EUKARYOTIC CELL, Feb. 2008, p. 258–267 Vol. 7, No. 21535-9778/08/$08.00�0 doi:10.1128/EC.00345-07

Pneumocystis Encodes a Functional S-AdenosylmethionineSynthetase Gene�

Geetha Kutty,1 Beatriz Hernandez-Novoa,1† Meggan Czapiga,2 and Joseph A. Kovacs1*Critical Care Medicine Department, NIH Clinical Center, National Institutes of Health, Bethesda, Maryland,1 and

Research Technologies Branch, National Institutes of Allergy and Infectious Diseases,National Institutes of Health, Bethesda, Maryland2

Received 18 September 2007/Accepted 23 November 2007

S-Adenosylmethionine (AdoMet) synthetase (EC 2.5.1.6) is the enzyme that catalyzes the synthesis of AdoMet, amolecule important for all cellular organisms. We have cloned and characterized an AdoMet synthetase gene (sam1)from Pneumocystis spp. This gene was transcribed primarily as an �1.3-kb mRNA which encodes a proteincontaining 381 amino acids in P. carinii or P. murina and 382 amino acids in P. jirovecii. sam1 was also transcribedas part of an apparent polycistronic transcript of �5.6 kb, together with a putative chromatin remodeling proteinhomologous to Saccharomyces cerevisiae, CHD1. Recombinant Sam1, when expressed in Escherichia coli, showedfunctional enzyme activity. Immunoprecipitation and confocal immunofluorescence analysis using an antipeptideantibody showed that this enzyme is expressed in P. murina. Thus, Pneumocystis, like other organisms, cansynthesize its own AdoMet and may not depend on its host for the supply of this important molecule.

Pneumocystis jirovecii is a pathogen that causes pneumonia inpatients with AIDS and in other immunocompromised patients(22, 27). Pneumocystis organisms that infect different mammalianhosts are unique and genetically divergent (9, 31, 33, 37) and aredesignated as different species (6, 14, 32). Because a reliable invitro culture system is lacking, it is difficult to study the biology ofthis organism directly. One group has reported that the continu-ous addition of S-adenosylmethionine (AdoMet) can enhance thesurvival of the organism in culture (25, 26). The failure to detectAdoMet synthetase (EC 2.5.1.6) activity in Pneumocystis cariniihomogenates led to the conclusion that Pneumocystis is unable toexpress functional AdoMet synthetase and thus must rely on itshosts for its supply of AdoMet (24).

AdoMet synthetase catalyzes the formation of AdoMet frommethionine and ATP (15). AdoMet is an essential molecule incellular metabolism: it is the methyl donor for most methyl-ation reactions, such as the methylation of proteins, nucleicacids, lipids, and polysaccharides (19). It also serves as a pre-cursor for polyamines and glutathione synthesis. Almost allorganisms have a functional AdoMet synthetase and are ableto synthesize this molecule de novo.

Genes encoding AdoMet synthetase have been character-ized from prokaryotes and eukaryotes and are highly con-served (15). In perusing the Pneumocystis genome project da-tabase (8), we noted a partial sequence homologous toAdoMet synthetase for other organisms, including fungi. Ouraim in the current study was to determine whether the Pneu-mocystis genome contained an AdoMet synthetase gene capa-ble of encoding a functional enzyme that is expressed by Pneu-mocystis.

MATERIALS AND METHODS

RNA and DNA extraction. Total RNA was extracted, using RNAzol B (Tel-Test Inc., Friendswood, TX) from, P. carinii- or Pneumocystis murina-infectedlungs and from P. carinii or P. murina organisms partially purified from theinfected lungs of rats or mice by Ficoll-Hypaque density gradient centrifugation,as described previously (16). Genomic DNA was isolated using a QIAamp DNAMini Kit (Qiagen, Valencia, CA). For P. jirovecii, genomic DNA was extractedfrom autopsy lung samples.

PCR and DNA sequencing. PCR and sequencing were performed as describedpreviously (17). PCR was performed using High Fidelity PCR master mix (RocheDiagnostics Corp., Indianapolis, IN) and genomic DNA or cDNA from P. cariniior P. murina organisms or from P. jirovecii-infected lung samples as templates.The sequences of the primers used for the amplifications are listed in Table 1. Incertain experiments, AccuPrime Pfx (Invitrogen, Carlsbad, CA) or HotStar Taq(Qiagen) was used.

Partial genomic sequences of sam1 from both P. murina and P. jirovecii wereobtained by sequencing the PCR products generated by the amplification ofgenomic DNA, using primers designed from the P. carinii sam1 gene sequenceobtained from the Pneumocystis genome project database (7).

For reverse transcription (RT)-PCR, first-strand cDNA was synthesized fromtotal RNA preparations obtained from partially purified P. carinii organisms orfrom P. murina-infected lung samples, using AP primer and Superscript II re-verse transcriptase (Invitrogen). PCR was performed utilizing primers designedfrom the known sam1 gene sequence. For 3� rapid amplification of cDNA ends(3� RACE), primer UAP (3� RACE kit), and the sam1 gene-specific primerswere used. RNA isolated from P. carinii organisms or from P. murina-infectedlung samples was subjected to RNA ligase-mediated rapid amplification ofcDNA ends (RLM-RACE), using a First Choice RLM-RACE kit (Ambion Inc.,Austin, TX) according to the manufacturer’s protocol. The first- and second-round PCR were performed using outer and inner adapter primers along withthe sam1 gene-specific primers.

Inverse PCR was done as described previously (20). Briefly, genomic DNAextracted from lung samples infected with P. carinii, P. murina, or P. jirovecii wasdigested with restriction enzyme HindIII or MboI (New England Biolabs, Bev-erly, MA). The digested product was ligated using T4 DNA ligase (New EnglandBiolabs, Beverly, MA) and subjected to nested PCR.

In some cases, PCR products were subcloned into TOPO TA cloning PCR 2.1vector (Invitrogen). The clones were verified by sequencing PCR products gen-erated using M13 forward and reverse primers.

Southern and Northern blotting analyses. Southern and Northern blottinganalyses were performed as described previously (17). Southern blotting analysiswas performed using genomic DNA from P. carinii-infected lung samples di-gested with different restriction enzymes. The blots were hybridized with adigoxigenin (DIG)-labeled PCR product spanning nucleotides 552 to 2020 of theP. carinii sam1 genomic sequence (DIG-High Prime; Roche) or a DIG-dUTP–

* Corresponding author. Mailing address: Building 10, Room2C145, MSC 1662, Bethesda, MD 20892-1662. Phone: (301) 496-9907.Fax: (301) 402-1213. E-mail: jkovacs@nih.gov.

† Present address: Servicio de Enfermedades Infecciosas, 4a PlantaCentro. Control A, Hospital Ramon y Cajal, Ctra. de Colmenar Km9.100, 28034 Madrid, Spain.

� Published ahead of print on 7 December 2007.

258

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

labeled oligonucleotide (DIG oligonucleotide tailing kit; Roche). For Northernblotting analysis, total RNA from P. carinii- or P. murina-infected lung sampleswas subjected to agarose gel electrophoresis in the presence of formaldehyde,transferred to a Nytran membrane, and hybridized as described above for South-ern blots.

Protein expression and refolding. The coding region of the P. carinii or P.murina sam1 gene (1,143 bp) was amplified, cloned into the pET 28 expressionvector (EMD Biosciences, San Diego, CA), and transformed into Escherichia colistrain BL21(DE3) RIL (Stratagene, Cedar Creek, TX). Recombinant proteinwas induced with 1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG) for 3 hat 30°C. Recombinant protein and controls used for the AdoMet synthetaseactivity assay were expressed using Overnight Express Autoinduction System 1(EMD Biosciences). Cells were harvested and resuspended in buffer containing0.5 M NaCl, 50 mM Tris-HCl (pH 8.0), 0.1% �-mercaptoethanol, and a cocktailof protease inhibitors. Following cell sonication, the lysate was centrifuged at10,000 � g for 10 min, and the pellet was processed as described previously (29).Briefly, the pellet was washed three times with the buffer containing 0.1 MTris-HCl (pH 7.5), 10 mM MgSO4, 5% Triton X-100, and 4 M urea, followed bytwo washes using the same buffer without Triton X-100 or urea, and subsequentlysolubilized at 10°C in buffer containing 50 mM Tris-HCl (pH 8.0), 10 mMMgSO4, and 8 M urea. The samples were dialyzed (three times within 24 h) at4°C, using refolding buffer (50 mM Tris-HCl [pH 8.0], 10 mM MgSO4, and 10mM dithiothreitol). Prior to dialysis, the samples were diluted fourfold by usingrefolding buffer.

AdoMet synthetase assay. AdoMet synthetase activity was measured as de-scribed previously (4). The reaction mixture (250 �l) contained 100 mM Tris-HCl (pH 7.5), 200 mM KCl, 10 mM MgCl2, 1 mM dithiothreitol, 5 mM ATP, 1mM L-methionine, and 0.2 �Ci of L-[methyl-14C]methionine (GE Health Care,Pittsburgh, PA). Samples (125 �l) along with the reaction buffer were incubatedat 37°C, and the reaction was stopped at different time points by the addition of10 ml of cold water. The reaction samples were loaded onto AG 50 W-X2cation-exchanger columns (NH4

�; Bio-Rad, Hercules, CA) and washed with 20ml of water. AdoMet was eluted in two 4-ml aliquots of 3 M NH4OH. Eacheluate was added to 10 ml of Optiphase-Hisafe 3 (Perkin Elmer, Wellesley, MA),and the radioactivity was measured in a scintillation counter.

Peptide antibodies. A synthetic peptide, ISTEKIREEILEKIVKKVIPS (cor-responds to amino acids 199 to 219 of P. murina Sam1) was used to commerciallyraise antibodies in rabbits and to affinity purify the hyperimmune sera (Sigma-Genosys, The Woodlands, TX).

Immunofluorescence and confocal microscopic analysis. Immunofluorescentstaining was performed by Histoserv, Inc. (Germantown, MD). P. murina-in-fected or uninfected lung tissue sections were costained with affinity purifiedanti-Sam1 antibody and anti-Pneumocystis monoclonal antibody 4D7 (1, 23).Antibody 4D7 recognizes a Pneumocystis-specific antigen that, based on immu-nofluorescence, appears to be present on both cysts and trophozoites. AlexaFluor 488 goat anti-rabbit immunoglobulin G (IgG) was used for the detectionof Sam1, while biotin-conjugated anti-mouse IgG and streptavidin-conjugatedAlexa Fluor 594 were used for staining Pneumocystis organisms. Nuclei werestained with 4�,6�-diamidino-2-phenylindole (DAPI). In certain experiments,Sam1 antibody was preincubated with the purified recombinant P. murina Sam1(insoluble form), cells were centrifuged, and the supernatant was used for im-munohistochemistry.

Confocal microscopy images were collected with a Leica SP5 confocal micro-scope (Leica Microsystems, Exton, PA) using an �63 oil immersion objectivewith a numerical aperture of 1.4, and zoom 4. Fluorochromes were excited byusing an argon laser (Enterprise model 651; Coherent, Inc.) at 364 nm for DAPI,an argon laser at 488 nm for Alexa Fluor 488, and an orange helium-neon laserat 594 nm for Alexa Fluor 594. To avoid possible cross-talk, the wavelengths werecollected separately and were merged later. Images were processed using LeicaLAS-AF software (version 1.7.0, build 1240).

Immunoprecipitation. Partially purified P. murina organisms were resus-pended in 20 mM HEPES (pH 7.5), 150 mM NaCl, 1% sodium dodecyl sulfate(SDS) and a cocktail of protease inhibitors containing EDTA. The extracts wereboiled for 10 min and then centrifuged for 15 min at 13,000 rpm, and thesupernatant was adjusted to a final concentration of 0.12% SDS, 1% TritonX-100, 20 mM HEPES, and 150 mM NaCl. The samples were incubated over-night at 4°C with the affinity purified anti-Sam1 antibody. Simultaneously, P.murina extracts were treated with preimmune serum to be used as a negativecontrol. The samples were incubated with protein A-Sepharose beads for 2 h at4°C. The beads were washed twice with Tris-buffered saline containing 0.1%Tween 20, followed by a final wash with Tris-buffered saline and then boiled inSDS sample denaturing buffer before they were subjected to SDS-polyacrylamidegel electrophoresis (PAGE) and Western blotting analysis.

SDS-PAGE and Western blotting analysis. Recombinant Sam1 was electro-phoretically separated on 10 to 20% Tricine gels (Invitrogen) and stained withCoomassie brilliant blue R250. Western blotting analysis of the recombinantSam1 protein was performed using peroxidase-conjugated anti-His tag antibody(Roche). Immunoprecipitated samples from partially purified P. murina prepa-

TABLE 1. Sequences of oligonucleotides used for PCRs

Oligonucleotide Sequence (5�–3�) Description of corresponding or complementaryamino acid range and organism

BH26sams TGCTATTTTGGATGCATGTTTA Corresponds to 718–739 of the P. carinii sam1 geneBH21sams TTCAACGAGTTCAGATGAAG Complementary to 1811–1830 of the P. carinii sam1 geneBH19sams TGTTGAACATTATGGAACAAG Corresponds to 1782–1802 of the P. carinii sam1 geneBH29sams AGATCCAAATTCTAGAGTTGCT Corresponds to 745–766 of the P. carinii sam1 geneBH34sams GATTGTTCTTCAATAGCAAGAA Complementary to 974–995 of the P. carinii sam1 geneGK632sams GGAATGGTGGTCCCTGTTCG Corresponds to 1206–1225 of the P. murina sam1 geneGK629sams GATCTTCTTTTAAACATGCATC Complementary to 728–749 of the P. carinii sam1 geneGK628sams CATGCATCCAAAATAGCATC Complementary to 716–735 of the P. carinii sam1 geneGK1sams ATTTTAGCCGGAAAAAACGC Corresponds to 378–397 of the P. murina sam1 geneGK12sams CTAACTTTTTAGGTTTTTCCCA Complementary to 1994–2015 of the P. carinii sam1 geneGK9sams TGTTGAACATTATGGAACAAGT Corresponds to 1782–1803 of the P. carinii sam1 geneGK13sams ATGTCCAGGTTTTTATTTACTTC Corresponds to 552–574 of the P. carinii sam1 geneGK14sams AAACACTAACTTTTTAGGTTTTTCCCAG Complementary to 1874–1901 of the P. murina sam1 geneGK11sams CTAACTTTTTAGGTTTTTCCCA Complementary to 1994–2015 of the P. carinii sam1 geneGK4sams ATTCTAGAGTTGCTTGTGAG Corresponds to 753–772 of the P. carinii sam1 geneGK54sams TGTTTAACAACAGTTGGTGAT Corresponds to 19–39 of the P. carinii sam1 geneGK53sams TACAGTTGTTTCAATAAAATCACCAAC

TGTTGTTAAACATTCTTTTAAAATCComplementary to 6–57 of the P. carinii sam1 gene

GK7sams GTGCACATGGTGGTGGT Corresponds to 1496–1512 of the P. murina sam1 geneGK20sams AGCTTTAGTTGTAATTTCACC Complementary to 660–680 of the P. jirovecii sam1 geneGK24sams ATTGGCATTTCTTATCCTTTAAG Corresponds to 1547–1569 of the P. jirovecii sam1 geneGK25sams GGTGTTATTGTTAAAGAACTTG Corresponds to 1655–1676 of the P. jirovecii sam1 geneGK29sams CAATAACAAATCTTCCAGACG Complementary to 1279–1299 of the P. jirovecii sam1 geneGK26sams ATGGCCTTCTCCAACAGAT Complementary to 423–441 of the P. jirovecii sam1 geneGK27sams CTAAGATTGCATCTGATATCTGAT Complementary to 501–524 of the P. jirovecii sam1 geneGK30sams TGTATCAACAATAATCTTTCTTC Complementary to 1371–1393 of the P. jirovecii sam1 gene

VOL. 7, 2008 PNEUMOCYSTIS AdoMet SYNTHETASE 259

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

rations were used for SDS-PAGE and Western blotting analysis. The blots werethen probed with Sam1 antibody and peroxidase-conjugated anti-rabbit IgG(ReliaBlot; Bethyl Laboratories, Inc. Montgomery, TX). Immunoreactive bandswere visualized using BM Blue POD Substrate precipitating (Roche). In certainexperiments, anti-Sam1 antibody was preincubated with excess antigen (refoldedrecombinant P. murina Sam1) before being used for Western blotting analysis.

RESULTS

Characterization of AdoMet synthetase genes of Pneumocys-tis. Following the identification of a partial genomic sequence(�1,600 bp) of AdoMet synthetase in the Pneumocystis genomeproject database, we undertook to determine whether a full-length functional enzyme was carried by the organism. We ob-tained a partial cDNA sequence of AdoMet synthetase from P.carinii by sequencing an RT-PCR product generated by usingRNA preparations from partially purified P. carinii organisms andprimers designed from the known genomic sequence. PartialcDNA and genomic sequences from P. murina and P. jiroveciiwere determined by sequencing RT-PCR or PCR products ob-tained using RNA or genomic DNA from P. murina- or P. jirove-cii-infected lung samples and primers designed from conservedareas of the P. carinii AdoMet synthetase sequence. Inverse PCRwas utilized to obtain upstream and downstream genomic se-quences. 3� and 5� RACE were employed to obtain the completecDNA sequence of P. carinii (1,232 bp) or P. murina (1,309-bp)AdoMet synthetase (GenBank accession numbers EF377365 andEF377360, respectively). For P. jirovecii, the cDNA sequence(GenBank accession number EF377362) for the coding regionwas deduced by comparing the genomic sequence with the cDNAsequences of P. carinii and P. murina AdoMet synthetase. The ATcontent of all three genes was 70 to 72%, consistent with an originfrom Pneumocystis rather than from a mammalian host. The ac-curacy of the genomic and cDNA sequences was confirmed for P.carinii and P. murina by PCR amplification and sequencing of theentire coding region, using both genomic and cDNA as a tem-plate. Figure 1 shows P. carinii AdoMet synthetase genomic se-quence together with the deduced amino acid sequences. Thefigure also contains a partial sequence of the adjacent gene lo-cated immediately upstream of AdoMet synthetase, which hashomology to the chromatin remodeling protein CHD1 of Saccha-romyces cerevisiae (see below). A comparison of genomic andcDNA sequences of AdoMet synthetase identified seven introns.The GenBank accession numbers of P. carinii, P. murina, and P.jirovecii AdoMet synthetase genomic sequences are EF377364,EF377361, and EF377363, respectively.

Most organisms have at least two forms of AdoMet syn-thetase (15). In Saccharomyces cerevisiae, two isozymes en-coded by the two genes sam1 and sam2 have been reported(35, 36), but in Schizosaccharomyces pombe, only sam1 hasbeen identified (11). We report the Pneumocystis AdoMet syn-thetase gene as sam1, since it has high homology to the sam1gene of S. pombe.

Deduced amino acid sequences of Pneumocystis Sam1. ThecDNA sequence of P. carinii sam1 or P. murina sam1 containsan open reading frame encoding a protein containing 381amino acids, while P. jirovecii Sam1 contains 382 amino acids.Figure 2 shows alignment of the deduced amino acid se-quences of AdoMet synthetase from Pneumocystis, yeast, E.coli, rats, mice, and humans (11–13, 21, 30, 36). The twoAdoMet synthetase signature motifs GAGDQGIMFGY and

GGGAFSGKD are 100% conserved among these species (11).ATP binding sites are also highly conserved (15, 28, 34). TheSam1 protein sequence is highly conserved among Pneumocys-tis: P. carinii Sam1 showed 94% identity to that of P. murina,and both showed 83% identity to that of P. jirovecii. Pneumo-cystis Sam1 (all three species) showed 75% identity to S. pombeSam1 and 71% to that of S. cerevisiae. Identity to human,mouse, and rat sequences (GenBank accession numbersNM_000429, NM_133653, and NM_012860, respectively)ranged from 64% to 67%, and the E. coli sequence (GenBankaccession number NP_289514) showed 53% to 55% identity.

Northern and Southern blotting analyses. To see whetherthe sam1 gene was being transcribed, Northern blotting anal-ysis was performed using RNA extracted from partially puri-fied P. carinii organisms or from P. murina-infected mouse lung(Fig. 3A). A DIG-labeled PCR product corresponding to nu-cleotides 552 to 2020 of the P. carinii sam1 genomic sequencewas used as the probe for hybridization. In both P. carinii (Fig.3, lane 1) and P. murina (Fig. 3, lane 2) preparations, an�1.3-kb hybridization signal was observed, which is consistentwith the size expected for the sam1 gene transcript. However,a second, less intense band of �5.6 kb was observed consis-tently in the RNA preparations from both organisms.

The 5.6-kb transcript could be derived from a gene whichcontained sequences with homology to the probe. To examinethis, a Southern blotting analysis was performed using restrictionendonuclease-digested genomic DNA from P. carinii-infected ratlung (Fig. 3B); the blot was hybridized with the same probe.Genomic DNA digested with AseI (Fig. 3B, lane 1) showed asingle band, while that digested with XbaI (Fig. 3B, lane 2)showed two bands. This is due to the presence of one XbaI site inthe probe-spanning region. Thus, the Southern blot shows that P.carinii sam1 appears to be a single-copy gene, and no second genewith homology to the probe that could account for the higherband on the Northern blot was identified.

We also excluded the possibility that the higher transcriptwas related to the host sam1 gene: the same probe did notshow any reactivity with RNA from a normal (uninfected)mouse lung, while an oligonucleotide specific for mouse sam1gave a band of the appropriate size (�3.5 kb; data not shown).

An alternative explanation is that the 5.6-kb band representeda polycistronic RNA. Adjacent genes are rarely cotranscribed asa polycistronic RNA in eukaryotes (2). The open reading frame ofthe sam1 gene is downstream of another gene that shows homol-ogy to the chromatin remodeling protein, CHD1, of S. cerevisiae(GenBank accession no. U18917; Fig. 1). These two genes areseparated by an intergenic region of 238 bp (Fig. 1). RT-PCRperformed using an upstream oligonucleotide designed from thecoding region of the chd1 homologue gene along with a down-stream oligonucleotide designed from the sam1 cDNA sequenceamplified an �2,000-bp product that contained part of the puta-tive chd1 cDNA sequence as well as sam1 cDNA, confirming thatthese two genes are transcribed as a single RNA. The eliminationof reverse transcriptase and pretreatment of the RNA withRNase-free DNase confirmed that it was RNA, not DNA, thatwas being amplified (data not shown). A comparison of genomicand cDNA sequences identified one intron in the partial se-quence of the putative chd1 gene and two introns in the intergenicregion (Fig. 1).

To confirm that the 5.6-kb band in the Northern blotting

260 KUTTY ET AL. EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

FIG. 1. Nucleotide and deduced amino acid sequences of P. carinii sam1 and partial sequences of the putative chd1 gene. Initiation andtermination codons are shown in bold and are underlined. The transcription start site is indicated by an arrow, the introns are shown in lowercaseletters, and the XbaI site is marked by a solid line above the sequence.

VOL. 7, 2008 PNEUMOCYSTIS AdoMet SYNTHETASE 261

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

analysis was derived from this cotranscribed message, the sameblot was reprobed with an oligonucleotide corresponding tothe coding region of the putative chd1 gene. The probe hybrid-ized to the 5.6-kb band but not to the 1.3-kb band (Fig. 3A,lane 3). In S. cerevisiae, the size of chd1 cDNA is �4.4 kb. Thissuggests that the 5.6-kb band represents a bicistronic RNA

containing the chd1 and sam1 transcripts. We also reprobedthe Southern blots with the chd1 gene-specific oligonucleotide.A single band was observed for DNA digested with either AseI(Fig. 3B, lane 3) or XbaI (Fig. 3B, lane 4). In both digests, thebands observed correspond to bands seen when the blot washybridized with the sam1 probe.

FIG. 2. Alignment of the deduced Pneumocystis Sam1 amino acid sequences with those of other organisms. Sam1 sequences from P. carinii, P.murina, P. jirovecii, S. pombe, and S. cerevisiae, MetK sequence from E. coli, and MAT1 sequences from mice (Mus musculus), rats (Rattasnorvegicus), and humans (Homo sapiens) were aligned using Clustal W. Identical amino acid residues are boxed. AdoMet synthetase signaturemotifs are underlined. ATP binding motifs are boxed in bold.

262 KUTTY ET AL. EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

Expression of the P. carinii Sam1 protein in E. coli. Thecoding region from P. carinii sam1 cDNA (1,145 bp) was am-plified and cloned into the pET 28 expression vector and ex-pressed as a His tag fusion protein in bacteria. SDS-PAGEanalysis of whole-bacterium extract expressing recombinantprotein showed a prominent band of �45-kDa protein bandwhen stained with Coomassie blue (Fig. 4A, lane 1), which isthe size expected for Sam1, but this band was not seen whenbacteria transfected with a control vector with no insert wereanalyzed (Fig. 4A, lane 2). The expressed protein showed im-munoreactivity to His tag antibody when analyzed by Westernblotting (Fig. 4B, lane 1), but no immunoreactivity was seenwith the control preparation (Fig. 4B, lane 2).

Most of the expressed protein was in insoluble bacterialinclusions (data not shown). To obtain soluble, potentiallyfunctional protein, expressed recombinant protein was dena-tured and allowed to refold as described for AdoMet syn-thetase in Leishmania donovani (29). Control samples wereprocessed in parallel. SDS-PAGE followed by Coomassie bluestaining (Fig. 4C) and Western blotting (Fig. 4D) demon-strated solubilization of the recombinant protein.

AdoMet synthetase assay. The refolded protein was ana-lyzed for AdoMet synthetase activity using 14C-labeled methi-onine as described previously (4). Figure 5 shows the AdoMetsynthetase activity of P. carinii refolded recombinant protein,demonstrating increased production of AdoMet over time.The control preparation (vector alone) showed no enzyme

activity. When ATP was omitted from the reaction mixture, noproduct was detected (data not shown). The activity was alsodependent on enzyme concentration (data not shown).

Immunochemical analysis of Sam1 in Pneumocystis. Giventhat the sam1 mRNA was expressed by Pneumocystis and thatthe mRNA encoded a functional enzyme, we were interestedin demonstrating the expression of Sam1 in Pneumocystis byimmunochemical analysis. For that experiment, a polyclonalantibody was generated against a synthetic peptide corre-sponding to amino acid residues 199 to 219 of P. murina Sam1.The antibody recognized the expressed recombinant protein(Fig. 4E, lane 1), and immunoreactivity was effectively blockedwhen the antibody was preincubated with excess refolded re-combinant P. murina Sam1 (Fig. 4E, lane 2). To concentratenative Sam1, partially purified P. murina extracts were sub-jected to immunoprecipitation, using this antibody; preim-mune serum was used as a negative control. Western blottinganalysis of immunoprecipitated samples identified an �45-kDaband (Fig. 6, lane 1) when the antipeptide antibody was usedthat was not seen with preimmune serum (Fig. 6, lane 2).Preincubation of the antibody with recombinant protein led toa loss of reactivity (Fig. 6, lane 3).

To examine the expression of Sam1 protein in P. murina-in-fected tissue, lung sections were costained with anti-Sam1 andanti-Pneumocystis (4D7) antibodies and subjected to confocal mi-croscopic analysis (Fig. 7). The immunoreactivity toward Sam1antibody colocalized with the staining of Pneumocystis using 4D7

FIG. 3. Northern and Southern blotting analyses of Pneumocystis sam1. (A) Northern blotting analysis of total RNA from P. carinii organismsor P. murina-infected mouse lung. The blots were hybridized with a DIG-labeled PCR product spanning 552 to 2,020 bp of P. carinii sam1 genomicsequence. A strong hybridization signal (�1.3 kb) indicated by the solid arrow is seen in P. carinii (lane 1) or P. murina (lane 2) RNA preparations,which is consistent with the size of Pneumocystis sam1 cDNA. The probe also recognized a minor band of �5.6 kb, which is indicated by an openarrow. When the blot containing P. carinii RNA was reprobed with DIG-labeled oligonucleotides designed from the coding region of the putativechd1 gene, only the 5.6-kb band was seen (lane 3). (B) Southern blotting analysis of genomic DNA from P. carinii. Genomic DNA extracted fromP. carinii-infected rat lung was digested with different restriction endonucleases, and the blots were probed with a DIG-labeled PCR productspanning 552 to 2,020 bp of P. carinii sam1 genomic sequence. DNA digested with AseI (lane 1) showed a single band; XbaI (lane 2) gave two bandsdue to the presence of a restriction site within the region of the probe. When the same blot was reprobed with the DIG-labeled oligonucleotidedesigned from the putative chd1 gene, a single band was seen following digestion with AseI (lane 3) or XbaI (lane 4). The hybridization signalsobtained correspond to the same size as the band recognized by the sam1 probe, consistent with a tandem genetic arrangement of sam1 and theputative chd1 gene. Molecular size markers (kb) are shown to the right of each gel.

VOL. 7, 2008 PNEUMOCYSTIS AdoMet SYNTHETASE 263

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

antibody, indicating the expression of Sam1 protein in Pneumo-cystis (Fig. 7A). It was noted that structures consistent with Pneu-mocystis cysts did not stain with the anti-Sam1 antibody, suggest-ing that Sam1 expression may be decreased or absent in cysts.When immunofluorescence analysis was done using anti-Sam1antibody that was preabsorbed with recombinant P. murina Sam1,the immunoreactivity was lost (Fig. 7B).

DISCUSSION

In the current study we have identified genes encodingAdoMet synthetase (sam1) in Pneumocystis and have demon-strated that sam1 mRNA is transcribed, that recombinant

FIG. 4. Expression of P. carinii recombinant protein Sam1. (A) SDS-PAGE analysis of the bacterial cells expressing recombinant proteinshowed a band of the expected size (�45 kDa, indicated by the arrows), when stained with Coomassie blue (lane 1). When vector with no insertwas analyzed, no band of that size was observed (lane 2). (B) Bacterial cells expressing the Sam1 protein showed immunoreactivity with theexpected size band when probed in a Western blot with His tag antibody (lane 1), while there was no immunoreactivity when vector alone wasanalyzed (lane 2). (C) Refolded protein showed a band of �45 kDa when stained with Coomassie blue (lane 1), while no band of that size was seenwhen vector alone was analyzed (lane 2). (D) A 45-kDa band showed immunoreactivity when Western blotting analysis shown in panel C wasperformed using His tag antibody (lane 1), but no immunoreactivity was observed when vector alone (negative control) was analyzed (lane 2).(E) Immunoreactivity to a 45-kDa band (lane 1) was lost when the anti-Sam1 antibody was preincubated with the antigen (recombinant protein)(lane 2). Molecular size markers (kDa) are shown to the right of panels B and D.

FIG. 5. AdoMet synthetase activity. AdoMet synthetase activity ofrecombinant, refolded P. carinii protein was measured at different timeintervals. The figure shows the activity measured in two different ex-periments and performed in duplicate. Values are means � standarddeviations (error bars) (n � 4). The enzyme activity is expressed asnmol of AdoMet formed/mg protein. The protein preparation ob-tained by using the vector alone showed no activity.

FIG. 6. Western blotting analysis of immunoprecipitated samplesfrom P. murina. Partially purified P. murina extracts were subjected toimmunoprecipitation, using anti-Sam1 antibody (lane 1) or preimmuneserum as a negative control (lane 2), followed by Western blotting anal-ysis, using the anti-Sam1 antibody. The former (lane 1) showed a reactiveband of 45 kDa (arrow), the size expected for Sam1, while the latter (lane2) showed no immunoreactivity. The bands corresponding to IgG aremarked. When anti-Sam1 antibody that was preincubated with recombi-nant Sam1 was used for the Western blot, immunoreactivity to the 45-kDaband was blocked (lane 3), demonstrating that the immunoreactivity isspecific for Sam1.

264 KUTTY ET AL. EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

Sam1 is enzymatically active, and that immunoreactive Sam1can be identified in Pneumocystis preparations. These datastrongly support the conclusion that Pneumocystis can synthe-size AdoMet de novo and suggest that the organism does notneed to rely on exogenous, host-derived AdoMet for survival.

At least two isozymes of AdoMet synthetase encoded bydifferent but closely related genes are present in many eu-karyotes. The sequences are highly conserved among species(15). With Pneumocystis, we were able to identify only onegene, sam1, for encoding AdoMet synthetase, similar to whathas been reported for S. pombe (11). Pneumocystis AdoMetsynthetase showed high homology to that of yeast and less so tothose of E. coli and mammalian species (11–13, 21, 30, 35, 36).AdoMet synthetase signature motifs and ATP binding sites arehighly conserved in all these sequences (28, 34). While therecombinant protein demonstrated AdoMet synthetase activ-ity, the specific activity under nonoptimized conditions, �0.64nmol/min/mg protein, was less than that seen with recombinantrat (1.5 to 30 nmol/min/mg protein, depending on the condi-tions for refolding) or Leishmania enzyme (�80 nmol/min/mgprotein), though it was similar to that seen with crude extractsobtained from S. pombe (�0.05 to 0.55 nmol/min/mg protein,depending on the phase of growth) (11, 18, 29).

It is of interest that Northern blotting analysis identified twotranscripts, a major band (�1.3 kb) that corresponded to theexpected size of the sam1 mRNA, and a minor band (�5.6 kb)

that is consistent with a bicistronic mRNA containing sam1and a putative chd1 homologue. The presence of polycistronicRNA is very rare in eukaryotes, and the genes derived from thepolycistronic RNA are usually functionally related (3). Co-transcription of these genes was seen for both rat and mousePneumocystis, suggesting that this organization dates to theancestor of at least these two species. Insufficient RNA wasavailable to examine transcription in P. jirovecii.

A probe corresponding to the chd1 gene recognized only thelarger size band; thus, chd1 appears to be invariably tran-scribed with sam1, while the majority of sam1 transcripts aremonocistronic. It is unknown whether the translation of bothproteins occurs from the cotranscribed message and what ef-fect the excision of introns from the intergenic region may haveon the synthesis of Sam1. Bicistronic RNA in which dmc1 andrad 24 are cotranscribed has been reported in S. pombe (10).The functional significance of bicistronic RNA in fungi is cur-rently unknown.

Our findings do not support the conclusion of Merali andClarkson (24) that Pneumocystis does not possess a functionalAdoMet synthetase gene. This group reported that Pneumo-cystis cannot synthesize AdoMet and that this pathogen has todepend on its hosts for the supply of this important molecule(26). AdoMet is an important molecule, and all organisms,with the exception of the xD strain of Amoeba proteus, areknown to synthesize this molecule. It has been reported that

FIG. 7. Confocal immunofluorescence microscopic detection of Sam1 in P. murina-infected mouse lung. (A) Dual immunofluorescence stainingof P. murina-infected mouse lung tissue sections using anti-Sam1 and anti-Pneumocystis (4D7) antibodies. (B) Dual immunofluorescence stainingof P. murina-infected mouse lung tissue sections using anti-Sam1 antibody preabsorbed with insoluble recombinant AdoMet protein andanti-Pneumocystis (4D7) antibody. Panel 1, blue indicates the cell nuclei stained with DAPI. Panel 2, staining of Pneumocystis using 4D7 antibody,biotin-conjugated anti-mouse IgG and streptavidin-conjugated Alex Fluor 594. Red indicates immunoreactivity. Panel 3, staining with rabbit anti-P.murina Sam1 antibody, using Alexa Fluor 488-conjugated goat anti-rabbit IgG as the secondary antibody. Green indicates the immunoreactivitywith the anti-Sam1 antibody. Panel 4, merged images. The green anti-Sam1 fluorescence colocalizes with the anti-Pneumocystis red fluorescencestaining. An arrow indicates a structure that is consistent with a cyst, within which are multiple DAPI-stained nuclei that, however, did not stainwith the anti-Sam1 antibody. The anti-Sam1 immunoreactivity was blocked when the antibody was preabsorbed with recombinant protein, showingthat the immunoreactivity is specific for Sam1. The thickness of the slides used for the confocal examination was 5 �m, and each confocal pictureis estimated to be �1 �m.

VOL. 7, 2008 PNEUMOCYSTIS AdoMet SYNTHETASE 265

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

the xD strain of Amoeba proteus, which originated followingthe spontaneous infection of the D strain of Amoeba proteus byX-bacteria, must depend on its symbiont X-bacteria for itssupply of AdoMet (5). Merali and Clarkson (24) noted theexistence of a possible Pneumocystis-specific AdoMet syn-thetase gene in the genome project but proposed that ATPbinding sites of Pneumocystis AdoMet synthetase might bemutated, resulting in a nonfunctional enzyme. However, ourstudy demonstrates that this is not the case; Pneumocystis Sam1retains all the consensus ATP binding sites (28, 34).

By immunochemical analysis, we were able to show theexpression of the Sam1 protein in P. murina. The affinitypurified antibody raised against a peptide that correspondsto amino acid residues 199 to 219 of P. murina Sam1 reactedwith a 45-kDa protein in the extracts of partially purified P.murina organisms isolated from infected mouse lung, whenanalyzed by immunoprecipitation. The size is consistentwith the expected size of Sam1. Preincubation of anti-Sam1antibody with the refolded recombinant P. murina Sam1completely removed the 45-kDa band, indicating that it isspecific for Sam1. Confocal immunofluorescence analysis ofP. murina-infected lung tissue sections using the same anti-body showed that the immunostaining of Sam1 is colocal-ized to Pneumocystis organisms detected with a specificmonoclonal antibody (1, 23). While there was some nonspe-cific activity seen with the anti-Sam1 antibody, preabsorp-tion of the antibody with the antigen (recombinant P. murinaSam1) blocked the immunoreactivity, supporting its speci-ficity for Sam1.

In summary, we have characterized the sam1 gene fromPneumocystis, which is transcribed into an �1.3-kb mRNA.The recombinant protein expressed in E. coli showed func-tional enzyme activity. Our study clearly shows that Pneumo-cystis has a sam1 gene that can encode a functional AdoMetsynthetase. We were able to detect the expression of Sam1protein in P. murina by immunoprecipitation and confocalimmunofluorescence analyses. Thus, Pneumocystis, like otherorganisms, could synthesize its own AdoMet and does not needto depend on its hosts for the supply of this important mole-cule, as reported by Merali and Clarkson (24).

ACKNOWLEDGMENTS

We thank Rene Costello and Howard Mostowski for their assistancewith the animal studies.

This research was supported by the Intramural Research Program ofthe NIH Clinical Center and the National Institute of Allergy andInfectious Diseases.

REFERENCES

1. Angus, C. W., A. Tu, P. Vogel, M. Qin, and J. A. Kovacs. 1996. Expression ofvariants of the major surface glycoprotein of Pneumocystis carinii. J. Exp.Med. 183:1229–1234.

2. Blumenthal, T. 1998. Gene clusters and polycistronic transcription in eu-karyotes. Bioessays 20:480–487.

3. Blumenthal, T. 2004. Operons in eukaryotes. Brief. Funct. Genomic Pro-teomic 3:199–211.

4. Chiang, P. K., and G. L. Cantoni. 1977. Activation of methionine for trans-methylation. Purification of the S-adenosylmethionine synthetase of bakers’yeast and its separation into two forms. J. Biol. Chem. 252:4506–4513.

5. Choi, J. Y., T. W. Lee, K. W. Jeon, and T. I. Ahn. 1997. Evidence forsymbiont-induced alteration of a host’s gene expression: irreversible loss ofSAM synthetase from Amoeba proteus. J. Eukaryot. Microbiol. 44:412–419.

6. Cushion, M. T. 2004. Molecular and phenotypic description of Pneumocystiswakefieldiae sp. nov., a new species in rats. Mycologia 96:429–438.

7. Cushion, M. T., and J. Arnold. 1997. Proposal for a Pneumocystis genomeproject. J. Eukaryot. Microbiol. 44:7S.

8. Cushion, M. T., A. G. Smulian, B. E. Slaven, T. Sesterhenn, J. Arnold, C.Staben, A. Porollo, R. Adamczak, and J. Meller. 2007. Transcriptome ofPneumocystis carinii during fulminate infection: carbohydrate metabolismand the concept of a compatible parasite. PLoS ONE 2:e423.

9. Dei-Cas, E., E. Mazars, C. O. Ferragut, I. Durand, E. M. Aliouat, M. Dridba,F. Palluault, J. C. Cailliez, N. Seguy, M. Tibayrenc, et al. 1994. Ultrastruc-tural, genomic, isoenzymatic and biological features make it possible todistinguish rabbit Pnenumocystis from other mammal Pneumocystis strains. J.Eukaryot. Microbiol. 41:84S.

10. Fukushima, K., Y. Tanaka, K. Nabeshima, T. Yoneki, T. Tougan, S. Tanaka,and H. Nojima. 2000. Dmc1 of Schizosaccharomyces pombe plays a role inmeiotic recombination. Nucleic Acids Res. 28:2709–2716.

11. Hilti, N., R. Graub, M. Jorg, P. Arnold, A. M. Schweingruber, and M. E.Schweingruber. 2000. Gene sam1 encoding adenosylmethionine synthetase:effects of its expression in the fission yeast Schizosaccharomyces pombe.Yeast 16:1–10.

12. Horikawa, S., M. Ishikawa, H. Ozasa, and K. Tsukada. 1989. Isolation of acDNA encoding the rat liver S-adenosylmethionine synthetase. Eur. J. Bio-chem. 184:497–501.

13. Horikawa, S., and K. Tsukada. 1991. Molecular cloning and nucleotidesequence of cDNA encoding the human liver S-adenosylmethionine syn-thetase. Biochem. Int. 25:81–90.

14. Keely, S. P., J. M. Fischer, M. T. Cushion, and J. R. Stringer. 2004. Phylo-genetic identification of Pneumocystis murina sp. nov., a new species inlaboratory mice. Microbiology 150:1153–1165.

15. Kotb, M., and A. M. Geller. 1993. Methionine adenosyltransferase: structureand function. Pharmacol. Ther. 59:125–143.

16. Kovacs, J. A., J. L. Halpern, J. C. Swan, J. Moss, J. E. Parrillo, and H.Masur. 1988. Identification of antigens and antibodies specific for Pneumo-cystis carinii. J. Immunol. 140:2023–2031.

17. Kutty, G., and J. A. Kovacs. 2007. Identification and characterization ofrad51 of Pneumocystis. Gene 389:204–211.

18. Lopez-Vara, M. C., M. Gasset, and M. A. Pajares. 2000. Refolding andcharacterization of rat liver methionine adenosyltransferase from Esche-richia coli inclusion bodies. Protein Expr. Purif. 19:219–226.

19. Lu, S. C. 2000. S-adenosylmethionine. Int. J. Biochem. Cell. Biol. 32:391–395.

20. Ma, L., L. Borio, H. Masur, and J. A. Kovacs. 1999. Pneumocystis cariniidihydropteroate synthase but not dihydrofolate reductase gene mutationscorrelate with prior trimethoprim-sulfamethoxazole or dapsone use. J. In-fect. Dis. 180:1969–1978.

21. Markham, G. D., J. DeParasis, and J. Gatmaitan. 1984. The sequence ofmetK, the structural gene for S-adenosylmethionine synthetase in Esche-richia coli. J. Biol. Chem. 259:14505–14507.

22. Masur, H., M. A. Michelis, J. B. Greene, I. Onorato, R. A. Stouwe, R. S.Holzman, G. Wormser, L. Brettman, M. Lange, H. W. Murray, and S.Cunningham-Rundles. 1981. An outbreak of community-acquired Pneumo-cystis carinii pneumonia: initial manifestation of cellular immune dysfunc-tion. N. Engl. J. Med. 305:1431–1438.

23. Mei, Q., Q. Wang, W. Fan, B. Li, Y. Chen, and Y. Liu. 1994. Experimentaland clinical study on pneumocystosis. III. Development and character-ization of monoclonal antibody against Pneumocystis carinii. Zhongguo JiSheng Chong Xue Yu Ji Sheng Chong Bing Zuzhi. 12:188–191. (In Chi-nese.)

24. Merali, S., and A. B. Clarkson, Jr. 2004. S-adenosylmethionine and Pneu-mocystis. FEMS Microbiol. Lett. 237:179–186.

25. Merali, S., U. Frevert, J. H. Williams, K. Chin, R. Bryan, and A. B. Clarkson,Jr. 1999. Continuous axenic cultivation of Pneumocystis carinii. Proc. Natl.Acad. Sci. USA 96:2402–2407.

26. Merali, S., D. Vargas, M. Franklin, and A. B. Clarkson, Jr. 2000. S-adeno-sylmethionine and Pneumocystis carinii. J. Biol. Chem. 275:14958–14963.

27. Munoz, A., L. K. Schrager, H. Bacellar, I. Speizer, S. H. Vermund, R. Detels,A. J. Saah, L. A. Kingsley, D. Seminara, and J. P. Phair. 1993. Trends in theincidence of outcomes defining acquired immunodeficiency syndrome(AIDS) in the Multicenter AIDS Cohort Study: 1985–1991. Am. J. Epide-miol. 137:423–438.

28. Perez-Pertejo, Y., R. M. Reguera, C. Garcia-Estrada, R. Balana-Fouce, andD. Ordonez. 2004. Mutational analysis of methionine adenosyltransferasefrom Leishmania donovani. Eur. J. Biochem. 271:2791–2798.

29. Perez-Pertejo, Y., R. M. Reguera, H. Villa, C. Garcia-Estrada, R. Balana-Fouce, M. A. Pajares, and D. Ordonez. 2003. Leishmania donovani methio-nine adenosyltransferase. Role of cysteine residues in the recombinant en-zyme. Eur. J. Biochem. 270:28–35.

30. Sakata, S. F., L. L. Shelly, S. Ruppert, G. Schutz, and J. Y. Chou. 1993.Cloning and expression of murine S-adenosylmethionine synthetase. J. Biol.Chem. 268:13978–13986.

31. Sinclair, K., A. E. Wakefield, S. Banerji, and J. M. Hopkin. 1991. Pneumo-cystis carinii organisms derived from rat and human hosts are geneticallydistinct. Mol. Biochem. Parasitol. 45:183–184.

32. Stringer, J. R., C. B. Beard, R. F. Miller, and A. E. Wakefield. 2002. A newname (Pneumocystis jirovecii) for Pneumocystis from humans. Emerg. Infect.Dis. 8:891–896.

266 KUTTY ET AL. EUKARYOT. CELL

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.

33. Stringer, J. R., S. L. Stringer, J. Zhang, R. Baughman, A. G. Smulian, andM. T. Cushion. 1993. Molecular genetic distinction of Pneumocystis cariniifrom rats and humans. J. Eukaryot. Microbiol. 40:733–741.

34. Taylor, J. C., and G. D. Markham. 2000. The bifunctional active site ofS-adenosylmethionine synthetase. Roles of the basic residues. J. Biol. Chem.275:4060–4065.

35. Thomas, D., R. Rothstein, N. Rosenberg, and Y. Surdin-Kerjan. 1988. SAM2encodes the second methionine S-adenosyl transferase in Saccharomyces

cerevisiae: physiology and regulation of both enzymes. Mol. Cell. Biol.8:5132–5139.

36. Thomas, D., and Y. Surdin-Kerjan. 1987. SAM1, the structural gene for oneof the S-adenosylmethionine synthetases in Saccharomyces cerevisiae. Se-quence and expression. J. Biol. Chem. 262:16704–16709.

37. Wright, T. W., T. Y. Bissoondial, C. G. Haidaris, F. Gigliotti, and P. J.Haidaris. 1995. Isoform diversity and tandem duplication of the glycoproteinA gene in ferret Pneumocystis carinii. DNA Res. 2:77–88.

VOL. 7, 2008 PNEUMOCYSTIS AdoMet SYNTHETASE 267

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/e

c on

16

Nov

embe

r 20

21 b

y 37

.55.

115.

222.