Proc. Nati. Acad. Sci. USAVol. 91, pop. 2110-2114, March 1994Medical Sciences

Organization of the -human CD40L gene: Ixaplications for moleculardefects in X -chromosomehlinked hyper-IgM syndrome andprenatal diagnosisANNA VILLA*t, LuIGi D. NOTARANGELOf, JAMES P. Di SANTO§, PAOLO P. MACCHI*, DARIO STRINA*,ANNALISA FRATTINI*, FRANco LuccHINI*, CRISTINA M. PATROSSo*, SILVIA GILIANIf, ELIDE MANTUANO0,SILVANO AGOSTI¶, GIANFRANCO NOCERA¶, RICHARD A. KROCZEKII, ALAIN FISCHER§, ALBERTO G. UGAZIO,GENEVItVE DE SAINT BASILE§, AND PAOLO VEZZONI**Istituto di Tecnologie Biomediche Avanzate, Consiglio Nazionale delle Ricerche, via Ampire 56, 20131 Milan, Italy; tClinica Pediatrica, Uaiversit& diBrescia, Brescia, Italy; lQuita Clinica Ostetrica e Ginecologica, Universit& di Milano, Milan, Italy; IIMolecular mmunlogy Departmn, Robert KochInstitute, Nordufer 20, Berlin, Germany; and fInstitut National de la Sant et de la Recherche MEdicale U132 H6pital Necker-Enfants Malades,149 me de Sevres, 75743 Paris, France

Communicated by Renato Dulbecco, October 29, 1993

ABSTRACT R y, CD40L has been s thegene responible for X co meind hyper-lim sn-drome (HIGMi). CDL on activated T cells HIGM1pate faib to bind B-cel CD40 molecules, and subequentalyis of CD4OL by reverse PrC

approach, however, is Of linl use forpreatofIflGM1 In the early i fetus. In this report, we havedefined the gen strue of the CD40L gene, which iscomposed of five exons ad four Intrveing trons. With thisinformation, we have do* at the go leve the CD4LFee a _ for three prev sy descraIe HIGM1

regiog ThefedetdWepatientswholdos roefim k

distbct A _IFing (a) a spice donor mutatio withex" s n, () asieaeor mutin with ofacritclspice site, and (U,) adeletinsertion eventwh thecreation of a new splice site. In i , we have

prea vluon of an l1-week-old fetus at riskfo HIGMi. CD4GLg on clones provide a sarting point forarter sudie of the genetic s that crol CD4L

.Our HeAW CDte L gmn winbofadiinlmttosiprove, sW for the lO yI

HIGM1 and for perfing genetic counseling about thisdisose.

The X chromosome-linked form of the hyper-IgM syndrome(HIGM1) is a rare disorder characterized by the inability ofB cells to undergo immunoglobulin isotype switch. Affectedindividuals present normal or elevated serum concentrationsof IgM and markedly decreased levels of IgG, IgE, and IgA(1). This disorder is characterized by severe bacterial andopportunistic infections and an increased susceptibility toneoplasms and autoimmunity. The patient's quality of life ispoor, despite the current recommended therapy consisting ofregular administration of intravenous immunoglobulins.Molecular isolation of the CD40 B-cell antigen revealed a

strong homology to the tumor necrosis factor (TNF) areceptor (2). Recently, cDNAs coding for the mouse andhuman ligand for the CD40 molecule (CD4OL) have beencloned and characterized by various groups (3-7). The en-coded product is a type II membrane glycoprotein of 261amino acids and the mature protein has an apparent molec-ular mass of 39 kDa (hence, the name gp39). CD40L isexpressed on subsets of activated T cells and interacts with

B-cell CD40 surface molecules. As expected, CD40L showedhomology with TNF-a, and, for this reason, it has also beendesignated TRAP UNF-related activated protein; ref. 4).After interaction of CD40L with CD40 and costimulation byappropriate cytokines (interleukins 4 and 10), 13 cells prolif-erate and perform unoglobulin isotype switch (6). Mu-tations inCD40L transcripts in 12 cases ofHIGMi have beencharacterized (8-11). Among these, 11 have been detected inthe extracellular domain, with the 12th being located in thetransmembrane domain. Nine patients demnstrated pointmutations; three patients reported by a single group haddeletions of 8, 10, and 63 bp, respectively (10). Interestingly,these three deletions clustered within a limited region of thecoding sequence. Although a splicing defect has been hy-pothesized, it could not be demonstrated since the genomicstructure ofthe CD40L gene was not known. In additon, twoother incompletely characterized mutations have been brieflyreported (12, 13), one of which had a deletion of 58 nucleo-tides adjacent to those absent in the 63-bp deletion.These small deletions in mRNA might result from true

genomic deletions or mutations that affect splcing of thetranscript. Here we report the CD40L genomic structure anda more precise characterization of these abnormaites. Wealso show that knowledge of the CD40L exonintron struc-ture can be applied to prenatal diagnosis of HIGSi usingPCR amplification of genomic DNA derived from fetal sam-ples.

MATERIALS ANDMETH-OSolation ofGenoic Clones for CD40L. Two parallel strat-

egies were used to isolate .CD40L genomic sequences. Thefirst utilized PCR amplification ofgenomicDNA using primerpairs corresponding to the coding regions. The second ap-proach involved isolation of clones from an X chromosome-enriched cosmid library gridded onto nylon filters (14) usinga full-length CD40L cDNA (7). Both approaches provedsuccessful and provided identical data regarding sequenceand structural organization.The following primers were used to amplify the whole

coding region of CD40L in six steps. Nucleotides are num-bered according to theCDOL sequence ofHIlleubaugh et aL(ref. 5; GenBank accession no. Z15017): primer A (2-21,sense), CATTTCAACTTTAACACAGC; primer B (36X52,sense). CAACCAAACTTCTCCCC; primer C (140-158, an-tisense), AGATACACAGCAAAAAGTG; primer D (245-264, sense), GAGAAAGATCCTTATCCTTA; primer E

Abbreviation: HIGM1, hyper-IgM syndrome.tTo whom reprint requests should be addressed.

2110

The publication costs ofthis article were defrayed in part by page chargepayment. This article must therefore be hereby marked "advertisement"in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 29

, 202

0

Proc. Natl. Acad. Sci. USA 91 (1994) 2111

(264-280, antisense), TCTCCTCACAGTTCAGT; primer F(338-357, sense), AGAAAGAAAACAGCTTTGAA; primerG (348-367, antisense), CTTTTTGCATTTCAAAGCTG;primer H (379-396, sense), CCTCAAATTGCGGCACAT;primer I (382-399, antisense), GACATGTGCCGCAA-TTTG; primer J (483-500, sense), CCTGGAAAATGG-GAAACA; primer K (483-500, antisense), TGTTTCCCAT-TTTCCAGG; primer L (821-838, antisense), AGCTCCAC-CACAGCCTGC. Primer pairs and resultant product lengthswere as follows: A-C, 157 bp; B-E, -2000 bp; D-G, =4000bp; F-I, -2000 bp; H-K, =3000 bp; J-L, 395 bp. PCRconditions were as follows: denaturation, 940C for 1 min forall primer pairs; annealing, 50TC for 1 min for A-C and J-L,50TC for 1.30 min for B-E, and 58TC for 2 min for the others;extension, 720C for 1 min for A-C and J-L and for 3 min forthe others.

Amplification products were cloned in TA cloning vector.DNA was prepared for sequence analysis with the Magicminiprep DNA purification kit (Promega). Sequencing wasperformed by the dideoxy method using the Sequenase kitfrom United States Biochemical (15). CD4OL genomic se-quences were also obtained by direct cosmid sequencing,using 32P-labeled oligonucleotides and a Taq polymerase kit(Circumvent, New England Biolabs). The Genetics Com-puter Group package was used for analysis on a VAX3600computer. To determine the exon-intron boundaries, thegenomic sequence was compared to the published cDNAsequence (accession no. Z15017).

Patient Samples. Three unrelated male infants were re-ferred to the H6pital Necker-Enfants Malades (Paris) be-cause of recurrent infections occurring from early on in life.Family history and laboratory investigations in each caseconfirmed the diagnosis of HIGM1. These patients failed toexpress functional CD40L on their activated T cells and weresubsequently shown to have deletions of 63, 8, and 10 bp,respectively, in the CD4OL coding region (P1, P2, and P4 ofref. 10).A female cousin of a previously reported HIGM1 male

patient (T.G. in ref. 11) became pregnant and requested helpin determining if the fetus was affected with HIGM1. Achorionic villus sample was obtained from the 11-week-oldfetus by using transabdominal aspiration (16). The villi werecarefully dissected under an inverted microscope to remove

1kb

H

//

//

/

4

/ 1

I In I

FIG. 1. Amplification products of the CD40L gene with specificoligonucleotides. The whole gene is amplified with six pairs ofprimers. See the text for primer sequences and PCR conditions. Thepositions of the primers are also indicated in Fig. 2. Lane 1, primersA-C; lane 2, primers B-E; lane 3, primers D-G; lane 4, primers F-I;lane 5, primers H-K; lane 6, primers J-L; lanes M, marker, 1-kbladder (BRL).

maternal decidua. Approximately 50mg of villi was obtained,of which <15 mg was processed to perform chromosomeanalysis using direct and cultured methods as described andthe remainder was used for DNA extraction and analysis (17).

Patient samples were PCR amplified and cloned. In eachcase, multiple PCR clones were sequenced for each patient toavoid Taq polymerase artifacts.

RESULTS

Organization of the CD40L Gene. Southern blot analysis ofgenomic human DNA digested with EcoRI and hybridizedwith the coding portion of the CD40L cDNA demonstratedtwo bands of about 2.5 and 10 kb (data not shown). Thissuggested that the CD40L gene might be small, and thereforewe attempted to determine its structure by means of PCRamplification of genomic human DNA.Coding region primers were designed from the CD4OL

sequence, avoiding the dinucleotide GG that could some-times represent the relict of a splicing junction. In addition,we took into account the possibility that nucleotides 430-431could represent an intron-exon boundary, since the threepreviously reported deletions were centered at these nucle-otides (10). Finally, we hypothesized that the 63-bp (nucle-otides 367-430) deletion in patient 1 and a 58-bp (nucleotides310-367) deletion briefly reported elsewhere (13) might re-

a

IXII i I IlU

2

HE . a 1

I . .

3

a -gi D --I F 7;- -P

FIG. 2. Schematic representation of the exon-intron structure of the CD40L gene. (Top) Restriction map of the CD40L locus, with EcoRI(E) and HindIll (H) restriction sites. Exons are indicated by vertical bars and numbered below. (Bottom) Coding region ofCD40L. Black boxesindicate the untranslated regions; spotted boxes correspond to the coding exons. The dashed lines indicate introns (not drawn to scale). Arrowsshow the position of the primers used for PCR amplification; they are indicated by letters as described in the text.

Medical Sciences: Villa et al.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 29

, 202

0

2112 Medical Sciences: Villa et al.

Table 1. Exon-intron junctions of CD40L geneIntron

Exon 5' ends Acceptor site Donor site length, kb Framet1 1 .... ACAAGgtaagatgaaccacaagcctttattaacta 2 32 178 atttatcatatocttgttattccaaaatagATAGA .... TGAAGgtaagcagcttaattactggtaaaagtgtc 4 33 310 aaatgacctottgoatgottottattttagGATAT .... AAAAGgtaggtttgctatttgctaatttctatgaa 2 14 368 ttagcctgacagtttttggttccatttcagGTGAT .... ATCTGgtaagtcacacagcatctgagcggtacgca 3 15 431 caccacaaactttccctttctttgtaacagTGTTA ....

*Nuclwotide number of most-S1 base of exon [according to Hollenbaugh et al. (5)].tPosition of 5' boundary of exon with respect to reading frame. The 1, 2, 3 boundary lies immediately after the first, second, and third baseof the codon, respectively.

flect exon skipping and designed primers accordingly. Thislast assumption proved correct.

Primers were identified that allowed amplification of theentire CD40L gene (Figs. 1 and 2). PCR products were clonedand sequenced. The restriction map ofthe locus as well as theposition of the primers and the amplification products areshown in Fig. 2. An EcoRI site is present in intron 1 andanother is found in the 3' untranslated region. Exon 1 detectsthe 2.5-kb EcoRI fragment on Southern blot. All other exonsand introns are contained in the 10-kb EcoRI fragment, ingood agreement with PCR amplification product size. There-fore the coding regions of the CD40L locus are spread over12 or 13 kb of genomic DNA.The gene is composed of five exons and four intervening

introns (Fig. 2). The exon boundaries, splice donor andacceptor sequences, and the approximate intron sizes arereported in Table 1. All splicing signals contain the GT-AGdinucleotide found in the consensus motif (18). Introns in-terrupt the cDNA sequence at codons 52, 96, 115, and 136.The first exon contains the intracellular, the transmembranedomains, and the first portion ofthe extracellular (EC) region(6 amino acids) (4). The remainder of the EC domain ispresent on exons 2-5. Two small exons (3 and 4) encode 19amino acids and 21 amino acids, respectively. The last exonencodes the C-terminal 125 amino acids, including the re-m three cysteine residues and a potential N-linkedglycosylation site. No deviation from the reported sequencewas noted except a silent T/C polymorphism at the first baseof codon 50 (leucine).A parallel approach to isolate the CD40L gene involved

screening an X chromosome cosmid library (14). Positivecosmids were sequenced to determine the exon-intron bound-aries and subjected to Southern analysis using EcoRI and

A

WT

tov

5'

ACGT

Pt .1

T

4- a - A -l

0

TTT

\CA

IN*

o.._it_IC

AC

aI1,

Ia doa 40do 0

ACGT

HindIII. No sequence or structural deviations from theCD40Lgene organization determined by PCR were found. An anchor-PCR method was used to map the 5' end of the CD40Ltranscript (19). Comparison ofthe 5' transcript sequence withthe corresponding CD40L cosmid sequence excluded theexistence of additional 5' exons (data not shown).

Analysis of the structure of the CD40L gene allowed us toperform prenatal evaluation by direct gene analysis of chori-onic villi DNA from an 11-week-old fetus at risk of HIGM1.We established that the pregnant mother carried the sameamber mutation at codon 140 as her affected male cousin (sonof her maternal aunt, subject T.G. in ref. 11; subject III-2 ofref. 20). This mutation results in the expression ofa truncatedmolecule unable to bind CD40 (11). Chorionic villi DNAamplification with primers H and K, followed by sequencingofthree independent clones, showed a normal sequence, thusexcluding the possibility of an affected male fetus. However,we were unable to directly correlate the molecular diagnosiswith the phenotype since complete immunological evalua-tion, which would have substantiated the validity of theapproach, is not possible until several months after birth.Genonk CD40L Defects in IHGM Paties with mRNA

Deletis. We next analyzed genomic DNA from three un-relatedHIGM1 patients in which we had previously identifiedclustered deletions in the CD40L transcripts, which resultedin lack ofCD40L binding by the mutated CD40L protein (10).In each case, the underlying molecular genetic defect provedto be unique. The CD40L gene sequence abnormalities areshown in Fig. 3 and their effects on CD40L transcript splicingare shown in Fig. 4.The 63 nucleotides deleted in P1 (nucleotides 367-430)

overlap exactly with exon 4 of the CD40L gene. This coin-cidence suggested a defect in splicing rather than a genomic

B

CXAT-// T

G*-T - C -4

C

A

C

AA

T0T

C/A

CCC

C

Pt.2 WT

I.-I

a_de

ACGT

Pt .4-C

rC ca

_ fT T

T

ACGT ACGT

GTT

FIG. 3. Sequencing analysis of the PCR-amplified CD40L gene from HIGM1 patients with transcript deletions. The normal sequence (WT)is shown on the left of each panel. Arrows indicate point mutations; asterisks (*) indicate nucleotide insertions. Nucleotides deleted in thegenomic sequence in P4 are boxed. (A) Patient 1 (P1). (B) Patient 2 (P2). (C) Patient 4 (P4).

Proc. Natl. Acad Sci. USA 91 (1994)

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 29

, 202

0

Proc. Natl. Acad. Sci. USA 91 (1994) 2113

AJAkA| -gt ag -gt ag-T

Ex Ex4 Ex5

B .... A~-gt. agi9XGAT..TCTGJ -4 a g |C TGO CTOAA

Exc 3 \Ex 4 /Ex 5

C....AAAG | g -gt .......... a-...CGg9l 9tgttacagSEx 3 \ Ex 4 Ex

(-a hp)

D ..AlU -|gt a.. . .ag | al.Wi............................... s.........a-|.9

Ex 3 Ex\

(-10 blp)

FIG. 4. Schematic representation of normal (A) and aberrantsplicing of the CD40L gene in P1 (B), P2 (C), and P4 (D). Exons areboxed and numbered. Introns are represented by dotted lines.Boldface uppercase letters indicate normal nucleotide sequence atexon boundaries. The number of nucleotides deleted in the maturetranscript is in parentheses. Exon 5 nucleotides abnormally splicedout in P2 and P4 are indicated in italics; inserted nucleotides in P4 areunderlined twice. Lowercase letters indicate the conserved GT-AGdinucleotides at intron-exon junctions. Point mutations abolishingnormal splice sites are underlined.

deletion. There could be a mutation at the level of either thedonor or the acceptor consensus site ofthis exon. The regionsflanking exon 4 were PCR amplified and sequenced. Nodifference was detected in the exonic sequence, but the Gnucleotide in the invariant GT dinucleotide of the donor site(position +1) was substituted by an A (Fig. 3A). As a result,exon skipping occurred, giving rise to a 63-bp deleted tran-script, as depicted in Fig. 4B.

Deletion of 8 and 10 nucleotides ofP2 and P4, respectively,could also be explained by genomic deletions or by anacceptor site abnormality in intron 4 with utilization of adownstream cryptic splice site in the same exon. To char-acterize the underlying molecular defect in these patients, weanalyzed PCR clones obtained with primers H and K. Se-quencing of a region of about 200 bp around donor andacceptor splice sites in P2 (bearing the 8-nucleotide deletion)demonstrated that the A nucleotide in the conserved AGdinucleotide of the acceptor site was substituted by a G (Fig.3B). This led to the utilization of a cryptic splice site 8 bpdownstream, in exon 5. The resultant transcript lacks these8 nucleotides and generates an in-frame termination codon(Fig. 4C).

Analysis of the same region in P4 (10-nucleotide deletion inthe mRNA) demonstrated a 10-bp deletion in the genomicDNA with an insertion of the AA dinucleotide at the 3' endof the deletion (Fig. 3C); the deletion includes the G of theinvariant AG dinucleotide, destroying the normal acceptorsplice site, and the first 9 nucleotides of exon 5. A new splicesite, different from the normal one as well as from the oneused in patient 2, is formed by the last A and the G atnucleotide 440 of the mRNA, allowing splicing to occur (asdepicted in Fig. 4D) and leading to an out-of-frame prematuretermination. As a consequence of the deletion, a Mae III siteis destroyed in the genomic sequence. The fact that 10nucleotides are deleted in genomic sequence and transcript

sequence is coincidental, depending on the creation of a newsplice site just 10 bp from the wild-type one.

DISCUSSIONX chromosome-linked HIGM1 is a severe disease for whichno satisfactory therapy exists, thus emphasizing the need forprenatal diagnosis. Furthermore, the observation that thegene is selectively expressed in activated T lymphocytesmakes HIGM1 a candidate for gene therapy trials. Weestablished that the CD40L gene is composed of five exonsand four introns and that the locus spans about 12 or 13 kb.We have not yet characterized the promoter region and theelements that confer such tightly regulated expression in Tcells. However, our isolation ofCD40L cosmid clones shouldhelp to elucidate these control elements.Our analysis allowed us to investigate previously reported

abnormalities in three patients affected by deletions in theCD40L transcript. Interestingly, all three deletions werecentered around nucleotide 430, and two were extremelysimilar in that the 8 bp deleted in P2 were included in the 10-bpdeletion of P4. We demonstrated that the mutations in thethree patients arise differently and that they are not related tothe existence of a hot spot in the CD4OL gene. In fact, P1 andP2 had mutations in the invariant GT (P1) or AG (P2) splicingsignals of intron 4 that lie about 3 kb apart. The consequencesof these mutations were different. In P1, skipping of thewhole exon 4 occurred, whereas mutation in the acceptor siteof the same intron of P2 allowed utilization of a crypticacceptor site a few base pairs downstream in exon 5. Similarmutations at the same positions (+1 in the donor and -2 inthe acceptor sites) resulting in exon skipping or activation ofcryptic splice sites have been described in a number ofhumanhereditary diseases (21-31). In this regard, it is likely that theadditional HIGM1 patient reported to lack nucleotides 310-367 in the CD4OL transcript (13) represents exon skipping ofthe third exon since the missing nucleotides coincide exactlywith the boundaries of this exon.The mechanism accounting for the deletion in P4 is less

obvious, since the 10-bp deletion in the transcript is causedby a genomic deletion of 10 bp, including the G at position -1of the acceptor splice site in intron 4. Concomitant with the10-bp deletion is an insertion of 2 deoxyadenosine nucleo-tides, one of which contributes to create an AG dinucleotidein a new splice site. Alternatively, a deletion of 8 nucleotidescould be accompanied by two point mutations, but thiscomplex explanation seems less plausible. As in P2, theutilization of the new splice site alters the reading frameleading to premature termination (10).

Small genomic deletions involving more than a singlenucleotide are not very common, the most frequent being the3-bp deletion (delta F508, ref. 32) present in about 70%o ofpatients affected by cystic fibrosis. In a partial review of theliterature we were able to find small exonic deletions in anumber ofhuman diseases (22, 23, 33-42). In addition, a fewcases of small deletions involving the donor splice site havebeen reported (41, 43, 44), but we were unable to find smalldeletions involving the acceptor site. In all of these cases,these were pure deletions, since no extra nucleotides wereinserted at the deletion site. Complex rearrangements withinversion, duplication, and insertion are frequent in grossdeletions but are rarely found with small deletion/insertions(45, 46).The mechanisms leading to genomic deletions are un-

known. Recombination between homologous sequences byunequal crossing-over or intrachromosomal recombinationbetween repetitive elements or short direct repeats has beendocumented in some cases of large deletions involving dif-ferent loci (47-54). Some of the small deletions reportedabove occur within the context of short repeated sequences

Medical Sciences: Villa et al.

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 29

, 202

0

2114 Medical Sciences: Villa et al.

(34, 37-39) and could be explained by polymerase slippage orunequal sister-chromatid exchange. In this regard, it is note-worthy that deletion in patient 4 occurred in an imperfectdirect repeat, (IAACAiT.-GITAC.M . Theoretically, allof these deletions should not be accompanied by insertion ofextra nucleotides. The possibility that an insertion-excisionof a mobile element leading to a small deletion with the twoadenosines being the relict of its poly(A) tail cannot beexcluded but is not supported by our present data.

Determination of the exon-intron structure of the geneallows for the investigation ofHIGM1 patients and carriers atthe DNA level. The mRNA is not easily available, becauseCD40L is expressed in subsets of T cells only after stimula-tion; hence, knowledge of the genomic structure will beinstrumental in the analysis of patients in which DNA is theonly available material. In addition, it should allow for earlyprenatal diagnosis utilizing chorionic villi. However, moredata are needed to substantiate this point.CD40L genomic clones and the definition of its exon-

intron structure provide a starting point for further studies ofthe genetic elements that regulate CD40L expression. Ourknowledge of the CD40L gene structure will prove useful foridentification of additional mutations in HIGM1 and forperforming genetic counseling about this disease.

We thank Mr. Arrigo Caraffini for oligonucleotide preparation,Mrs. Stdphanie Certain, Mrs. Lucia Susani, and Mr. MassimoLittardi for technical assistance. Dr. H. Lehrach (Imperial CancerResearch Fund) is gratefully acknowledged for supplying the griddedX-chromosome cosmid filters. This work is supported in part bygrants from Consiglio Nazionale delle Ricerche, PF IngegneriaGenetica Sottoprogetto 5 (to P.V.) and Sottoprogetto 4 (to A.G.U.),and Biotecnologie e Biostrumentazione (to C.M.P.). The financialsupport of Telethon, Italy (Grant no. A.14), is gratefully acknowl-edged. J.P.D.S. and G.d.S.B. are supported by AssociationFrancaise contre les Myopathies (AFM) and l'Institut National de laSante et de la Recherche Mddicale (INSERM).

1. Notarangelo, L. D., Duse, M. & Ugazio, A. G. (1992) Immunodefic.Rev. 3, 101-122.

2. Stamenkovic, I., Clark, E. A. & Seed, B. (1989) EMBO J. 8, 1403-1410.3. Armitage, R. J., Fanslow, W. C., Strockbine, L., Sato, T. A., Clifford,

K. N., Macduff, B. M., Anderson, D. M., Gimpel, S. D., Davis-Smith,T., Maliszewski, C. R., Clark, E. A., Smith, C. A., Grabstein, K. H.,Cosman, D. & Spriggs, M. K. (1992) Nature (London) 357, 80-82.

4. Graf, D., Korthkuer, U., Mages, H. W., Senger, G. & Kroczek, R. A.(1992) Eur. J. Immunol. 22, 3191-3194.

5. Hollenbaugh, D., Grosmaire, L. S., Kullas, C. D., Chalupny, N. J.,Braesch-Andersen, S., Noella, R. J., Stamenkovic, I., Ledbetter, J. A.& Aruffo, A. (1992) EMBO J. 11, 4313-4321.

6. Spriggs, M. K., Armitage, R. J., Stockbine, L., Clifford, K. N.,Macduff, B. M., Sato, T. A. & Fanslow, W. C. (1992)J. Exp. Med.,176,1543-1550.

7. Gauchat, J. F., Aubry, J. P., Mattei, G., Life, P., Jomotte, T., Elson, G.& Bonnefoy, J. Y. (1993) FEBS Lett. 315, 259-266.

8. Allen, C. R., Armitage, R. J., Conley, M. E., Rosenblatt, H., Jenkins,N. A., Copeland, N. G., Bedell, M. A., Edelhoff, S., Disteche, C. M.,Simoneaux, D. K., Fanslow, W. C., Belmont, J. & Spriggs, M. K. (1993)Science 259, 990-993.

9. Aruffo, A., Farrington, M., Hollenbaugh, D., Li, X., Milatovich, A.,Nonoyama, S., Bajorath, J., Grosmaire, L. S., Stenkamp, R., Neubauer,M., Roberts, R. L., Noelle, R. J., Ledbetter, J. A., Francke, U. & Ochs,H. D. (1993) Cell 72, 291-300.

10. DiSanto, J. P., Bonnefoy, J. Y., Gauchat, J. F., Fisher, A. & de SaintBasile, G. (1993) Nature (London) 361, 541-543.

11. Korthiuer, U., Graf, D., Mages, H. W., Britre, F., Padayachee, M.,Malcolm, S., Ugazio, A. G., Notarangelo, L. D., Levinsky, R. J. &Kroczek, R. A. (1993) Nature (London) 361, 539-541.

12. Fuleihan, R., Narayanaswamy, R., Loh, R., Jabara, H., Rosen, F.,Chatila, T., Fu, S. M., Stamenkovic, I. & Geha, R. S. (1993) Proc. NatI.Acad. Sci. USA 90, 2170-2173.

13. Ramesh, N., Fuleihan, R., Rosen, F. S. & Geha, R. S. (1993) J. Immu-nol. 190, 26 (abstr.).

14. Nizetic, D., Zehetner, G., Monaco, A. P., Gellen, L., Young, B. D. &Lehrach, H. (1991) Proc. Nail. Acad. Sci. USA 88, 3233-3237.

15. Sanger, F., Nicklen, S. & Coulson, A. (1977) Proc. Natl. Acad. Sci. USA74, 5463-5467.

16. Hogge, W. A., Schomberg, S. A. & Golbus, M. S. (1985) PrenatalDiagn. 5, 393-400.

17. DalprA, L., Nocera, G., Tibiletti, M. G., Gramellini, F., Agosti, S. &Oldrini, A. (1986) Hum. Reprod. 2, 103-106.

18. Breathnach, R. & Chambon, P. (1981) Annu. Rev. Biochem. 90, 349-386.19. De Chavassel, R. & de Villartay, J. P. (1993) Eur. J. Immunol. 23,

1294-1299.20. Padayachee, M., Levinsky, R. J., Kinnan, C., Finn, A., McKeown, C.,

Feighery, C., Notarangelo, L. D., Hendriks, R. W., Read, A. T. &Malcolm, S. (1992) J. Med. Genet. 30, 202-205.

21. Zielenski, J., Bozon, D., Kerem, B., Markiewicz, D., Durie, P., Rom-mens, J. M. & Tsui, L. C. (1991) Genomics 10, 229-235.

22. Berg, M. A., Argente, J., Chernausek, S., Gracia, R., Aguirre-Guevara,J., Hopp, M., Perez-Jurado, L., Rosenbloom, A., Toledo, S. P. A. &Francke, U. (1993) Am. J. Hum. Genet. 52, 998-1005.

23. Brown, J. M., Thein, S. L., Weatherall, D. J. & Mar, K. M. (1992) Br.J. Haematol. 81, 574-578.

24. Olschwang, S., Laurent-Puig, P., Groden, J., White, R. & Thomas, G.(1993) Am. J. Hum. Genet. 52, 273-279.

25. Schapiro, B. L., Newburger, P. E., Klempner, M. S. & Dinauer, M. C.(1991) N. Engl. J. Med. 325, 1786-1790.

26. Treisman, R., Proudfoot, N. J., Shander, M. & Maniatis, T. (1982) Cell29, 903-911.

27. Kontusaari, S., Tromp, G., Kuivaniemi, H., Ladda, R. L. & Prockop,D. J. (1990) Am. J. Hum. Genet. 47, 112-120.

28. Cole, W. G., Chiodo, A. A., Lamande, S. R., Janeczko, R., Ramirez, F.,Dahl, H.-H. M., Chan, D. & Bateman, J. F. (1990) J. Biol. Chem. 265,17070-17077.

29. Sakuraba, H., Eng, C. M., Desnick, R. J. & Bishop, D. F. (1992)Genomics 12, 643-650.

30. Nakima, H., Kono, N., Yamasaki, T., Hotta, K., Kawachi, M.,Kuwajima, M., Noguchi, T., Tanaka, T. & Tarui, S. (1990) J. Biol. Chem.265, 9392-9395.

31. Macke, J. P., Davenport, C. M., Jacobson, S. G., Hennessey, J. C.,Gonzalez-Fernandez, F., Conway, B. P., Heckeulively, J., Palmer, R.,Maumenee, I. H., Sieving, P., Gouras, P., Good, W. &Nathans,J. (1993)Am. J. Hum. Genet. 53, 80-89.

32. Kerem, B.-S., Rommens, J. M., Buchanan, J. A., Markiewicz, D., Cox,T. K., Chakravarti, A., Buchwald, M. & Tsui, L.-C. (1989) Science 254,1073-1076.

33. Dean, M., White, M. B., Gerrard, B., Milunsky, A. & Amos, J. (1992)Genomics 13, 235-236.

34. Granell, R. T., Solera, J., Carrasco, S. & Molano, J. (1992)Am. J. Hum.Genet. 50, 1022-1026.

35. Pang, Y., Metzenberg, A., Das, S., Jing, B. & Gistchier, J. (1992) NatureGenet. 2, 103-106.

36. Tassabehji, M., Read, A. P., Newton, V. E., Patton, M., Gruss, P.,Harris, R. & Strachan, T. (1993) Nature Genet. 3, 26-30.

37. Jaruzelska, J., Melle, D., Matuszak, R., Borski, K. &Munnich, A. (1992)Hum. Mol. Genet. 1, 763-764.

38. Caillaud, C., Lyonnet, S., Rey, F., Melle, D., Frebourg, T. Berthelon,M., Vilarinho, L., Osorio, R. V., Rey, J. & Munnich, A. (1w91) J. Biol.Chem. 266, 9351-9354.

39. Groden, J., Gelbert, L., Thliveris, A., Nelson, L., Robertson, M.,Joslyn, G., Samowitz, W., Spirio, L., Carlson, M., Burt, R., Leppert, M.& White, R. (1993) Am. J. Hum. Genet. 52, 263-272.

40. Matsuo, M., Masumura, T., Nishio, H., Nakajima, T., Kitoh, Y.,Takumi, T., Koga, J. & Nakamura, H. (1991) J. Clin. Invest. 87,2127-2131.

41. Tuddenham, E. G. D., Cooper, D. N., Gitschier, J., Higuchi, M.,Hoyer, L. W., Yoshioka, A., Peake, I. R., Schwaab, R., Olek, K.,Kazazian, H. H., Lavergnc, J. M., Giannelli, F. & Antonarakis, S. E.(1991) Nucleic Acids Res. 19, 4821-4833.

42. Huang, S. Z., Xu, Y. H., Zeng, F. Y., Wu, D. F., Ren, Z. R. & Zeng,Y. T. (1991) Br. J. Haematol. 78, 125-126.

43. Leoni, G. B., Rosatelli, M. C., Cossu, G., Pischedda, M. C., De Vir-giliis, S. & Cao, A. (1993) Hum. Mol. Genet. 2,83-84.

44. Poort, S. R., Briet, E., Bertina, R. M. & Reitsma, P. H. (1990) Thromb.Haemostasis 64, 379-384.

45. Oner, R., Oner, C., Wilson, J. B., Tamagnini, G. P., Ribeiro, L. M. &Huisman, T. H. (1991) Br. J. Haematol. 79, 306-310.

46. Deidda, G., Novelletto, A., Hafez, M., El-Ziny, M., Terrenato, L. &Felicetti, L. (1991) Br. J. Haematol. 79, 90-92.

47. Canning, S. & Dryja, T. P. (1989) Proc. Natl. Acad. Sci. USA 86,5044-5048.

48. Orkin, S. H. & Kazazian, H. H., Jr. (1984) Annu. Rev. Genet. 18,131-171.

49. Lehrman, M. A., Russell, D. W., Goldstein, J. L. & Brown, M. S. (196)Proc. Natl. Acad. Sci. USA 83, 3679-3683.

50. McGookey Milewicz, D., Witz, A. M., Smith, A. C. M., Manchester,D. K., Waldstein, G. & Byers, P. H. (1993) Am. J. Hum. Genet. 53,62-70.

51. Chen, S. H. & Scott, C. R. (1990) Am. J. Hum. Genet. 47, 1020-1022.52. Giacalone, J. P. & Francke, U. (1992) Am. J. Hum. Genet. S9, 725-741.53. Li, L._& Bray, P. F. (1993) Am. J. Hum. Genet. 53,140-149.54. Lee, B., D'Alessio, M., Vissing, H., Ramirez, F., Steinziann, B. &

Superti-Furga, A. (1991) Am. J. Hum. Genet. 48, 511-517.

Proc. Natl. Acad. Sci. USA 91 (1994)

Dow

nloa

ded

by g

uest

on

Feb

ruar

y 29

, 202

0