rbm47 , a novel RNA binding protein, regulates zebrafish head development

rbm47, a Novel RNA Binding Protein, Regulates Zebrafish Head Development

Rui Guan1,2,3,4, Suzan EI-Rass1,2, David Spillane1,2, Simon Lam3,Youdong Wang1,2, Jing Wu3, Zhuchu Chen4, Anan Wang3, Zhengping Jia3, Armand Keating2, Jim Hu3* and Xiao-Yan Wen1,2*

1 Zebrafish Centre for Advanced Drug Discovery, Keenan Research Centre, Li Ka Shing Knowledge Institute, St. Michael’s Hospital, Toronto, Ontario, Canada 2 Department of Medicine, Physiology & Institute of Medical Science, University of Toronto, Canada 3 Department of Laboratory Medicine and Pathology, University of Toronto & Program in Physiology & Experimental Medicine, The Hospital for Sick Children, Toronto, Canada 4 Key Laboratory of Cancer Proteomics of Chinese Ministry of Health, Xiangya Hospital and Cancer Research Institute, Central South University, Hunan Province, China Running title: rbm47 in zebrafish head development

Key words: RNA binding protein, rbm47, head development, zebrafish, gene regulation, gene knockdown, morpholino, microarray

* Co-correspondence to:

a. Xiao-Yan Wen 209 Victoria Street, Rm 519 Toronto, Ontario, Canada M5B 1T8 Email: [email protected] b. Jim Hu 555 University Avenue, Toronto, Ontario, Canada M5G 1X8 Email: [email protected]

Research Article Developmental DynamicsDOI 10.1002/dvdy.24039

Accepted Articles are accepted, unedited articles for future issues, temporarily published onlinein advance of the final edited version.© 2013 Wiley Periodicals, Inc.Received: Feb 22, 2013; Revised: Aug 02, 2013; Accepted: Aug 14, 2013

Dev

elop

men

tal D

ynam

ics

Guan R et al, Aug 22, 2013

2

ABSTRACT

Background: Vertebrate trunk induction requires inhibition of bone morphogenetic protein (BMP)

signaling, whereas vertebrate head induction requires concerted inhibition of both Wnt and BMP

signaling. RNA binding proteins play diverse roles in embryonic development and their roles in

vertebrate head development remain to be elucidated.

Results: We first characterized the human RBM47 as a RNA binding protein that specifically binds

RNA but not single stranded DNA. Next, we knocked down rbm47 gene function in zebrafish using

morpholinos targeting the start codon and exon-1/intron-1 splice junction. Down-regulation of

rbm47 resulted in headless and small head phenotypes, which can be rescued by a wnt8a blocking

morpholino. To further reveal the mechanism of rbm47’s role in head development, microarrays

were performed to screen genes differentially expressed in normal and knockdown embryos. epcam

and a2ml were identified as the most significantly up- and down-regulated genes, respectively. The

microarrays also confirmed up-regulation of a number of genes involved in head development,

including gsk3a, otx2 and chordin, which are important regulators of Wnt signaling.

Conclusion: Altogether, our findings reveal that Rbm47 is a novel RNA-binding protein critical for

head formation and embryonic patterning during zebrafish embryogenesis which may act through a

Wnt8a signaling pathway.

Key findings:

• Human RBM47 is localized to the nucleus and is capable of interacting with RNA.

• Morpholino-based rbm47 knockdown in zebrafish results in loss of or reduced head

development.

• Rbm47 functions through a pathway involving Wnt8a signaling.

Page 2 of 28

John Wiley & Sons, Inc.

Developmental DynamicsD

evel

opm

enta

l Dyn

amic

s


3

INTRODUCTION

Formation of the head during vertebrate embryogenesis has been a hot topic in developmental

biology since the discovery of the head organizer by Spemann and Mangold (Spemann, 1924).

Embryological and genetic evidence indicates that vertebrate head induction requires the concerted

inhibition of Nodal, Wnt and Bone Morphogenetic Protein (BMP) signaling (Piccolo, 1999). During

anterior-posterior (AP) patterning, the Spemann organizer produces a group of factors that inhibit

the posteriorizing effects of Wnt and BMP signaling (Glinka et al., 1997). This so-called “Two

Inhibitor Model” proposes that inhibition of both pathways is responsible for the regional

specification of vertebrate head induction.

RNA Binding Proteins (RBPs) are proteins containing one or more RNA binding domain, the

most common being the RNA Recognition Motif (RRM) (Lunde et al., 2007). RBPs are gene

regulators required throughout early vertebrate development. They exert their effects through

interactions with gene transcripts, thus modulating their activity. There are a multitude of

mechanisms through which RBPs can regulate gene expression (Colegrove-Otero et al., 2005).

These effects may be exerted at all levels of post-transcriptional regulation: nonsense-mediated

decay (e.g. UPF3; Ruiz-Echevarria et al., 1998), splicing (e.g. U2AF; Ruskin et al., 1988) and

alternative splicing (e.g. hnRNPA1; Allemand et al., 2005), mRNA stability (e.g. HuD; Lazarova et

al., 1999), RNA editing (e.g. ACF; Dance et al., 2002), RNA localization (e.g. HuR; Gallouzi et al.,

2001), pre-rRNA complex formation (e.g. Nucleolin; Chen et al., 2012), and translation (e.g. PABP;

Tarun and Sachs, 1996).

RBPs are important regulators during development of various organs, including germ cells,

heart and ear (Beck et al., 1998; Gerber et al., 2002; Jiang et al., 1997; Rowe et al., 2006). Several

RBPs have been identified for their roles in neural development. For example, Vg1-RBP, expressed

in embryonic and neoplastic cells, is required for the migration of cells forming the roof plate of the

neural tube, and plays essential roles in neural crest migration (Yaniv et al., 2003). Quaking

homolog, also known as KH domain RNA binding (QKI), regulates distinct mRNA targets to

promote oligodendrocyte differentiation and myelin formation, which is associated with

schizophrenia (Bockbrader and Feng, 2008). Depletion of cold-inducible RNA binding protein

Page 3 of 28



evel

opm

enta

l Dyn

amic

s


4

(CIRP), a Xenopus transcription factor 3 (XTcf-3)-specific target gene, by antisense morpholino

oligonucleotide injection leads to an enlargement of the anterior neural plate (van Venrooy et al.,

2008). There is emerging evidence to suggest the importance of RBPs in head development. For

example, the putative RBP cellular nucleic acid binding protein (CNBP) controls neural crest cell

expansion during rostral head development by affecting levels of cellular proliferation and apoptosis

as well as fate determination (Weiner et al., 2011).

RBM proteins possess one or more RRMs, highly conserved RNA interaction motifs consisting

of a four-stranded antiparallel β-sheet packed against two α-helices (Nagai et al., 1990). By

regulating post-transcriptional processes, RBMs are capable of functioning through diverse

mechanistic pathways. For example, RBM4, possessing two RRMs and a CCHC-type zinc finger,

functions in several cellular processes including alternative splicing of pre-mRNA, translation, and

RNA silencing (Kar et al., 2006; Lin et al., 2007; Lin and Tarn, 2005; Markus et al., 2006; Markus

and Morris, 2006; Markus and Morris, 2009). RBM5, which contains 2 RRMs, is a modulator of

apoptosis (Mourtada-Maarabouni and Williams, 2002). Some RRM domains are capable of

protein-protein interaction, such as in the RBM protein heterogeneous ribonucleoprotein A1

(hnRNPA1), whose first RRM domain interacts with the cap region of topoisomerase I through a

hydrophobic pocket on its β-surface, and thus may be involved in DNA relaxation

(Trzcinska-Daneluti et al., 2007). Several RBMs appear to be important for vertebrate development.

RBM19 is reported to play a role in digestive organ development in zebrafish (Mayer and Fishman,

2003) and preimplantation development in mice (Borozdin et al., 2006; Lorenzen et al., 2005;

Zhang et al., 2008). RBM24a and b are involved in vasculogenesis, early angiogenesis, and vascular

maintenance in the developing zebrafish (Maragh et al., 2011).

RNA Binding Motif Protein 47 (RBM47) (aka Ribonucleoprotein-47, NCBI Accession

#AF262323) is an uncharacterized, putative RBP. In the current study, we have characterized human

and zebrafish RBM47 (Rbm47), and explored its role in zebrafish embryonic development,

demonstrating that it plays a pivotal role in head formation and early embryonic patterning through

a pathway involving Wnt8a signaling.

Page 4 of 28



evel

opm

enta

l Dyn

amic

s


5

RESULTS

Human RBM47 is a Novel RNA-binding Protein

In searching for novel RNA interacting proteins, we identified human RBM47 on chromosome

4p14. RBM47 produces 2 transcripts resulting from alternative splicing events. Isoform a consists of

7 exons, while isoform b has 5 exons. Isoform b lacks exons 5 and 7, but alternatively contains a

shorter exon 4 in the mid-coding region. As shown in Figure 1A, isoform a and b encode 2 proteins

that are 592 and 523 amino acids in length, respectively, with projected molecular weights of 64kDa

and 57kDa. Structural analysis found that both protein isoforms contain 3 RRMs, suggesting RBP

activity.

To determine subcellular localization, HeLa cells were transfected with a RBM47-GFP fusion

protein, revealing nuclear localization (Fig. 1C). To validate our prediction that RBM47 is a RBP, a

RNA binding assay was performed. Human RBM47 showed strong affinities to poly-A, -C, and -U

RNAs, low affinity to poly-G RNA and no ability to interact with single stranded DNA (ssDNA)

(Fig. 1D).

Zebrafish rbm47 is Expressed during Early Embryogenesis

Zebrafish rbm47 encodes a protein of 599 amino acids, and contains 3 RRMs (Fig. 1A).

Zebrafish Rbm47 protein shows 81.5% identity to human RBM47-a, with 90% similarity within the

RRM sequences (Fig. 1B). No alternative splicing transcript was identified for zebrafish rbm47.

To reveal the spatio-temporal expression pattern of rbm47 during zebrafish embryogenesis, we

carried out whole-mount in situ hybridization on embryos at different developmental stages using

rbm47 ribo-probes. As shown in Fig. 1E, rbm47 is ubiquitously expressed from the one-cell stage

up to 24 hours post-fertilization (hpf). This expression pattern suggests that rbm47 plays an

important role in early stages of zebrafish development.

rbm47 is Involved in Zebrafish Head Development

In order to determine the role of rbm47 in development, zebrafish rbm47 was knocked down in

Page 5 of 28



evel

opm

enta

l Dyn

amic

s


6

developing embryos using antisense morpholino oligonucleotides. Two blocking morpholinos were

designed to target rbm47 RNA (Fig. 2A): MO-rbm47-ATG targets the start codon of rbm47 in exon

1, preventing translation initiation; MO-rbm47-E1I1 targets the exon-1/intron-1 boundary,

interfering with pre-mRNA splicing. Both MOs were fluorescently labeled to achieve direct

visualization upon microinjection. MO-rbm47-ATG was labeled with green fluorescein at the

carboxyl terminal, whereas MO-rbm47-E1I1 was tagged with fluorescently red lissamine. A

standard control oligo (MO-Ctrl), labeled with green fluorescein, was used as a control. RT-PCR

analysis of rbm47 mRNA from MO-injected embryos validated specific and effective

splice-blocking of the rbm47 transcript in MO-rbm47-E1I1-injected embryos (Fig. 2B).

Zebrafish embryos (n=500) at the 1- or 2-cell stage were microinjected with 5 ng

MO-rbm47-ATG, MO-rbm47-E1I1 or two MOs combined. 24 hours later, similar phenotypes were

observed in both MO-injected groups, characterized by defects in anterior head development.

Approximately 9-16% of MO-injected embryos lacked heads, demonstrating a headless phenotype

(Fig. 2C-b & c; Table 1), and 20-30% had reduced head development (Fig. 2C-d & e; Table 1),

while the embryos injected with MO-Ctrl developed normally (Fig. 2C and Table 1).

Next, we performed rescue experiments to test whether the headless phenotype is a specific

effect of rbm47 knockdown. Five pg rbm47 mRNA was co-injected with 10 ng MO-rbm47-E1I1

into zebrafish embryos. Examining the development of embryos at 2 hour intervals, the incidence of

the headless phenotype was reduced to ~2% (Fig. 2D and Table 1). This data suggests that rbm47

expression is required for head formation.

rbm47 Acts on Head Development through the Wnt8a Signaling Pathway

To reveal the molecular mechanism of rbm47 in regulation of zebrafish head development,

microarray gene expression analysis was performed on MO-rbm47 embryos. RNA was isolated

from MO-injected embryos (n=200 for each group) at 75% epiboly. The 75% epiboly stage is

characterized by anterior axial hypoblast development as the prechordal plate reaches the animal

pole. This occurs two hours prior to head-mesoderm formation, and we anticipate that genes critical

for head induction are expressed at this time point.

Page 6 of 28



evel

opm

enta

l Dyn

amic

s


7

The expression levels of 15,619 genes were probed and compared across groups. A minimum

4-fold decrease in expression was detected for 26 genes in both the MO-rbm47-ATG and

MO-rbm47-E1I1 groups compared to control MO injected embryos. Meanwhile, 20 genes had a

minimum 4-fold increase in expression as a result of rbm47 knockdown (Fig. 3A and Table 2).

Interestingly, the microarray analysis revealed that wnt8a expression was increased 1.4- and

2.3-fold in MO-rbm47-E1I1 and MO-rbm47-ATG fish, respectively, suggesting the involvement of

rbm47 in this major pathway of head development. Furthermore, gene expression profiling detected

upregulation of other genes involved in Wnt as well as BMP signaling, including gsk3a, otx2, and

chordin (Table 3).

To examine the involvement of Rbm47 in Wnt8a signaling, MO-rbm47 was co-injected with

MO-wnt8 to see whether wnt8 knockdown is capable of rescuing the morphant phenotype.

Co-injection dramatically decreased the incidence of the headless and small head phenotypes (Fig.

2D and Table 1), implying that Rbm47 does indeed function through the Wnt signaling pathway in

regulating head development and early embryonic patterning.

Among genes with altered expression levels, epithelial cell adhesion molecule (epcam) had the

highest upregulation, while alpha-2-macroglobulin-like (a2ml) was the most severely

downregulated (Table 2). epcam is a Wnt/β-catenin signaling target gene in hepatocellular

carcinoma cells (Yamashita et al., 2007). Human A2M is reportedly associated with Wnt/β-catenin

signaling (Lindner et al., 2010). These genes were chosen for qRT-PCR analysis to verify Rbm47’s

effect on gene expression. epcam expression was elevated ~4 fold following rbm47 knockdown (Fig.

3B), while the expression of a2ml was reduced to ~23% normal levels compared to the control MO

group (Fig. 3C).

Page 7 of 28



evel

opm

enta

l Dyn

amic

s


8

DISCUSSION

In the present study, we have characterized human and zebrafish RBM47 (Rbm47), and

investigated its role as a putative RNA binding protein involved in zebrafish embryogenesis. RBPs

mediate their effects by altering post-transcriptional events of specific gene transcripts. RBPs

interact with target transcripts through RNA binding domains, such as RNA Recognition Motifs.

Zebrafish Rbm47 possesses 3 RRMs with high homology to those found in the human orthologue.

We found that human RBM47 strongly interacts with poly-A, -C and -U RNAs, while binding with

poly-G RNA occurs with low affinity, demonstrating its ability to bind to RNA. RBM47 is not

capable of interaction with ssDNA. Additionally, we created a RBM47-GFP fusion protein to

determine its subcellular localization, which was found to be within the HeLa cell nuclei. Based on

this information, we propose that RBM47 is a novel RNA Binding Protein.

To characterize the spatio-temporal expression of rbm47, whole mount in situ hybridization for

rbm47 mRNA was performed on developing zebrafish embryos. rbm47 is expressed ubiquitously

throughout early embryonic development. To study its function during zebrafish development, we

used a morpholino-based knockdown approach to target either the rbm47 translation start codon or

exon-1/intron-1 splicing. We demonstrated that a high percentage of rbm47 knockdown embryos

had incomplete head formation or total loss of head development. This striking phenotype was

rescued upon co-injection of rbm47 mRNA, supporting our conclusion that defective head

development is a consequence of rbm47 knockdown, and that rbm47 expression is required for

normal head development.

Vertebrate head induction requires the concerted inhibition of both Wnt and BMP signaling

pathways (Glinka et al., 1997; Piccolo S, 1999). Indeed, the headless phenotype as a consequence

of single gene knockdown is an important observation that has only be seen as a result of altering

the regulation of a small set of master regulatory genes involved in early vertebrate development,

including foxA3 and gsc (Seiliez et al., 2006; Yao and Kessler, 2001), tcf3 (Kim et al., 2000), and

dkk1 (Glinka et al., 1998). Wnt8 is the key transcriptional motivator to act on the anterior

neuroectoderm from the lateral mesoderm to produce the Anterior-Posterior regional patterning of

the central nervous system (Erter et al., 2001). The graded Wnt8 activity mediates overall

Page 8 of 28



evel

opm

enta

l Dyn

amic

s


9

neuroectodermal posteriorization and thus determines the location of the midbrain-hindbrain

boundary organizer (Rhinn et al., 2005). Wnt8 expression is inhibited within the organizer, but is

found in the lateral margin of the zebrafish gastrula (Kim et al., 2000). Thus, excess Wnt8 activity

due to over-expression or loss of inhibition leads to loss of anterior structure. Our observation that

morpholino knockdown of rbm47 causes headless and reduced head phenotypes suggests that it

may act through a pathway involving Wnt8.

In investigating Rbm47’s mechanistic pathway, we used a microarray to screen the expression

levels of 15,619 zebrafish genes from rbm47 MO-knockdown embryos at 75% epiboly. We found

92 genes with increased expression in both splice- and translation-blocked knockdown groups,

compared to MO-control embryos, with 20 genes having a minimum 4-fold increase. epcam was

identified as the most up-regulated gene by this screen. epcam regulates cell adhesion, integrity,

plasticity and morphogenesis as a partner of E-cadherin during zebrafish epiboly and skin

development (Slanchev et al., 2009). Two Tcf-binding elements were identified in the epcam

promoter and epcam was found to be a Wnt-β-catenin target gene in hepatocellular carcinoma cells

(Yamashita et al., 2007). These findings support the idea that rbm47’s effect on head development

occurs through the canonical Wnt8 signaling pathway (Lu et al., 2011).

In accordance with this, rescue experiments demonstrated that a wnt8a-blocking morpholino

can partially rescue the rbm47 knockdown phenotype (Fig. 2). In addition to epcam, several other

genes involved in Wnt signaling were upregulated, including gsk3a, otx2, and chordin. This further

supports our conclusion that the effect of rbm47 knockdown on head development occurs through

an overactive Wnt pathway.

Meanwhile, of the genes with decreased expression, 26 exhibited a minimum 4-fold expression

reduction by microarray analysis, with a2ml being the most severely affected. qRT-PCR confirmed

reduced gene expression of a2ml in rbm47 knockdown embryos. A2M, the human homologue of

zebrafish a2ml, is a plasma protease inhibitor, cytokine carrier, and ligand for cell-signaling

receptors (Roberts, 1985). A2M in the human and rat brain is an acute-phase protein synthesized

primarily by astrocytes, and is associated with Alzheimer's disease due to its ability to mediate the

clearance and degradation of amyloid β (Cavus et al., 1996; Kovacs, 2000). The activated forms of

Page 9 of 28



evel

opm

enta

l Dyn

amic

s


10

A2M can bind to neurotrophic factors as well as directly inhibit neurotrophic factor-receptor signal

transduction to repress neurite outgrowth of central neurons (Hu and Koo, 1998; Koo and Liebl,

1992; Koo et al., 1994; Liebl and Koo, 1993). Most importantly, human A2M is reported to regulate

β-catenin signaling though the Wnt inhibitory co-receptor low-density lipoprotein receptor-related

protein-1 (LRP1) (Lindner et al., 2010). An A2M conformational intermediate is capable of

regulating peripheral nerve injury response by a mechanism that requires LRP1 (Arandjelovic et al.,

2007). These previous studies have demonstrated that A2M plays an essential role in neurogenesis.

In this study, zebrafish a2ml’s down-regulation by rbm47 knockdown provides an important insight

into the mechanism of rbm47 on development, suggesting that it is also involved in neural

development. However, to identify the RNA binding partners of rbm47, detailed mechanistic

evaluation is required in future investigations.

As Rbm47 is ubiquitously expressed during zebrafish embryonic development, the finding that

its knockdown results in a tissue-specific phenotype requires explanation. We hypothesize that the

rbm47 target gene(s) and/or its binding partner(s) are tissue-specific regulators. Our preliminary

study indeed demonstrates that a2ml is expressed in the anterior head region during embryonic

patterning by RNA in situ hybridization (data not shown).

In summary, the present study demonstrates that Rbm47 is a RNA binding protein that plays an

important role in head development during zebrafish embryogenesis.

Page 10 of 28



evel

opm

enta

l Dyn

amic

s


11

EXPERIMENTAL PROCEDURES

RNA and DNA Constructs:

RNA was extracted from zebrafish using the Illustra RNAspin mini isolation kit (GE Healthcare,

Little Chalfont, Buckinghamshire, UK). RNase-free DNase digestion was performed to eliminate

genomic DNA. RNA was reverse transcribed into cDNA using the Roche Reverse Transcription kit

(Roche Applied Science, Laval, Quebec, Canada). The full length cDNA of zebrafish rbm47 was

amplified by PCR from zebrafish cDNA and then subcloned into the pBluescriptII vector.

Determination of the Cellular Localization of Human RBM47

A pRMB47-GFP plasmid was built to express the RBM47-GFP fusion protein in cultured human

cell lines using pEGFP-C1 (Clontech, Mountainview, CA, USA) as the cloning vector. HeLa cells

were transfected with pRMB47-GFP or the control plasmid, pEGFP-C1, which expresses GFP from

the CMV promoter, using lipofectamine. The transfected cells were examined under a fluorescent

microscope (Leica-model DM IRB, Deerfield, IL, USA) 48 hours post transfection.

RNA Binding Assay

Individual RNA-Sepharose Beads (Sigma, St. Louis, MO, USA), poly (A), poly (G), poly (C), poly

(U), or single stranded DNA-sepharose beads were washed in a buffer containing 20 mM HEPES

pH 8.0, 20% glycerol, 100 mM KCl, 0.2 mM EDTA, 1mM DDT, 0.5 mM PMSF, and RNA-guard

at 38 units/ml, and packed in mini-columns. RBM47 produced from E. coli was loaded in each

column and washed with the same buffer. Proteins retained in the columns were separated by

PAGE.

Morpholino Embryo Injections

Morpholinos were purchased from Gene Tools, LLC (Philomath, Oregon, USA). Two experimental

morpholino oligos were designed to target the translation start codon and the first exon-intron

boundary of zebrafish rbm47 pre-mRNA. The experimental and control morpholino sequences are

Page 11 of 28



evel

opm

enta

l Dyn

amic

s


12

as follows:

MO-rbm47-ATG: 5’ CGGAGTCTTCTGCTGTCATTCTGAA 3’-carboxyfluorescein

MO-rbm47-E1I1: 5’ TGATTGTAACTAAGATTAACCTGAA 3’-lissamine

MO-wnt8a: 5’ ACGCAAAAATCTGGCAAGGGTTCAT 3’

Standard control: 5’ CTCTTACCTCAGTTACAATTTATA 3’–carboxyfluorescein

Morpholino oligonucleotides were solubilized in water at 1 mM. The resulting stock solution was

heated at 60 oC for 10 minutes and then diluted to working concentrations in sterile water before

injection. The yolks of embryos at the 1-2 cell stage were microinjected with a volume of 5 nl MO

(200 embryos/µl). Effective doses were determined separately for each morpholino.

mRNA Injections

pBluescript II SK(+)-RBM47 was linearized with Acc65I (Promega, Madison, WI, USA). Capped

mRNA was transcribed in vitro using T3 RNA polymerase (Roche Applied Science, Laval, Quebec,

Canada). Synthesized RBM47-RNA was purified by centrifugation through the Ambion NucAway

column (Ambion, Austin, TX, USA). The mRNA was co-injected into 1-2 cell stage embryos with

the indicated morpholino. Siblings from the same batch served as the internal control for these

experiments.

In situ Hybridization

Plasmid pBluescript II SK(+)-RBM47 was digested with BstXI (Fermentas, Ottawa, ON, Canada).

DIG-labeled RNA antisense RBM47 probes were synthesized in vitro using T7 RNA polymerase

(New England BioLabs, Ipswich, MA, USA) and digoxigenin-labeled UTP (Roche Applied Science,

Laval, Quebec, Canada). The sense probe was transcribed using T3 RNA polymerase (Roche

Applied Science, Laval, Quebec, Canada) and used as a negative control. The sizes of antisense and

sense probes are 821 bp and 988 bp, respectively. Whole-mount in situ hybridization was performed

as previously described (Jowett and Lettice, 1994; Jowett and Yan, 1996) .

Zebrafish Microarray

Page 12 of 28



evel

opm

enta

l Dyn

amic

s


13

Following microinjection, developing embryos were observed under the dissecting microscope, and

dead embryos were removed every 2 hours. At approximately 8 hours post-fertilization, we

carefully checked and harvested the embryos at 75% epiboly. 200 embryos of each group were

collected for RNA extraction. RNA was isolated using 1 mL Trizol (Invitrogen, Carlsbad, CA, USA)

per 100 embryos, according to the manufacturer’s protocol, followed by further purification using

the Illustra RNAspin mini isolation kit (GE Healthcare, Little Chalfont, Buckinghamshire, UK).

Prior to microarray analysis, RNA quality was determined on an Agilent 2100 RNA Bioanalyzer

(Agilent Technologies, Santa Clara, CA, USA). Finally, 1 µg RNA from each group was subjected

to microarray analysis at The Center for Applied Genomics (Hospital for Sick Children, Toronto,

ON, Canada)

RT-PCR and Real Time PCR

RNA was isolated using Trizol (Invitrogen, Carlsbad, CA, USA) extraction followed by Illustra

RNAspin purification. Total RNA (1 µg) was reverse transcribed using random hexamer primers

and SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA, USA), following the

manufacturer’s instructions. RNase-free DNase digestion was performed to eliminate genomic

DNA. A reverse-transcriptase negative control was also used to exclude genomic DNA

contamination. To confirm disruption of mRNA maturation using the splice-blocking morpholino

MO-rbm47-E1I1, two oligo primers across intron 1 were designed for RT-PCR. The primer

sequences are as follows:

Forward primer (F): 5’ ATGACAGCAGAAGACTCCGCCT 3’

Reverse primer (R): 5’ TCAGTAGGTCTGGTATACATCA 3’

For Real-Time PCR, 20 ng template cDNA was sequence using the ABI Prism 7700 sequence

detection system (Applied Biosystems, Foster City, CA, USA). For relative quantification analysis,

values of RNA expression were compared between groups after normalization with β-actin

expression. All measurements were performed as previously described (Livak and Schmittgen,

2001). Primers were designed by the Prism 7700 system and synthesized at The Center for Applied

Genomics (Hospital for Sick Children, Toronto, ON, Canada).

The primer sequences are as follows:

Page 13 of 28



evel

opm

enta

l Dyn

amic

s


14

z-epcam forward: 5’ CAAGACGAGCCATAACTTTATTTCAT 3’

z-epcam reverse: 5’ CAAACAAGGCAACTAAAACCTTCA 3’

z-a2ml forward: 5’ GGATCTGGGAGCTTGCTGAA 3’

z-a2ml reverse: 5’ CAAGTCGTGATGGTGTCAGGAA 3’

β-actin forward: 5’ CGAGCAGGAGATGGGAACC 3’

β-actin reverse: 5’ CAACGGAAACGCTCATTGC 3’

Statistical Analysis

Microinjected embryos were divided into four groups: headless, small head, abnormal trunk and tail,

and normal. Data was analyzed using Pearson’s chi-squared test, comparing the number of headless

fish to all other phenotypes (normal, abnormal trunk and tail, and small headed) across

morpholino-injected groups.

Page 14 of 28



evel

opm

enta

l Dyn

amic

s


15

ACKNOWLEDGEMENTS

We thank Drs. Ashley Bruce and Vince Tropepe of the Department of Cell and Systems Biology,

University of Toronto for helpful discussions of the project. Thanks to Dr. Bruce for reading the

manuscript with helpful comments and suggestions. We acknowledge the Canada Foundation for

Innovation (CFI) for infrastructural funding in support of the Zebrafish Core Facility at St.

Michael’s Hospital.

Page 15 of 28



evel

opm

enta

l Dyn

amic

s


16

REFERENCES

Allemand E, Guil S, Myers M, Moscat J, Caceres JF, Krainer AR (2005). Regulation of heterogenous nuclear ribonucleoprotein A1 transport by phosphorylation in cells stressed by

osmotic shock. Proc Natl Acad Sci U S A 102: 3605-10. Arandjelovic S, Dragojlovic N, Li X, Myers RR, Campana WM, Gonias SL (2007). A derivative of the plasma protease inhibitor alpha(2)-macroglobulin regulates the response to peripheral nerve injury. J Neurochem 103: 694-705. Beck AR, Miller IJ, Anderson P, Streuli M (1998). RNA-binding protein TIAR is essential for primordial germ cell development. Proc Natl Acad Sci U S A 95: 2331-2336. Bockbrader K, Feng Y (2008). Essential function, sophisticated regulation and pathological impact

of the selective RNA-binding protein QKI in CNS myelin development. Future Neurol 3: 655-668. Borozdin W, Bravo-Ferrer Acosta AM, Seemanova E, Leipoldt M, Bamshad MJ, Unger S et al (2006). Contiguous hemizygous deletion of TBX5, TBX3, and RBM19 resulting in a combined

phenotype of Holt-Oram and ulnar-mammary syndromes. Am J Med Genet A 140A: 1880-1886. Cavus I, Koo PH, Teyler TJ (1996). Inhibition of long-term potentiation development in rat

hippocampal slice by alpha 2-macroglobulin, an acute-phase protein in the brain. J Neurosci Res 43: 282-288. Chen J, Guo K, Kastan MB (2012). Interactions of nucleolin and ribosomal protein L26 (RPL26) in

translational control of human p53 mRNA. J Biol Chem 287: 16467-76. Colegrove-Otero LJ, Minshall N, Standart N (2005). RNA-binding proteins in early development. Crit Rev Biochem Mol Biol 40: 21-73. Dance GS, Sowden MP, Cartegni L, Cooper E, Krainer AR, Smith HC (2002). Two proteins essential for apolipoprotein B mRNA editing are expressed from a single gene through alternative

splicing. J Biol Chem 277: 12703-9. Erter CE, Wilm TP, Basler N, Wright CV, Solnica-Krezel L (2001). Wnt8 is required in lateral

mesendodermal precursors for neural posteriorization in vivo. Development 128: 3571-83. Gallouzi IE, Brennan CM, Steitz JA (2001). Protein ligands mediate the CRM1-dependent export of HuR in response to heat shock. RNA 7: 1348-61. Gerber WV, Vokes SA, Zearfoss NR, Krieg PA (2002). A role for the RNA-binding protein, hermes, in the regulation of heart development. Dev Biol 247: 116-126.

Page 16 of 28



evel

opm

enta

l Dyn

amic

s


17

Glinka A, Wu W, Delius H, Monaghan AP, Blumenstock C, Niehrs C (1998). Dickkopf-1 is a member of a new family of secreted proteins and functions in head induction. Nature 391: 357-362. Glinka A, Wu W, Onichtchouk D, Blumenstock C, Niehrs C (1997). Head induction by

simultaneous repression of Bmp and Wnt signalling in Xenopus. Nature 389: 517-9. Hu YQ, Koo PH (1998). Inhibition of phosphorylation of TrkB and TrkC and their signal

transduction by alpha2-macroglobulin. J Neurochem 71: 213-20. Jiang C, Baehrecke EH, Thummel CS (1997). Steroid regulated programmed cell death during

Drosophila metamorphosis. Development 124: 4673-4683. Jowett T, Lettice L (1994). Whole-mount in situ hybridizations on zebrafish embryos using a mixture of digoxigenin- and fluorescein-labelled probes. Trends Genet 10: 73-74. Jowett T, Yan YL (1996). Double fluorescent in situ hybridization to zebrafish embryos. Trends

Genet 12: 387-389. Kar A, Havlioglu N, Tarn WY, Wu JY (2006). RBM4 interacts with an intronic element and

stimulates tau exon 10 inclusion. J Biol Chem 281: 24479-88. Kim CH, Oda T, Itoh M, Jiang D, Artinger KB, Chandrasekharappa SC et al (2000). Repressor

activity of Headless/Tcf3 is essential for vertebrate head formation. Nature 407: 913-916. Koo PH, Liebl DJ (1992). Inhibition of nerve growth factor-stimulated neurite outgrowth by

methylamine-modified alpha 2-macroglobulin. J Neurosci Res 31: 678-92. Koo PH, Liebl DJ, Qiu WS, Hu YQ, Dluzen DE (1994). Monoamine-activated alpha 2-macroglobulin inhibits neurite outgrowth, survival, choline acetyltransferase, and dopamine concentration of neurons by blocking neurotrophin-receptor (trk) phosphorylation and signal

transduction. Ann N Y Acad Sci 737: 460-4.

Kovacs DM (2000). alpha2-macroglobulin in late-onset Alzheimer's disease. Exp Gerontol 35: 473-9. Lazarova DL, Spengler BA, Biedler JL, Ross RA (1999). HuD, a neuronal-specific RNA-binding protein, is a putative regulator of N-myc pre-mRNA processing/stability in malignant human

neuroblasts. Oncogene 18: 2703-10. Liebl DJ, Koo PH (1993). Serotonin-activated alpha 2-macroglobulin inhibits neurite outgrowth and

survival of embryonic sensory and cerebral cortical neurons. J Neurosci Res 35: 170-82.

Page 17 of 28



evel

opm

enta

l Dyn

amic

s


18

Lin JC, Hsu M, Tarn WY (2007). Cell stress modulates the function of splicing regulatory protein

RBM4 in translation control. Proc Natl Acad Sci U S A 104: 2235-40. Lin JC, Tarn WY (2005). Exon selection in alpha-tropomyosin mRNA is regulated by the antagonistic action of RBM4 and PTB. Mol Cell Biol 25: 10111-21. Lindner I, Hemdan NY, Buchold M, Huse K, Bigl M, Oerlecke I et al (2010). Alpha2-macroglobulin inhibits the malignant properties of astrocytoma cells by impeding

beta-catenin signaling. Cancer Res 70: 277-87. Livak KJ, Schmittgen TD (2001). Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25: 402-408. Lorenzen JA, Bonacci BB, Palmer RE, Wells C, Zhang J, Haber DA et al (2005). Rbm19 is a nucleolar protein expressed in crypt/progenitor cells of the intestinal epithelium. Gene Expr

Patterns 6: 45-56. Lu FI, Thisse C, Thisse B (2011) Identification and mechanism of regulation of the zebrafish dorsal

determinant, Proc Natl Acad Sci U S A 108:15876-15880 Lunde BM, Moore C, Varani G (2007). RNA-binding proteins: modular design for efficient function.

Nat Rev Mol Cell Biol 8: 479-90. Maragh S, Miller RA, Bessling SL, McGaughey DM, Wessels MW, de Graaf B et al (2011). Identification of RNA binding motif proteins essential for cardiovascular development. BMC Dev

Biol 11: 62. Markus MA, Heinrich B, Raitskin O, Adams DJ, Mangs H, Goy C et al (2006). WT1 interacts with the splicing protein RBM4 and regulates its ability to modulate alternative splicing in vivo. Exp Cell

Res 312: 3379-88. Markus MA, Morris BJ (2006). Lark is the splicing factor RBM4 and exhibits unique subnuclear localization properties. DNA Cell Biol 25: 457-64. Markus MA, Morris BJ (2009). RBM4: a multifunctional RNA-binding protein. Int J Biochem Cell

Biol 41: 740-3. Mayer AN, Fishman MC (2003). Nil per os encodes a conserved RNA recognition motif protein required for morphogenesis and cytodifferentiation of digestive organs in zebrafish. Development 130: 3917-28. Mourtada-Maarabouni M, Williams GT (2002). RBM5/LUCA-15--tumour suppression by control of apoptosis and the cell cycle? ScientificWorldJournal 2: 1885-90.

Page 18 of 28



evel

opm

enta

l Dyn

amic

s


19

Nagai K, Oubridge C, Jessen TH, Li J, Evans PR (1990). Crystal structure of the RNA-binding domain of the U1 small nuclear ribonucleoprotein A. Nature 348: 515-20. Piccolo S AE, Leyns L, Bhattacharyya S, Grunz H, Bouwmeester T, De Robertis EM (1999). The

head inducer Cerberus is a multifunctional antagonist of Nodal, BMP and Wnt signals. Nature 397: 707-710. Rhinn M, Lun K, Luz M, Werner M, Brand M (2005). Positioning of the midbrain-hindbrain boundary organizer through global posteriorization of the neuroectoderm mediated by Wnt8

signaling. Development 132: 1261-72. Roberts RC (1985). Protease inhibitors of human plasma. Alpha-2-macroglobulin. J Med 16: 129-224. Rowe TM, Rizzi M, Hirose K, Peters GA, Sen GC (2006). A role of the double-stranded

RNA-binding protein PACT in mouse ear development and hearing. Proc Natl Acad Sci U S A 103: 5823-5828. Ruiz-Echevarria MJ, Yasenchak JM, Han X, Dinman JD, Peltz SW (1998). The upf3 protein is a component of the surveillance complex that monitors both translation and mRNA turnover and

affects viral propagation. Proc Natl Acad Sci U S A 95: 8721-6. Ruskin B, Zamore PD, Green MR (1988). A factor, U2AF, is required for U2 snRNP binding and

splicing complex assembly. Cell 52: 207-19. Seiliez I, Thisse B, Thisse C (2006). FoxA3 and goosecoid promote anterior neural fate through

inhibition of Wnt8a activity before the onset of gastrulation. Dev Biol 290: 152-163. Slanchev K, Carney TJ, Stemmler MP, Koschorz B, Amsterdam A, Schwarz H et al (2009). The epithelial cell adhesion molecule EpCAM is required for epithelial morphogenesis and integrity

during zebrafish epiboly and skin development. PLoS Genet 5. Spemann H MH (1924). Über Induktion von Embryonalanlagen durch Implantation artfremder Organisatoren. Arch Mikrosk Anat Entwicklungsmechan 100: 599–638. Tarun SZ, Jr., Sachs AB (1996). Association of the yeast poly(A) tail binding protein with translation initiation factor eIF-4G. EMBO J 15: 7168-77. Trzcinska-Daneluti AM, Gorecki A, Czubaty A, Kowalska-Loth B, Girstun A, Murawska M et al (2007). RRM proteins interacting with the cap region of topoisomerase I. J Mol Biol 369: 1098-112. van Venrooy S, Fichtner D, Kunz M, Wedlich D, Gradl D (2008). Cold-inducible RNA binding

Page 19 of 28



evel

opm

enta

l Dyn

amic

s


20

protein (CIRP), a novel XTcf-3 specific target gene regulates neural development in Xenopus. BMC

Dev Biol 8: 77. Weiner AM, Sdrigotti MA, Kelsh RN, Calcaterra NB (2011). Deciphering the cellular and molecular roles of cellular nucleic acid binding protein during cranial neural crest development.

Dev Growth Differ 53: 934-47. Yamashita T, Budhu A, Forgues M, Wang XW (2007). Activation of hepatic stem cell marker

EpCAM by Wnt-beta-catenin signaling in hepatocellular carcinoma. Cancer Res 67: 10831-10839. Yaniv K, Fainsod A, Kalcheim C, Yisraeli JK (2003). The RNA-binding protein Vg1 RBP is

required for cell migration during early neural development. Development 130: 5649-61. Yao J, Kessler DS (2001). Goosecoid promotes head organizer activity by direct repression of Xwnt8 in Spemann's organizer. Development 128: 2975-2987. Zhang J, Tomasini AJ, Mayer AN (2008). RBM19 is essential for preimplantation development in

the mouse. BMC Dev Biol 8: 115-115.

Page 20 of 28



evel

opm

enta

l Dyn

amic

s


21

FIGURE LEGENDS

Figure 1: Characterization of human and zebrafish RBM47. A. Diagrammatic representation of

human and zebrafish RBM47 (Rbm47) proteins (not to scale). Human RBM47 gene encodes two

alternatively spliced transcripts, resulting in two protein isoforms a and b. The grey box indicates

the non-homology region resulting from alternative splicing. Zebrafish rbm47 gene encodes only

one isoform. All proteins possess three RRM domains. B. Sequence alignment of highly conserved

regions of human and zebrafish RBM47 (Rbm47) RRMs. The zebrafish Rbm47 RRM has 90%

sequence identity compared with those of the human orthologue. C. HeLa cells transfected with

RBM47-GFP fusion plasmid express RBM47 in the nucleus, compared to control-transfected cells

that express GFP throughout the cell. D. The RNA binding assay demonstrates RBM47’s ability to

bind poly-A, -U and -C RNA, while weakly binding poly-G RNA, and having no affinity for

ssDNA as shown in lane S. E. rbm47 is expressed ubiquitously during zebrafish embryogenesis, as

shown by whole mount in situ hybridization. Scale bar = 200 µm.

Figure 2: rbm47 knockdown in developing zebrafish embryos disrupts head formation. A. Two

morpholino knockdown strategies were used to disrupt rbm47 function. MO-rbm47-ATG hybridizes

to the start codon, preventing translation initiation. MO-rbm47-E1I1 hybridizes to the

exon-1/intron-1 splice donor site, blocking splicing to exon 2. Schematic drawing is not to scale. B.

RT-PCR was used to show interrupted splicing of RNA extracted from MO-rbm47-E1I1 zebrafish,

which amplifies a band of approximately 3.5kb due to retention of intron 1. PCR cycles: lane 1 (34

cycles); lane 2 (30 cycles); lane 3 (30 cycles). C. Upper panels demonstrate typical loss of head

phenotype in rbm47 knockdown zebrafish (b and c) and a control zebrafish injected with control

morpholino (a). The lower panels depict typical small head phenotypes in MO-rbm47 injected fish

(d and e). Scale bar = 200 µm. D. The incidence of total loss of head development in

morpholino-injected zebrafish. Injection of morpholinos targeting rbm47 resulted in a 9-16%

incidence of the headless phenotype. Co-injection of rbm47 mRNA or wnt8a blocking morpholino

with rbm47 blocking morpholino resulted in a decreased incidence of headlessness (for detailed

Page 21 of 28



evel

opm

enta

l Dyn

amic

s


22

numbers and statistics, see Table 1).

Figure 3: RNA microarray to identify candidate rbm47 target genes. A. 20 genes were found to

be up-regulated and 26 genes were found to be down-regulated by at least 4-fold as shown on the

left and right side of the graph respectively. B & C. Confirmation of the most significantly up- and

down-regulated genes by real-time RT-PCR (epcam and a2ml).

Page 22 of 28



evel

opm

enta

l Dyn

amic

s


23

TABLE 1. Phenotype Summary of Zebrafish Embryos from rbm47 Morpholino Knockdown

Phenotype classes

Morpholinos small abnormal

trunk & tail

P value

headless head normal n= headless versus

Standard control 0±0% 0 6% 94% 240

MO-ATG 9±0.87%a 30% 14% 47% 500 1.62E-6 MO-CTRL

MO-E1I1 12±2.29%a 20% 15% 53% 500 2.16E-8 MO-CTRL

MO-ATG+MO-E1I1 16±1.28%a 30% 15% 39% 150 1.59E-10 MO-CTRL

MO-E1I1+ RNA 2±1.35%a 9% 6% 83% 150 2.83E-4 MO-E1I1

MO-E1I1+MO-wnt8 2±1.10%a 12% 6% 80% 150 2.83E-4 MO-E1I1

a – denotes standard error

Page 23 of 28



evel

opm

enta

l Dyn

amic

s


24

TABLE 2. Significantly Changes in Gene Expression Identified by Microarray Analysis

Gene name Access #

Fold change

MO-rbm47-E1I1 MO-rbm47-ATG

epithelial cell adhesion molecule (epcam) BQ262802 255.93 211.44

Wingless homolog (Drosophila) (wls) BM775264 182.53 388.67

kelch repeat and BTB (POZ) domain containing 10b

AI641542 43.4 56.3

calpain 8 AW233616 47.1 43.9

methionine-R-sulfoxide reductase B1 AA497219 16.33 8.76

hedgehog acyltransferase-like,b AI626348 10.72 15.12

alpha-2-macroglobulin-like (a2ml) AI793675 -53.5 -95.4

HORMA domain-containing protein BM316732 -9.6 -106.8

solute carrier family 20, member 1a AW077636 -27.4 -34.3

heat shock factor binding protein 1-like BM530302 -13.6 -10.9

apolipoprotein A-IV AI545593 -5.2 -6.8

annexin A2b BC153582 -3.0 -8.9

LIM domain only 7a BM279822 -4.5 -6.3

Page 24 of 28



evel

opm

enta

l Dyn

amic

s


25

TABLE 3. Microarray Profiling of BMP and Wnt Pathway Genes Following rbm47

Knockdown

Gene name

MO-E1I1

MO-ATG

Goosecoid -a -

Sonic hedgehog - -

Chordin - I,1.2

Follistatin - -

Noggin - -

Tcf3 - -

Dickkopf-1 - -

Pax2, pax6 - -

Otx2 - I,1.7b

Lmo-1 - -

Gsk3a I,1.9 I,2.6

Gsk3b - -

Wnt8a I,1.4 I,2.3

Wnt8b - -

Wnt-1 - -

Wnt2 - -

Wnt4 - -

Wnt5 - -

Wnt-10 - -

Wnt-11 - -

a _ denotes non-changed b “I” denotes that the gene is increased, expressed as a fold-change value

Page 25 of 28



evel

opm

enta

l Dyn

amic

s

Figure 1: Characterization of human and zebrafish RBM47. A. Diagrammatic representation of human and zebrafish RBM47 (Rbm47) proteins (not to scale). Human RBM47 gene encodes two alternatively spliced transcripts, resulting in two protein isoforms a and b. The grey box indicates the non-homology region

resulting from alternative splicing. Zebrafish rbm47 gene encodes only one isoform. All proteins possess three RRM domains. B. Sequence alignment of highly conserved regions of human and zebrafish RBM47

(Rbm47) RRMs. The zebrafish Rbm47 RRM has 90% sequence identity compared with those of the human orthologue. C. HeLa cells transfected with RBM47-GFP fusion plasmid express RBM47 in the nucleus, compared to control-transfected cells that express GFP throughout the cell. D. The RNA binding assay

demonstrates RBM47’s ability to bind poly-A, -U and -C RNA, while weakly binding poly-G RNA, and having no affinity for ssDNA as shown in lane S. E. rbm47 is expressed ubiquitously during zebrafish

embryogenesis, as shown by whole mount in situ hybridization. Scale bar = 200 µm. 114x226mm (300 x 300 DPI)

Page 26 of 28



evel

opm

enta

l Dyn

amic

s

Figure 2: rbm47 knockdown in developing zebrafish embryos disrupts head formation. A. Two morpholino knockdown strategies were used to disrupt rbm47 function. MO-rbm47-ATG hybridizes to the start codon,

preventing translation initiation. MO-rbm47-E1I1 hybridizes to the exon-1/intron-1 splice donor site,

blocking splicing to exon 2. Schematic drawing is not to scale. B. RT-PCR was used to show interrupted splicing of RNA extracted from MO-rbm47-E1I1 zebrafish, which amplifies a band of approximately 3.5kb

due to retention of intron 1. PCR cycles: lane 1 (34 cycles); lane 2 (30 cycles); lane 3 (30 cycles). C. Upper panels demonstrate typical loss of head phenotype in rbm47 knockdown zebrafish (b and c) and a control

zebrafish injected with control morpholino (a). The lower panels depict typical small head phenotypes in MO-rbm47 injected fish (d and e). Scale bar = 200 µm. D. The incidence of total loss of head development in morpholino-injected zebrafish. Injection of morpholinos targeting rbm47 resulted in a 9-16% incidence of the headless phenotype. Co-injection of rbm47 mRNA or wnt8a blocking morpholino with rbm47 blocking

morpholino resulted in a decreased incidence of headlessness (for detailed numbers and statistics, see Table 1).

Page 28 of 28



evel

opm

enta

l Dyn

amic

s

Figure 3: RNA microarray to identify candidate rbm47 target genes. A. 20 genes were found to be up-regulated and 26 genes were found to be down-regulated by at least 4-fold as shown on the left and right side of the graph respectively. B & C. Confirmation of the most significantly up- and down-regulated genes

by real-time RT-PCR (epcam and a2ml). 114x131mm (300 x 300 DPI)

Page 30 of 28



evel

opm

enta

l Dyn

amic

s

Documents

rbm47 , a novel RNA binding protein, regulates zebrafish head development