Novel MIR143-NOTCH fusions in benign and malignant glomus tumors

RESEARCH ARTICLE

Novel MIR143-NOTCH Fusions in Benignand Malignant Glomus Tumors

Juan-Miguel Mosquera,1 Andrea Sboner,1,2,3 Lei Zhang,4 Chun-Liang Chen,4 Yun-Shao Sung,4

Hsiao-Wei Chen,4 Narasimhan P. Agaram,4 Daniel Briskin,5 Basma M. Basha,6 Samuel Singer,7

Mark A. Rubin,1,3 Thomas Tuschl,5 and Cristina R. Antonescu4*

1Departmentof Pathology and Laboratory Medicine,Weill Medical College of Cornell University,NY2Institute for Computational Biomedicine,Weill Medical College of Cornell University,NY3Institute for Precision Medicine,Weill Medical College of Cornell University and NewYork Presbyterian Hospital,NY4Departmentof Pathology,Memorial Sloan-Kettering Cancer Center,NY5Laboratory for RNAMolecular Biology,Howard Hughes Medical Institute,The Rockefeller University,NY6Weill Cornell Medical College in Qatar,Doha,Qatar7Departmentof Surgery,Memorial Sloan-Kettering Cancer Center,NY

Glomus tumors (GT) have been classified among tumors of perivascular smooth muscle differentiation, together with myo-

pericytoma, myofibroma/tosis, and angioleiomyoma, based on their morphologic overlap. However, no molecular studies

have been carried out to date to investigate their genetic phenotype and to confirm their shared pathogenesis. RNA

sequencing was performed in three index cases (GT1, malignant GT; GT2, benign GT and M1, multifocal myopericytoma),

followed by FusionSeq data analysis, a modular computational tool developed to discover gene fusions from paired-end

RNA-seq data. A gene fusion involving MIR143 in band 5q32 was identified in both GTs with either NOTCH2 in 1p13 in

GT1 or NOTCH1 in 9q34 in GT2, but none in M1. After being validated by FISH and RT-PCR, these abnormalities were

screened on 33 GTs, 6 myopericytomas, 9 myofibroma/toses, 18 angioleiomyomas and in a control group of 5 sino-nasal

hemangiopericytomas. Overall NOTCH2 gene rearrangements were identified in 52% of GT, including all malignant cases

and one NF1-related GT. No additional cases showed NOTCH1 rearrangement. As NOTCH3 shares similar functions with

NOTCH2 in regulating vascular smooth muscle development, the study group was also investigated for abnormalities in

this gene by FISH. Indeed, NOTCH3 rearrangements were identified in 9% of GTs, all present in benign soft tissue GT, one

case being fused to MIR143. Only 1/18 angioleiomyomas showed NOTCH2 gene rearrangement, while all the myopericyto-

mas and myofibroma/toses were negative. In summary, we describe novel NOTCH1–3 rearrangements in benign and malig-

nant, visceral, and soft tissue GTs. VC 2013 Wiley Periodicals, Inc.

INTRODUCTION

Pericytes are specialized vascular smooth mus-

cle cell (VSMCs) that play an important role in

supporting and maintaining the capillary structure.

Pericytic tumors comprise a histologic continuum

of neoplasms with perivascular myoid differentia-

tion. Until recently their classification has been

somewhat controversial and historically were

lumped together with other tumors of similar mor-

phology, such as hemangiopericytoma, which sub-

sequently was reclassified together with solitary

fibrous tumors as showing fibroblastic rather then

true pericytic lineage. The 2013 WHO classifica-

tion of soft tissue tumors includes glomus tumors

(GT), myopericytoma, myofibroma, and angioleio-

myoma as members of the pericytic family of neo-

plasms (Fletcher et al., 2013). Despite their

histologic overlap and lesions with hybrid features

a unifying concept supported by shared genetic

abnormalities has not been yet established. In this

study, we investigated a subset of pericytic tumors

by RNA sequencing for novel gene discovery with

potential role in the pathogenesis of tumors of

perivascular myoid lineage. Our hypothesis is that

a better understanding of their genetic abnormal-

ities may clarify the relationship among the vari-

ous pericytic tumors and improve the current

classification based on morphologic features alone.

Additional Supporting Information may be found in the onlineversion of this article.

Supported by: P01CA47179, P50 CA 140146-01; Linn Fund andCycle for Survival.

*Correspondence to: Cristina R. Antonescu, Memorial Sloan-Kettering Cancer Center, 1275 York Ave, New York 10021, USA.E-mail: [email protected]

Received 19 June 2013; Accepted 24 July 2013

DOI 10.1002/gcc.22102

Published online 00 Month 2013 inWiley Online Library (wileyonlinelibrary.com).

VVC 2013 Wiley Periodicals, Inc.

GENES, CHROMOSOMES & CANCER 00:00–00 (2013)

MATERIAL AND METHODS

Patient Selection and Tumor Characteristics

The Pathology files of two participating Institu-

tions and the personal consultations of the corre-

sponding author were searched for cases of glomus

tumor (GT), myopericytoma, myofibroma, myofi-

bromatosis, and angioleiomyoma, with adequate

material available for molecular work-up. Hema-

toxylin and eosin (H&E) stained slides from all

cases were reviewed by two pathologists (CRA

and JMM). Immunostains for muscle markers

[smooth muscle actin (SMA), common muscle

actin, and desmin] to support the above diagnosis

were performed (pre-diluted antibodies from Ven-

tana Medical Systems, Tucson, AZ) or available

for review in all cases. Cases with hybrid morphol-

ogy were classified based on the predominant

growth pattern. Grade of malignancy was deter-

mined using the following criteria, including

marked nuclear pleomorphism and mitotic activity

or the presence of atypical mitotic figures

(Fletcher et al., 2013).

Three index cases with available frozen tissue

were subjected to RNA sequencing: GT1, a malig-

nant gastrointestinal GT (Figs. 4A–4C); GT2 a

benign soft tissue glomus tumor arising in the

neck (Fig. 2A); and M1, a multifocal soft tissue

myopericytoma of lower extremity (Figs. 4E–4H),

all characterized by classic morphology and immu-

nophenotype. The genetic abnormalities identi-

fied in the discovery step were validated and then

screened in a larger cohort of cases, spanning all

members of the pericytic tumor family, as well as

a wide variety of anatomic locations and grade of

malignancy. The study group included 33 GTs, 6

myopericytomas, 9 myofibroma/infantile myofibro-

matosis, and 18 angioleiomyomas. The clinico-

pathologic features are presented in Tables 1 and

2. Also included in the analysis was a control group

of five sino-nasal hemangiopericytomas for poten-

tial associations. The study was approved by the

Institutional Review Board at each institution

(IRB# 02–060 MSKCC and IRB# 1007011157

WCMC).

Among the GTs, there were 24 arising in the

soft tissue, including 14 in the nonacral extremity

(11 in the lower extremity and buttock, three in

the upper extremity), eight in the digits, one in

the soft tissue of the foot with secondary

TABLE 1. GT Showing NOTCH Rearrangements by FISH

GT# Age/gender Location Benign/malignant NOTCH FISH MIR143 FISH

1a 77/F Small bowel Malignant NOTCH2 1

2a 54/F Neck ST Benign NOTCH1 1b

3 68/M Thigh Benign NOTCH2 1

4 48/M Thigh Benign NOTCH2 1

5 52/M Arm Benign NOTCH2 1

6 36/M Kidney Malignant NOTCH2c 2

7 32/M Gastric, omental implants Malignant NOTCH2c 1

8 16/M Leg Benign NOTCH2 2

9 52/M Knee Benign NOTCH2 1

10 52/M Stomach Benign NOTCH2 1

11 69/M Buttock Benign NOTCH2 1

12 57/M Forearm Benign NOTCH2 1

13 67/M Buttock Benign NOTCH2 1

14 41/M Main-stem bronchus Benign NOTCH2 1

15 64/M Leg Benign NOTCH2 1

16 49/F G-E junction Malignant NOTCH2 2

17 74/M Foot Malignant NOCTH2 2

18d 47/M Finger Benign NOTCH2 2

19 41/M Forearm Benign NOTCH3 1



GT: glomus tumor.aIndex cases studied by RNA-seq.bConfirmed by RNA-seq and RT-PCR, but by FISH rearranged in <10% cells; ST, soft tissue.cNOTCH2 break-apart signal in the benign component, while the malignant area showed low level of amplification of centromeric part with loss of

the telomeric region.dNF1-developed GT, metachronous neurofibroma and MPNST negative for NOTCH2 rearrangements.

2 MOSQUERA ET AL.

Genes, Chromosomes & Cancer DOI 10.1002/gcc

destruction of the adjacent metatarsal bone and

one in the neck area. The remaining nine tumors

occurred in visceral locations, including four gas-

trointestinal (stomach, two; gastroesophageal (GE)

junction and small bowel, one each), two renal,

two pulmonary, and one multifocal, involving both

spleen and liver. There were 28 benign and 5

malignant tumors. The malignant lesions occurred

mainly in visceral location, including three in the

GI tract (GE junction, stomach, small bowel; Figs.

4N and 4O), one in the kidney (Fig. 4M) and one

in the soft tissue. The referred diagnoses for these

malignant lesions varied significantly, including

high grade undifferentiated sarcoma (case GT7,

Table 1), small blue round cell tumor/atypical

Ewing sarcoma (GT16), and epithelioid gastroin-

testinal stromal tumor (GT1). Their phenotype

thus varied from a spindled and pleomorphic sar-

comatoid neoplasm to tumors showing a more

monotonous but undifferentiated small blue round

cell morphology. The presence of actin reactivity,

often focal and weak, was typically disregarded

and interpreted as a nonspecific finding. In retro-

spect all these tumor had a coexisting benign com-

ponent, most commonly blending in with the

more sarcomatous/pleomorphic areas.

RNA Sequencing

Total RNA was prepared for RNA sequencing

in accordance with the standard Illumina mRNA

sample preparation protocol (Illumina). Briefly,

mRNA was isolated with oligo(dT) magnetic

beads from total RNA (10 mg) extracted from case.

The mRNA was fragmented by incubation at

94�C for 2.5 min in fragmentation buffer (Illu-

mina). To reduce the inclusion of artifactual chi-

meric transcripts due to random priming of

transcript fragments into the sequencing library

because of inefficient A-tailing reactions that lead

to self ligation of blunt-ended template molecules

(Quail et al., 2008), an additional gel size-selection

step was introduced prior to the adapter ligation

step. Size-ranges captured were 300–350 bp during

the first size-selection step and then 400–450 bp

for the second size-selection step after the ligation

of the adapters. The adaptor-ligated library was

then enriched by PCR for 15 cycles and purified.

The library was sized and quantified using

DNA1000 kit (Agilent) on an Agilent 2100 Bioana-

lyzer according to the manufacturer’s instructions.

Paired-end RNA-sequencing at read lengths of 50

or 51 bp was performed with the HiSeq 2000

(Illumina). Across all samples a total of about 268

million paired-end reads were generated, corre-

sponding to about 27 billion bases.

Analysis of RNA Sequencing Results with

FusionSeq

All reads were independently aligned with the

CASAVA 1.8 software provided by Illumina

against the human genome sequence (hg19) and a

splice junction library, simultaneously. The splice

junction library was generated by considering all

possible junctions between exons of each tran-

script. We considered the University of California,

Santa Cruz (UCSC) Known Genes annotation set

(Hsu et al., 2006) to generate this library via

RSEQtools, a computational method for process-

ing RNA-seq data (Habegger et al., 2011). The

mapped reads were converted into Mapped Read

Format (Habegger et al., 2011) and analyzed with

FusionSeq (Sboner et al., 2010) to identify poten-

tial fusion transcripts. FusionSeq is a computa-

tional method successfully applied to paired-end

TABLE 2. GT Negative for Structural Rearrangements in NOTCH1–3 and MIR143

GT# Age/gender Location Histologic grade

22 51/F Middle finger Benign23 42/F Finger Benign24 76/M Thumb Benign25 37/M Finger Benign26 43/F Thumb Benign27 38/F Digital, subungual Benign28 43/M Digital, subungual Benign29 26/M Knee Benign30 52/M Kidney Benign31 17/F Lower extremity, multifocal (familial) Benign32 68/M Multifocal liver, spleen Benign33 84/F Lung Benign

NOVEL MIR143-NOTCH FUSIONS IN GLOMUS TUMORS 3


RNA-seq experiments for the identification of chi-

meric transcripts (Tanas et al., 2011; Pierron et al.,

2012; Mosquera et al., 2013). Briefly, paired-end

reads mapped to different genes are first used to

identify potential chimeric candidates. A cascade

of filters, each taking into account different sour-

ces of noise in RNA-sequencing experiments, was

then applied to remove spurious fusion transcript

candidates. Once a confident list of fusion candi-

dates was generated, they were ranked with sev-

eral statistics to prioritize the experimental

validation. In these cases, we used the DASPER

score (Difference between the observed and ana-

lytically calculated expected SPER): a higher

DASPER score indicated a greater likelihood that

the fusion candidate was authentic and did not

occur randomly. See Sboner et al. (2010) for fur-

ther details about FusionSeq.

Fluorescence In Situ Hybridization (FISH)

FISH on interphase nuclei from paraffin-

embedded 4-micron sections was performed

applying custom probes using bacterial artificial

chromosomes (BAC), covering, and flanking genes

that were identified as potential fusion partners in

the RNA-seq experiment. BAC clones were cho-

sen according to USCS genome browser (http://

genome.uscs.edu), see Supporting Information

Table 1. The BAC clones were obtained from

BACPAC sources of Children’s Hospital of Oak-

land Research Institute (CHORI; Oakland, CA;

http://bacpac.chori.org). DNA from individual

BACs was isolated according to the manufacturer’s

instructions, labeled with different fluorochromes

in a nick translation reaction, denatured, and

hybridized to pretreated slides. Slides were then

incubated, washed, and mounted with DAPI in an

antifade solution, as previously described (Anto-

nescu et al., 2010). The genomic location of each

BAC set was verified by hybridizing them to nor-

mal metaphase chromosomes. Two hundred suc-

cessive nuclei were examined using a Zeiss

fluorescence microscope (Zeiss Axioplan, Oberko-

chen, Germany), controlled by Isis 5 software

(Metasystems). A positive score was interpreted

when at least 20% of the nuclei showed a break-

apart signal. Nuclei with incomplete set of signals

were omitted from the score.

Reverse Transcription Polymerase Chain Reaction

(RT-PCR)

An aliquot of the RNA extracted above from

frozen tissue (Trizol Reagent; Invitrogen; Grand

Island, NY) was used to confirm the novel fusion

transcript identified by FusionSeq. RNA quality

was determined by Eukaryote Total RNA Nano

Assay and cDNA quality was tested for PGK

housekeeping gene (247 bp amplified product).

Three microgram of total RNA was used for

cDNA synthesis by SuperScriptVR

III First-Strand

Synthesis Kit (Invitrogen, Carlsbad, CA). RT-PCR

was performed using the Advantage-2 PCR kit

(Clontech, Mountain View, CA) for 33 cycles at a

64.5�C annealing temperature, using the following

primers: MIR143HG Exon1.3 fwd 50-CAAACAG

GCTGGCTCCCGTCTC-30; NOTCH2 Exon27

rev 50-CCGTGTTCTTGAAGCAGTGGTC-30;NOTCH1 Exon28 rev 50-CGAAGAACAGAAGCA

CAAAGGC-30; NOTCH3 Exon30 rev 50-GGTCAG

TCCGTGCCCCAAG-30. The PCR products were

confirmed by agarose gel electrophoresis with ethi-

dium bromide staining and sequenced using the

Sanger method.

Long-Range PCR

Genomic DNA was extracted from frozen tissue

using the Phenol/Chloroform assay and quality

was confirmed by electrophoresis. Genomic DNA

(0.5 mg) was amplified with the Advantage 2 PCR

Kit (Clontech) using the following primers:

MIR143HG Intron1.11 fwd 50-GGTGGGGG

TGTCATAGAAGTCTG-30; NOTCH2 Intron26

rev 50-GAGATGGGGGTAAAACAGAAGATG-30;NOTCH3 Exon30 rev 50-GGTCAGTCCGTGCC

CCAAG-30. The PCR product was confirmed by

agarose gel electrophoresis with ethidium bromide

staining, and then sequenced by Sanger method.

Western Blotting

Total protein lysates were extracted from frozen

tissue in GT1 as well as a group of control tumors,

including GIST, angiosarcoma, as previously

described (Agaram et al., 2007). Electrophoresis

and Immunoblotting were done on the total pro-

tein extract (30 mg) following standard protocols.

Notch2 and b-actin were detected by anti-Notch2

(Cell Signaling Technology, Danvers, MA, #5732;

1:1,000 dilution) and by Anti-beta-actin (Cell Sig-

naling, #4970; 1:1,500 dilution). The secondary

antibodies used was goat anti-rabbit (Santa Cruz

Biotechnology, Dallas, TX; 1:10,000 dilution).

Real-Time PCR for NOTCH2, miR-143/miR-145

Real-Time PCR was done using both TaqMan

(NOTCH2) and SYBR Green (miR143HG) systems.

Total RNA (1 mg) was used for cDNA synthesis,

4 MOSQUERA ET AL.


http://genome.uscs.edu

http://genome.uscs.edu

http://bacpac.chori.org

using the TaqMan Reverse Transcription

Reagents (Invitrogen, # N8080234) and miScript

II RT Kit (Qiagen, Valencia, CA, #218160). Real-

Time PCR was performed using Invitrogen ViiA 7

for 40 cycles at a 60�C (TaqMan) and 55�C (Qia-

gen), using TaqMan Universal PCR Master Mix

(Invitrogen, Cat.4304437) or miScript SYBR Green

PCR Kit (Qiagen, #218073), with the following

primers: NOTCH2 (Invitrogen, #HS01050702);

NOTCH2–30End Exon34 (Invitrogen, #AIAAZJ2);

GAPDH (Invitrogen, # HS99999905); miR143

(Qiagen, # ms00003514); miR-143* (Qiagen, #

ms00008687); miR-145 (Qiagen, # ms00003528);

miR-145* (Qiagen, # ms00008708); and Run6

(Qiagen, #ms00033740). The miRNA nomencla-

ture and abbreviations used includes: MIR143,

human microRNA gene; miR-143, human mature

microRNA; miR-143*, complementary strand.

The miRNA expression values were calculated

based on 2� (2DDCt) values, using Run6 as

miRNA control, and represent a relative quantifi-

cation of the Real-Time PCR signal of the target

transcript of the sample of interest (i.e., GT1) to

that of a control sample (G1-Normal tissue).

Micro-RNA Sequencing

Total RNA was extracted from frozen tumor tis-

sue using Trizol reagent according to the manufac-

turer’s instructions (Invitrogen). Small RNA

cDNA libraries were prepared from 22 mesenchy-

mal tumors, including 3 MIR143-NOTCH fusion

positive GT1, GT2, and GT19, one myopericy-

toma (M1), one infantile myofibromatosis, 3 leio-

myomas, 12 leiomyosarcomas, and 2 GISTs, as

previously described (Hafner et al., 2010; Italiano

et al., 2012). In 20 ll reactions, 2 lg total RNA

was ligated to 100 pmol adenylated 30 adapter con-

taining a unique pentamer barcode at the 50 end

using 1 lg Rnl2(1–249)K227Q (purified from E.coli containing pET16b-Rnl2(1–249)K227Q

[Addgene, Cambridge, MA]), in 50mM Tris-HCl,

pH 7.6; 10mM MgCl2; 10mM 2-mercaptoethanol;

0.1 mg/ml acetylated bovine serum albumin (BSA;

Sigma-Aldrich, St. Louis, MO) and 15% DMSO

for 16 hr on ice. After ligation, up to 20 samples

bearing unique barcodes were pooled and purified

on a 15% denaturing polyacrylamide gel. RNAs of

45 and 50 nucleotides were excised from the gel,

eluted, and ligated to 100 pmol 50 oligoribonucleo-

tide adapter (GUUCAGAGUUCUACAGUCC-

GACGAUC) as described above for the 30

adaptors, except that reactions contained 0.2mM

ATP and RNL1 instead of RNL2(1–249) K227Q

and were incubated for 1 hr at 37�C. Ligated small

RNAs were purified on a 12% polyacrylamide gel,

reverse transcribed using SuperScript III Reverse

Transcriptase (Invitrogen), and amplified by PCR.

The forward primer was AATGATACGGCGAC

CACCGACAGGTTCAGAGTTCTACAGTCCGA;

reverse transcription and reverse primer was

CAAGCAGAAGACGGCATACGA. On average

1,265,133 (range 332, 816–2,543,130) sequence

reads of miRNAs were obtained per sample.

RESULTS

FusionSeq Identifies Novel Fusions Involving

MIR143 with either NOTCH1 or NOTCH2 in the

Two Index GT Investigated by RNA Sequencing

FusionSeq identified a MIR143-NOTCH2 fusion

as the top candidate in GT1, a malignant gastroin-

testinal GT (Figs. 4A–4C). Alignment of the reads

suggested a fusion of MIR143 exon 1 with exon 27

of NOTCH2, fusion transcript sequence, which was

then confirmed by RT-PCR (Figs. 1A and 1B).

Furthermore, FISH analysis showed break-apart

signals in both NOTCH2 and MIR143 genes (Figs.

1C and 1D). Long range DNA PCR, showed the

fusion of intron 1 (13,278 bp) of MIR143 with 444

bp of intron 26 of NOTCH2 (Fig. 1E).

In addition to the main fusion candidate

MIR143-NOTCH2, a second fusion candidate,

NOTCH2-CEP128, was identified by FusionSeq,

composed of NOTCH2 exon 26 fused to exon 7 of

CEP128. The RT-PCR confirmed a fusion tran-

script composed of NOTCH2 exon 26 fused to the

complimentary strand of CEP128 exon 7, with an

intervening small fragment of CEP128 intron 7

(Supporting Information Figs. 1A and 1B), by

using the following primers: NOTCH2 ex 26 fwd

50-CTGCTCCTCCCCACTTCC-30 and CEP128Ex5 fwd 50-GGAACAATCAATCGACCAACT

CC-30. A CEP128 break-apart signal was also vali-

dated by FISH (Supporting Information Fig. 1C)

in almost 100% of the cells tested. In summary,

the above RT-PCR and DNA PCR results con-

firmed a single DNA intronic break within intron

26 of NOTCH2. The subsequent fusion transcripts

composed of 30NOTCH2 exon 27 fused to

50MIR143 exon 1 and 50NOTCH2 exon 26 fused to

the complimentary strand of 30CEP128 exon 7,

suggest the possibility of a three-way translocation.

However, the FISH results point to a much more

complex and unbalanced event, with losses of

telomeric ends of NOTCH2 and the centromeric

portion of CEP128. As no additional GT have



been found to carry CEP128 gene rearrangement,

this complex translocation event found in GT1 is

most likely highly unstable and nonrecurrent.

The second case tested by RNA-seq, GT2, a

benign soft tissue GT from the neck region (Fig.

2A) showed the presence of a MIR143-NOTCH1 as

the top candidate on FusionSeq. FISH analysis

detected an unbalanced NOTCH1 break-apart with

loss of the telomeric part in most cells examined

(Fig. 2B), while the FISH for MIR143 identified

only a small number of cells with break-apart sig-

nal (<10%) to be definitive for a positive result.

The RT-PCR confirmed the fusion of MIR143exon 1 with exon 27 of NOTCH1 (Fig. 2C). No

fusion candidates were identified for M1, the mul-

tifocal soft tissue myopericytoma (Figs. 4E–4H),

by FusionSeq analysis.

Recurrent NOTCH2 Rearrangements are Present

in both Benign and Malignant GT

Upon screening the entire cohort, NOTCH2gene rearrangements were present in 17 of 33

(52%) of the GTs tested. In 12 of the 17 (71%)

cases NOTCH2 was fused with MIR143 by FISH.

Of the 24 soft tissue GT 11 (46%) showed

NOTCH2 rearrangements, with most of the posi-

tive cases occurring in the nonacral soft tissues (9/

15, 60%). Only two NOTCH2-rearranged GTs

occurred in an acral location, one in the digit of an

Figure 1. MIR143-NOTCH2 gene fusion in a malignant gastrointesti-nal glomus tumor (GT1). A: Schematic representation of the MIR143-NOTCH2 fusion indicating the loci that are joint together; MIR143exon 3 contains the miRNA precursor cluster, composed of pre-miR-143 and pre-miR-145 (the stem-loop structures, indicated with red andblue stars, respectively). B: Experimental validation of the fusion by RT-PCR shows the junction sequence between exon 1 of MIR143 andexon 27 of NOTCH2. C,D: FISH studies confirming break-apart signals

in both NOTCH2 and MIR143 (Red, centromeric; Green, telomeric). E:Long Range DNA PCR showing fusion of 13,278 bp of MIR143 intron1 to the 444 bp of NOTCH2 intron 26. F: Western blotting usingNOTCH2 ICD antibody showing strong expression of a different sizeband (red arrow) in keeping with truncated NOTCH2 protein in GT1,compared to wild-type NICD protein seen in the control tumorsangiosarcoma (AS) and GIST.

6 MOSQUERA ET AL.


NF1-patient (Figs. 4I–4L) and the other one in a

malignant GT of the foot involving both soft tis-

sues and bone. All the remaining somatic 7 digital

GTs were negative for NOTCH2 rearrangements.

No other GTs showed rearrangements of NOTCH1upon screening by FISH.

All five malignant GTs, regardless of location,

visceral, or soft tissue, showed rearrangements of

NOTCH2, with three of them being fused to

MIR143. In two of these cases the malignant sar-

comatous area was adjacent to or intermixed with

a benign GT component (Figs. 4M–4O), thus

FISH studies were applied separately in the two

components (GT6, GT7). In both cases, the

benign area showed a NOTCH2 break-apart signal,

while in the malignant zone there was in addition

low level of amplification of centromeric part with

loss of the telomeric region (Fig. 4P) in keeping

with an unbalanced translocation event.

NOTCH3 Gene Rearrangements are Present in a

Subset of Benign Soft Tissue GT

As both NOTCH2 and NOTCH3 have been

implicated to function synergistically in regulating

vascular smooth muscle development, we sought

to test for possible NOTCH3 gene structural abnor-

malities by FISH in this cohort of pericytic tumors

that were negative for NOTCH1/2 rearrangements.

As such, we identified three positive GTs for

NOTCH3 break-apart, all three being benign histo-

logically and originating in the soft tissue of

extremities (knee, 2; forearm, 1). In one of these

cases (GT19, Fig. 3A), NOTCH3 was fused to

MIR143 by FISH (Figs. 3C and 3D) and RT-PCR

using RNA extracted from frozen tissue confirmed

the fusion of MIR143 exon 1 to exon 29 of

NOTCH3 (data not shown). Long-range DNA

PCR showed the fusion of intron 1 (11,844 bp) of

MIR143 to 66 bp of NOTCH3 exon 29 (Fig. 3B).

Rare NOTCH2 Rearrangements were Identified in

Angioleiomyoma but not in Other Subtypes of

Pericytic Lesions

Only one of the 17 angioleiomyomas tested

showed a rearrangement in NOTCH2 and none in

the other genes investigated by FISH. This case

occurred in the knee soft tissue of a 32 year-old

male and had a typical morphologic appearance

indistinguishable from all the others (Fig. 4D). No

MIR143 break-apart signal was noted in this case.

Figure 2. MIR143-NOTCH1 gene fusion in a benign glomus tumor ofthe neck soft tissue (GT2). A: Typical morphologic appearance of a glo-mus tumor with uniform cuboidal cells with pale eosinophilic cyto-plasm and round, bland nuclei, with a distinctive angiocentric growtharound small blood vessels (H&E, 2003). B: FISH analysis showing an

unbalanced NOTCH1 rearrangement, with loss of the telomeric part(green signal) (tri-color assay, Orange/Green flanking NOTCH1, Red forC’-ABL used as control, centromeric to at 9q34). C: The top fusioncandidate selected by FusionSeq was confirmed by RT-PCR showingthe MIR143 exon 1 being fused to exon 27 of NOTCH1.



None of the other members of the pericytic fam-

ily included (myopericytoma and myofibroma/tosis)

showed any structural abnormalities in NOTCH1-3or MIR143. Similarly, the five sino-nasal hemangio-

pericytomas included in the control group were

negative for rearrangements in all genes tested.

Activation of 30NOTCH2 by Fusion to the Strong

Promoter of MIR143

GT1 and M1 index cases were investigated by

the Affymetrix U133A gene chip and the mRNA

expression was compared to a previously pub-

lished sarcoma dataset, spanning a large variety of

morphologic types, translocation-associated or

complex genomics sarcomas (Segal et al., 2003;

Hajdu et al., 2010). GT1 showed remarkably high

levels of NOTCH2 mRNA expression, compared

to M1 and all other types of soft tissue sarcomas

(Fig. 5A). Furthermore, Real-Time PCR using pri-

mers for either C-terminal or ectodomain of

NOTCH2, confirmed the Affymetrix transcriptional

data (Fig. 5B), showing high expression of the

30NOTCH2 mRNA in GT1, while the mRNA

expression off the N-terminal of NOTCH2 was

lower than the control group and matched normal

tissue (Fig. 5C). This result is in keeping with a

differential upregulation of the 30end of NOTCH2represented in the fusion transcript. This finding

was further confirmed by Western blotting using

an antibody for the intracellular domain (ICD) of

NOTCH2, which is maintained in the predicted

fusion protein, showing a strong expression of

NOTCH2 ICD in GT1 of different size compared

with control cases (Fig. 1F).

We then investigated the expression on

MIR143/145 genomic cluster in GT1, M1, and

other related smooth muscle lesions. We started

with miRNA Q-PCR that investigated the mature

miR-143 sequence and the complementary strand

to the mature sequence miR-143* and also the

downstream miR-145 in GT1, M1, other smooth

muscle tumors (LM, leiomyoma; LMS; leiomyo-

sarcoma), gastrointestinal stromal tumors (GIST)

and angiosarcomas (AS). The expression of both

miR-143 and miR-143* and miR145 sequence was

markedly upregulated in all smooth muscle

tumors, including MIR143-fusion positive GT1, as

well as leiomyoma, leiomyosarcoma, but not in

GIST and angiosarcoma (Fig. 5D).

Figure 3. MIR143-NOTCH3 fusion in a benign glomus tumor of the forearm (GT19). A: Histo-logic appearance of a benign glomus tumor. B: Long-range DNA PCR showed the fusion of11,844 bp of MIR143 intron 1 to 66 bp of NOTCH3 exon 29. C,D: FISH analysis detected break-apart signals for MIR143 and NOTCH3, respectively (Red centromeric; Green, telomeric).

8 MOSQUERA ET AL.


Figure 4. Morphologic spectrum of pericytic tumors. A: Indexmalignant gastrointestinal glomus tumor (GT1) showing transmuralinvolvement; high power showing focal benign component with classicmorphology (B), as well as areas of sarcomatous growth with areas ofgeographic necrosis (C). D: Angioleiomyoma of the knee soft tissuearea in a 32 year-old male, showing mature smooth muscle bundlesproliferating out small vessel walls; this example was the only one of18 examples tested showing a NOTCH2 gene rearrangement by FISH.E: The index soft tissue myopericytoma (M1) showing multifocal pre-sentation within subcutis by coronal STIR MRI and gross appearance(F); microscopically the tumor had a multinodular pattern, includingintravascular growth (G) and high power showed ovale to short spin-

dle cells in a haphazard, patternless pattern around small capillary ves-sels (H). I: Digital glomus tumor in a patient with NF1 (GT18) showingdermal proliferation of perivascular cuboidal and bland oval cells (J),highlighted by SMA (K), and showing unbalanced rearrangement ofNOTCH2 with deletion of telomeric part (Green signal) by FISH (L). M:Malignant glomus tumor showing an abrupt transition from a benignmonotonous appearance to a highly pleomorphic component (GT6) inthe kidney; a different example in the stomach (GT7), showing focalareas of benign GT (N), while most of the peritoneal spread was com-posed of an undifferentiated spindle cell sarcoma morphology (O). Thelatter component showed low level of amplification of NOTCH2 cen-tromeric parts (P, Red signal), with loss of the telomeric part (Green).



Additional miRNA profiling in three MIR143-

fusion positive GTs, M1 and a subset of smooth

muscle tumors (leiomyoma, leiomyosarcoma)

using deep sequencing of small RNA libraries con-

firmed that miR-143 and miR-145 constituted the

most abundant miRNA cistron (encompassing

50% of total miRNA expression) in all smooth

muscle tumor types, regardless of the MIR143

rearrangement status, compared to other sarcoma

types, including angiosarcoma, liposarcoma, and

normal tissues such as adipose tissue (Fig. 5E).

DISCUSSION

Due to their morphologic overlap, it has been

hypothesized that various pericytic tumors

Figure 5. MIR143-NOTCH2 fusion results in overexpression of 30-NOTCH2 mRNA, triggered by the strong MIR143 promoter, which ishighly expressed in smooth muscle lineage. Affymetrix U133A geneexpression showing high levels of NOTCH2 mRNA expression in GT1compared with M1 and other sarcoma types on X-axis (SS, synovial sar-coma; MLS, myxoid liposarcoma; MFH, malignant fibrous histiocytoma/undifferentiated pleomorphic sarcoma; LS, dedifferentiated liposar-coma; LMS, leiomyosarcoma; FS, adult type fibrosarcoma; CCS, clearcell sarcoma; AS, angiosarcoma); the Y-axis indicates the normalizedexpression of NOTCH2 mRNA (B) Real-Time PCR using 30-NOTCH2primers confirms the U133A high mRNA expression in GT1 comparedwith M1 and other tumors (GIST, LM, LMS, and AS), while (C) Real-Time PCR with primers for the NOTCH2 ectodomain (outside the

break) show low mRNA expression in GT1 compared with matchednormal or other tumors. D: Real-Time PCR for miR-143 expressionshow high levels in MIR143-fusion positive GT1 as well as in othersmooth muscle neoplasms lacking MIR143 structural abnormalities; Y-axis for (B–D) represents the relative expression. E: miRNA sequencingconfirms the highly abundant expression of the miR143/miR145genomic cluster across different smooth muscle tumors regardless ofMIR143 rearrangement status (X-axis: GT#1,2,19, MIR143-fusion posi-tive GTs; M1, myopericytoma; Myo1, infantile myofibromatosis; LM,leiomyoma; LMS, leiomyosarcoma; GIST, gastrointestinal stromaltumor; NF, normal fat; WDLS, well-differentiated liposarcoma; DDLS,dedifferentiated liposarcoma; Y-axis, relative frequency is obtained bythe ratio of miRNA read counts by total miRNA reads per sample).

10 MOSQUERA ET AL.


represent a histologic spectrum among a family of

neoplasms of perivascular smooth muscle cell deri-

vation (Granter et al., 1998). Despite their wide

recognition, no genetic abnormalities have yet

been established, to support their present joined

classification based on morphologic grounds. In

fact a more advanced understanding of their

pathogenesis has been established in syndromic

rather than sporadic cases. Multiple familial GT

[a.k.a. glomuvenous malformations (GVMs)] show

an autosomal dominant inheritance with variable

expressivity and incomplete penetrance, being

caused by inactivating mutations in the glomulin(GLMN) gene, located in 1p22.1, which is predom-

inantly expressed in VSMCs (Boon et al., 1999;

Brouillard et al., 2000). Furthermore, an associa-

tion between digital glomus tumor and neurofibro-

matosis has been reported, with a biallelic

inactivation of NF1 proposed as the mechanism of

glomus tumor formation in this setting (Brems

et al., 2009). A small rate of BRAF and KRASmutations have been detected in sporadic soft tis-

sue GT, which appears to be within the expected

range of mutations described in other tumor types

(Chakrapani et al., 2012).

Although morphologically rather distinct,

“pericytoma” is a rare but apparently discrete

pathologic entity grouped under the spectrum of

myopericytic neoplasms due to their perivascular

growth pattern and similar immunophenotype

(Fletcher et al., 2013; Dahlen et al., 2004). A recur-

rent t(7;12) translocation has been reported in this

subset of tumors, however, none of the 6 classic

myopericytomas included in this study were posi-

tive for GLI1 gene rearrangements (data not

shown), suggesting a different genetic subgroup of

tumors.

The dynamic expression of miR-143/miR-145

from its mir-143 genomic region between differen-

tiated and proliferative phenotypes of VSMCs sug-

gested that their stage-dependent expression may

elicit a critical switch for VSMC phenotypic modu-

lation (Cordes et al., 2009). In a miR-143/145-defi-

cient mouse model, the VSMC were locked in a

“synthetic” state, which incapacitated their con-

tractile phenotype and favored neointimal lesion

development (Boettger et al., 2009). In contrast,

overexpression of miR-145 increased expression of

VSMC differentiation marker genes, such as SMA,

calponin, and SM-MHC, which in turn were

downregulated by treatment of VSMCs with a

miR-145 inhibitor (Cheng et al., 2009). These data

indicate a prominent role for miR-143 and miR-

145 in smooth muscle function and are in keeping

with our results of MIR143 being the most abun-

dantly expressed miRNA cistron in different

smooth muscle tumors tested, regardless of the

MIR143 gene rearrangement status. This novel

finding most likely indicates a strong promoter of

MIR143 within the smooth muscle lineage and its

ability upon translocation to drive NOTCHoverexpression.

Accumulating evidence from murine models

suggests that Notch2 and Notch3 function

together to regulate vascular smooth muscle devel-

opment and smooth muscle differentiation (Wang

et al., 2012). When Notch2 and Notch3 genes are

simultaneously disrupted (combined mutations

Notch22/2; Notch32/2), mice die in utero at mid-

gestation due to severe cardiovascular abnormal-

ities secondary to lack of smooth muscle differen-

tiation (Wang et al., 2012). Although assembly of

the vascular network occurs normally, however,

smooth muscle cells surrounding the vessels are

grossly deficient leading to vascular collapse. Fur-

thermore, Notch2 hypomorphic mice have a loss of

smooth muscle markers as early as E10.5 (Wang

et al., 2012).

In adults the Notch3 receptor is highly enriched

in VSMCs (Joutel et al., 2000; Villa et al., 2001),

suggesting that Notch3 plays a critical role in

maintaining the phenotypic stability of VSMCs.

NOTCH3 loss of function mutations within the

ectoplasmic domain are the genetic hallmark of

CADASIL disease, which induces degeneration of

cerebral VSMCs, with subsequent cerebral autoso-

mal dominant arteriopathy, subcortical infarcts and

leukoencephalopathy (Joutel et al., 1996, 1997). It

is not clear whether CADASIL pathology occurs

as an indirect consequence of the abnormal accu-

mulation of the NOTCH3 protein, as a direct con-

sequence of perturbed NOTCH signal regulation,

or due to a combination of both. A small subset of

patients with Alagille syndrome secondary to

NOTCH2 mutations are also predisposed to multi-

ple vascular pathologies affecting blood vessels

derived smooth muscle, including stenosis of the

peripheral pulmonary vascular tree and intracranial

aneurysms (McElhinney et al., 2002; High et al.,

2007). Together, these observations demonstrate

that Notch signaling plays an important role in

multiple regions of the developing and adult

vasculature.

NOTCH1 and NOTCH2 gene rearrangements

have been recently identified in a small subset of

ER-negative breast carcinoma cell lines (Robinson

et al., 2011), and most likely nonrecurrent events

in one prostatic carcinomas with neuroendocrine



phenotype (Lapuk et al., 2012) and one colorectal

carcinoma (Wu et al., 2012). Similar to our results,

fusion transcripts retained exons that encode the

NOTCH intracellular domain (NICD), which is

responsible for inducing the transcriptional pro-

gram following NOTCH activation (Robinson

et al., 2011). In this study, the index cell lines

showed dependence on NOTCH signaling for

proliferation and survival as well as marked reduc-

tion in proliferation after treatment with g-

secretase inhibitor DAPT.

In a recent systematic analysis of inherited

GVMs using a sensitive allele-specific pairwise

SNP-chip method, a recurrent so-called “acquired

uniparental isodisomy” involving chromosome arm

1p was identified, in an A- and T-rich, high-DNA-

flexibility region (Amyere et al., 2013). The

1p13.1-1p12 acquired breakpoint was identified in

70% of familial cases studied, in addition to the

homozygous glomulin (GLMN) mutations, suggest-

ing that somatic second hits may be required for

the formation of GVMs and can explain the vari-

able phenotype and incomplete penetrance

observed (Amyere et al., 2013). The 1p12 locus

abnormalities are in keeping with the NOTCH2gene rearrangements seen in the majority of the

sporadic GT in our study. NOTCH2 is located very

close to the centromere (alpha satellite) and heter-

ochromatin 1q12 (beta satellite), both structures

rich in tandem repeat sequences, including ALU

family sequences. This may explain why NOTCH2is a break-prone site, positioned at a sensitive

region for chromosomal 1 organization and struc-

ture stability.

In summary, we are reporting novel MIR143-NOTCH fusions in more than half of GTs, regard-

less of anatomic location or degree of malignancy.

Despite the different NOTCH gene partners

involved (NOTCH1-3), the pattern of fusion is

remarkably conserved, with the first exon on

MIR143 being fused to most of the NICD domain

of NOTCH (Supporting Information Fig. 2). The

significant overexpression of NICD at both

mRNA and protein level suggests that the most

likely mechanism of MIR143-NOTCH tumorigene-

sis is through oncogenic activation of NOTCH

driven by the very strong MIR143 promoter as

indicated by extremely high miR-143 expression

in the smooth muscle cell lineage. The resulting

NOTCH1-3 truncated protein would be nearly

identical to NICD and potentially sensitive to

NOTCH inhibitors (i.e., g-secretase inhibitors),

which seem attractive therapeutic options in

malignant or advanced GT. The high incidence of

NOTCH2 gene rearrangements detected by FISH

in malignant GTs suggests that this can be a used

as a reliable molecular diagnostic test in challeng-

ing cases. These results argue that GT are geneti-

cally distinct than most myopericytic tumors and

sinonasal hemangiopericytoma-like tumors (a.k.a.

glomangiopericytomas), despite their perivascular

growth pattern and shared immunophenotype.

REFERENCES

Agaram NP, Besmer P, Wong GC, Guo T, Socci ND, Maki RG,DeSantis D, Brennan MF, Singer S, DeMatteo RP, AntonescuCR. 2007. Pathologic and molecular heterogeneity in imatinib-stable or imatinib-responsive gastrointestinal stromal tumors.Clin Cancer Res 13:170–181.

Amyere M, Aerts V, Brouillard P, McIntyre BA, Duhoux FP,Wassef M, Enjolras O, Mulliken JB, Devuyst O, Antoine-PoirelH, Boon LM, Vikkula M. 2013. Somatic uniparental isodisomyexplains multifocality of glomuvenous malformations. Am JHum Genet 92:188–196.

Antonescu CR, Zhang L, Chang NE, Pawel BR, Travis W, KatabiN, Edelman M, Rosenberg AE, Nielsen GP, Dal Cin P,Fletcher CD. 2010. EWSR1-POU5F1 fusion in soft tissuemyoepithelial tumors. A molecular analysis of sixty-six cases,including soft tissue, bone, and visceral lesions, showing com-mon involvement of the EWSR1 gene. Genes ChromosomesCancer 49:1114–1124.

Boettger T, Beetz N, Kostin S, Schneider J, Kruger M, Hein L,Braun T. 2009. Acquisition of the contractile phenotype bymurine arterial smooth muscle cells depends on the Mir143/145gene cluster. J Clin Invest 119:2634–2647.

Boon LM, Brouillard P, Irrthum A, Karttunen L, Warman ML,Rudolph R, Mulliken JB, Olsen BR, Vikkula M. 1999. A genefor inherited cutaneous venous anomalies ("glomangiomas")localizes to chromosome 1p21–22. Am J Hum Genet 65:125–133.

Brems H, Park C, Maertens O, Pemov A, Messiaen L, UpadhyayaM, Claes K, Beert E, Peeters K, Mautner V, Sloan JL, Yao L,Lee CC, Sciot R, De Smet L, Legius E, Stewart DR. 2009.Glomus tumors in neurofibromatosis type 1: Genetic, func-tional, and clinical evidence of a novel association. Cancer Res69:7393–7401.

Brouillard P, Olsen BR, Vikkula M. 2000. High-resolution physicaland transcript map of the locus for venous malformations withglomus cells (VMGLOM) on chromosome 1p21-p22. Genomics67:96–101.

Chakrapani A, Warrick A, Nelson D, Beadling C, Corless CL.2012. BRAF and KRAS mutations in sporadic glomus tumors.Am J Dermatopathol 34:533–535.

Cheng Y, Liu X, Yang J, Lin Y, Xu DZ, Lu Q, Deitch EA, HuoY, Delphin ES, Zhang C. 2009. MicroRNA-145, a novel smoothmuscle cell phenotypic marker and modulator, controls vascularneointimal lesion formation. Circ Res 105:158–166.

Cordes KR, Sheehy NT, White MP, Berry EC, Morton SU, MuthAN, Lee TH, Miano JM, Ivey KN, Srivastava D. 2009. miR-145 and miR-143 regulate smooth muscle cell fate and plastic-ity. Nature 460:705–710.

Dahlen A, Fletcher CD, Mertens F, Fletcher JA, Perez-AtaydeAR, Hicks MJ, Debiec-Rychter M, Sciot R, Wejde J, Wedin R,Mandahl N, Panagopoulos I. 2004. Activation of the GLI onco-gene through fusion with the beta-actin gene (ACTB) in agroup of distinctive pericytic neoplasms: pericytoma with t(7;12). Am J Pathol 164:1645–1653.

Fletcher CDM, Bridge JA, Hogendoorn PC, Mertens F. 2013b.WHO Classification of Tumours of Soft Tissue and Bone.Lyon: IARC.

Granter SR, Badizadegan K, Fletcher CD. 1998. Myofibromatosisin adults, glomangiopericytoma, and myopericytoma: A spec-trum of tumors showing perivascular myoid differentiation. AmJ Surg Pathol 22:513–525.

Habegger L, Sboner A, Gianoulis TA, Rozowsky J, Agarwal A,Snyder M, Gerstein M. 2011. RSEQtools: a modular frameworkto analyze RNA-Seq data using compact, anonymized data sum-maries. Bioinformatics 27:281–283.

12 MOSQUERA ET AL.


Hafner M, Renwick N, Pena J, Mihailovic A, Tuschl T. 2010.Barcoded cDNA libraries for miRNA profiling by next-generation sequencing. In: Hartmann RK, Bindereif A, SchonA, Weshof A, editors. Handbook of RNA Biochemistry, 2nd ed.Wennheim, Germany: Wiley-VCH Verlag GmH.

Hajdu M, Singer S, Maki RG, Schwartz GK, Keohan ML,Antonescu CR. 2010. IGF2 over-expression in solitary fibroustumours is independent of anatomical location and is related toloss of imprinting. J Pathol 221:300–307.

High FA, Zhang M, Proweller A, Tu L, Parmacek MS, Pear WS,Epstein JA. 2007. An essential role for Notch in neural crestduring cardiovascular development and smooth muscle differen-tiation. J Clin Invest 117:353–363.

Hsu F, Kent WJ, Clawson H, Kuhn RM, Diekhans M, HausslerD. 2006. The UCSC Known Genes. Bioinformatics 22:1036–1046.

Italiano A, Thomas R, Breen M, Zhang L, Crago AM, Singer S,Khanin R, Maki RG, Mihailovic A, Hafner M, Tuschl T,Antonescu CR. 2012. The miR-17–92 cluster and its targetTHBS1 are differentially expressed in angiosarcomas depend-ent on MYC amplification. Genes Chromosomes Cancer 51:569–578.

Joutel A, Corpechot C, Ducros A, Vahedi K, Chabriat H, MoutonP, Alamowitch S, Domenga V, Cecillion M, Marechal E,Maciazek J, Vayssiere C, Cruaud C, Cabanis EA, RuchouxMM, Weissenbach J, Bach JF, Bousser MG, Tournier-LasserveE. 1996. Notch3 mutations in CADASIL, a hereditary adult-onset condition causing stroke and dementia. Nature 383:707–710.

Joutel A, Vahedi K, Corpechot C, Troesch A, Chabriat H,Vayssiere C, Cruaud C, Maciazek J, Weissenbach J, BousserMG, Bach JF, Tournier-Lasserve E. 1997. Strong clustering andstereotyped nature of Notch3 mutations in CADASIL patients.Lancet 350:1511–1515.

Joutel A, Andreux F, Gaulis S, Domenga V, Cecillon M, BattailN, Piga N, Chapon F, Godfrain C, Tournier-Lasserve E. 2000.The ectodomain of the Notch3 receptor accumulates within thecerebrovasculature of CADASIL patients. J Clin Invest 105:597–605.

Lapuk AV, Wu C, Wyatt AW, McPherson A, McConeghy BJ,Brahmbhatt S, Mo F, Zoubeidi A, Anderson S, Bell RH,Haegert A, Shukin R, Wang Y, Fazli L, Hurtado-Coll A, JonesEC, Hach F, Hormozdiari F, Hajirasouliha I, Boutros PC,Bristow RG, Zhao Y, Marra MA, Fanjul A, Maher CA,Chinnaiyan AM, Rubin MA, Beltran H, Sahinalp SC, GleaveME, Volik SV, Collins CC. 2012. From sequence to molecularpathology, and a mechanism driving the neuroendocrine pheno-type in prostate cancer. J Pathol 227:286–297.

McElhinney DB, Krantz ID, Bason L, Piccoli DA, Emerick KM,Spinner NB, Goldmuntz E. 2002. Analysis of cardiovascularphenotype and genotype-phenotype correlation in individuals

with a JAG1 mutation and/or Alagille syndrome. Circulation106:2567–2574.

Mosquera JM, Sboner A, Zhang L, Kitabayashi N, Chen CL,Sung YS, Wexler LH, Laquaglia MP, Edelman M,Sreekantaiah C, Rubin MA, Antonescu CR. 2013. RecurrentNCOA2 gene rearrangements in congenital/infantile spindlecell rhabdomyosarcoma. Genes Chromosomes Cancer 52:538–550.

Pierron G, Tirode F, Lucchesi C, Reynaud S, Ballet S, Cohen-Gogo S, Perrin V, Coindre JM, Delattre O. 2012. A new sub-type of bone sarcoma defined by BCOR-CCNB3 gene fusion.Nat Genet 44:461–466.

Quail MA, Kozarewa I, Smith F, Scally A, Stephens PJ, Durbin R,Swerdlow H, Turner DJ. 2008. A large genome center’simprovements to the Illumina sequencing system. Nat Methods5:1005–1010.

Robinson DR, Kalyana-Sundaram S, Wu YM, Shankar S, Cao X,Ateeq B, Asangani IA, Iyer M, Maher CA, Grasso CS, LonigroRJ, Quist M, Siddiqui J, Mehra R, Jing X, Giordano TJ, SabelMS, Kleer CG, Palanisamy N, Natrajan R, Lambros MB, Reis-Filho JS, Kumar-Sinha C, Chinnaiyan AM. 2011. Functionallyrecurrent rearrangements of the MAST kinase and Notch genefamilies in breast cancer. Nat Med 17:1646–1651.

Sboner A, Habegger L, Pflueger D, Terry S, Chen DZ, RozowskyJS, Tewari AK, Kitabayashi N, Moss BJ, Chee MS, DemichelisF, Rubin MA, Gerstein MB. 2010. FusionSeq: a modular frame-work for finding gene fusions by analyzing paired-end RNA-sequencing data. Genome Biol 11:R104.

Segal NH, Pavlidis P, Antonescu CR, Maki RG, Noble WS,DeSantis D, Woodruff JM, Lewis JJ, Brennan MF, HoughtonAN, Cordon-Cardo C. 2003. Classification and subtype predic-tion of adult soft tissue sarcoma by functional genomics. Am JPathol 163:691–700.

Tanas MR, Sboner A, Oliveira AM, Erickson-Johnson MR,Hespelt J, Hanwright PJ, Flanagan J, Luo Y, Fenwick K,Natrajan R, Mitsopoulos C, Zvelebil M, Hoch BL, Weiss SW,Debiec-Rychter M, Sciot R, West RB, Lazar AJ, Ashworth A,Reis-Filho JS, Lord CJ, Gerstein MB, Rubin MA, Rubin BP.2011. Identification of a disease-defining gene fusion in epithe-lioid hemangioendothelioma. Sci Transl Med 3:98ra82.

Villa N, Walker L, Lindsell CE, Gasson J, Iruela-Arispe ML,Weinmaster G. 2001. Vascular expression of Notch pathwayreceptors and ligands is restricted to arterial vessels. Mech Dev108:161–164.

Wang Q, Zhao N, Kennard S, Lilly B. 2012b. Notch2 and Notch3function together to regulate vascular smooth muscle develop-ment. PLoS One 7:e37365.

Wu Y, Wang X, Wu F, Huang R, Xue F, Liang G, Tao M, Cai P,Huang Y. 2012. Transcriptome profiling of the cancer, adjacentnon-tumor and distant normal tissues from a colorectal cancerpatient by deep sequencing. PLoS One 7:e41001.



Documents

Novel MIR143-NOTCH fusions in benign and malignant glomus tumors