F.1: Detail of positively and negatively selected sites for ORF1, 2 and 3 of

the genome of non-Australian PstDV isolates (nAus Grp 1) as analyzed

by method consensus (SLAC, FEL and REL). Significance level: SLAC

p-value: 0.1; FEL p-value: 0.1; REL Bayes Factor: 50. Color legend in

the tables: Codon is non-neutral according to a given method at the

specified significance level. In the consensus column, Codon has

dN>dS '+' inside the box means that the difference is significant. In the

consensus column, Codon has dN<dS '+' inside the box means that the

difference is significant.

Codon SLAC dN-

dS

SLAC p-

value

FEL dN-

dS

FEL p-

value

REL dN-

dS

REL Bayes

Factor

Consensus

ORF1: 2 positively selected sites (at least 1 method)

28 9.348 0.764 164.054 0.349 0.025 54.024 +

193 11.072 0.657 129.346 0.301 0.082 50.913 +

ORF1: 33 negatively selected sites (at least one method)

249 -24.507 0.111 -204.917 0.048 -8.061 2.786 -

320 -23.780 0.205 -288.331 0.080 -2.355 1.434 -

359 -34.492 0.045 -514.138 0.006 -15.054 82.545 - - -

381 -15.890 0.267 -160.344 0.094 -2.183 1.437 -

386 -12.254 0.333 -191.963 0.089 -2.468 1.501 -

396 -19.273 0.216 -531.647 0.026 -4.478 1.844 -

398 -25.177 0.196 -284.854 0.076 -2.450 1.446 -

400 -19.273 0.243 -531.647 0.035 -4.471 1.725 -

403 -12.254 0.333 -263.267 0.072 -2.703 1.497 -

404 -12.254 0.333 -163.252 0.092 -1.410 1.360 -

414 -13.699 0.309 -272.539 0.047 -3.473 1.685 -

418 -12.254 0.333 -353.725 0.060 -2.936 1.530 -

443 -13.233 0.318 -138.520 0.095 -1.907 1.462 -

449 -25.177 0.162 -284.854 0.054 -2.452 1.494 -

454 -38.265 0.049 -1684.100 0.002 -13.734 13.804 - -

111

482 -30.588 0.134 -429.351 0.042 -3.850 1.713 -

483 -32.193 0.127 -758.425 0.032 -3.200 1.607 -

503 -34.108 0.047 -601.924 0.011 -15.101 98.748 - - -

508 -12.254 0.333 -226.093 0.075 -2.022 1.408 -

509 -12.254 0.335 -189.235 0.069 -2.367 1.534 -

527 -12.254 0.339 -191.963 0.068 -2.471 1.546 -

534 -19.532 0.213 -3145.630 0.015 -4.152 1.786 -

558 -31.984 0.128 -649.646 0.017 -4.775 1.883 -

570 -30.588 0.134 -429.351 0.042 -3.850 1.713 -

579 -25.177 0.162 -284.854 0.048 -2.455 1.534 -

585 -12.254 0.333 -226.093 0.083 -2.020 1.385 -

591 -12.254 0.333 -200.876 0.074 -1.835 1.422 -

601 -26.819 0.097 -371.419 0.026 -14.905 52.476 - - -

604 -19.273 0.243 -531.647 0.035 -4.471 1.725 -

607 -12.254 0.333 -148.660 0.084 -1.440 1.423 -

632 -12.254 0.339 -191.963 0.068 -2.471 1.546 -

645 -26.068 0.157 -267.760 0.069 -3.062 1.566 -

647 -29.879 0.137 -307.014 0.050 -2.568 1.510 -

ORF2: 10 negatively selected sites (at least one method) (No positively selected site)

26 -26.123 0.162 -1390.360 0.034 -4.116 1.641 -

46 -23.449 0.131 -1003.320 0.028 -14.053 13.017 -

141 -12.720 0.333 -359.967 0.094 -2.680 1.449 -

169 -24.262 0.175 -980.074 0.043 -4.042 1.547 -

183 -30.938 0.090 -631.957 0.049 -11.177 4.556 - -

194 -12.720 0.333 -308.374 0.099 -2.423 1.440 -

211 -12.720 0.333 -544.141 0.071 -2.920 1.507 -

301 -13.633 0.311 -698.707 0.063 -3.716 1.547 -

325 -12.720 0.333 -269.023 0.092 -1.885 1.502 -

326 -47.222 0.119 -4394.120 0.018 -4.860 1.666 -

ORF3: 21 positively selected sites (at least one method)

8 12.924 0.430 80.958 0.212 0.352 75545.300 +

35 5.062 0.810 26.426 0.526 0.300 184.277 +

112

44 5.026 0.816 21.713 0.569 0.291 156.904 +

51 -11.384 0.925 -930.813 0.066 0.307 217.359 - +

53 6.158 0.699 22.119 0.525 0.292 159.601 +

105 8.444 0.952 35.154 0.616 0.352 38011.900 +

113 -6.148 0.889 -75.432 0.391 0.301 188.842 +

163 7.454 0.623 42.507 0.354 0.312 244.865 +

167 6.148 0.667 30.558 0.374 0.304 202.017 +

185 7.871 0.610 40.868 0.361 0.311 238.683 +

188 6.148 0.667 26.915 0.440 0.300 185.584 +

240 13.690 0.440 94.149 0.319 0.352 82137.700 +

246 11.755 0.488 85.510 0.195 0.352 88298.600 +

247 6.064 0.676 33.568 0.344 0.307 215.710 +

292 5.024 0.816 26.030 0.536 0.299 181.558 +

303 12.290 0.445 70.562 0.195 0.352 64015.100 +

304 12.924 0.430 82.087 0.210 0.352 76154.500 +

314 6.148 0.667 27.249 0.438 0.301 188.457 +

319 -12.048 0.930 -495.996 0.145 0.307 215.928 +

322 5.690 0.758 22.857 0.563 0.294 165.248 +

325 5.793 0.707 33.882 0.348 0.307 217.966 +

ORF3: 31 negatively selected sites (at least one method)

27 -18.741 0.225 -269.663 0.021 -0.923 2.325 -

42 -12.296 0.333 -78.320 0.096 -0.916 2.098 -

51 -11.384 0.474 -930.813 0.066 0.307 0.005 -

63 -21.788 0.188 -138.386 0.055 -0.927 2.453 -

70 -21.877 0.187 -119.249 0.055 -0.926 2.420 -

85 -12.296 0.335 -97.296 0.067 -0.926 2.408 -

89 -22.152 0.185 -125.874 0.046 -0.935 2.771 -

93 -12.296 0.333 -130.322 0.074 -0.916 2.113 -

100 -29.028 0.088 -172.774 0.024 -0.919 2.189 - -

103 -17.692 0.244 -75.099 0.096 -0.921 2.242 -

114 -21.877 0.187 -119.242 0.066 -0.916 2.109 -

118 -12.296 0.333 -97.059 0.083 -0.915 2.081 -

113

122 -24.592 0.148 -207.472 0.034 -0.897 1.678 -

131 -18.741 0.230 -269.663 0.021 -0.922 2.290 -

135 -12.296 0.335 -93.480 0.072 -0.926 2.408 -

145 -22.239 0.184 -274.273 0.021 -0.928 2.486 -

152 -21.781 0.188 -192.662 0.049 -0.916 2.110 -

172 -12.296 0.333 -117.591 0.058 -0.916 2.113 -

173 -18.749 0.230 -494.847 0.023 -0.923 2.299 -

178 -24.592 0.111 -187.052 0.020 -0.905 1.830 -

182 -12.296 0.333 -93.480 0.085 -0.916 2.099 -

189 -22.152 0.185 -125.881 0.053 -0.926 2.427 -

199 -22.152 0.185 -125.881 0.063 -0.916 2.101 -

206 -12.296 0.335 -97.296 0.067 -0.926 2.408 -

208 -12.732 0.349 -106.807 0.086 -0.912 2.003 -

211 -21.795 0.220 -203.735 0.048 -0.909 1.910 -

219 -21.877 0.187 -119.249 0.055 -0.926 2.420 -

231 -12.296 0.333 -201.700 0.051 -0.916 2.099 -

238 -12.296 0.333 -64.922 0.095 -0.927 2.454 -

241 -17.692 0.244 -75.099 0.096 -0.921 2.242 -

255 -22.152 0.185 -125.874 0.052 -0.927 2.443 -

114

Table F.2: Detail of positively and negatively selected sites for ORF1 Fr1 and Fr2,

ORF2 and ORF3 of the genome of Australian PstDV isolates (Aus Grp

2) as analyzed by method consensus (SLAC, FEL and REL).

Significance level: SLAC p-value: 0.1; FEL p-value: 0.1; REL Bayes

Factor: 50. Color legend in the tables: Codon is non-neutral according to

a given method at the specified significance level. In the consensus

column, Codon has dN>dS '+' inside the box means that the difference

is significant. In the consensus column, Codon has dN<dS '+' inside the

box means that the difference is significant.

Codon SLAC dN-dS SLAC p-

value

FEL dN-dS FEL p-

value

REL dN-

dS

REL Bayes Factor Consensus

ORF1 Fr1: 4 positively selected sites (at least one method)

110 10.045 0.414 55.742 0.124 1.004 195.346 +

159 7.981 0.587 73.579 0.204 0.954 402.187 +

177 7.799 0.548 49.489 0.555 0.833 113.836 +

193 7.410 0.569 52.875 0.197 0.946 134.326

+

ORF1 Fr1: 37 negatively selected sites (at least one method)

69 -36.208 0.019 -176.943 0.008 -7.386 6.204 - -

93 -11.848 0.211 -87.088 0.061 -1.699 2.871 -

109 -12.461 0.204 -103.983 0.045 -1.945 3.341 -

139 -14.968 0.111 -94.834 0.025 -5.257 4.012 -

170 -10.348 0.186 -85.697 0.033 -4.084 2.684 -

185 -9.877 0.209 -74.126 0.050 -1.524 3.958 -

221 -8.883 0.232 -39.137 0.082 -0.766 3.605 -

257 -32.072 0.016 -726.351 0.001 -11.990 27.673 - -

269 -6.076 0.333 -42.465 0.086 -0.875 3.482 -

271 -12.178 0.166 -131.163 0.044 -1.788 3.999 -

282 -13.311 0.186 -53.991 0.081 -1.124 2.962 -

330 -198.191 0.295 -318.190 0.093 -2.712 1.478 -

333 -214.249 0.273 -203.936 0.075 -2.988 1.730 -

342 -21.986 0.193 -2335.770 0.007 -2.752 6.512 -

343 -24.905 0.167 -42.937 0.059 -0.964 5.124 -

349 -25.383 0.190 -174.357 0.027 -2.064 5.610 -

115

351 -24.905 0.201 -42.937 0.078 -0.953 4.005 -

357 -14.738 0.377 -365.508 0.022 -5.835 1.140 -

359 -27.144 0.137 -193.245 0.004 -12.475 21.545 -

369 -12.504 0.333 -42.556 0.061 -0.920 5.001 -

371 -24.905 0.201 -42.937 0.078 -0.953 4.005 -

377 -3.881 0.646 -73.758 0.056 -2.536 0.635 -

381 -23.328 0.189 -1032.240 0.004 -3.714 6.676 -

386 -25.008 0.111 -370.962 0.001 -10.142 15.431 -

389 -12.309 0.339 -43.298 0.055 -0.988 4.070 -

393 -12.309 0.339 -34.235 0.090 -0.730 4.066 -

403 -12.504 0.333 -29.240 0.093 -0.640 4.420 -

405 -12.504 0.333 -29.240 0.093 -0.640 4.420 -

406 -14.756 0.298 -29.322 0.090 -0.717 4.675 -

407 -12.504 0.339 -134.018 0.042 -1.577 5.508 -

413 -6.253 0.556 -60.002 0.064 -1.665 0.631 -

416 -25.599 0.163 -45.011 0.070 -0.984 4.028 -

417 -27.969 0.089 -199.838 0.003 -12.311 30.432 - -

418 -12.504 0.333 -42.556 0.064 -0.914 4.511 -

424 -23.328 0.189 -54.111 0.058 -1.188 4.515 -

425 -16.386 0.269 -32.744 0.081 -0.707 4.230 -

429 -33.692 0.124 -44.632 0.053 -1.012 6.055 -

ORF1 Fr2: 82 negatively selected sites (at least one method). No positively selected found

2 -104.865 0.342 -83.465 0.016 -1.208 120920.000 - -

4 -93.227 0.408 -10.424 0.529 -1.119 610.181 -

5 -298.453 0.112 -35.551 0.045 -1.207 6690.230 - -

6 -201.121 0.186 -7118.060 0.007 -1.207 8577280000.000 - -

11 -213.300 0.144 -23.045 0.059 -1.208 2115.700 - -

20 -92.051 0.333 -11.367 0.099 -1.208 58274.500 - -

23 -95.604 0.321 -9.487 0.137 -1.207 166339.000 -

24 -95.604 0.321 -13.729 0.098 -1.207 12970.200 - -

25 -92.051 0.333 -14.950 0.104 -1.207 59321.900 -

116

26 -92.051 0.333 -14.950 0.082 -1.208 66239.800 - -

28 -298.453 0.112 -35.551 0.045 -1.207 6690.230 - -

30 -128.602 0.228 -40.710 0.022 -1.207 73856500000.000 - -

31 -213.300 0.144 -23.045 0.065 -1.208 2056.810 - -

32 -25.860 0.157 -78.749 0.015 -1.208 36252.000 - -

33 -39.883 0.075 -52.324 0.019 -1.208 344217000.000 - - -

35 -16.372 0.333 -5.482 0.149 -1.209 496917.000 -

36 -27.141 0.162 -24.110 0.028 -1.207 58978500000.000 - -

37 -32.743 0.111 -29.792 0.036 -1.207 53997400000.000 - -

38 -27.141 0.162 -28.712 0.025 -1.207 60798900000.000 - -

45 -32.743 0.113 -37.393 0.025 -1.206 15985900000.000 - -

48 -27.141 0.162 -34.037 0.012 -1.207 27023600000.000 - -

50 -34.019 0.103 -14.754 0.044 -1.208 60786200000.000 - -

51 -32.743 0.113 -31.763 0.026 -1.206 16996700000.000 - -

53 -29.085 0.167 -21.308 0.032 -1.207 5312250.000 - -

54 -22.946 0.291 -47.839 0.008 -1.207 19199100.000 - -

55 -32.743 0.113 -37.393 0.025 -1.206 15985900000.000 - -

56 -56.380 0.045 -117.240 0.005 -1.208 60923700.000 - - -

57 -55.239 0.034 -51.701 0.002 -1.207 1845550000.000 - - -

59 -16.372 0.333 -4.826 0.164 -1.209 5333960.000 -

60 -32.743 0.113 -37.393 0.025 -1.206 15985900000.000 - -

61 -29.085 0.167 -21.308 0.032 -1.207 5312250.000 - -

67 -71.718 0.023 -75.467 0.008 -1.208 5922130.000 - - -

68 -16.372 0.392 -11.341 0.104 -1.208 17296300.000 -

73 -15.029 0.363 -5.418 0.175 -1.208 335897.000 -

78 -16.372 0.339 -11.341 0.147 -1.206 17368800.000 -

79 -38.404 0.155 -92.140 0.016 -1.208 186565.000 - -

81 -34.612 0.191 -9.836 0.107 -1.208 67423700.000 -

82 -16.372 0.333 -9.787 0.105 -1.208 639015.000 -

83 -12.197 0.447 -7.235 0.159 -1.207 431307.000 -

87 -16.372 0.333 -10.478 0.087 -1.209 701908.000 - -

89 -17.013 0.321 -5.364 0.178 -1.208 375136.000 -

117

94 -32.743 0.111 -25.829 0.025 -1.207 504807000.000 - -

95 -34.626 0.158 -14.109 0.073 -1.208 3397.500 - -

96 -34.626 0.158 -14.109 0.073 -1.208 3397.500 - -

99 -22.897 0.227 -18.947 0.035 -1.207 423752000000.000 - -

100 -12.211 0.447 -6.494 0.157 -1.208 105485.000 -

101 -34.626 0.158 -14.109 0.058 -1.209 3621.550 - -

106 -19.280 0.336 -10.780 0.114 -1.207 23263.900 -

108 -16.372 0.333 -9.676 0.126 -1.207 109513.000 -

110 -18.076 0.302 -11.048 0.097 -1.208 25065.700 - -

114 -38.221 0.146 -17.534 0.065 -1.208 11250.600 - -

117 -65.605 0.016 -164.204 0.003 -1.208 7020822970.000 - - -

119 -16.372 0.340 -17.883 0.123 -1.206 2000880000.000 -

120 -24.120 0.218 -13.555 0.102 -1.206 33083000.000 -

121 -18.076 0.302 -11.048 0.097 -1.208 25065.700 - -

122 -16.372 0.333 -9.676 0.087 -1.209 57025700.000 - -

125 -18.076 0.302 -11.048 0.097 -1.208 25065.700 - -

128 -34.626 0.158 -14.109 0.066 -1.209 3524.600 - -

129 -38.221 0.156 -17.534 0.062 -1.208 10952.200 - -

130 -34.626 0.158 -14.109 0.073 -1.208 3397.500 - -

136 -32.743 0.111 -18.513 0.019 -1.209 261894000000.000 - -

138 -16.372 0.333 -7.574 0.123 -1.208 138450.000 -

140 -16.372 0.333 -6.032 0.214 -1.206 6247480.000 -

141 -21.601 0.276 -20.947 0.052 -1.208 11725.600 - -

143 -15.008 0.364 -7.270 0.148 -1.207 116280.000 -

147 -16.372 0.333 -9.403 0.096 -1.209 166410.000 - -

149 -16.372 0.333 -9.178 0.098 -1.209 163797.000 - -

152 -15.008 0.364 -12.463 0.079 -1.207 119174.000 - -

153 -32.743 0.111 -30.035 0.014 -1.209 1109760000.000 - -

158 -16.372 0.339 -9.178 0.160 -1.206 64875.000 -

159 -12.211 0.447 -7.536 0.142 -1.208 121084.000 -

162 -22.050 0.312 -14.559 0.087 -1.206 35739700.000 - -

172 -16.372 0.333 -8.249 0.099 -1.209 158708.000 - -

118

173 -16.372 0.333 -8.249 0.099 -1.209 158708.000 - -

178 -34.626 0.158 -14.109 0.072 -1.208 3371.940 - -

183 -16.372 0.339 -10.930 0.150 -1.206 9750690.000 -

184 -10.263 0.541 -20.554 0.064 -1.205 188.957 - -

189 -21.601 0.258 -20.947 0.055 -1.208 12047.700 - -

190 -38.221 0.156 -17.534 0.062 -1.208 10952.200 - -

192 -17.013 0.321 -6.545 0.153 -1.208 241795.000 -

196 -35.213 0.096 -88.658 0.014 -1.208 969808000.000 - - -

197 -34.626 0.158 -14.109 0.073 -1.208 3397.500 - -

ORF2: 3 positively selected sites (at least one method)

158 11.908 0.360 52.541 0.102 0.975 51.569 +

175 6.981 0.480 58.808 0.321 1.148 1634.730 +

196 9.133 0.639 88.931 0.623 1.136 1962.660 +

ORF2: 22 negatively selected sites (at least one method)

27 -22.708 0.157 -155.344 0.036 -0.795 2.654 -

78 -22.708 0.157 -155.344 0.036 -0.793 2.597 -

86 -13.621 0.272 -329.826 0.072 -0.778 2.388 -

115 -16.551 0.218 -62.429 0.085 -0.792 2.702 -

140 -10.715 0.333 -46.519 0.092 -0.802 2.999 -

141 -21.430 0.111 -206.937 0.021 -0.822 2.359 -

147 -0.657 0.008 0.000 1.000 -0.678 2.658 -

152 -0.383 0.014 0.000 1.000 -0.640 2.201 -

164 -16.460 0.217 -72.844 0.079 -0.770 2.194 -

167 -22.708 0.157 -155.344 0.036 -0.795 2.654 -

169 -23.530 0.152 -720.400 0.023 -0.802 2.840 -

177 -12.170 0.111 -135.328 0.008 -0.865 3.631 -

179 -6.085 0.333 -45.494 0.079 -0.816 3.514 -

183 -10.089 0.224 -129.294 0.059 -0.805 3.148 -

186 -17.807 0.053 -111.257 0.015 -0.867 3.841 - -

187 -6.085 0.333 -55.668 0.050 -0.823 3.350 -

119

201 -9.567 0.212 -50.931 0.078 -0.794 2.780 -

211 -6.085 0.333 -58.237 0.094 -0.817 3.871 -

228 -8.443 0.231 -86.546 0.038 -0.844 3.065 -

234 -6.085 0.335 -34.147 0.088 -0.829 4.341 -

235 -15.392 0.132 -120.116 0.026 -0.839 4.488 -

357 -178.812 0.333 -101.808 0.092 -0.745 1.800 -

ORF3: 72 negatively selected sites (at least one method). No positively selected site

13 -11.914 0.133 -43.226 0.035 -0.944 0.000 -

14 -6.071 0.350 -25.887 0.064 -0.949 0.000 -

22 -11.329 0.179 -25.997 0.072 -0.949 0.000 -

23 -10.566 0.194 -41.178 0.056 -0.948 0.000 -

35 -11.329 0.179 -25.996 0.063 -0.951 0.000 -

36 -8.146 0.275 -91.448 0.034 -0.946 0.000 -

39 -10.566 0.232 -41.178 0.062 -0.947 0.000 -

40 -11.329 0.179 -25.997 0.059 -0.952 0.000 -

41 -10.906 0.186 -84.485 0.019 -0.951 0.000 -

42 -6.071 0.333 -59.215 0.031 -0.950 0.000 -

45 -6.071 0.370 -23.470 0.088 -0.947 0.000 -

59 -11.329 0.179 -25.997 0.072 -0.949 0.000 -

62 -11.144 0.182 -24.032 0.068 -0.951 0.000 -

65 -11.329 0.179 -25.997 0.065 -0.951 0.000 -

66 -11.329 0.179 -25.997 0.059 -0.952 0.000 -

67 -11.329 0.179 -25.997 0.072 -0.949 0.000 -

70 -11.499 0.176 -84.555 0.017 -0.951 0.000 -

72 -11.329 0.211 -25.996 0.080 -0.948 0.000 -

73 -11.587 0.200 -92.656 0.020 -0.948 0.000 -

82 -11.144 0.214 -24.032 0.084 -0.948 0.000 -

85 -12.142 0.112 -48.235 0.026 -0.945 0.000 -

87 -12.162 0.163 -27.079 0.043 -0.956 0.000 -

89 -19.967 0.032 -24690.900 0.004 -0.958 0.000 - -

93 -5.384 0.333 -12.346 0.092 -0.955 0.000 -

120

96 -5.384 0.333 -12.346 0.082 -0.957 0.000 -

97 -12.839 0.169 -93.412 0.007 -0.955 0.000 -

99 -9.946 0.213 -13.038 0.087 -0.955 0.000 -

100 -6.654 0.298 -16.986 0.084 -0.955 0.000 -

103 -8.765 0.226 -24.891 0.050 -0.956 0.000 -

107 -8.445 0.235 -11.498 0.094 -0.955 0.000 -

108 -5.384 0.333 -15.586 0.081 -0.957 0.000 -

114 -9.984 0.180 -14.380 0.064 -0.958 0.000 -

116 -5.384 0.333 -12.346 0.092 -0.955 0.000 -

119 -10.768 0.111 -35.102 0.013 -0.954 0.000 -

122 -27.686 0.148 -37.076 0.031 -0.945 0.000 -

126 -24.270 0.145 -37.042 0.028 -0.948 0.000 -

131 -26.087 0.195 -113.285 0.027 -0.948 0.000 -

134 -27.686 0.113 -43.593 0.033 -0.943 0.000 -

136 -13.843 0.333 -27.143 0.079 -0.949 0.000 -

144 -13.843 0.333 -27.916 0.077 -0.949 0.000 -

148 -24.834 0.218 -35.871 0.078 -0.947 0.000 -

175 -17.293 0.267 -21.607 0.085 -0.949 0.000 -

176 -28.213 0.198 -171.282 0.020 -0.946 0.000 -

181 -13.843 0.333 -27.916 0.091 -0.946 0.000 -

182 -27.686 0.111 -40.932 0.019 -0.949 0.000 -

189 -25.526 0.181 -26.543 0.066 -0.950 0.000 -

193 -13.843 0.333 -18.146 0.097 -0.949 0.000 -

202 -28.213 0.198 -171.282 0.020 -0.946 0.000 -

207 -24.959 0.185 -79.559 0.015 -0.949 0.000 -

209 -21.331 0.239 -28.790 0.071 -0.947 0.000 -

216 -25.526 0.181 -26.543 0.073 -0.949 0.000 -

219 -26.421 0.175 -374.369 0.015 -0.951 0.000 -

228 -27.686 0.111 -36.074 0.028 -0.949 0.000 -

230 -27.686 0.111 -48.727 0.013 -0.949 0.000 -

232 -21.613 0.175 -20.350 0.060 -0.955 0.000 -

234 -11.336 0.333 -46.645 0.059 -0.953 0.000 -

121

235 -25.587 0.163 -35.163 0.050 -0.952 0.000 -

241 -33.592 0.062 -1042.660 0.001 -0.952 0.000 - -

245 -11.336 0.333 -32.565 0.067 -0.953 0.000 -

253 -11.336 0.333 -32.565 0.067 -0.953 0.000 -

254 -22.672 0.111 -79.957 0.013 -0.951 0.000 -

256 -21.613 0.175 -20.351 0.063 -0.954 0.000 -

258 -11.336 0.333 -17.678 0.080 -0.953 0.000 -

260 -21.613 0.175 -20.350 0.072 -0.953 0.000 -

265 -21.412 0.176 -63.368 0.034 -0.956 0.000 -

280 -25.587 0.163 -35.163 0.050 -0.952 0.000 -

283 -41.427 0.045 -53727.500 0.000 -0.951 0.000 - -

287 -22.672 0.111 -41.256 0.017 -0.951 0.000 -

291 -15.958 0.224 -27.390 0.045 -0.948 0.000 -

295 -11.336 0.333 -17.482 0.097 -0.950 0.000 -

299 -11.336 0.333 -14.121 0.095 -0.953 0.000 -

313 -21.613 0.175 -20.351 0.063 -0.954 0.000 -

122

APPENDIX G

List of Oral presentations and workshop

2015 “One base pair deletion is associated with reduction of virulence in australian

Penaeus stylirostris densovirus”, World Aquaculture Conference 2015, 26-

30 June, Jeju, South Korea

2014 “Rapid and sensitive detection of Penaeus stylirostris densovirus by

recombinase polymerase amplification (RPA) combined with a lateral flow

dipstick (LFD)”, Aquaculture America 2014, 9-12 Feb, Seattle, USA

Workshop

2008 Biosafety Course, College of Public Health, Medical and Veterinary

Sciences, James Cook University, Townsville, Queensland, Australia

123

APPENDIX H

Publication 1

124

125

126

127

APPENDIX H

Publication 2

128

129

130

131

132

133

134

135

APPENDIX H

Publication 3

136

137

138

139

140

141

142

143