Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Ökologischen Landbau und Pflanzenbausysteme
Interkingdom signaling:
The role of homoserine lactones in early responses and
resistance in barley (Hordeum vulgare L.)
Simone Corinna Rankl
Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan
für Ernährung, Landnutzung und Umwelt der Technischen Universität München
zur Erlangung des akademischen Grades eines
Doktors der Naturwissenschaften
genehmigten Dissertation.
Vorsitzender: Univ.-Prof. Dr. J. Schnyder
Prüfer der Dissertation: 1. apl. Prof. Dr. P. Schröder
2. Univ.-Prof. Dr. R. Hückelhoven
Die Dissertation wurde am 27.12.2016 bei der Technischen Universität München
eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für
Ernährung, Landnutzung und Umwelt am 13.02.2017 angenommen.
PUBLICATIONS
Rankl, S., Gunsé, B., Sieper, T., Schmid, C., Poschenrieder, C., Schröder, P. Microbial
homoserine lactones (AHLs) are effectors of root morphological changes in barley. Plant
Science (2016) 253: 130-140.
Gunsé, B., Poschenrieder, C., Rankl, S., Schröder, P., Rodrigo-Moreno, A., Barceló, J. A
highly versatile and easily configurable system for plant electrophysiology. MethodsX (2016)
25: 436-451.
TABLE OF CONTENTS
1 INTRODUCTION .......................................................................................................................... 1
1.1 Plant-microbe interactions in the rhizosphere .................................................................. 1
1.1.1 The rhizosphere and its underground inhabitants ................................................... 1
1.1.2 Interkingdom signaling and the involvement of quorum sensing .......................... 5
1.2 The plant immune system ................................................................................................. 10
1.3 Systemic resistance ........................................................................................................... 12
1.3.1 Systemic acquired resistance ................................................................................... 12
1.3.2 Induced systemic resistance ..................................................................................... 13
1.4 Barley (Hordeum vulgare L.) ............................................................................................. 14
1.5 Objectives ............................................................................................................................ 16
2 MATERIALS AND METHODS .................................................................................................. 17
2.1 Materials ............................................................................................................................... 17
2.1.1 Plant material ............................................................................................................... 17
2.1.2 Pathogens .................................................................................................................... 17
2.1.3 N-acyl-D/L-homoserine lactones .............................................................................. 17
2.1.4 Media ............................................................................................................................ 17
2.2 Methods ................................................................................................................................ 19
2.2.1 Surface sterilization .................................................................................................... 19
2.2.2 Plant growth systems and conditions ...................................................................... 20
2.2.3 Treatment of barley with AHLs ................................................................................. 22
2.2.4 Root morphology, fresh and dry weight determination ......................................... 22
2.2.5 Nitric oxide determination in root tissue .................................................................. 22
2.2.6 Cell viability assay ...................................................................................................... 23
2.2.7 Microelectrode ion flux measurements .................................................................... 23
2.2.8 Membrane potential measurements ........................................................................ 25
2.2.9 RNA Extraction ............................................................................................................ 26
2.2.10 RNA sequencing ......................................................................................................... 26
2.2.11 Bioinformatic analysis of gene expression .............................................................. 27
2.2.12 cDNA synthesis ........................................................................................................... 27
2.2.13 Primer design .............................................................................................................. 27
2.2.14 Quantitative real-time-PCR analysis ........................................................................ 29
2.2.15 Sequencing of qRT-PCR products ........................................................................... 29
2.2.16 Phytohormone determination .................................................................................... 30
2.2.17 Flavonoid determination ............................................................................................ 32
2.2.18 Preparation of protein crude extract ........................................................................ 32
2.2.19 Enzyme activity measurement .................................................................................. 33
2.2.20 Bacterial inoculation and pathogen infection assay .............................................. 33
3 RESULTS..................................................................................................................................... 35
3.1 Impact of AHLs on the morphology of barley plants ..................................................... 35
3.1.1 Fresh and dry weight determination of root and shoot ......................................... 35
3.1.2 Root parameters ......................................................................................................... 36
3.2 AHL induced reactions in root tissue ............................................................................... 39
3.2.1 Nitric oxide production in the root of barley ............................................................ 39
3.2.2 Investigation of the cell viability ................................................................................ 41
3.2.3 Influence of AHLs on the potassium budget of root epidermal cells ................... 43
3.2.4 Manipulation of the membrane potential by AHL application ............................... 44
3.3 AHL induced reactions in the shoot ................................................................................. 46
3.3.1 Transcriptome analysis of leaf tissue ...................................................................... 46
3.3.2 Influence of short- and long-chain AHLs on phytohormone levels...................... 57
3.3.3 Flavonoid contents in barley leaves after AHL treatments ................................... 60
3.3.4 Short-term kinetic of phenylalanine ammonia lyase activity ................................ 61
3.3.5 Pathogen infection assay with Xanthomonas translucens pv. cerealis .............. 62
4 DISCUSSION .............................................................................................................................. 64
4.1 AHL-mediated effects on barley’s root tissue ................................................................. 64
4.1.1 Growth inducing effects of AHLs .............................................................................. 64
4.1.2 AHLs induce a K+ uptake in barley roots ................................................................. 67
4.1.3 AHLs force a membrane hyperpolarization in epidermal root cells .................... 70
4.1.4 AHL-induced NO accumulation in barley roots ...................................................... 75
4.1.5 Cell viability .................................................................................................................. 78
4.2 AHL induced reactions in the upper plant part ............................................................... 79
4.2.1 Defense compounds and plant phytohormones in ISR ........................................ 79
4.2.2 Differential gene regulation after AHL application ................................................. 84
4.2.3 AHL induced systemic resistance against Xanthomonas translucens ............... 92
4.3 Big picture and future perspectives.................................................................................. 96
5 SUMMARY/ ZUSAMMENFASSUNG ...................................................................................... 98
6 REFERENCES .......................................................................................................................... 100
7 APPENDIX ................................................................................................................................. 123
LIST OF FIGURES AND TABLES
Figures:
Figure 1.1 Forms of PGPR processes in the rhizosphere .............................................................. 3
Figure 1.2 Structure of a quorum sensing molecule and the molecular mechanism of QS in Vibrio
fischeri. ................................................................................................................................... 6
Figure 1.3 Summarizing model of the impact of AHLs on plants.. ................................................... 8
Figure 1.4 The ‚zigzag‘-model describing the amplitude of plant-defense pathogen-attack antagonism.
.............................................................................................................................................11
Figure 2.1 Different growth systems for barley plants. ..................................................................20
Figure 2.2 Structure of the “glass bowl system”. ..........................................................................21
Figure 2.3 Representation of the net K+ measurement of barley roots ............................................24
Figure 2.4 Raw data of K+ ion flux measurement. ........................................................................25
Figure 2.5 Processed flow estimation taken from the potassium ion flux measurement in figure 2.4. .25
Figure 3.1 Influence of C8- and C12-HSL application on the fresh and dry weights of barley roots and
shoots ...................................................................................................................................36
Figure 3.2 Influence of C8- and C12-HSL application on different root parameters of barley .............37
Figure 3.3 Developmental response of barley roots to AHL treatment. ...........................................38
Figure 3.4 Schematic diagram of NO determination in excised barley roots ....................................39
Figure 3.5 AHL treatment causes NO accumulation in excised barley roots....................................40
Figure 3.6 Effect of AHLs on NO accumulation in excised barley roots. .........................................41
Figure 3.7 Vital staining of excised barley roots after different growing conditions and
treatments………………………………………… ................................................................................ …42
Figure 3.8 10 µM C8-HSL induces K+ influx in intact barley roots. .................................................43
Figure 3.9 C12-HSL induces K+ influx in intact barley roots...........................................................44
Figure 3.10 Membrane hyperpolarization of root epidermal cell treated with 10 µM C8- HSL. ...........45
Figure 3.11 Transcriptome mapping of total reads per treatment and time point classified in mapped
and not mapped reads. ............................................................................................................47
Figure 3.12 Overview of the transcriptional reprogramming of barley leaves after application of short-
and long-chain AHLs for 6, 12, and 24 h. ...................................................................................50
Figure 3.13 Statistically significant GO-term distribution of barley genes differentially regulated in
response to AHL treatments. ....................................................................................................52
Figure 3.14 Transcript accumulation of bHLH DNA-binding protein, chitinase, chaperon protein DnaJ
(HSP40), subtilisin-chymotrypsin inhibitor, 60 kDa jasmonate-induced protein (JIP60), and the leaf-
specific thionin in leaves of 10-day-old barley plants ....................................................................56
Figure 3.15 SA content of barley leaves after 4, 8, 12, and 24 h of control, 10 µM C8- or C12-HSL
treatment ...............................................................................................................................57
Figure 3.16 Contents of JA and JA-Ile in barley leaves after 4, 10, and 22 h of control, 10 µM C8- or
C12-HSL application ...............................................................................................................58
Figure 3.17 ABA content of barley leaves after 4, 10, and 22 h of control, 10 µM C8-, or C12-HSL
application..............................................................................................................................59
Figure 3.18 Content of the flavonoids lutonarin and saponarin in barley leaves after control, 72 h, and
96 h of 10 µM AHL treatment. ...................................................................................................60
Figure 3.19 Phenylalanine ammonia lyase activity in leaves after incubation with 10 µM C8- and C12-
HSL .......................................................................................................................................61
Figure 3.20 Kinetics of Xanthomonas translucens pv. cerealis titer in barley leaves after 24, 48, 72,
and 96 h of control or AHL application .......................................................................................63
Figure 4.1 AHL application leads to root and leaf growth induction and root system augmentation ....67
Figure 4.2 Schematic illustration of a proposed model for regulating K+ uptake by AHLs in a barley root
epidermal cell. ........................................................................................................................73
Figure 4.3 Prospective model summarizing defense compounds involvement in ISR after AHL
application. .............................................................................................................................83
Figure 4.4 Expression of AHL responsive genes in barley leaves ..................................................91
Figure 4.5 Model summarizing AHL induced reactions in barley. ...................................................96
Figure 7.1 Multi-dimensional scaling plot of RNA-seq data from 3 different treatments (control (D), C8-
and C12-HSL). ..................................................................................................................... 124
Tables:
Table 2-1 Used media with listed ingredients ..............................................................................18
Table 2-2 Primers used for qRT-PCR ........................................................................................28
Table 3-1 Genes differentially regulated and used for the expression analysis via qRT-PCR ............53
Table 3-2 Comparison of transcript levels analysed by RNA seq and qRT-PCR ..............................55
Table 4-1 Auxin dependent and independent reactions in plants induced by different AHL derivatives
.............................................................................................................................................75
Table 7-1 Genes commonly regulated after C8- and C12-HSL treatment.. ................................... 125
Table 7-2 Annotation result of the RNA seq of all treatments and time points ............................... 128
Abbreviations A ampere
ABA abscisic acid
ACC 1-aminocyclopropane-1-carboxylate
AHL N-acyl-D/L-homoserine lactone
Avr avirulence
BABA β-aminobutyric acid
bHLH basic helix-loop-helix
bit binary digit
bn billion
bp base pair
BTH benzothiadiazole
C carbon
cDNA complementary deoxyribonucleic acid
CDS coding sequence
CFU colony forming units
cPTIO 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-
oxide
DAF-FM diacetate 4-amino-5-methylamino-2',7'-difluorofluorescein diacetate
DAMPs damage-associated molecular patterns
DMSO dimethyl sulfoxide
DPBS Dubelcoo´s phosphate buffered saline
dpi dots per inch
EF-TU elongation factor Tu
Em membrane potential
ETI effector-triggered immunity
ETS effector-triggered susceptibility
FDA fluorescein diacetate
FDR false discovery rate
fig. figure
flg22 flagellin
fwd forward
g gram or g-force
GO gene ontology
GOI genes of interest
GPCR G-protein-coupled receptor
h hour
H2Odist. distilled water
HMGU Helmholtz Zentrum München Deutsches Forschungszentrum
für Gesundheit und Umwelt
hpi hours past AHL incubation
HPLC high performance liquid chromatography
HSL homoserine lactone
HSP heat shock protein
INA 2,6-dichloroisonicotinic acid
ISR induced systemic resistance
JA jasmonic acid
JA-Ile jasmonic acid isoleucine
JIP jasmonate-inducible protein
kDa kilo dalton
K+ potassium
l liter
LC–ESI–MS/MS liquid chromatography-electrospray ionization-tandem mass
spectrometry
LPS lipopolysaccharides
LRR-RLK leucine-rich repeat receptor-like kinases
M molar
m milli or meter
m2 square meter
MAMPs microbial-associated molecular patterns
MAPKs mitogen-activated protein kinases
mg milligram
MIFE microelectrode ion flux estimation
min minute
N nitrogen
NAE N-acylethanolamines
ng nanogram
nkat nanokatal
nm nanometer
nmol nanomolar
NO nitric oxide
NPR1 nonexpressor of pathogenesis- related genes
OD optical density
OPDA oxophytodienoic acid
P phosphorus
PAL phenylalanine ammonia lyase
PAMPs pathogen-associated molecular patterns
PGPR plant-growth-promoting-rhizobacteria
PI propidium iodide or protease inhibitor
pmol picomol
ppb parts per billion
PR pathogenesis related
PRR pattern recognition receptors
psi pound per square inch
PTI PAMP-triggered immunity
pv. pathovar
qRT-PCR quantitative real-time polymerase chain reaction
R resistance
rev reversed
RIP ribosome inactivating protein
RNA seq ribonucleic acid sequencing
ROS reactive oxygen species
RT room temperature
s second
SA salicylic acid
SAR systemic acquired resistance
SNP sodium nitroprusside
TIF tagged image file format
TSA tryptone soya agar
UAB Universitat Autònoma de Barcelona
UPLC-MS/MS ultra-performance liquid chromatography-tandem mass
spectrometry
V volt
v/v volume/volume
W watt
w/v weight/volume
Xtc Xanthomonas translucens pv. cerealis
µ micro
ε epsilon
⌀ diameter
°C degree Celsius
INTRODUCTION
1
1 INTRODUCTION
One of the major challenges of the 21st century is to feed the global human population. In
2015, the population reached 7.34 bn people and the worldwide production of maize, rice,
and wheat was 1 bn, 7.38 M, and 7.28 M tons, respectively (FAOSTAT). There is a need to
increase agricultural productivity and to render plants more resistant in this complex network
“environment”, where they undergo various biotic and abiotic stresses. Quite frequently the
usage of chemical fertilizers, pesticides, and other supplements doesn´t lead to the desired
goal because resistant pathogens spread and also reduce the quantity and quality of the
yield. Also, these agents are potentially harmful chemicals to humans and environment.
Therefore, the reduction of the environmental exposure to these potentially dangerous
chemicals is an important approach. For this, the treatment with positively operating
microbial derived signaling compounds, namely N-acyl-D/L-homoserine lactones (AHLs),
which are in the focus of this thesis, may be a welcome and applicable alternative for
sustainable food production. The investigation of the consequences of their application and
the explanation of the underlying mechanism and signaling pathways could be the foundation
of a new and environmentally compatible alternative to increase plant health and to restrict
disease spreading.
1.1 Plant-microbe interactions in the rhizosphere
1.1.1 The rhizosphere and its underground inhabitants
In the beginning of the 20th century, Lorenz Hiltner, a pioneer in soil bacteriology and
rhizosphere investigation, reported the rhizosphere effect in a lecture titled “On new
experiences and problems in the field of soil bacteriology with special reference to green
manure and fallow” (Verbon and Liberman, 2016). He characterized the term “rhizosphere”
as the soil zone that is directly modified by roots and its exudates (Hartmann et al., 2008).
The rhizosphere comprises the root epidermis, lateral roots, and root hairs with the mucus
layer plus the soil region that circumvents the root within a radius of a few millimeters
(Belandreau and Knowles, 1978). Hence, the rhizosphere plays host to complex root-root,
root-insect, and root-microbe interactions, which can be found to be both beneficial or
detrimental (Bais et al., 2006). This region is of significant importance for the sessile plant
because besides the aforementioned interactions also a nutritive and feeding aspect is part
of it. Further on, characterizations of the rhizosphere microbiomes and soil properties
showed that they differ strongly from those of bulk soil, indicating a high impact of the plant
INTRODUCTION
2
species on bacterial community composition (Berg et al., 2014). The bacterial populations
housing in the rhizosphere are denser than those residing in bulk soils, with the rich microbial
community in the rhizosphere reaching between 1010 and 1012 bacteria per gram of soil
(Nihorimbere et al., 2011). The term “rhizosphere effect” describes the attraction of a larger
number of microorganisms along the root by the nutrient secretion of plants (Hartmann et al.,
2008). Indeed, plants directly and indirectly manage and shape their own microbiome and
attract various bacteria, nematodes, fungi, and viruses by rhizodeposits, including exudates,
mucilage, and detached root material (Philippot et al., 2013). The composition and level of
exudates is dependent on the plant’s growth and health status, the plant cultivar, the
surrounding soil type, and soil conditions. Additionally, the excretion of exudates is
heterogeneous along the root and certain root zones differ strongly in their exudation pattern,
which leads to the formation of bacterial hotspots in the rhizosphere (Compant et al., 2010).
The density of the microflora is not static and is subject to temporal fluctuations, which is
described by the model of wave-like oscillations, as a result of alterable organic carbon
supply, bacterial growth, and death cycle (Semenov et al., 1999). Rudrappa et al. (2008)
recently demonstrated that Pseudomonas syringae pv. tomato DC3000 infected A. thaliana
increased the exudation of malic acid, which attracted the beneficial rhizobacterium Bacillus
subtilis to colonize the rhizosphere. This example demonstrates that the rhizomicrobiome is
directly influenced by the plant exudates and that plants, despite their sessile lifestyle,
actively contribute to their survival.
However, besides maintaining a nutrient-rich environment, plant roots communicate
with rhizobacteria by producing signals that are recognized by the microbes, which in turn
extrude signals to initiate colonization. Beneficial underground interactions include symbiotic
interactions with arbuscular mycorrhizal fungi, symbiotic-nitrogen-fixing bacteria, and root
colonization by beneficial microbes referred to as plant-growth-promoting-rhizobacteria
(PGPRs, Pérez-Montaño et al., 2014). A common example describing the concept of
PGPRs, are the nitrogen-fixing rhizobacteria that provide the legume plant with nitrogen in
nitrogen-poor environments, while in return the nodules of the host plant present a habitat
with excellent nutrient supply for the bacteria (Brencic and Winans, 2005). Therefore, host
and microbial visitor profit from each other. Typical PGPR strains proven on crop plants
comprise Arthrobacter, Azotobacter, Azospirillum, Bacillus, Burkholderia, Pseudomonas and
Serratia (Pérez-Montaño et al., 2014). To be classified as a typical PGPR strain the following
attributes have to be valid: (i) colonization-ability of the root surface (ii) survival, proliferation
and challenge with other microbes during their plant growth promotion activities, and (iii) the
induction of plant growth promotion (reviewed in Ahemad and Kibret, 2014). Accordingly,
plant biomass gains, improved root development, lateral root formation, stronger plant fitness
and stress tolerance, as well as increased uptake of nutrients such as nitrogen,
INTRODUCTION
3
Figure 1.1 Forms of PGPR processes in the rhizosphere. (A) PGPRs can act as biofertilizers and make various minerals accessible for plants. (B) Plant exudates help spreading and multiplication of pesticide-degrading PGPRs, termed rhizoremediation. (C) Degradation of the plant-derived ethylene precursor ACC via PGPR-derived ACC-deaminase production. (D) PGPRs produce phytohormones that function as phytostimulators leading to plant biomass gain. (E) Inhibition of soil-borne pathogens by production of antibiotics, toxins, etc. and induction of systemic response ISR in the plant leading to disease suppression. Picture: scan of a 4-day-old barley seedling, Simone Rankl, HMGU.
phosphorous, and potassium are attributed to PGPRs (Berg, 2009; Vacheron et al., 2013).
Because of these listed characteristics and a growing comprehension of environmental
protection and a demand for ecologically compatible strategies, the usage of PGPRs in
agriculture is rising (Berg, 2009). The following figure (fig. 1.1) summarizes the forms of
PGPR effects and processes in the rhizosphere.
Used as biofertilizers, PGPRs achieve an improvement of the nutrient uptake of plants. Thus,
symbiotic and non-symbiotic nitrogen-fixing bacteria serve as an additional nitrogen source,
while PGPRs also confer solubilization and mobilization of minerals like phosphorus and
potassium, as well as iron acquisition. This is achieved through the acidification of the
rhizosphere soil, chelation, or stimulation of proton pumps, which will positively effect total
plant growth, root development, and water and mineral uptake activity (van Loon, 2007;
Pérez-Montaño et al., 2014). Further, PGPRs can be used in rhizoremediation for
degradation of a variety of toxic environmental pollutants (herbicides, pesticides) that reside
in the soil (Bais et al., 2006). Related to the field of stress control, PGPRs remove plant-
derived 1-aminocyclopropane-1-carboxylate (ACC) through the production of an ACC-
deaminase. ACC is produced in stressed plant roots and would be converted to ethylene,
INTRODUCTION
4
which can be harmful in various cellular processes. In the case of phytostimulation, the ability
of PGPRs to synthesize auxins, gibberellins, and cytokinins is exploited to obtain root
architecture alterations of the plant (Pérez-Montaño et al., 2014). An excellent review about
known growth promoting substances released by PGPRs and their positive effect after
application on plants is given in Ahemad and Kibret (2014).
Another indirect mechanism of growth promotion involves the application of rhizobacteria as
biocontrol agents that restrict the spreading of pathogens and support plant health. Disease
suppression can be achieved by the strategy of antagonism. Here, the production of PGPR-
derived antibiotics (hydrogen cyanides, phenazines, pyrrolnitrin), extracellular cell wall lytic
enzymes (chitinase, ß-1,3-glucanase), and various volatile organic compounds support the
fight against soil-borne pathogenic microbes. However, PGPRs decrease the activity of
pathogenic microbes not only through antagonism, but also by triggering the plants’ self-
defense. This phenomenon, designated as ‘induced systemic resistance’ (ISR), was first
discovered in carnation that was systemically protected against fusarium wilt in consequence
of root-treatment with the PGPR strain Pseudomonas WCS417 (van Peer et al., 1991). The
spatial separation of root-adherent beneficial rhizobacteria and above-ground located
pathogens suggested a protective plant-mediated response (De Vleesschauwer and Höfte,
2009). Since this discovery, ISR induction by PGPRs was investigated in several plant
species, with Bacillus, Serratia, and Pseudomonas being the most prominent PGPRs eliciting
ISR responses in plants (Kloepper et al., 2004; Weller, 2007; Berg, 2009; De Vleesschauwer
and Höfte, 2009; Pieterse et al., 2014). Interestingly, a certain specificity in the host-PGPR
interaction is given because potential resistance induced by PGPRs is highly dependent on
the plant-PGPR combination and the type of pathogen (Balmer et al., 2012). Thus, for
example, Pseudomonas fluorescens WCS417r confers resistance to Pseudomonas syringae
pv. tomato and Botrytis cinerea in A. thaliana (Pieterse et al., 1996; Van der Ent et al., 2008),
while the same PGPR reduces the disease of fusarium wilt in radish (Leeman et al., 1995a).
The application of Bacillus pumilus SE34 mediated resistance against cucumber mosaic
virus and Pseudomonas syringae pv. maculicola in A. thaliana (Ryu et al., 2003; Ryu et al.,
2004). Furthermore, it reduced disease symptoms of Phytophthora infestans in tomato (Yan
et al., 2002). These examples show that a certain PGPR strain is able to confer resistance
against a broad spectrum of pathogens in different plant species. The combination of the
host plant and the PGPR strain in ISR elicitation plays an important role: Pseudomonas
aeruginosa 7NSK2 and Serratia plymuthica IC1270 stop the fungal infestation of
Magnaporthe oryzae in rice, but a spreading of Rhizoctonia solani is not prevented (De
Vleesschauwer et al., 2006; De Vleesschauwer et al., 2009; Balmer et al., 2012). The
particular mechanism of ISR and involved signaling cascades is further described in chapter
1.3.2.
INTRODUCTION
5
1.1.2 Interkingdom signaling and the involvement of quorum
sensing
Broad communication exists in the rhizosphere between plants and microbes during all plant
developmental stages. Mainly 3 types of ‘conversation’ are occurring: (i) microbial intra- and
interspecies communication, which is maintained via bacteria derived signaling molecules,
(ii) small plant-secreted signaling molecules, which are important in maintaining microbial-
derived symbiotic interactions, and iii) communication between microorganisms and plants,
where microbial produced signaling compounds are sent out to the host (Venturi and Keel,
2016). The first comprises microbial cell-to-cell communication, termed as ‘quorum sensing’
(QS) and functions in a cell density-dependent manner. Bacteria produce and secrete
signaling molecules, designated as autoinducers, which increase in amount in response to
the cell density and initiate an alteration in gene expression. The size of the ‘quorum’ is not
defined and depends on the relative amount of production and loss of the microbial signaling
molecules, which will fluctuate due to prevailing environmental conditions (Whitehead et al.,
2001). Moreover, QS surpasses the expectation of population density sensing, wherefore 3
further models have been postulated in the literature: First, in the context of ‘diffusion
sensing’, bacteria calculate via their excreted autoinducers how fast they are diffusing into
their surroundings and whether the expression of any gene of interest is profitable (Redfield,
2002). The second model comprises ‘compartment sensing’, in which the accumulated QS
molecules are on the one hand a measure of the extent of a compartmentalization and on
the other hand a resource to share obtained information within the quorum (Winzer et al.,
2002). The latest model ,efficiency sensing’, combines all models and also implies, besides
the sensing of their species and others, the spatial distribution of cells and the efficiency of
supplied autoinducers regarding a fitness benefit (Hense et al., 2007).
The most common autoinducers produced by gram-negative bacteria are AHLs.
Bacteria release and sense the AHLs and adjust their particular behavior on a population-
wide scale, which allows an adaptation to environmental changes. QS-controlled processes
involve e.g. biofilm formation, antibiotic production, nitrogen fixation, bioluminescence,
virulence factor expression, and sporulation (Miller and Bassler, 2001; Whitehead et al.,
2001). The first QS regulated mechanism was described by Nealson and coworkers in
studies on the bioluminescent marine bacterium Vibrio fischeri. These bacteria live
symbiotically in the light organs of a variety of marine fishes and squids and produce the
luminescence by themselves, in a process termed as ‘auto-induction’ (Nealson et al., 1970;
Fuqua et al., 2001). The accumulation of the autoinducer, when reaching a defined
concentration, leads to the induction of the bacterial luciferase (Eberhard, 1972). The
signaling molecule in this process was identified as 3-oxo-N-tetrahydro-2-oxo-3-furanyl
INTRODUCTION
6
Figure 1.2 Structure of a quorum sensing molecule and the molecular mechanism of QS in Vibrio fischeri. (A) General AHL structure with core lactone ring and acyl side chain (indicated by R), which differs in the length: 4 to 18 C-atoms. Red circle indicates substitution possibility at C-3 position (hydroxy- or oxo-group addition) (B) Schematic QS mechanism modified from Waters and Bassler, 2005 and Galloway et al., 2011. AHL molecule is produced by LuxI-Synthetase, diffuses via membrane outside of the cell. Reaching a defined threshold level, AHL binds to the LuxR-Receptor, which binds to luxICDABEG operon and initiates gene expression.
hexanamide (Eberhard et al., 1981), also commonly known as N-3-oxohexanoyl homoserine
lactone (3-oxo-C6-AHL). AHLs consist of a common molecular structure, which is displayed
in figure 1.2 A. The conserved homoserine lactone ring is connected to a variable acyl side
chain, where short-chain AHLs (C4-C8-HSL) and long-chain AHLs (C10-C16-HSL) exist,
which can be additionally modified by hydroxyl- or oxo-group substituents at the C3-position
(Fuqua et al., 2001; Williams, 2007). The conserved QS process of gram-negative bacteria is
regulated via the LuxI/LuxR system of Vibrio fischeri, the basal mechanism of which is
demonstrated in figure 1.2 B: LuxI regulatory proteins with synthase activity produce AHLs
(Eberhard et al., 1981; Engebrecht et al., 1983; Engebrecht and Silverman, 1984). The LuxI
enzyme transfers an acyl group from an appropriately charged acyl carrier protein onto S-
adenosylmethionine, which serves as a source for the homoserine lactone moiety and is
further released passively or actively from the cell. With increasing bacterial population
density, the AHL concentration rises outside of the cell and causes an intracellular
accumulation due to molecule back diffusion and reimport into the cell. Reaching a defined
intracellular molecule concentration, the LuxR protein (AHL-receptor) binds the AHL
molecule with its amino-terminal domain and further binds towards a specific promoter region
of the luxICDABE operon with its carboxyl-terminal region. Now, besides luciferase
expression, also luxI- and luxR- genes are expressed resulting in a positive feedback loop
(Engebrecht et al., 1983; Fuqua et al., 2001; Miller and Bassler, 2001).
INTRODUCTION
7
Interestingly, QS is also known to be involved in the establishment of root, root hair, and
rhizosphere colonization (Soto et al., 2006; Wei and Zhang, 2006). Thus, during colonization,
plants are exposed to PGPRs and AHLs, and in recent years many reports demonstrated
that plants are able to sense and to respond to AHL treatment in a tissue-specific manner,
which is summarized in figure 1.3. This crosstalk between bacterial signaling molecules and
an eukaryotic host is designated as interkingdom signaling (Pacheco and Sperandio, 2009).
Accordingly, the induced biological response in plants to AHL treatment depends on the
length and substitution degree of the carbon side chains. Mainly, the application of short
chain AHLs is leading to leaf and root growth promotion with particular root architecture
modifications, while long-chain AHLs are known to be involved in resistance induction
(reviewed in Hartmann et al., 2014; Schikora et al., 2016). Thus, for example the application
of N-butyryl homoserine lactone (C4-HSL) and N-hexanoyl homoserine lactone (C6-HSL)
resulted in primary root elongation and the ratio of auxin/cytokinin was enhanced in A.
thaliana (von Rad et al., 2008). In some cases, also long chain AHLs are involved in
morphological changes. Thus, the long chain N-3-oxodecanoyl homoserine lactone (3-oxo-
C10-HSL) induces adventitious root formation in mung bean (Bai et al., 2012), while its
unsubstituted homologue N-decanoyl homoserine lactone (C10-HSL) induced lateral root
formation in A. thaliana (Ortíz-Castro et al., 2008). Moreover, a strong root hair development
and root shortening and thickening appeared upon N-dodecanoyl homoserine lactone (C12-
HSL) treatment in A. thaliana (Ortíz-Castro et al., 2008).
INTRODUCTION
8
Figure 1.3 Summarizing model of the impact of AHLs on plants. (A) Root hair and lateral root formation (Ortíz-Castro et al., 2008); (B) Adventitious root formation (Bai et al., 2012); (C) Primary root growth (von Rad et al., 2008). AHL transport is leading to systemic effects: (D) Growth promotion (Klein et al., 2009). (E) Modified hormone signaling; (F) Transcriptome and proteome alteration, and (G) Resistance induction (Schuhegger, 2003). Picture source is given behind every bullet character.
+AHL
+AHL
INTRODUCTION
9
Besides morphological modifications, AHL induced effects on gene expression levels were
analyzed. The first study reporting global transcriptional changes upon AHL treatment,
occurred already more than a decade ago (Mathesius et al., 2003). Here, the treatment of
Medicago truncatula roots with N-3-oxo-hexadecanoyl homoserine lactone (3-oxo-C16-HSL)
from the legume symbiotic bacteria Sinorhizobium meliloti and N-3-oxo-dodecanoyl
homoserine lactone (3-oxo-C12-HSL) from the pathogenic bacteria Pseudomonas
aeruginosa resulted in changes in the quantity of 150 proteins related to defense and stress
management, phytohormones, and metabolic regulation (Mathesius et al., 2003). Further
studies in various dicotyledonous plants followed (Ortíz-Castro et al., 2008; von Rad et al.,
2008; Schenk et al., 2012) and revealed that AHLs confer resistance against necrotrophic,
biotrophic, and hemibiotrophic pathogens by triggering salicylic acid dependent defense
pathways in tomato, Arabidopsis thaliana, and barley, respectively (Schuhegger et al., 2006;
Schikora et al., 2011; Schenk and Schikora, 2015). Thus, the AHL producing bacterial strain
Serratia liquefaciens MG1 conferred resistance to the fungal pathogen Alternaria alternata in
A. thaliana (Schuhegger et al., 2006), while Serratia plymuthica protected cucumber-plants
from the damping-off disease provoked by Pythium aphanidermatum. The latter also
decreased infection symptoms of Botrytis cinerea, which causes the grey mold disease in
bean and tomato plants (Pang et al., 2009). As aforementioned, most of the AHL-studies
were conducted in dicotyledons, while less is known about AHL-induced reactions in
monocotyledons. Recently, studies with the N-3-oxotetradecanoyl homoserine lactone (oxo-
C14-HSL) producing Sinorhizobium meliloti displayed enhanced resistance in the crops
barley, wheat and tomato against the agricultural pathogens Blumeria graminis, Puccinia
graminis f. sp. tritic , and Phytophthora infestans respectively (Hernández-Reyes et al.,
2014). Furthermore, AHL application hardly had an impact on plant growth and pigment
content in barley and yam bean plants (Sieper et al., 2014; Götz-Rösch et al., 2015).
Moreover, the detoxifying activity of glycosyltransferases, ascorbate dependent enzyme
reactions, and ROS eliminating enzymes were regulated tissue specificly in barley after the
application of different AHL derivatives (Götz-Rösch et al., 2015). Recent findings also
demonstrated that AHLs are translocated from roots into shoot, while the AHL chain length
and plant species are crucial (Götz et al., 2007; von Rad et al., 2008; Sieper et al., 2014).
The uptake, transport, and the fact that some plant species are sensitive to a certain AHLs
while others are not, suggest a putative host-cell-AHL receptor. Little is known about such a
putative AHL-receptor and the signaling pathway in plants. Lately, studies with GCR1 and
GCR2 loss-of-function mutants (plants that are impaired in G-protein-coupled receptor
(GPCR) gcr1 and gcr2) had abolished activity to AHL-induced root growth promotion in
Arabidopsis (Bian et al., 2011). Additionally, in loss-of-function mutants of the GPCRs,
Cand2, and Cand7, also an insensitivity to short-chain AHLs was demonstrated (Jin et al.,
INTRODUCTION
10
2012). These results indicate that heterotrimeric G-protein signaling might be involved in the
regulation of root growth by QS signals, but further studies have to be done to elucidate AHL
signaling pathway in plants.
In view to the QS signaling compounds, several publications suggest that plants respond to
AHLs with their own plant derived signals, mimicking AHLs. Many studies demonstrated that
algae and higher plants seem to be able to interfere actively with the bacterial QS system by
secretion of secondary metabolites similar to QS signaling molecules (Bauer and Mathesius,
2004). The marine red alga Delisea pulchra produces halogenated furanones that represent
plant secondary metabolites similar in structure to AHLs. These furanone AHL mimics are
shown to inhibit QS regulated swarming activity of Serratia liquefaciens (Givskov et al.,
1996). In higher plants exudates from pea, rice, soybean, tomato, crown vetch, and
Medicago truncatula were found to activate AHL-dependent swarming in the bacterial
reporter strain Serratia liquefaciens MG44 (Teplitski et al., 2000). Some of the QS signal
mimics are AHL structural analoga and belong to the group of alkamides and N-
acylethanolamines (NAEs). Both AHL-mimics are naturally produced in plants (Ortíz-Castro
et al., 2009). Interestingly, when applied to plants these substances have the potential of
modulating root developmental processes and altering root architecture, including the
stimulation of lateral roots (Blancaflor et al., 2003; López-Bucio et al., 2006; Campos-Cuevas
et al., 2008; Méndez-Bravo et al., 2010).
1.2 The plant immune system
Plants face an enormous amount of challenges by potentially pathogenic microorganisms
during their life time. To counterbalance microbial attacks, plants evolved complex defense
mechanisms to quickly recognize and combat potential pathogens. Basically, 2 main types of
defense are differentiated in plants: host resistance and non-host resistance. The former is
mainly regulated by a single resistance gene (R gene) and its corresponding avirulence gene
(avr gene) in the pathogen (gene-for-gene concept, Flor, 1971). The latter, also known as
basal resistance, confers an effective and broad resistance against a vast majority of
pathogens (Heath, 2000; Gill et al., 2015). Both host and non-host resistance are
characterized based on pathogen adaptation to a particular plant cultivar (host) and lack of
adaptation to other cultivars (non-host), but both are the result of the plant immune response
(Gill et al., 2015)
Plants have evolved constitutive preformed defense mechanisms that comprise
physical (cuticle, epidermis, cell wall) and chemical defense barriers, which include
INTRODUCTION
11
Figure 1.4 The ‚zigzag‘-model describing the amplitude of plant-defense pathogen-attack antagonism. This scheme comprises disease resistance of plants and pathogens and the fight for
immunity and/or susceptibility for each counterpart. PAMP: pathogen-associated molecular pattern, PTI: PAMP-triggered immunity, ETS: effector-triggered susceptibility, ETI: effector-triggered immunity, HR: hypersensitive response, Avr: avirulence effector, R: resistance protein. Figure originates from Jones and Dangl, 2006.
antimicrobial secondary metabolites (saponin, alkaloids, cumarins), and antimicrobial
proteins (glucanases, chitinases, defensins, Thordal-Christensen, 2003; Nürnberger and
Lipka, 2005; Gill et al., 2015). When pathogens overcome the first border of defense, they
have to conquer inducible defense mechanisms, which are activated in the early pathogen
recognition. The existing and widely accepted zig-zag model, proposed by Jones and Dangl
(2006), describes the plant-defense pathogen-attack antagonism as following.
Once the first obstacle has been overcome, extracellular surface pattern recognition
receptors (PRRs) in the plant cell membrane perceive evolutionarily conserved microbial- or
pathogen-associated molecular patterns (MAMPs/PAMPs) of the microbe or specific plant-
derived damage-associated molecular patterns (DAMPs). Characteristic MAMPs or ‘general
elicitors’ include flagellin (flg22) structural elements of lipopolysaccharides (LPS), the
elongation factor Tu (EF-Tu) from gram-negative bacteria and chitin, β-glucans, and
ergosterol from fungi (Nürnberger and Lipka, 2005; Ingle et al., 2006). Thus for example
flg22 is recognized by the FLS2 receptor, which belongs to the leucine-rich repeat receptor-
like kinases (LRR-RLK, Chinchilla et al., 2006). After PAMP recognition, an initiated down-
stream signaling in the plant results in the activation of PAMP-triggered immunity (PTI,
INTRODUCTION
12
Chisholm et al., 2006; Gill et al., 2015). Hereby, within the first seconds, transcriptional
reprogramming occurs via the initiation of mitogen-activated protein kinases (MAPKs), the
activation of WRKY transcription factors and Ca2+ bursts, the production of reactive oxygen
species (ROS) and nitric oxide (NO), defense gene activation, the production of antimicrobial
compounds, and local callose deposition at infection sites (He et al., 2007; Zipfel and
Robatzek, 2010; Ishihama and Yoshioka, 2012). Also, the accumulation of defense
phytohormones, such as salicylic acid (SA), jasmonic acid (JA), and abscisic acid (ABA) was
reported (Halim et al., 2009; Li et al., 2012).
Successfully adapted pathogens evolved effectors to suppress their recognition and to
promote spreading and virulence, leading to effector-triggered susceptibility (ETS) in the
plant. Plants in turn developed resistance (R) proteins that recognize specific pathogen-
derived effectors or Avr proteins, resulting in a defense response, termed effector-triggered
immunity (ETI, Zipfel and Robatzek, 2010; Cui et al., 2015; Gill et al., 2015). The largest
class of characterized R proteins contain a nucleotide binding site (NBS) and leucine-rich
repeat (LRR) domains. Furthermore, the class of NBS-LRR can be divided in 2 types,
depending on their N-terminal domain: The first class of R proteins possess a coiled-coil
(CC) domain at the N-terminus (CC-NBS-LRR), while the second contain a toll-interleukin-1-
receptor domain at the N-terminus (TIR-NBS-LRRs, Chisholm et al., 2006). The ETI
resembles an intensified and prolonged version of PTI and therefore partly shares
downstream molecular signaling events such as SA, ROS, and NO accumulation, activation
of MAPKs, and the induction of pathogenesis-related (PR) genes, which result in a form of
local programmed cell death, termed hypersensitive response (HR). The HR restricts further
pathogen spreading and causes the dying back of infected tissues (Jones and Dangl, 2006;
Mur et al., 2008).
1.3 Systemic resistance
Induced defense responses in plants after pathogen exposure are not restricted to local
areas and can be transferred to distal plant parts. Two signaling pathways that lead to a
global enhanced resistance are the systemic acquired resistance (SAR) and the induced
systemic resistance (ISR), which will be described in the following chapters.
1.3.1 Systemic acquired resistance
SAR represents a systemic induced immune response of plants, contributing to a durable
and broad spectrum resistance to a vast majority of harmful microbes, such as bacteria,
fungi, or viruses (Vlot et al., 2009). SAR is mainly induced by a local infection of necrotizing
INTRODUCTION
13
pathogens in systemic plant tissue and mobile alarm signals are sent to activate systemic
resistance in distal pathogen-free foliage (Shah, 2009; Fu and Dong, 2013). Recent
investigations have demonstrated that also PAMP elicitors are sufficient to induce SAR
(Mishina and Zeier, 2007). An important hallmark of SAR is the induction of SA, which is
therefore locally and systemically produced (Grant and Lamb, 2006; Spoel and Dong, 2012;
Fu and Dong, 2013). Hereby, mobile and long-distance signals are translocated via the
vasculature, which comprise methyl salicylic acid, azelaic acid, glycerol-3-phosphate, and the
abietane diterpenoid dehydroabietinal (Gozzo and Faoro, 2013). The accumulation of SA
leads to redox state changes in the cytosol. Thereby, the regulatory oligomeric NPR1
(nonexpressor of pathogenesis- related genes) protein, which is the master regulator of SAR,
is transformed into an active monomer. It can then translocate into the nucleus to interact
with TGA transcription factors, which promote the expression of antimicrobial PR genes
(Gozzo and Faoro, 2013). Typical SAR marker genes in dicotyledons comprise the
expression of PR1 (function unknown), PR2 (β-1,3-glucanase), and PR5 (thaumatin-like
protein, Fu and Dong, 2013).
Compared to dicotyledons, the knowledge of SAR in monocotyledons is limited. The master
regulator NPR1 is conserved among monocotyledons and dicotyledons, but the role of SA in
SAR in monocotyledons is still elusive (Kogel and Langen, 2005; Balmer et al., 2012). For
example, rice already possess constitutive elevated SA levels, which did not raise upon
pathogen infection (Silverman et al., 1995). In barley, SAR was determined to be
independent of both HvNPR1, the AtNPR1 homologue, and SA (Dey et al., 2014). In
contrast, SAR in Zea mays was associated with local and systemic SA accumulation (Balmer
et al., 2012). It is even possible that SAR proceeds differently in barley than in other
monocotyledons.
1.3.2 Induced systemic resistance
ISR describes a systemic resistance effect triggered by beneficial root-colonizing
rhizobacteria or chemical compounds in distal not-challenged plant parts of monocotyledons
and dicotyledons (De Vleesschauwer and Höfte, 2009; Pieterse et al., 2014). Besides
PGPRs, endophytic fungi, and mycorrhizae have been demonstrated to induce resistance
against a broad spectrum of pathogens (Balmer et al., 2012). The effective trigger of ISR are
prominent MAMPs such as lipopolysaccharides, exopolysaccharides, while also AHLs and
siderophores have been demonstrated to confer ISR (De Vleesschauwer and Höfte, 2009;
Balmer et al., 2012). As already mentioned in chapter 1.1.2 induction of ISR relies on the
host-rhizobacterium combination and the type of pathogen (Pieterse, 2001; Balmer et al.,
2012). For the clarification of the fundamental molecular mechanism, the ISR-model system
A. thaliana-Pseudomonas fluorescens WCS417r has been used. In this case, the realization
INTRODUCTION
14
that ISR confers a broad-spectrum resistance to pathogens, supposes that the fundamental
mechanism of ISR is similar to SAR. But, ISR was shown to be a SA-independent non-host
resistance that skips PR gene accumulation. Rather, NPR1 and the phytohormones JA and
ethylene (ET) are dominant players in ISR regulation (De Vleesschauwer and Höfte, 2009;
Pieterse et al., 2014). During SAR establishment, the regulatory role of NPR1 is clearly
associated to a function in the nucleus, while during ISR a cytosolic function of NPR1 in
JA/ET signaling is suggested (reviewed in Pieterse et al., 2014). However, some exceptions
documented that PGPRs are able to trigger SA-dependent ISR, which resembles pathogen-
induced SAR. If this is the case, the initiated ISR mechanism overlaps partly with pathogen-
induced SAR (Van Loon, 2007).
Surprisingly, investigations displayed that the broad resistance effect in ISR-expressing
plants did not rely on enhanced phytohormone production in the systemic tissue. Rather,
enhanced sensitivity to these hormones and potentiated expression of JA/ET-regulated
genes upon subsequent pathogen challenge is involved (van Wees et al., 1999). Thus, being
stronger forearmed to fight against upcoming pathogens is designated as priming and
describes a state of faster and robust preparedness of plant self-protection, which results in
increased resistance against future microbial challenges. Therefore, transferring plants into a
primed state is the basic mechanism of ISR (Conrath et al., 2002; Conrath, 2011; Pieterse et
al., 2014). The priming state can be achieved by treatment with natural or synthetic
compounds, wounding, molecular patterns of microbes, as well as plants’ and pathogen-
derived effectors, while the molecular basis can vary and is poorly understood (reviewed in
Conrath, 2011; Gamir et al., 2014). Besides defense gene activation, accumulation of
inactive MAPKs is comprised in priming with benzothiadiazole (BTH, a synthetic SA-analog).
Moreover, the induced priming response to Pseudomonas fluorescens WCS417r- and to
Trichoderma-colonized A. thaliana roots included activation of a root-specific transcription
factor MYB72, which is an important signaling node for the onset of ISR (Verhagen et al.,
2004; Van der Ent et al., 2008; Segarra et al., 2009; Alizadeh et al., 2013). Interestingly,
MYB72 is up-regulated in roots under iron-limited conditions, giving a hint to a linkage
between the induction of ISR and iron homeostasis (Palmer et al., 2013; Pieterse et al.,
2014). Furthermore, rhizobacteria and chemical substances prime for NPR1- and ABA-
dependent enhanced callose deposition in A. thaliana (Van der Ent et al., 2009).
1.4 Barley (Hordeum vulgare L.)
The history of agriculture began with the domestication of Neolithic founder crops, the
precursors of our present cultivated crop species, around 9000 BC (Fuller, 2007). The
INTRODUCTION
15
monocotyledonous plant barley belongs to the tribe Triticeae of the Poaceae and is a very
old crop, domesticated since 10 000 years. The domestication began in the Fertile Crescent
using the wild and initial progenitor Hordeum spontaneum C. Koch (Pourkheirandish and
Komatsuda, 2007). Since the ‘International Barley Genome Sequencing Consortium’
completed a whole-genome sequence for barley, detailed genome information is available
and simplifies the usage of Hordeum vulgare as monocotyledonous model plant in the
laboratory (Mayer et al., 2012). Barley was also used in the present study as model system.
The broad application ranges of barley as an important cereal crop in the food chain for
human and animal consumption and as brewing malts, directed breeding towards faster
growth, higher reproduction rate, and increased yields. With the breeding for high-yielding
varieties in monocultures, with strong focus on certain growth properties, the genetic
resistance diversity against biotic and abiotic stressors became less important (Tilman et al.,
2002). Barley has to deal with a broad spectrum of pathogens, with Xanthomonas
translucens pv. cerealis (Xtc) being one of them, also used in a pathogenicity-assay in the
course of this thesis. Xtc is a biotrophic, seed-borne pathogen. It is transmitted via rain and
dew on the plants, while the invasion occurs mainly via stomata. Disease spreading happens
predominantly under warm and humid conditions (26-30 % humidity). Xtc causes bacterial
leaf streak with typical leaf symptoms comprising narrow and yellowish streaks (European
and Mediterranean Plant Protection Organization).
OBJECTIVES
16
1.5 Objectives
Plants evolve in close interaction with a broad spectrum of internal and external inherent
microorganisms, which are indispensable for the plants development and survival. Thus, the
plant and its associated microbiota are frequently considered as holobiont. Plant-associated
bacteria produce AHLs, which plants acquired to sense and to respond to. Until now, several
studies were able to partially elucidate AHL induced effects in plants and thus broaden the
knowledge concerning this interkingdom signaling. But still, many facts are elusive.
AHLs reportedly induce morphological changes in plants (Ortíz-Castro et al., 2008; von Rad
et al., 2008). Thus, first of all in the course of this thesis, an axenic and sterile growth system
was to be developed to study the influence of 2 different AHL derivatives on plant growth and
root architecture changes. A second approach was to elucidate, whether AHLs impact
nutrient uptake of epidermal root cells. Connected to this, studies were undertaken to identify
initial reactions in root cells upon AHL treatment by using electrophysiological and staining
methods.
Further experiments should reveal which systemic reactions are triggered in barley after AHL
treatments. In order to identify systemic AHL-responsive genes, a leaf transcriptome analysis
was planned to give a rough overview, which genes and pathways are differentially
regulated. Simultaneously, it should be analyzed by qRT-PCR, how root-applied AHLs
systemically influence the expression pattern of selected candidate genes. Moreover,
investigations of the phytohormones salicylic acid, jasmonic acid, and abscisic acid should
contribute to clarify gene expression patterns and possible signaling pathways in barley. The
investigation of the gateway enzyme phenylalanine ammonia lyase should provide insight in
the regulation of the secondary metabolism, while in this context also the levels of flavonoids
should be determined. Last, but not least this thesis aimed to shed light on the mode of
action of AHLs, and the induced signaling pathways in conferring systemic resistance to the
biotrophic pathogen Xanthomonas translucens pv. cerealis.
MATERIALS AND METHODS
17
2 MATERIALS AND METHODS
All used lab chemicals were in the highest available purity. Buffers and media were prepared
with desalinated and filtered water (H2Odist.) and if needed sterilized at 121°C for 20 min in an
autoclave (Systec D65/V65/50, Systec GmbH Labor-Systemtechnik, Wettenberg, Germany).
2.1 Materials
2.1.1 Plant material
Throughout this study the barley (Hordeum vulgare L.) cultivar Barke was used, which was
provided by the Saatzucht Josef Breun GdbR (Herzogenaurach, Germany). The seeds were
not dressed and were stored in a cool, dry and dark place prior to use.
2.1.2 Pathogens
The phytopathogenic bacterium Xanthomonas translucens pv. cerealis strain LMG 7393
(Belgian Coordinated Collections of Microorganisms, Brussels, Belgium) was used for
bacterial infection assays and was cultivated in a Max Q 6000 incubator (Thermo Fisher
Scientific, Massachusetts, USA) on Tryptone Soya Agar (TSA) plates (see table 2.1) at 28°C.
2.1.3 N-acyl-D/L-homoserine lactones
AHLs were obtained from Sigma-Aldrich (Steinheim, Germany). Throughout this study barley
plants were treated with defined concentrations of N-octanoyl-D/L-homoserine lactone (C8-
HSL) and N-dodecanoyl-D/L-homoserine lactone (C12-HSL). AHL stock solutions (20 mM
and 60 mM) were prepared in an appropriate volume of absolute ethanol, distributed in 20 µl
aliquots, lyophilized and stored at -20 °C.
2.1.4 Media
All components of the used media were dissolved in H2Odist. and sterilized at 121°C for
20 min in an autoclave (Systec D65/V65/50, Systec GmbH Labor-Systemtechnik,
Wettenberg, Germany). When needed, 18 g/l agar-agar was added to the media before the
sterilization process.
MATERIALS AND METHODS
18
Table 2-1 Used media with listed ingredients
Medium component g/l
LB (Luria-Bertani) 25 g/l, pH 7 tryptone 10
yeast extract 5
sodium chloride 10
TSA (Tryptone Soya Agar) 25 g/l, pH 7.3 tryptone 15
soja-peptone 5
sodium chloride 5
NB (Nutrient Broth No. 4) 8 g/l, pH 7 meat peptone 5
meat extract 3
MS (Murashige & Skoog) 4.3 g/l, pH 7.2 Duchefa Biochemie BV, Haarlem, Neatherlands
macronutrients mg/l
NH4NO3 1.65
CaCl2 2*H2O 440
MgSO4 7*H2O 370
KH2PO4 170
KNO3 1.9
micronutrients mg/l
H3BO3 6.2
CoCl2 6*H2O 0.025
CuSO4 5*H2O 0.025
FeSO4 7*H2O 27.8
MnSO4 4*H2O 22.3
KI 0.83
Na2MoO4 2*H2O 0.25
ZnSO4 7*H2O 8.6
Na2EDTA 2*H2O 37.2
Hydroponic solution, pH 6.6 KCl
mg/l 37
CaCl2 11
MES 39
MATERIALS AND METHODS
19
Hoagland solution, pH 6.0 macronutrients g/l
(Hoagland and Arnon, 1950) KNO3 202
Ca(NO3)2•4H2O 236 /0.5L
Iron (Sprint 138 iron chelate)
15
MgSO4•7H2O 493
NH4NO3 80
micronutrients g/l
H3BO3 2.86
MnCl2•4H2O 1.81
ZnSO4•7H2O 0.22
CuSO4•5H2O 0.051
H3MoO4•H2O 0.09
KH2PO4 136
Plant agar gel
1.2 % (w/v) plant agar-agar and 4.3 g/l, pH 7.2. MS salts were dissolved in H2Odist..
2.2 Methods
2.2.1 Surface sterilization
The surface sterilization of seeds in a sterile hood (BDK, Luft- und Raumfahrttechnik GmbH,
Sonnenbühl-Genkingen, Germany) followed a protocol of Rothballer (2004). In brief, barley
seeds were incubated in 1 % Tween 80 solution for 2 min in a 50 ml Falcon tube (BD
Bioscience, Heidelberg, Germany). The solution was replaced by 70 % ethanol for 5 min
incubation. After 3 washing steps with autoclaved H2Odist., the seeds were incubated in 13 %
sodium hypochlorite for 20 min and rinsed with autoclaved H2Odist.. After soaking the seeds
for 2 h in autoclaved H2Odist., a 10 min incubation in 13 % sodium hypochlorite followed.
Seeds were rinsed 5 times with sterile H2Odist. and then germinated crease-side down on NB-
agar plates (see 2.1.4) at 23 °C in the dark. The agar plates were sealed with parafilm M
(Pechiney Plastic Packaging, Chicago, USA). After 2 days of germination, the seedlings were
transferred into an axenic growth system (see 2.2.2). The day after the surface sterilization
was set as day 1 of growth.
MATERIALS AND METHODS
20
Figure 2.1 Different growth systems for barley plants. (A) Duran system, to grow single plants. (B) Beaker system, to grow 4 plants, packed in rectangular greenhouse. Pictures: Simone Rankl, HMGU.
2.2.2 Plant growth systems and conditions
All seedlings were planted into various growth systems under sterile bench conditions. The
following growth systems were used:
A) The duran system: For single plant cultivation, seedlings were grown in an axenic
system (see Figure 2.1 A; Götz, 2008), consisting of 2 test tubes (⌀ 30 mm, Schott, Mainz,
Germany), closed with parafilm. The lower one, having a side aperture sealed with a silicon
stopper to allow sampling or treatments, was filled with 50 g of sterile glass beads (⌀ 0.7-
2 mm, Carl Roth GmbH, Karlsruhe, Germany) and 10 ml of sterile full strength MS-medium
(Murashige and Skoog, 1962; see table 2.1). The upper test tube was imposed on the lower
one with parafilm.
B) The beaker system: To grow barley plants in a group of 4 (see Figure 2.1 B),
autoclaved 200 ml beakers, filled with 185 g of glass beads and 45 ml of sterile full strength
MS-medium (see 2.1.4), were used. To keep sterile conditions, the beakers were enclosed in
a small, sterilized, rectangular mini greenhouse (FloraSelf, Hornbach, Germany; 59 x 38 cm).
C) The glass bowl system: For root morphology studies, a new sterile plant growth
system was developed (see Figure 2.2). For this purpose, a gel glass pane sandwich was
created in an autoclaved rectangular metal mold (19 x 14 x 2.5 cm), which contained a glass
pane as a base (see Figure 2.2 A). A 1.5 cm thick gel, containing 1.2 % (w/v) plant agar-agar
(see 2.1.4) and supplemented with dimethyl sulfoxide (DMSO) to a final concentration of
MATERIALS AND METHODS
21
Figure 2.2 Structure of the “glass bowl system”. (A) Metal mold, helping to construct the glass-gel sandwich (B). (B) glass-gel sandwich with planted seeds on the gel layer. (C) Arrangement of 3 glass bowl systems in a rack. Pictures: Simone Rankl, HMGU.
0.025 % (v/v) or C8- or C12-HSL to a final concentration of 10 µM, was poured into this mold.
After gel solidification, a second glass pane was added to fix the gel in between. This
construct was then placed vertically into a sterile rectangular glass bowl. Then, the sterilized
and germinated barley seeds were arranged on the top of the gel. Thereafter, the glass bowl
was closed with a sterile polycarbonate lid.
D) The floating mesh system: For ion flux measurements, plants were grown on a
floating mesh in small plastic beakers filled with a continuously aerated hydroponic solution
(see 2.1.4) in the dark at 23°C.
E) The paper roll system: For nitric oxide (NO) detection in barley roots, seeds were
germinated in humid paper rolls, dipped in medium (2 mM KCl and 1 mM CaCl2) in the dark
at 23°C.
The growth systems A to C were kept in a climate chamber (Heraeus-Vötsch, Vötsch
Industrietechnik GmbH-Umweltsimulation, Balingen-Frommern, Germany) and the conditions
were set with a day/night cycle 14 /10 h and temperature of 23 °C during the day and 18 °C
during the night with 50 % relative humidity. The photosynthetic active radiation in the axenic
systems was 1500 µmol/m2/s and the UV-A and UV-B radiation amount 43.7 W/m2 and
1.14 W/m2, respectively.
A C
B
MATERIALS AND METHODS
22
2.2.3 Treatment of barley with AHLs
AHL stock solutions (see 2.1.3) were dissolved in 20 µl of 50 % DMSO. To treat plants that
had been grown in one of the glass bead based growth systems (2.2.2), 3 ml of MS medium
were removed, under sterile conditions, from the growth system. This was done using a
sterile syringe (Braun, Bad Arolsen, Germany) with a needle (⌀ 0.8*120 mm, Sterican Braun,
Melsungen, Germany). The medium was mixed with an appropriate volume of AHLs, to yield
a final concentration of 10 µM AHL. The mixture was reinjected homogeneously into the
growth system without damaging the plant roots. Control plants were mock treated
accordingly with 50 % DMSO to a final concentration of 0.025 % DMSO. For root morphology
and dry weight determination, the germinated seedlings were directly grown on plant agar
(see 2.2.2), supplemented with the same substances and final concentrations as mentioned
above. For ion flux measurements and NO determination experiments, the AHLs were
directly added to the incubation medium.
2.2.4 Root morphology, fresh and dry weight determination
Barley plants were grown in the glass bowl system (see 2.2.2) for 10 days. Per treatment
(DMSO, C8- and C12-HSL) and biological sample, 4 technical replicates (equals 4 single
plants) were analyzed. The experiment was conducted in 4 biological replicates. For this,
barley plants were scanned (Epson 4180 Photo, Meerbusch, Germany) with the following
settings: 800 dpi, 8-bit grey scale, saved as a TIF file to obtain the scaling details. The root
parameter analysis (total root length, diameter classes, number of root tips) was done with
the software WinRHIZO (2013e 32 bit, Regent Instrument, Quebec, Canada) with the
following settings: pale root on black background; debris and rough edges removal: high;
length/width ratio: 4. For fresh and dry weight determinations roots and leaves were
separated, related plant parts were marked, fresh weights determined and oven dried 24 h at
70 °C (Heareus instruments B6060, Hanau, Germany). After that, shoot and root dry weights
were determined (Adventurer AR3130, Ohaus, Nänikon, Switzerland).
2.2.5 Nitric oxide determination in root tissue
Excised roots from 4-day-old barley seedlings (growth system see 2.2.2) were used for NO
detection. Per treatment and biological repetition, 3 roots from different plants were analyzed.
Root segments were first incubated in buffer medium (2 mM KCl and 1 mM CaCl2) and
afterwards treated for 20 min with the following substances: DMSO, C8-HSL and C12-HSL
(1, 10, 100 μM), 100 μM 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide
(cPTIO, a NO scavenger) and 100 μM sodium nitroprusside (SNP, a NO donor). NO was
MATERIALS AND METHODS
23
monitored with 100 μM 4-amino-5-methylamino-2',7'-difluorofluorescein diacetate (DAF-FM
diacetate, Molecular Probes D23844) in 10 mM Tris-HCl pH 7.4. The treated root segments
were incubated in the fluorescent dye for 1 h at room temperature (RT) in the dark and
washed 3 times with fresh Tris-HCL buffer. The fluorescence signals were detected using a
binocular stereomicroscope (Nikon SMZ 1000, Camera: Nikon DS-5M) and monitored with a
GFP-L filter (EX: 480/40 DM 505 EM:510). Fluorescence signals were quantified by counting
the emission intensity in selected areas by employing the software Image ProPlus 6.
2.2.6 Cell viability assay
Excised roots of 4-day-old plants were mock- and AHL-treated for 20 min at RT under light
exclusion. The experiment was conducted in triplicates. Control and treated roots were
compared and statistically evaluated by analysis of variance (ANOVA, p< 0.05). Roots were
first incubated for 3 minutes in fluorescein diacetate (FDA, 0.005 g/ ml solved in acetone and
diluted 1:250 in Dubelcoo´s phosphate buffered saline, DPBS). After a washing step in DPBS
buffer the root segments were transferred to a propidium iodide solution (PI,0.001g / 50 ml
DPBS) for 10 min with a further washing step in DPBS following Jones and Senft (1985). The
non-fluorescent FDA is taken up into cells and is converted into the green fluorescent
metabolite fluorescein by esterases. Therefore, viable and intact cells would appear with
green fluorescence. In contrast, the nuclei staining dye PI is not able to pass through a viable
cell membrane. It reaches the nuclei of damaged or dead cells and intercalates with the DNA
double helix of the cell. Under these conditions the cell would exhibit a red fluorescence.
Visualization was done with a binocular fluorescence stereomicroscope (Nikon SMZ 1000,
Camera: Nikon DS-5M) and a FITC filter: Ex: 450-490 nm Em: 520 nm.
2.2.7 Microelectrode ion flux measurements
The microelectrode ion flux measurements were conducted in a modified form of the protocol
of Rodrigo-Moreno et al. (2013) For the determination of the potassium (K+) net ion fluxes,
the non-invasive Microelectrode Ion Flux Estimation (MIFE) system was used (Gunsé et al.,
2016). Prior to the implementation of K+ measurements, the microelectrodes were fabricated
using the protocol of Shabala and Shabala (2002): Microelectrodes (outer diameter 5 µm)
were produced in a vertical puller PULL-100 (WPI Europe, Hertfordshire, UK), oven dried
overnight and silanized with DMSO for 1 h at 100 °C. The measuring electrode was back-
filled with 0.2 M KCl solution and the electrode tip was filled with a specific ion-selective
cocktail (Fluka, catalogue no: 99311 for K+). The electrode was mounted on a 3-dimensional
electrode holder, filled with 0.2 M KCL. The backfilling of the reference electrode contained
0.8 % agar supplemented with 0.2 M KCl and was also mounted on a 0.2 M KCl filled holder.
MATERIALS AND METHODS
24
Figure 2.3 Representation of the net K+ measurement of barley roots.
The electrodes passed through a 3-point calibration (0.1, 0.2, 0.5 mM KCL). Electrodes with
responses of less than 50 mV per decade for K+ and a correlation coefficient of less than
0.999 were discarded. The ion flux measurements were performed in the mature root zone,
3 mm from the root tip of a barley seedling because the highest effect of AHLs on NO
accumulation was determined there (growth conditions see 2.2.2). Per treatment 3 roots
were analyzed. Fifteen minutes prior to the measurement the seedling was centered and
immobilized in a petri dish (⌀ 60 mm, Greiner Bio-One, Frickenhausen, Germany) with Blu-
Tack (Bostik, Australia), filled with a bathing solution (0.5 mM KCl and 0.1 mM CaCl2). The
measurements were conducted on an inverted fluorescence microscope (Nikon Eclips
TE2000-E; Nikon Instruments Europe, Amsterdam, Netherlands). The measuring electrode
was arranged 50 µm from the root surface, at 100x magnification to measure the ion
potential difference close to the root surface and at a known distance (150 µm displacement)
from the root surface by moving in a 10 s square-wave- manner. Figure 2.3 shows the
experimental set up of the measurement.
The electrode’s movement was controlled by a computer-based stepper motor (Gunsé et al.,
2010). The process of ion flux measurement was documented by a digital camera (Nikon
digital sight DS-U2 controller; Nikon Instruments Europe) and the software NIS-Elements F
2.30 (National Instrument Spain, Madrid). The plant response towards AHL treatment was
studied as follows: after 15 min of “blank-measurement” the plant was treated with 1, 10 and
100 μM AHL solution and the recording continued for further 75 min. The calibration curve of
the microelectrode (Nernst slope) was used to calculate the electrochemical potential. The
distance of the electrode to the root, its displacement, and the root radius were considered in
all calculations. The net ion fluxes were calculated by using the cylindrical diffusion geometry
(Newman, 2001). The raw data of an example recording are displayed in figure 2.4 and its
data processing in figure 2.5.
MATERIALS AND METHODS
25
Figure 2.4 Raw data of K+ ion flux measurement. The left figure shows a screen shot of the ion flux measurement experiment recording. The green line stands for the root closer position of the electrode towards the root and the red one the 150 µm displacement position of the electrode. The graph on the right represents the potassium concentration of both close and far positions of the microelectrode tip. A bigger difference in ion concentration among both positions implies a higher flux. After 15 min of blank-measurement the substance that had to be tested was applied.
2.2.8 Membrane potential measurements
Membrane potentials were measured using the plant cultivation, experimental conditions and
procedures of the ion flux measurements described in 2.2.7. Measurements were conducted
as described by Gunsé et al., (2016) with minor modifications. Briefly, a measuring electrode
with a tip diameter of 1 to 3 mm was used and the reference electrode contained 0.8 % agar
supplemented with 0.2 M KCl. After 20 min of electrode signal stabilization in measuring
Figure 2.5 Processed flow estimation taken from the potassium ion flux measurement in figure 2.4. The observed difference in ion concentration between the close and the far position of the electrode, gives the ion flux.
MATERIALS AND METHODS
26
buffer, the measuring electrode was manually impaled into a cortical cell using a coarse
micromanipulator. Correct insertion was confirmed by rapid decreases in membrane potential
(Em). Blank measurements were performed several minutes, after Em values had stabilized.
Subsequently, 10 µM C8-HSL was added to the measuring solution. The measurement kept
going on until the epidermal cell displayed a resting potential again.
2.2.9 RNA Extraction
Frozen plant material was ground into fine plant tissue powder with liquid nitrogen in
precooled mortars. The total RNA extraction was carried out using the RNeasy Plant Mini Kit
(Qiagen GmbH, Hilden, Germany) in accordance to the kit´s manual (protocol: purification of
total RNA from plant cells and tissues and filamentous fungi). All laboratory equipment used
was either autoclaved twice or cleaned with RNase Away (Thermo Fisher Scientific,
Massachusetts, USA). The RNA concentration was photometrically determined with a
NanoDrop® (ND-1000 spectral photometer, NanoDrop Technologies, Wilmington, USA). The
A260/A280 ratio was used to determine the purity of the RNA and to detect the presence of
proteins, phenolics or other contaminants that absorb at approximately 280 nm. A ratio
between 1.8 to 2.0 was generally accepted for pure RNA. The A260/A230 ratio is a measure
of second level of purity, which should be in the range of 2.0-2.2.
2.2.10 RNA sequencing
For RNA sequencing (RNA seq) experiments, 10-day-old barley plants, grown in the duran
system (see 2.2.2), were AHL or mock treated respectively (see 2.1.3). For each treatment
and biological sample 4 plants were pooled and the total RNA was extracted (see 2.2.9).
Two biological replicates were used for this experiment. The RNA seq service was kindly
provided by the Center of Excellence for Fluorescent Bioanalytics (Regensburg, Germany).
The preparation of the library and the RNA seq was performed in accordance to the Illumina
TruSeq RNA Sample Preparation v2 Guide, the Illumina Hiseq 1000 System User Guide
(Illumina, Inc., California, USA), and the KAPA Library Quantification Kit-Illumina-ABI Prism
User Guide (Kapa Biosystems, Inc., Massachusetts, USA). In brief, the process of sample
preparation included the purification of poly-A containing RNA via poly-T oligo-attached
magnetic beads, followed by mRNA fragmentation and randomly primed first strand cDNA
synthesis. This was followed by the second strand cDNA synthesis and adapter ligation. The
sequencing run was performed on a HiSeq 1000 instrument using the Illumina TruSeq Single
Read Cluster Kit v3 and SBS Kit v3. The base calling and data filtration were achieved by the
CASAVA1.8.2 software, while FastQ files were generated.
MATERIALS AND METHODS
27
2.2.11 Bioinformatic analysis of gene expression
The bioinformatic data analysis was supported by the group of Plant Genome and Systems
Biology (Helmholtz Center Munich). Therefore, FastQ files with the obtained single-end 50 bp
RNA seq reads were mapped against the repeat masked version of the Hordeum vulgare
cultivar Morex assembly v3 (Mayer et al., 2012). This process was conducted using TopHat
(v 2.0.11), a fast and efficient read-mapping algorithm with Bowtie2 (v 2.2.3), a high-
throughput short read aligner (Kim et al., 2013). To assemble the aligned reads into
transcripts and to quantify their relative abundance, the program Cufflinks 2.1.1 (Trapnell et
al., 2010) was used. Based on the read alignments and the barley annotation, the calculation
and identification of differentially expressed genes was done in comparison to the particular
untreated reference samples (DMSO solvent control). Therefore, the Cuffdiff 2.1.1 tool
(Trapnell et al., 2012) with default parameters and filtered for a false discovery rate (FDR)-
adjusted p value < 0.05 was used. The enriched gene ontology (GO)-terms were calculated
using the statistical analysis software R with bioconducter libraries topGO (Alexa and
Rahnenführer, 2014) and GOstats (Falcon and Gentleman, 2007). The visualization of the
differentially expressed genes of treated samples compared to untreated reference samples
was done by using the R programming tool gplots (Warnes et al., 2015).
2.2.12 cDNA synthesis
The complementary DNA (cDNA) was synthesized from 1500 ng of total RNA by a 2- step
reverse transcriptase reaction using the SuperScript II kit (Invitrogen, Life Technologies
GmbH, Darmstadt, Germany) according to the manufacturer´s instructions. The cDNA was
used for real time quantification analysis (see 2.2.14).
2.2.13 Primer design
The coding sequencing of the genes of interest (GOI), which was obtained from the Plant
Genome and System Biology database (www.pgsb.helmholtz-muenchen.de/plant/index.jsp;
Mayer et al., 2012), was the template for the primer design. All primers were designed using
the NCBI Primer-BLAST tool (Ye et al., 2012). Each primer sequence was checked for
hairpin, self- and hetero-dimer formation by using the integrated DNA technologies
OligoAnalyzer 3.1 tool (PrimerQuest® program, IDT, Coralville, USA). All primers were
ordered from Eurofins (Hamburg, Germany) and are presented in table 2-2.
MATERIALS AND METHODS
28
Table 2-2 Primers used for qRT-PCR
Locus/
accession
number
annotation sequence fwd primer sequence rev primer bp
MLOC_67053/ AK371210
basic helix-loop-helix (bHLH) DNA-binding superfamily protein
GCCTTCGCCTCATAAATTCC GGGTTCTCTGAAGATGGAGG 75
MLOC_68184 chitinase family protein GTCTCCACCCTACTATGGAC GCTCACAAGGTCCTTCCC 94
MLOC_22770/ AK356806/
chaperone protein DnaJ GGACGATGTTCTTGGAAGCG CAGTTCACAGGGCAGGACTC 93
MLOC_2643 subtilisin-chymotrypsin inhibitor-2A TAAGGACATGCCTGAAGCG GGTTGGTCCTGAAGTCGAG 74
MLOC_25773 60 kDa jasmonate-induced protein
TTGTTAAAGGCGAGCTTGAG CCGACCAAAAGATTGTCACC 105
MLOC_46400/ AK252675.1
thionin 2.2
TGCTACAACACTTGCCGTTTC ACATCTGGTTCACCGGATTCAG 140
AY220735 HvUBC2 (housekeeping gene) CTGCTTACCGACCCTAACCC GGCTCCGTATCATCCCATGG 132
MATERIALS AND METHODS
29
2.2.14 Quantitative real-time-PCR analysis
To analyze and quantify the expression levels of GOI, quantitative real-time-PCR (qRT-PCR)
was selected as the most precise and accurate method. The housekeeping gene HvUBC2,
the ubiquitin conjugating enzyme from Hordeum vulgare L. (GenBank accession number
AY220735; Jensen et al., 2007), was selected as the internal control to normalize the
expression level of the GOI. The qRT-PCR was conducted on a 7300 Real Time PCR
System (Applied Biosystems, Darmstadt, Germany). The DNA intercalating dye Power
SYBR® Green Master Mix (Thermo Fisher Scientific, Massachusetts, USA) was used
according to the manufacturer´s instructions. The analysis of the qRT-PCR results was
carried out with the 7300 System SDS v1.4 software (Applied Biosystems, Darmstadt,
Germany). To determine the primer efficiency, a qRT-PCR efficiency calculator
(www.thermofisher.com) was applied. The primers were utilized at a concentration of
5 pmol/µl per qRT-PCR reaction. The annealing temperature of all primers was 60 °C. For
the first qRT-PCR run of each GOI, the fragments were analyzed on a 2 % agarose gel,
containing 10 % ethidium bromide. The amplicon size was determined by a GeneRuler
100 bp plus DNA ladder (Thermo Fisher Scientific, Massachusetts, USA). The gel was run at
120 V and 200 mA.
2.2.15 Sequencing of qRT-PCR products
To proof the sequence of the qRT-PCR amplicons, a sanger sequencing amplification was
performed on the purified qRT-PCR products using the BigDye Terminator v3.1 Cycle
Sequencing Kit according to its manual (Thermo Fisher Scientific, Massachusetts, USA). The
qRT-PCR fragments were purified by applying the MinElute Reaction Cleanup Kit (Qíagen
GmbH, Hilden, Germany) according to the manufacturer´s instructions. Five nanogram of
qRT-PCR product and 10 pmol/µl gene specific primers were utilized in the Sanger
sequencing reaction, which were performed in a 96 well plate. The amplification was
conducted on a peqSTAR 96X universal cycler (peqlab, VWR international, Erlangen,
Germany) with the following PCR-profile: initial step 96 °C 1 min and for 35 cycles: 96 °C
15 s, 60 °C 4 min. The PCR products were purified by adding 50 µl of 100 % ethanol and
incubated for 5 min at RT, shielded from light. After centrifugation (4 °C, 40 min, 2000 g,
sigma 4K15, Osterode am Harz, Germany) the ethanol was removed by an upside down
centrifugation at 4 °C for 1 min and 185 g. Then 250 µl of 70 % ethanol were added to the
samples and a centrifugation step at 4 °C for 15 min and 2000 g was performed. After
ethanol removal (4 °C, 1 min, 185 g) the samples were dissolved in 50 µl LiChrosolv (Merck
Chemicals GmbH, Darmstadt, Germany). The sequencing was performed by the Genome
Analysis Center (GAC, Helmholtz Center Munich, Germany). The sequenced qRT-PCR
MATERIALS AND METHODS
30
fragments were validated with the BioEdit sequence alignment editor 7.2.5 (Hall, 1999) and
the NCBI nucleotide blast online tool (McGinnis and Madden, 2004).
2.2.16 Phytohormone determination
The determination of the phytohormone SA was kindly performed by the Department of
Animal Biology, Plant Biology and Ecology of the UAB in Spain. The leaves of 10-day-old
barley plants, grown in the duran system (see 2.2.2), were harvested after 4, 8, 12 and 24 h
of AHL or control treatment (2.2.3). Per biologically independent experiment (n=3),
2 technical replicates were harvested per time point and treatment. The analysis of SA
extracted from barley leaf material was carried out by using liquid chromatography-
electrospray ionization-tandem mass spectrometry (LC–ESI–MS/MS) following the method of
Segarra et al. (2006; Llugany et al., 2013). Under cold conditions, 0.25 g frozen plant
material was ground with liquid nitrogen into fine plant tissue powder, extracted with 750 μl
methanol:water:acetic acid (90:9:1 v/v/v), and centrifuged for 1 min at 10,600 g at room
temperature. The supernatants were evaporated under nitrogen atmosphere and the
residues resuspended in 200 μl of 0.05 % acetic acid in water:acetonitrile (85:15 v/v). The
leaf extracts were then filtered through a 0.45 μm pore size cellulose acetate membrane filter
(Corning Costar Spin-X – centrifuge tube filter, Sigma Aldrich, Steinheim, Germany). The
internal standard for all samples was deuterated salicylic acid (d6SA 98 atom % D -Sigma-
Aldrich, Steinheim, Germany) at 500 ppb. For the quantification of the phytohormones an
additional standard calibration curve was needed, while control plant samples were spiked
with SA (Sigma-Aldrich, Steinheim, Germany) solutions ranging from 5 to 150 ppb. The
extraction was performed as described above. The separation of the hormones was
conducted using an high performance liquid chromatography (HPLC) Agilent 1100 (Waldrom,
Germany) system with a Discovery C18 column (5 µm, 2.1 x 9150 mm ID, Supelco,
Bellefonte, USA) under reversed phase conditions at a constant flow rate of 0.6 ml/ min by
applying a linear gradient of eluents (buffer A: H2O, 0.05 % acetic acid; buffer B: acetonitrile
with the following proportions of B [t (min), % B]: (0, 10), (3, 15), (5,100), (6, 100), (7, 10),
and (8, 10), with 8 min of re-equilibration. The injection volume was 10 µl. For the MS/MS
experiments on an API3000 triple quadrupole mass spectrometer (PE Sciex, Concord,
Ontario, Canada), the Turbo Ion spray source in negative ion mode was used to analyze the
phytohormone.
The determination of jasmonates and ABA was kindly performed by the Department of Cell
and Metabolic Biology of the Leibnitz Institute of Plant Biochemistry. The leaves of 10-day-
old barley plants, grown in the duran system (see 2.2.2), were harvested after 4, 10, and
MATERIALS AND METHODS
31
22 h of AHL or control treatment (2.2.3). Two plants were pooled per treatment and biological
replicate (n=5). Phytohormones were quantified simultaneously using a standardized ultra-
performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS)-based
method according to (Balcke et al., 2012). Frozen plant material was homogenized and
50 mg of each sample were extracted with 500 μl methanol containing 0.1 ng/μl of each
stable isotope-labeled internal standard (2H6-ABA, 2H6-JA, 2H2-JA-Ile). The extraction was
conducted using a bead mill (FastPrep24 instrument, MP Biomedicals LLC, Santa Ana, CA,
USA) at a speed of 6.5 m/s2 for 30 s. After centrifugation at 20000 g (5 - 10 min, 0°C), 450 μl
of supernatant was transferred into a polypropylene tube, diluted with water to 10 %
methanol to an end volume of 5 ml. Solid phase extraction was performed in 96-well filter
plates and deep well receiving plates in conjunction with centrifugation. Therefore, the plates
were packed with 50 mg of a strong cation exchange HR-XC material (Macherey & Nagel,
Düren, Germany), while the material was conditioned with 1 ml methanol and equilibrated
with 1 ml water. The plant extracts were loaded on the wells in 5 times 1 ml-portions. The
elution of the fraction containing the phytohormones was performed with 900 μl acetonitrile.
The eluate fraction was then stored at −20°C. For the calibration curve a serial dilution of
each individual standard was prepared, ranging from 0.01 nmol/l – 500 μmol/l. For
quantification, 20 mg of lyophilized plant material was spiked with a standard mixture
containing 2H6- ABA, 2H6-JA, 2H2-JA-Ile at 8 concentration levels (0.14 – 27.33 μg/l). These
samples were methanol-extracted and subjected to solid phase extraction as described
above. The separations were conducted on a Waters HSS T3 C18 column (1 x 100 mm,
particle size 1.8 μm) using a Waters ACQUITY UPLC System. Eluents A and B were water
and 90 % aq. acetonitrile, respectively, both containing 0.1 % HCOOH, 0.3 mmol/l
NH4CH3COO (adjusted to pH 4.0 with acetic acid). The elution started isocratically for
0.5 min at 5 % eluent B and then consecutive linear gradients to 30, 80 and 95 % eluent B in
5, 0.5, and 2 min, respectively were applied, while the flow rate was 150 μl/min and the
column temperature was set at 40°C. The phytohormones were detected by ESI-MS/MS
using a 3200 Q TRAPW LC/MS/MS System hybrid QqLIT mass spectrometer equipped with
an ESI-TurboIon-Spray™ interface, operating in negative ion mode and controlled by Analyst
1.5 software (AB Sciex, Darmstadt, Germany). The LC-ESI source operation parameters
were as the following: ion spray voltage, -2700 V; nebulizing gas, 40 psi; source temperature,
550°C; drying gas, 40 psi; curtain gas, 25 psi.
MATERIALS AND METHODS
32
2.2.17 Flavonoid determination
The determination of flavonoids was kindly performed by the by the team of Dr. Heller of the
Institute of Biochemical Plant Pathology of the Helmholtz Center Munich. The leaves of 10-
day-old barley plants, grown in the duran system (see 2.2.2), were harvested after 0, 72, and
96 h of AHL or mock treatment (2.2.3). Per treatment and biological replicate (n=2) 2 plants
were pooled. Frozen plant material was ground with liquid nitrogen in precooled mortars to
fine plant tissue powder. Total flavonoids were extracted from 50 mg plant material with
500 µl methanol. The samples were incubated, shielded from light, for 1 h on a shaker
(NeoLab, DRS-12). After centrifugation (10 min, 9000 g, RT), the supernatant was collected
and the flavonoid content was determined by HPLC using a Beckman 507e “Gold 7.11”
HPLC system. Ten µl of the plant methanol extract were injected. The separation was
performed on a C18 ProntoSIL Spheribond ODS 2 column (5 μM, 250 × 4.6 mm, Bischoff,
Leonberg-Ramtel, Germany) under reversed phase conditions, applying a linear gradient of
eluents (buffer A: H2O, 0.1 % ammonium formate; buffer B: 90.1 % methanol, H2O and 0.1 %
ammonium formate) and a flow rate of 1 ml/min. The gradient started with 100 % A for 5 min,
ramped up to 100 % B 40 min, remained at 100 % in B for 5 min, and finally ramped down to
100 % A within 5 min. Flavonoid content was measured at 280 nm in a photodiode array
detector (Beckman 168) and identified by comparison of the spectra and retention times in
relation to a saponarin standard (Sigma Aldrich, Steinheim, Germany). A calibration curve
was set up from a saponarin standard solution, ranging from 0.05 to 0.4 mg/l.
2.2.18 Preparation of protein crude extract
After 10 days of growth in the duran system (see 2.2.2), barley plants were AHL or mock
treated for 6,12 and 24 h. Three plants per sample and treatment were pooled and frozen in
liquid nitrogen. The protein crude extract was prepared following the method of Messner and
Schröder (1999) in modified form. Briefly, 0.5 g of frozen plant material was ground with
liquid nitrogen in precooled mortar into fine plant tissue powder and transferred into a 25 ml
beaker. Immediately 3 ml of extraction buffer (0.1 M borate buffer pH 8.8, 10 mM
dithiothreitol, 1 % polyvinylpyrrolidon K90) were added and the solution was stirred on ice for
5 min. The extract was centrifuged for 20 min at 15.000 g and 4 °C (centrifuge type JA 25,
Beckmann Coulter GmbH, Krefeld, Germany). The supernatant, representing the protein
crude extract, was collected and stored at –80°C until further usage.
MATERIALS AND METHODS
33
2.2.19 Enzyme activity measurement
The phenylalanine ammonia lyase (PAL) enzyme activity was assayed in sterile 96 well UV-
plates (Greiner, Frickenhausen, Germany) by using a SpektraMax Plus 384
spectrophotometer (Molecular Devices, Ismaning, Germany). The activity was determined
according to Hahlbrock et al., (1995) with some modifications. The PAL activity was
determined based on the rate of cinnamic acid formation, assayed spectrophotometrically
based on the absorbance at 290 nm (ε= 10.9 mM-1cm-1). In brief, 40 µl of the crude extract
(see 2.2.18) were mixed add 200 µl with 0.1 M borate buffer pH 8.8, containing L-
phenylalanine to a final concentration of 10 mM. During the incubation of 1.5 h at 30 °C, the
cinnamic acid production was determined in intervals of 15 min. Additionally, the pathlength
of each well was measured. The blank contained 0.1 M borate buffer. All samples were
measured in technical triplicates. The results of the enzyme kinetics were calculated in
rates/cm by the software of the spectrophotometer (SoftMax Pro 4.6), presenting the slope of
the extinction over time (milliOD/min) including the pathlength. To calculate the specific
activity, the total protein concentration was determined with the method of Bradford
(Bradford, 1976). Briefly, the appropriate diluted enzyme extract was incubated with 200 µl of
1:10 diluted Bradford reagent (Fluka, Steinheim, Germany) for 10 min at RT, after which the
absorption was measured at 595 nm. The quantification was performed using a bovine
serum albumin standard curve. To calculate the enzyme activity, the following equation was
applied:
𝐴𝑐𝑡𝑖𝑣𝑖𝑡𝑦 = 𝐸 ∙ 𝑉𝑤𝑒𝑙𝑙
𝜀 ∙ 𝑑 ∙ 𝑡 ∙ 𝑣𝑒𝑛𝑧𝑦𝑚𝑒 𝑒𝑥𝑡𝑟𝑎𝑐𝑡= 𝑛𝑚𝑜𝑙/𝑙 ∙ min = 𝑛𝑘𝑎𝑡/𝑚𝑙
For the calculation of the specific activity (nkat/mg), the activity was divided by the protein
concentration.
2.2.20 Bacterial inoculation and pathogen infection assay
10-day-old barely plants that had been grown in the beaker system (see 2.2.2) were treated
for 24, 72 and 96 h with AHLs. The inoculation with Xanthomonas translucens pv. cerealis
(Xtc) strain LMG 7393 (see 2.1.2) was done as described in Dey et al., (2014) and was
supported by the team of Dr. Vlot of the Institute of Biochemical Plant Pathology of the
Helmholtz Center Munich. An overnight bacteria culture was used for inoculation (see 2.1.2).
The inoculum was removed from the plate with a sterile pipet tip and resuspended in 1 ml of
10 mM MgCl2. The optical density of this suspension was measured at a wavelength of
MATERIALS AND METHODS
34
600 nm using a photometer (DU720 UV/Vis spectrophotometer, Beckman Coulter, Krefeld,
Germany). To yield a concentration of 105 colony forming units per milliliter (CFU /ml), which
corresponds to an OD600 = 0.0002, the bacterial culture was diluted with an appropriate
volume of 10 mM MgCl2. The second leaf of 10-day-old barley plants was syringe-infiltrated
with 1 x 105 CFU/ml, at the tip from the adaxial side of the leaves. The infiltration was
performed in a sterile hood, to avoid contaminations and then the plants were transferred in
the sterilized mini greenhouse. After 4 days, the second leaf was harvested and used for
bacterial growth calculation. For this, 3 leaf discs with a diameter of 6 mm were cut per
second leaf (8 technical replicates per treatment). The discs were shaken at 600 rpm in
500 µl of 10 mM MgCl2 with 0.01 % Silwet L-77 (Lehle seeds, Texas, USA) for 1 h at RT. The
extracted bacteria were diluted in 5 serial 1:10 steps in 10 mM MgCl2. Twenty microliters of
each dilution were plated onto TSA plates and incubated for 4 days at 28 °C. The colonies of
a certain dilution were counted and CFU/cm2 was calculated.
RESULTS
35
3 RESULTS
3.1 Impact of AHLs on the morphology of barley plants
In the rhizosphere plants are exposed to AHLs and respond in a tissue-specific way. The
impact of different AHLs on physiological and root-shoot parameters has been reviewed in
recent literature (Schikora et al., 2016). In the latest publication of Götz-Rösch et al. (2015),
tendencies for increased shoot length and fresh weight in 17-day old barley plants, grown in
an axenic glass beads based growth systems (Götz et al., 2007) have been reported. The
influence on root parameters turned out to a lesser extent. Due to the invention of a novel
axenic growth system (described in chapter 2.2.2 C), a different set of AHLs and sampling
time points, it was necessary to prove the influence of AHLs again. The objectives of this
chapter are to elucidate the influence of C8-HSL and C12-HSL on growth and root
development of barley plants.
3.1.1 Fresh and dry weight determination of root and shoot
The influence of C8- and C12-HSL on the morphology of 10-day-old barley plants was
analyzed by determining the fresh and dry weights of roots and shoots. The results are
represented by boxplots as percentage of controls (fig. 3.1). Because the data was normally
distributed the statistical significance was tested using an ANOVA (p< 0.05) with Tukey post-
hoc procedure. Plants treated with both bacterial signaling derivatives showed significantly
increased root (fig. 3.1 A) and shoot (fig. 3.1 B) fresh weights. Here, short-chain AHL caused
a gain of 42.85 % of root (p≤ 0.0015) and 30.17 % of shoot (p≤ 0.0017) biomass. After long-
chain HSL treatment, root fresh weights increased for 28.46 % (p≤ 0.044) and shoot fresh
weights for 23.97 % (p≤ 0.013), compared to controls. Regarding dry weights, also both AHL
treatments produced a significant increase. The biomass gained after C8-HSL application
was 6.16 % (p≤ 0.001) and 6.67 % (p≤ 0.0001) in root (fig. 3.1 C) and shoot (fig. 3.1 D),
respectively. The cultivation on C12-HSL containing medium achieved a rise of 2.18 % (p≤
0.0083) and 4.47 % (p≤ 0.0001) of the root (fig. 3.1 C) and shoot (fig. 3.1 D) dry weights,
respectively. When comparing within both AHL treatments, it turned out that the C8-HSL
application achieved an increase by a factor of 1.5 in the root fresh weight and even a factor
of 2.82 in the root dry weights compared to long-chain AHL treatment. Concerning shoot
weights, a similar trend was observed. Here, the effect of short-chain AHL application is
higher than with the C12-HSL application by a factor of 1.25 in the fresh weights and by 1.5
in the dry weights. Furthermore, it is noticeable that the dry weight values show a lower
fluctuation than the ones from the fresh weights. To sum up, C8-HSL application had a
RESULTS
36
Figure 3.1 Influence of C8- and C12-HSL application on the fresh and dry weights of barley roots and shoots. Plants were grown axenically for 10 days in MS-agar medium supplied with 10 µM AHL. Controls contained the same amount of solvent (DMSO) as used in AHL treatments. Values are presented in percentage to the control. (A) root fresh weights. (B) shoot fresh weights. (C) root dry weights. (D) shoot dry weights. The dark horizontal line represents the median (n=4), boxes indicate the range between first and third quartiles and whiskers extend to the extremes. Outliers are indicated by
points. Statistical significance was tested using ANOVA with Tukey post-hoc procedure. * shows significant difference of treatment versus control groups at p≤ 0.05). (C)+(D) are published in Rankl et al. (2016).
greater influence on root and shoot tissue of fresh and dry weights than the C12-HSL
treatment had, compared to controls.
3.1.2 Root parameters
On the basis of the positive influence of AHLs on plant biomass, their effect on the root
structure was analyzed. The results are displayed in figure 3.2 and are represented by
boxplots. When data were found to be normally distributed, the statistical evaluation was
performed by analysis of variance (ANOVA, p< 0.05) and Tukey post-hoc procedure in the
software package R (V. 3.2.2., R Core Team, 2014), otherwise a robust ANOVA and post-
hoc procedure was applied (Wilcox, 2005). In general, barley control plants showed an
RESULTS
37
Figure 3.2 Influence of C8- and C12-HSL application on different root parameters of barley. Plants were grown axenically for 10 days in MS-agar medium supplied with 10 µM AHL. Controls contained the same amount of solvent (DMSO) as used in AHL treatments. (A) total root length. (B) average diameter. (C) number of root tips. (D) average root tips per length. (E) total surface area. The dark horizontal line represents the median (n=4), boxes indicate the range between first and third quartiles and whiskers extend to the extremes. Outliers are indicated by points. Statistical significance was tested using ANOVA with Tukey post-hoc procedure. * shows significant difference of treatment versus control groups at p≤ 0.05).
average root length ranging from 22 to 26 cm. After a 10 µM C8-HSL treatment, roots
displayed a tendency for elongation, although not significant, whereas the root length was
not affected by the C12-HSL treatment (fig. 3.2 A).
RESULTS
38
Figure 3.3 Developmental response of barley roots to AHL treatment. Representative pictures are taken from plants grown axenically for 10 days in MS-agar medium supplied with 10 µM AHL or 0.025 % DMSO (solvent control). (A) Control, (B) C8-HSL, (C) C12-HSL. Controls received the same amount of solvent (DMSO) as used in AHL treatments. Scale bar: 1 cm. This figure is published in Rankl et al. (2016).
Other root parameters like total surface area and average diameter showed similar
tendencies. Here, an AHL application caused almost no difference compared to controls
(fig. 3.2 B+E). Additionally, the average number of root tips per plant was characterized. In
control plants, 23 to 33 tips per plant were counted, whereas after both, short- and long-chain
AHL application, a significant increase of 41.4 % (p ≤ 0.031 for C8-HSL) and 39.2 %
(p ≤ 0.043 for C12-HSL; see fig. 3.2 C) in root tip formation was noticeable, compared to
controls. This effect is displayed in figure 3.3, where it is apparent that plants being treated
with AHLs start to develop more root tips than mock treated plants grown in the axenic
system.
To emphasize this fact, the number of root tips per total root length was calculated. Here, the
result clearly demonstrates more tips per root system after AHL application (fig. 3.2 D). The
C8-HSL treatment tended to increase the amount of tips per root for 19 %, but this effect was
not significantly different to controls due to scattering values. However, the C12-HSL gave a
28 % significant gain of the number of tips per root length (p ≤ 0.032). Taking into account
that every root tip stands for a single root, it could be hypothesized that in fact AHLs have the
ability to influence post-embryonic root development by the stimulation of lateral root
formation. Our results clearly demonstrate that the alterations in the root system architecture
are AHL acyl-side chain length dependent. Furthermore, the observed root weight increase
after an AHL treatment correlates well with the additional stimulation of root tips.
RESULTS
39
Figure 3.4 Schematic diagram of NO determination in excised barley roots. Roots were cut from 3 to 4-day old barley seedlings, treated with AHLs and then stained with DAF-FM to reveal NO accumulation. (A) Diagram of the relative fluorescence along the barley root in (B). (B) Representative root for all measurements with marked zones in which (a) indicates the location of the calyptra and (b) the elongation zone. Scale bar: 1 mm. This figure is published in Rankl et al. (2016).
3.2 AHL induced reactions in root tissue
In the previous chapter it could be shown that AHL also possess the potential of plant
morphology alteration. In this chapter initial and early responses of the root tissue and of
single root epidermal cells upon AHL application should be elucidated.
3.2.1 Nitric oxide production in the root of barley
Nitric oxide is a highly volatile and versatile gas and plays a key role in many signal
transducing processes (reviewed in Beligni and Lamattina, 2001) and is an important factor
in root development (Correa-Aragunde et al., 2004; Méndez-Bravo et al., 2010). Alkamides,
a group of fatty acid amides structurally related to AHLs, reportedly induced lateral formation
in A. thaliana roots. This fact was related to an increased NO accumulation, determining a
NO dependent regulated process (Méndez-Bravo et al., 2010). Since we could show an AHL
induced lateral root formation in barley roots (fig. 3.3) an answer had to be sought to the
question whether AHLs could effectuate a NO accumulation in root tissues.
To do this, NO-related relative fluorescence was analyzed in excised roots of 3- to 4-day-old
barley plants. Hereby the fluorescence was determined along the whole root (fig. 3.4 A) by
counting the emission intensity in selected areas employing the software Image ProPlus 6.
RESULTS
40
Figure 3.5 AHL treatment causes NO accumulation in excised barley roots. Average fluorescence intensity in the calyptra and elongation zone of control and AHL-treated roots. C8-HSL and C12-HSL were applied at 1, 10, 100 µM. Controls received the same amount of solvent (DMSO) as used for AHL treatments. Values are means ± SD of triplicates. Significance was tested by ANOVA (‘*’= p≤ 0.05).
The calyptra and elongation zone (3 mm from root tip) were the selected zones for NO
determination (fig. 3.4 B). Additionally, the NO scavenger cPTIO was applied to confirm that
NO induction occurs due to AHL treatment. SNP, a NO donor, constitutes the positive control
in this assay (fig. 3.6). In the present experiment, the data were found to be normally
distributed and therefore the statistical evaluation was performed by an analysis of variance
(ANOVA, p< 0.05). Both the calyptra and the elongation zone (fig. 3.5) showed a change in
fluorescence after AHL treatment, compared to the control. Both AHL derivatives tested in all
concentrations generated a significant NO accumulation in each root part, compared to the
control. However, no clear concentration-dependent effect could be observed. The
fluorescence of the control roots hardly increased in both root zones. Overall, the application
of AHLs induced in the elongation zone a 5 times higher reaction than in the root tip. In the
calyptra, the response to C8-HSL treatment resulted in NO production with values ranging
from 6- to 11-fold higher than the control.
RESULTS
41
Figure 3.6 Effect of AHLs on NO accumulation in excised barley roots. Roots were cut from 4-day-old barley seedlings, treated with AHLs and then stained with DAF-FM to reveal NO accumulation. Control contained 0.025 % DMSO; C8- and C12-HSL were applied in a concentration of 10 µM; Reduction of NO accumulation was achieved by application of the NO scavenger cPTIO; The NO donor SNP served as positive control. Representative pictures were taken for each treatment. The experiment was done in triplicates. Parts of this figure are published in Rankl et al. (2016).
The application of the long-chain AHL led in general to a lower NO accumulation (2- to 3-
fold) in both zones. Compared to control roots, C8-HSL application yielded a 6.5- to 7.5-fold
increase of the fluorescence in the elongation zone, whereas C12-HSL application yielded
signals ranging from 3.5- to 4.5-fold upregulation. Overall, C12-HSL mediated NO production
was lowest in both zones, which is clearly observable in the fluorescence captures of the
different treatments presented in figure 3.6. Here, roots treated with the bacterial signaling
molecules showed stronger fluorescence than controls, while the highest fluorescence signal
was obtained after C8-HSL treatment. Furthermore, AHL induced NO accumulation was
suppressed when the NO scavenger cPTIO was applied while the use of the NO donor SNP
resulted in strong green fluorescence (fig 3.6). This might indicate that AHLs have the ability
to promote NO accumulation in roots.
3.2.2 Investigation of the cell viability
Before conducting electrophysiological investigation for ion uptake and membrane potential
measurements, it was necessary to prove whether root cells are still alive after AHL
treatments. Further, it was important to select the optimum cultivation method and medium
for the ion flux measurements that would not affect the root epidermal cells because in the
present study it was demonstrated that AHLs induce the accumulation of NO. NO is an
important key player in the reactive oxygen intermediates induced hypersensitive response,
which could lead to local cell death (Delledonne et al., 1998; Delledonne et al., 2001). To
prove all this, barley seedlings were grown in tap water, on agar plates, in half strength
Hoagland media, and buffer solutions to test the cell vitality. Cell viability was also analyzed
after pure AHL treatments and after the completion of K+ net ion flux measurements. Treated
barley roots were analyzed for membrane integrity with FDA/PI double staining (fig. 3.7).
Both the cultivation in tap water and in half strength Hoagland medium caused dead or at
least damaged cells, indicated by a red/orange fluorescence in root epidermal cells in figure
3.7 A and C, respectively; the cultivation on agar-agar-medium did as well, but to a lesser
RESULTS
42
Figure 3.7 Vital staining of excised barley roots after different growing conditions and treatments. Pictures show representative fluorescence of a single experiment. Each experiment was done in triplicate. Barley plants were grown in (A) tap water, (B) agar-agar gel, (C) half strength Hoagland medium, (D) buffer solution (also used for ion flux measurements), (E) and (F) show roots after 20 min of 100 µM C8-HSL treatment in buffer solution, (G) control root (treated with DMSO in buffer solution), (H) like (E) after finishing the K+- flux-measurements. Parts of this figure are published in Rankl et al. (2016).
extend (fig. 3.7 B). Further, it is noticeable that the solid medium cultivation and also the
Hoagland solution cultivation both lead to root hair development, compared to all other
treatments and conditions, which could present a disturbing factor for electrophysiological
measurements. Figure 3.7 D demonstrates a root grown in buffer solution, representing the
standard medium for K+-ion net flux and membrane potential measurements (chapter 2.2.7).
All epidermal cells display green fluorescence. Neither the application of 100 µM C8-HSL for
20 min (fig. 3.7 E+F) or longer (fig. 3.7 H), nor the application of the solvent DMSO, which
served as solvent control in all experiments, caused red fluorescence in root epidermal cells.
Since all cells exhibited a green fluorescence, it was clear that PI was unable to penetrate
the cells. We conclude that neither AHLs, the produced NO, nor the cultivation medium did
affect the integrity of root´s cell membrane.
RESULTS
43
3.2.3 Influence of AHLs on the potassium budget of root epidermal
cells
It has been demonstrated that microbial plant growth promoting agents, when being used as
inoculants in agriculture, positively influence the uptake activity of different nutrients in plants
(reviewed in Adesemoye and Kloepper, 2009). Besides the primary macronutrients nitrogen
and phosphorus, potassium plays an important role in the plants lifecycle (reviewed in
Maathuis, 2009; Nieves-Cordones et al., 2014). An important question was whether the
observed AHL-mediated biomass gain in barley could be linked to an increased K+ uptake.
Figure 3.8 shows the net K+ flux kinetics after application of different concentrations of C8-
HSL. A slight tendency for a K+ uptake became visible at 10 min after 1 µM treatment. At the
same time point (total time point 30 min), the supply of 10 µM C8-HSL resulted in an
increase of the net K+ influx which stayed elevated until the end of the measurement. The
application of 100 µM C8-HSL did not result in elevated K+ uptake by the root as was the
case in controls.
Figure 3.8 10 µM C8-HSL induces K+ influx in intact barley roots. Average net K+ flux at the elongation root zone (3mm from root tip) of barley seedlings. 1, 10 and 100 µM of C8-HSL were added at around 15 min (as indicated by arrow). Controls received the same amount of solvent (DMSO) as used for AHL treatments. Values are means of triplicates with standard error bars. This figure is published in Rankl et al. (2016).
RESULTS
44
Figure 3.9 C12-HSL induces K+ influx in intact barley roots. Average net K+ flux at the elongation root zone (3 mm from root tip) of barley seedlings. 1, 10 and 100 µM of C12-HSL were added at around 15 min (as indicated by arrow). Controls received the same amount of solvent (DMSO) as used for AHL treatments. Values are means of triplicates with standard error bars. This figure is published in Rankl et al. (2016).
In contrast, the application of C12-HSL led to an influx response for all concentrations (fig.
3.9). All tested concentrations showed a similar kinetic trend among each other, but with a
concentration dependent time shift. After 45 min the highest potassium uptake was reached
with 1 µM C12-HSL application with 27.9 K+ nmol m-2 s-1. Ten and 100 µM resulted in
26.2. nmol m-2 s-1 potassium influx. Taken together, the long-chain AHL induced a totally
different reaction pattern in the K+ net flux compared to the one caused by C8-HSL, where
only the concentration of 10 µM seemed to be an active concentration.
3.2.4 Manipulation of the membrane potential by AHL application
Since we could demonstrate an altered K+ intake after AHL application, the question arises
whether the Em could also be influenced by the signaling compounds. As the C8-HSL
showed an explicit effect in the previous experiment, the influence of the short-chain AHL on
the Em was analyzed. The bacterial signaling molecules were applied in a concentration of
10 µM (experimental procedure see chapter 2.2.8) because of its highest observed impact on
RESULTS
45
Figure 3.10 Membrane hyperpolarization of root epidermal cell treated with 10 µM C8- HSL. (A) The graph shows a representative kinetics of a membrane potential measurement experiment. The experiment was done in triplicate. The graph is published in Rankl et al. (2016). (B) enlarged section of the membrane hyperpolarization in (A) with a time interval indicating the progress of the membrane potential to its maximum negative value. Red arrow marks AHL application. a= blank measurement, b= measurement noise, c= hyperpolarization.
B
A
the K+ uptake. Figure 3.10 A shows the typical kinetics of an Em measurement, where single
steps of the measurement are marked. A successful impalement in the membrane was
recognizable as a decline of the Em. The resting potential of a plant cell is around -100 mV
(Higinbotham, 1973).
In the diagramed figure 3.10 A, the Em amounts to -122 mV ± 2 mV prior to AHL application.
The AHL addition is characterized by measurement noise, occurring because of the motion
RESULTS
46
of the measuring buffer. Directly after that the Em started to slope to a more negative value,
indicating a gradual hyperpolarization of the root cell membrane. After the hyperpolarization,
the Em started to recover to the output value of the resting potential. Figure 3.10 B shows an
enlarged section of the hyperpolarization event in figure 3.10 A. Here it is clearly obvious that
the membrane potential drops after the C8-HSL addition to -131 mV within 22 s and
continues towards a more negative potential of -134.6 mV within the next 10 min. In other
experiments, the C8-HSL consistently induced a hyperpolarization in the root epidermal cells
of barley, with the magnitude of the response varying, depending on the value of the
previous blank measurement Em.
3.3 AHL induced reactions in the shoot
In recent publications it has been demonstrated that AHLs are transported via the symplast
into the shoot tissue, after being applied to the roots (Götz et al., 2007; Sieper et al., 2014).
This leads to the assumption that AHLs and their metabolites (Götz-Rösch et al., 2015)
interact with the plant in different organs and modes of action and may trigger different
reactions. Until now, only little information is available on how plants react. Therefore, the
aim of this chapter will be to shed some light on the influence of AHLs on the barley
transcriptome and on some distinct selected genes. Additionally, it will be analyzed whether
previous reports about AHL inducing resistance in A. thaliana and barley (Schuhegger et al.,
2006; Schikora et al., 2011; Hernández-Reyes et al., 2014) can be achieved with C8-HSL
and C12-HSL application in the cultivation system used here.
3.3.1 Transcriptome analysis of leaf tissue
The investigation of gene expression changes in barley leaves after AHL application was
carried out using the next generation sequencing platform Illumina Hiseq 1000. The
procedure of the sequencing was kindly provided by the Center of Excellence for Fluorescent
Bioanalytics (Regensburg) and the data analysis was supported by the group of Plant
Genome and Systems Biology (Helmholtz Center Munich). The whole RNA seq procedure,
analysis, and plant growth is explained in the material and methods section 2.2.9 – 2.2.11.
The mapping statistics of all treatments are presented in figure 3.11. The rate for unmapped
reads amounted between 4.8 % and 8 % per sample. In total, 553,764556 reads (50 bp size)
were obtained from one cDNA library and resulted in a 94 % transcriptome mapping
percentage in the end with 521,769604 reads, overall. Multi-dimensional scaling plots of the
RNA seq data (fig. 7.1 in the appendix part) are used to show the distribution of all samples
per time point and replicates in a distance-based relationship. Here, samples that are near
RESULTS
47
Figure 3.11 Transcriptome mapping of total reads per treatment and time point classified in mapped and not mapped reads. Bars represent mean value of 2 biological replicates that have been sequenced. D represents the control treatments, C8 the C8-HSL and C12 the C12-HSL treatments.
each other in the 2-dimensional space have similar expression pattern. The samples of the 3
time points cluster separately. The samples of the 24 h time point are clearly separated and
therefore dissimilar from the 6 and 12 h samples. Furthermore, samples taken at 12 h are
also slightly distinct to the ones of 6 h and are highly dissimilar to the 24 h sample point. A
small overlap is found in 6 and 12 h after AHL treatment. Unfortunately, the replicability
between 2 replicates of each treatment was relatively small.
3.3.1.1 Overview of up- and down-regulation of genes after AHL treatment
Based on the read alignments and the barley annotation, the calculation and identification of
differentially expressed genes was done in comparison to the particular untreated reference
samples (DMSO solvent control) by using the Cuffdiff 2.1.1 tool (Trapnell et al., 2013) and
filtering for a false discovery rate (FDR) adjusted p-value < 0.05. The similarity of the gene
expression patterns between the different treatments and time points was visualized using
heat maps (fig. 3.12 A). In each heat map both replicates that have been sequenced are
compared to the corresponding control, while only differentially expressed genes are
displayed. Overall, changes in the expression profile are observable in all AHL-samples.
Treatments with the long-chain AHL provoked the regulation of more genes than the C8-HSL
treatment did, indicated in red color. Unfortunately, the similarity between 2 replicates of 1
treatment was relatively small. Only the samples C8_6h, C12_24h, and C12_6h to a lesser
extent, show similar differential gene regulation within the 2 replicates. These findings are in
concert with the result of the multi-dimensional scaling plots, indicating a low replicate
correlation (fig. 7.1). The heat maps are combined with hierarchical clustering, based on the
similarity in the expression pattern between the genes. Within the above-mentioned
conditions, 342 genes were found to be differentially regulated for all samples, wherein the
long-chain AHL provoked a higher influence on the transcriptome than the short-chain AHL
RESULTS
48
did. Figure 3.12 C gives an overview about the total gene regulation, represented by Venn-
diagrams. Here, samples that have been treated with C8-HSL displayed a lower amount of
differentially regulated genes, whereas 54 and 23 genes were down- and up-regulated,
respectively (fig. 3.12 B+C). A larger amount of genes responded to C12-HSL application,
where 75 and 190 genes were down- and up-regulated, respectively (fig. 3.12 B+C).
RESULTS
49
A
RESULTS
50
Figure 3.12 Overview of the transcriptional reprogramming of barley leaves after application of short- and long-chain AHLs for 6, 12, and 24 h. AHLs were added to a final concentration of 10 µM to 10-day-old, axenically grown barley plants. Genes were selected by a cutoff of p-value of ≤ 0.1 and a log2 fold change of >1. (A) Heat maps of genes display significant transcriptional changes at indicated time points and treatments. Here, the lettering A and B indicates the 2 replicates that have been sequenced and controls containing the same amount of solvent (DMSO) as used for AHL treatments. The dendrogram shows hierarchical clustering, based on the similarity in the expression pattern between genes. (B) Number of significant differential expressed genes after AHL treatment. (C) Venn diagram of genes up-, down-, and commonly regulated by each AHL derivative. In total, 342 genes were differentially regulated.
B
C
RESULTS
51
The long-chain AHL induce an 8-fold higher induction of up-regulated genes, compared to
the short-chain AHL treatment. Regarding the long-chain AHL, the strongest reaction in up-
regulated genes of barley was achieved after 12 h of their application, followed by 6 and 24
h. A different impression is conveyed by the C8-HSL derivative, where positive regulations
were achieved with 12 and 24 h incubations, while in addition a high number of genes was
down-regulated after 12 h. Among all of these genes, only 18 respond with down-regulation
after 12 h of both AHLs, whereas only 1 is up-regulated after half a day. After 24 h of dual
AHL application 9 genes were up and none down-regulated. After 6 h both AHL derivatives
induce the up- and down-regulation of 1 gene (fig. 3.12 C).
3.3.1.2 Gene ontology analysis of differential expressed genes in barley in
response to AHLs
A gene ontology (GO)-analysis was performed to achieve an overview which potential gene
functions are stimulated by AHL treatments. The enriched GO-terms were calculated using
the statistical analysis software R with bioconducter libraries topGO (Alexa and
Rahnenführer, 2014) and GOstats (Falcon and Gentleman, 2007). Figure 3.13 displays
differentially regulated genes after both AHL treatments, pooled in each AHL treatment
method without considering the 3 time points and using a p-value of ≤ 0.1. The GO classifies
the functions of an annotation along 3 aspects: biological process, cellular component, and
molecular function, whereas here the biological process is considered. The 77 genes,
differentially regulated after C8-HSL treatment were classified in 9 GO-terms, including
processes of oxidation-reduction (37 %), chitin catabolism (16 %), response to oxidative
stress (11 %), cell wall organization or biogenesis (11 %), aminoglycan metabolism (5 %),
cell wall modification (5 %), organonitrogen compound catabolism (5 %), external
encapsulation structure organization (5 %), and cell wall macromolecule catabolism (5 %) as
shown in figure 3.13 A. The C12-HSL treatment induced the response of 265 genes that
could be classified in GO-term processes of metabolism (30 %), regulation of RNA
biosynthesis (17 %), oxidation-reduction (14 %), response to stimulus (5 %), phosphorelay
signal transduction system (4 %), metal-, ion and transport (4 %), amide and oligopeptide
transport (4 %), response to wounding (4 %), amino sugar catabolism (3 %), signaling (2 %),
response to oxidative stress (2 %), amino glycan metabolism, and asparagine biosynthesis
with 2 %, and 7 further categories attending with 1 % are listed in figure 3.13 B. Four GO-
term categories were commonly enriched among transcripts expressed after both AHL
treatments and are marked by colors in the graph. Within them are the GOs: oxidation-
reduction, chitin catabolic process, response to stress, and aminoglycan metabolism, but in
varying percentage occurrence between C8- and C12-HSL treatment. The short-chain AHL
RESULTS
52
Figure 3.13 Statistically significant GO-term distribution of barley genes differentially regulated in response to AHL treatments. The figures represent all genes per treatment, without considering single sampling time points. (A) Enriched GO-terms display the category “biological process” to which all genes, differentially regulated after C8.HSL are classified. (B) Displays the same like mentioned in (A) but after C12-HSL treatment. GO-terms common in (A) and (B) are marked with similar colors.
led to differential expression of genes related to biotic/abiotic stress, signal transduction, and
cell wall organization, whereas the C12-HSL regulated genes are related to metabolism,
signal transduction, and biotic/abiotic stress response. A list with the results of the RNA seq
(all treatments and time points) and the associated GO-term annotation is given in the
appendix (table 7.2).
B
A C8-HSL
C12-HSL
RESULTS
53
3.3.1.3 Selection of AHL-responsive genes
The functional classification first led to insights in gene regulation. Further it was aimed to
analyze the expression pattern of interesting and distinct genes over all sample time points
per AHL treatment via qRT-PCR. The criteria for gene selection were a log2 fold change
of ≥ 3 in the RNA seq in at least 1 expression time point, a significant regulation, and
possibly a regulation induced by both AHL molecules. Table 7-1 shows genes commonly
regulated by both AHLs and is provided in the appendix. Out of this list, 4 genes were
selected for quantification via qRT-PCR (see table 3-1): AK371210, a basic helix-loop-helix
(bHLH) DNA-binding superfamily protein, MLOC_68184, a chitinase family protein,
MLOC_2643, a subtilisin-chymotrypsin inhibitor 2A, and MLOC_22770, a chaperone protein
DnaJ. Additionally, 2 more genes were selected from the total list of all genes because they
showed clearly up-regulated log2 fold change values: MLOC_25773.1, a 60 kDa jasmonate-
induced protein and AK252675.1 a thionin 2.2.
Table 3-1 Genes differentially regulated and used for the expression analysis via qRT-PCR
Locus/ accession
number
annotation log2 fold change
(sample)
p value
MLOC_67053/ AK371210 basic helix-loop-helix (bHLH) DNA-binding superfamily protein
4.2 (C8_24h); 2.6 (C12_6h); 2.54 (C12_12h); 4.91 (C12_24h)
0.00005
MLOC_68184 chitinase family protein 3.94 (C8_12h); 2.73 (C12_6h)
0.00005
MLOC_22770/ AK356806/
chaperone protein DnaJ 5.3 (C8_24h); 1.74 (C12_6h); 6.63 (C12_24h)
0.00005
MLOC_2643 subtilisin-chymotrypsin inhibitor-2A
2.26 (C8_6h); 5.5 (C12_6h)
0.0001; 0.00005
MLOC_25773 60 kDa jasmonate-induced protein
5.09 (C12_12h) 0.00005
MLOC_46400/ AK252675.1
thionin 2.2 6.93 (C12_6h) 0.00005
The locus of all genes was supplied to the Ensemble genome annotation system (Kersey et
al., 2015) to gain further information of their functional category. Here, for AK371210, the
bHLH DNA-binding superfamily protein, only the category molecular process of the GO is
available and categorizes this gene with DNA binding and protein dimerization activity. The
locus MLOC_68184, describing the gene of the chitinase family protein, belongs to the GO-
RESULTS
54
terms carbohydrate metabolic process, chitin catabolic process, metabolic process, and cell
wall macromolecule catabolic process with molecular functions of chitinase and hydrolase
activity. The chaperone protein DnaJ (MLOC_22770) possesses the molecular activity of
iron-sulfur cluster binding. This gene is further described as a member of the molecular
group of heat shock proteins 40 (HSP40), an important assistant for the regulation of the
heat shock protein 70 (HSP70, Walsh et al., 2004). The fourth selected gene, which is
regulated by both AHLs, is MLOC_2643, a subtilisin-chymotrypsin inhibitor 2A. This gene is
classified in the GO-term of response to wounding and is described with the molecular
function of serine-type endopeptidase inhibitor activity. MLOC_25773.1, annotated as a 60
kDa jasmonate-induced protein is part of GO-term of negative regulation of translation and is
attributed to the molecular functions of hydrolase and rRNA N-glycosylase activity. The last
gene with accession number AK252675.1 and the locus MLOC_46400 is described as
THI1.3, a leaf-specific thionin, in the Ensemble data base. It belongs to the GO-term of
defense response.
3.3.1.4 Investigation of the leaf-specific expression of AHL-responsive
genes
The transcript accumulation of the selected genes was studied in leaves of 10-day-old barley
plants. The sampling time points were 6, 12, and 24 h after control, C8-, and C12-HSL
treatment. Table 3-2 shows the comparison between the gene expression values of the first
2 replicates that have been sequenced with the Illumina Hiseq 1000 and then additionally
confirmed by qRT-PCR, to validate the sequencing reaction. Expression levels are given in
the log2 fold change. For normalization of the relative quantification of the qRT-PCR, the
housekeeping gene Ubiquitin conjugating enzyme 2 (HvUBC2) was used. The values of the
transcript levels of bHLH DNA-binding protein, subtilisin-chymotrypsin inhibitor-2A, and 60
kDa jasmonate-induced protein obtained by RNA seq were almost achieved by the qRT-
PCR, while for the other 3 genes no confirmation by qRT-PCR could be achieved.
Unfortunately, the results were quite distinct from each other. Despite missing correlation
between RNA seq and qRT-PCR, the transcript level of all 6 genes for all time points was
determined in further replicates using qRT-PCR. The results of the qRT-PCR are shown in
figure 3.14, where each dot presents a biological independent replicate. Expressed genes
were defined as upregulated starting from a log2 fold change value of 0.6, which corresponds
to a 1.5-fold upregulation of the gene. The a log2 fold change of 0.6 is marked by a red dotted
line in all the figures.
RESULTS
55
Table 3-2 Comparison of transcript levels analyzed by RNA seq and qRT-PCR
In the RNA seq results, the accumulation of bHLH DNA-binding protein transcripts was
detected at 4 time points: at C8_24 h and for all of the C12-HSL time points. When applying
the qRT-PCR, the transcript accumulation could be confirmed for the time points C8_24 h
and C12_12 h. A clear increase of the chitinase transcripts could be confirmed after 6 h and
after 12 h of the long-chain AHL application. For the 24 h sample a strong induction of the
transcript is obvious, but was not repeatable in further replicates, moreover at this time point
no transcript was detected by the RNA seq (table 3-2). The expression pattern of chaperon
protein DnaJ, achieved by the RNA seq, was not reproducible with qRT-PCR in the first 2
replicates (table 3-2), but adding more replicates resulted in a clear upregulation of chaperon
protein DnaJ at the time point C12_6h. Tendencies for a further upregulation of this gene are
visible at the 24 h sample time point of the short-chain AHL, but more replicates are needed
to confirm this trend (fig. 3.14). The accumulation of the subtilisin-chymotrypsin inhibitor
transcript was fully confirmed by qRT-PCR at the given time points of the RNA seq. In
additional replicates it was not possible to reach approximate high values of the RNA seq,
but the trend is clearly determinable. The positive transcript regulation of the 60 kDa
jasmonate-induced protein (JIP60) was shown for the 12 h time points of both AHLs via qRT-
annotation time point log 2 fold change
RNA seq qRT-PCR
bHLH DNA-binding
protein
C8_24 h 4.19 1.61
C12_6 h 2.60 0.75
C12_12 h 2.54 2.44
C12_24 h 4.91 4.61
chitinase
C8_12 h 3.94 0.02
C12_6 h 2.73 0.85
chaperon protein DnaJ
(HSP40)
C8_24 h 5.30 -0.09
C12-6 h 5.91 -0.24
C12_12 h 6.63 -1.56
subtilisin-chymotrypsin
inhibitor 2A
C8_6 h 2.26 1.74
C12_6 h 5.51 3.50
JIP60
C12-12 h 5.09 1.48
leaf-specific thionin
C12-6h 6.94 -0.42
RESULTS
56
Figure 3.14 Transcript accumulation of bHLH DNA-binding protein, chitinase, chaperon protein DnaJ (HSP40), subtilisin-chymotrypsin inhibitor, 60 kDa jasmonate-induced protein (JIP60), and the leaf-specific thionin in leaves of 10-day-old barley plants. Transcript accumulation was determined by qRT-PCR with sampling time points 6, 12, and 24 h after control, C8-, and C12-HSL treatment. The qRT-PCR was conducted in 7 biological independent experiments, only the qRT-PCR of the bHLH DNA-binding protein was repeated in 5 biological replicates. The housekeeping gene HvUBC2 was used for normalization. Each data point per sampling time point and treatment presents the average of 3 technical replicates and displays a biological independent replicate. The red dotted line indicates the log2 fold change of 0.6 (= corresponding to a 1.5-fold upregulation) on the y-axis.
PCR. Further, it seems that the gene is down-regulated after 6 h of C8-HSL application. The
upregulation of the leaf-specific thionin could be confirmed in 4 replicates for the time points
C8_6 h and C12_24 h, while a 5th replicate already shows the tendency of an upregulation
with an log2 fold change of 0.58 for the time point C12_24 h (fig. 3.14).
RESULTS
57
Figure 3.15 SA content of barley leaves after 4, 8, 12, and 24 h of control, 10 µM C8- or C12-HSL treatment. Controls received the same amount of solvent (DMSO) as used for AHL treatments. Application of each substance was carried out for axenically grown 10-day-old barley plants. Values indicated are most probable means of n=3 (with 2 technical replicates per biological experiment) according to Bayesian analysis with error bars representing the 95 % highest density interval. * shows a credible difference to the control measurement within each time point.
3.3.2 Influence of short- and long-chain AHLs on phytohormone
levels
3.3.2.1 Determination of salicylic acid
The SA content was determined in leaves during a time course of 24 h after 10-day-old
barley plants were treated with 10 µM C8- and C12-HSL (fig. 3.15). The determination of the
phytohormone content was kindly performed by the Department of Animal Biology, Plant
Biology and Ecology of the UAB in Spain. To better illustrate the data structure a Bayesian
analysis was performed. The treatments with short- and long-chain AHLs caused 13.5- and
14-fold credible increases compared to the control after 4 h, leading to phytohormone levels
of 22.7 and 24.2 pmol per gram plant fresh weight, respectively. This shows that both AHL
derivatives were able to induce an SA response in barley leaves. The incubation time of 8 h
with C8-HSL caused only a slight credible SA increase, whereas a decrease of SA occurred
after 12 h with C8-HSL treatment and remained at this level until 24 h. The application of the
long-chain AHL induced a slight decline in SA compared to the previous time point, but the
SA level still remains credibly elevated compared to the control, while further treatment led to
credible 2-fold increase after 12 h compared to controls. Subsequently the SA concentration
shows a decline after additional 12 h of C12-HSL. After 24 h the controls reached 9.4-fold
up-regulated SA contents compared to both AHL treatments. Taken together, the highest
AHL-mediated SA level was achieved 4 h after C8 and C12-HSL treatment, whereas the
C12-HSL induced an additional small SA peak after 12 h, but showed generally a credible
difference within the whole measurement series to the control.
RESULTS
58
Figure 3.16 Contents of JA and JA-Ile in barley leaves after 4, 10, and 22 h of control, 10 µM C8- or C12-HSL application. Controls received the same amount of solvent (DMSO) as used for AHL treatments. Application of each substance was carried out for axenically grown, 10-day-old barley plants. Values indicated are most probable means of n=5 (with 2 technical replicates per biological experiment) according to Bayesian analysis with error bars representing the 95 % highest density interval.
3.3.2.2 Determination of jasmonic acid and its derivative jasmonic acid-
isoleucine
The content of JA and its amino acid conjugate JA-Ile were determined in leaves of 10-day-
old barley plants during a time course of 22 h and are displayed in figure 3.16. For this,
samples were taken 4, 10, and 22 h after C8- and C12-HSL treatments (for experimental
procedure chapter 2.2.16). The determination of the jasmonates was kindly performed by the
Department of Cell and Metabolic Biology of the Leibnitz Institute of Plant Biochemistry. For
the present data a Bayesian analysis was applied to better illustrate the data structure. Both
levels of JA and JA-Ile equal the control values with small deviations till the time point 22 h. It
seems that at 4 h after C12-HSL and 10 h after C8-HSL a slight increase of JA is induced,
but the standard deviations are too high in their variance that a reliable statement can be
done. Additionally, JA-Ile levels seems to be repressed after 4 and 22 h of C12-HSL
treatment, but also here high standard deviations prevent a clear statement.
RESULTS
59
Figure 3.17 ABA content of barley leaves after 4, 10, and 22 h of control, 10 µM C8-, or C12-HSL application. Controls received the same amount of solvent (DMSO) as used for AHL treatments. Application of each substance was carried out for axenically grown, 10-day-old barley plants. Values indicated are most probable means of n=5 (with 2 technical replicates per biological experiment) according to Bayesian analysis with error bars representing the 95 % highest density interval. * shows a credible difference to the control measurement within each time point.
3.3.2.3 Determination of abscisic acid
The AHL mediated influence on the ABA-level in barley leaves was determined during a time
course of 22 h (for experimental procedure chapter 2.2.16) and the results are presented in
the line graph 3.17. For the present data a Bayesian analysis was applied to better illustrate
the data structure. The analysis of the phytohormone content was kindly performed by the
Department of Cell and Metabolic Biology of the Leibnitz Institute of Plant Biochemistry. The
short-term incubation of 4 h caused a credible 2-fold up-regulation of the ABA level in C12-
HSL treated plants. Further, the ABA content of C12-HSL treated plants approximated to the
control-values at the last sample time point at 22 h after AHL application, whereby the values
declined below control values at the 22 h time point, but always displayed a credible
difference to the control treatment. Accordingly, the treatments with the short-chain AHL
displayed kinetics similar to control plants throughout the entire treatment period, and
showed additionally a credible difference to controls after 4 and 22 h of application. At this
time point, the values were even below controls. In summary, C12-HSL mediated an
enhanced ABA concentration after 4 h compared to controls and lowered the phytohormone
level after 10 h to control levels.
RESULTS
60
Figure 3.18 Content of the flavonoids lutonarin and saponarin in barley leaves after control, 72 h, and 96 h of 10 µM AHL treatment. 0 h shows the flavonoid level before starting the experiment. Controls received the same amount of solvent (DMSO) as used for AHL treatments. Application of each substance was carried out for axenically grown, 10-day-old barley plants. Values indicated are most probable means of n=2 (with 2 technical replicates per biological experiment) according to Bayesian analysis with error bars representing the 95 % highest density interval. No credible difference to the control measurement could be determined.
3.3.3 Flavonoid contents in barley leaves after AHL treatments
The AHL mediated influence on the flavonoids, lutonarin and saponarin, in leaf tissue was
determined for 2 distinct time points (for experimental procedure chapter 2.2.17). The
determination of flavonoids was kindly performed by. the Institute of Biochemical Plant
Pathology of the Helmholtz Center Munich. Figure 3.18 display the means of 2 biologically
independent experiments per treatment and time point according to a Bayesian analysis with
error bars representing the 95 % highest density interval. The Bayesian analysis was applied
to better illustrate the data structure. Figure 3.18 clearly shows that barley leaves contain 10
times more saponarin than lutonarin. Compared to the experimental starting value (0 h) the
lutonarin content in controls did not change after 72 h but decreased after 96 h. The
application of both AHLs induced a reduction of the lutonarin level, compared to the 0 h and
the 72 h time point. After 96 h AHL treatment the concentration of lutonarin increased,
compared to the 96 h control. Saponarin levels tended not to change after AHL application,
compared to the 0 h time point. A slight saponarin decreasing effect is observable after 72 h
of microbial compound treatment, compared to the 72 h control.
However, statistical calculations were performed between the time points per treatments,
within the time points of a single treatment, and just between the time points independent of
the treatment, but neither AHL-treatment did cause any credible differences compared to the
control. Contents of lutonarin tended to decrease and to increase after 72 and 96 h
compared to the control, respectively. The same effect was achieved for saponarin at the
time point 72 h, but only the application of C8-HSL led to slightly increased saponarin content
after 96 h.
RESULTS
61
Figure 3.19 Phenylalanine ammonia lyase activity in leaves after incubation with 10 µM C8- and C12-HSL. Values indicated are means in % to the control of 3 biological independent replicates; solid line at 100 % represents the control value according to Bayesian analysis with error bars representing the 95 % highest density interval. Three plants were pooled per replicate, time point, and treatment. No credible difference to the control measurement could be determined.
3.3.4 Short-term kinetic of phenylalanine ammonia lyase activity
The PAL catalyzes the first step in the phenylpropanoid biosynthesis and is therefore the
adjusting screw for various secondary metabolites, covering inter alia the flavonoids like
lutonarin and saponarin. The activity of the PAL was determined in 10-day-old barley leaves
after 6, 12, and 24 h of control, 10 µM C8- and C12-HSL treatment (see chapter 2.2.18 and
2.2.19). The values in figure 3.19 display the means of 3 biologically independent
experiments per treatment and time points and values are given in % to the control
treatment. The applied Bayesian analysis did result in any credible differences between
treatments and control.
After 6 h of C8-HSL treatment the activity in the leaves was reduced by 96.5%, compared to
controls. Furthermore, within the next 6 h the activity increased to 148 % of the control and
decreased further on to 66 % of the control after 24 h of AHL treatment. The enzyme activity
in plants treated for 6 h with C12-HSL showed an increase of 30 % compared to controls,
raised further to 55 % after 12 h, and reduced the activity to 117 % of controls after 24 h. To
sum up, the treatment with the long-chain AHL generally increased the activity of the PAL
compared to the control, whereas an application of the short-chain AHL increased the activity
after 12 h and then reduced it to a third of the control.
RESULTS
62
3.3.5 Pathogen infection assay with Xanthomonas translucens pv.
cerealis
Various AHLs reportedly confer resistance against necrotrophic, biotrophic, and
hemibiotrophic pathogens in tomato, Arabidopsis thaliana, and barley, respectively
(Schuhegger et al., 2006; Schikora et al., 2011; Schenk and Schikora, 2015). In the present
study, the transcriptome analysis revealed differential expression of genes involved in
defense regulation, thus we investigated the potentially systemic resistance-causing effect of
AHLs to the biotrophic leaf pathogen Xtc. Figure 3.20 represents the result of the Xtc
infection assay on barley. It displays the means of 4 biologically independent experiments
per treatment and time point according to the Bayesian analysis with error bars representing
the 95 % highest density interval. The Bayesian analysis was applied to better illustrate the
data structure. A dual AHL-incubation for 24 h led to credible lower Xtc titers in the second
barley leaf compared to controls (fig. 3.20 A). Two and 3 days of AHL treatment showed
tendencies towards a resistance effect, indicated by the median of the short- and long-chain
AHL treatment, which is lower than the control of both days, although the values show high
scattering. Contrastingly, a clear and credible reduction in bacterial growth and therefore an
AHL-resistance conferring effect is apparent when barley plants were treated for 96 h with
short- and long-chain AHLs before Xtc injection. The C8-HSL application shows a slightly
stronger effect than the C12-HSL application when considering the median value.
A
RESULTS
63
Figure 3.20 Kinetics of Xanthomonas translucens pv. cerealis titer in barley leaves after 24, 48, 72, and 96 h of control or AHL application. AHL were added in a final concentration of 10 µM to 10-day-old, axenically grown barley plants. Controls received the same amount of solvent (DMSO) as used for AHL treatments. (A) Bacterial titer is represented as boxplots. The dark horizontal line represents the median (n=4), boxes indicate the range between first and third quartiles and whiskers extend to the extremes. (B) Line graph from values presented in (A) to emphasize bacterial reduction. (A+B) Values indicated are most probable means of n=4 (with 8 technical replicates per biological experiment) according to Bayesian analysis with error bars representing the 95 % highest density interval. * shows a credible difference to the control measurement within each time point. Lower case letters in (A) indicate credible difference of each time point within a treatment. hpi= hours past AHL incubation
Furthermore, the bacterial titer of all treatments decreased during the 4-day time course (fig.
3.20 B), but even though a 96 h AHL treatment caused a lowering of Xtc in the second barley
leaf, compared to the control. In this context, to exclude direct effects of AHLs on bacterial
growth, Xtc was cultivated in the presence of 1, 10 and 100 µM C8-and C12-HSL for 24 h.
No changes in the growth of bacterial lawn could be documented. Difference of each time
point within a treatment are marked by lower case letters in the figure 3.20 A, where different
time points were compared within a treatment. To sum up, the treatment of barley roots with
C8- and C12-HSL for 24 and 96 h induced a systemic resistance in barley against the
biotrophic leaf pathogen Xtc.
B
DISCUSSION
64
4 DISCUSSION
Plants conquered land 700 million years ago (Heckman et al., 2001), whereas first root-like
structures appeared in the lower Devonian (419-393 million years, Raven and Edwards,
2001). This is probably the time when a first contact occurred with bacteria due to a plant-
based soil colonization, as bacteria are traceable on earth since 3.8 bn years (DeLong and
Pace, 2001). This coexistence of plants and prokaryotes is accompanied with interactions in
the rhizosphere and the contact with bacteria-derived signaling molecules, the AHLs. Until
now, it has been demonstrated that plants respond to AHLs in a tissue-specific manner
(growth, root structure changes, lateral root, and root hair formation, Mathesius et al., 2003;
Ortíz-Castro et al., 2008; von Rad et al., 2008; Schenk et al., 2012), but that the molecules
are also able to confer resistance to necrotrophic, biotrophic, and hemibiotrophic pathogens
(Schuhegger et al., 2006; Schikora et al., 2011; Schenk and Schikora, 2015).
The aim of this thesis was to investigate the influence of C8- and C12-HSL on the
morphology, transcriptome, and fitness of barley. Therefore, growth and morphology analysis
of barley plants was conducted and the initial reactions in root cells after AHL exposure were
investigated using staining and electrophysiological methods. It was scrutinized whether
AHL-induced growth effects would be associated with enhanced nutrient uptake.
Further, trying to elucidate the first reactions and possible signaling pathways in barley upon
AHL exposure, the transcriptome and the expression pattern of distinct genes in barley
leaves were investigated. Here, the induction of defense related genes, the phytohormone
and flavonoid levels as well as the activity of the flavonoid pathway regulating enzyme PAL
were related to the evidence of an AHL- mediated resistance to the biotrophic leaf pathogen
Xtc in barley.
4.1 AHL-mediated effects on barley’s root tissue
4.1.1 Growth inducing effects of AHLs
The influence of AHLs on the morphology of barley was investigated using a newly
developed glass bowl system (fig. 2.2), providing axenic conditions, easy handling, and good
observation of growth. The growth in agar-agar supplemented with 10 µM AHL resulted in
increased biomass for fresh and dry matter of shoots and roots (fig. 3.1). Interestingly, not
only the short-chain AHL was able to induce biomass gains, but also, to a lesser extent, the
long-chain AHL, which is contradicting to recent publications. In Götz-Rösch et al. (2015) no
effects on the root and leaf fresh weight could be determined when barley and yam bean
plants were treated with C6-, C8, and C10-HSL, whereas A. thaliana showed significantly
DISCUSSION
65
increased root fresh weights after C6-HSL and shoot fresh weights after C6-, C8- and oxo-
C10-HSL treatments (Schenk et al., 2012). Further, the long-chain AHLs oxo-C12- and oxo-
C14-HSL did not lead to any biomass gain (Schenk et al., 2012), which could be refuted here
with the biomass gaining effect of C12-HSL. Beside the fresh weights, the dry weights were
also determined, as fresh weights tend to show biomass variations, caused by moisture
differences of the plant, by the growth system, and by the experimental environment (Bashan
and De-Bashan, 2005). These effectors could possibly explain the wide range of deviation of
the fresh weights compared to the dry weights in the present investigations (fig. 3.1).
Additionally, the determination of the dry weights provides proof that the significant biomass
gain in fresh weight is achieved by higher dry matter and not by increased water storage of
the plant, as it has been discussed by Bashan and De-Bashan (2005). In any case, the
application of short-chain AHL led to slight root elongation and a 19 % increase in the root tip
number, whereas the long-chain AHL increased the number of root tips by 28 %, compared
to the control (fig. 3.2 and 3.3). Concluding that every root tip stands for a single root, it could
be assumed that, in fact, AHLs have the ability to influence post-embryonic root development
by the stimulation of lateral root formation. Our results clearly demonstrate that the
alterations in the root system architecture are AHL acyl-side chain length dependent.
Accordingly, previous studies displayed the relationship between various AHL derivatives
and the magnitude in changes of growth and morphology of plants (reviewed in Hartmann et
al., 2014). Thus, short-chain AHLs are related to root elongation or inhibiting effects and
long-chain AHLs are involved in lateral root and root hair formation (Ortíz-Castro et al., 2008;
Teplitski et al., 2011). Furthermore, the observed root weight increase after AHL treatment
correlates well with the stimulation of lateral roots. Besides gains in plant biomass and root
hair growth (Dobbelaere et al., 1999), PGPRs induce the promotion of lateral roots (Verbon
and Liberman, 2016). Inoculation experiments with the PGPR strain Serratia marcescens 90-
166 and the application of different fractions of the cell culture and the cell lysate led to
lateral root formation in A. thaliana (Shi et al., 2010). The authors discuss that besides the
auxin production of the strain, which could induce lateral root formation in plants (Vacheron
et al., 2013), additional compounds are possibly involved, because they could determine an
AHL production of this strain (Shi et al., 2010). Three different short-chain AHLs are
produced by Serratia marcescens 90-166: C4-HSL, oxo-C6-HSL and C8-HSL (Ryu et al.,
2013). It is likely that these AHLs might also be involved in the generation of lateral roots
because the different fractions of the cell culture and the cell lysate were tested positive
(Huang et al., 2016). In the present study, the single application of C8-and C12-HSL led to
the formation of lateral roots in barley (see fig. 3.3). Accordingly, C10-HSL also induced
lateral roots in the model plant A. thaliana (Ortíz-Castro et al., 2008). The present data
confirm lateral root induction after AHL treatments and show that purified AHLs are sufficient
DISCUSSION
66
for lateral root promotion. This gives rise to the assumption that these quorum sensing
molecules could be an additional acting part in PGPR induced lateral root formation.
It has been demonstrated that AHLs are systemically transported. So, short-chain AHLs were
detectable in roots and shoots, long-chain AHLs only in the root using UPLC and FT-
ICR/MS, whereas application of tritium-labeled AHLs led to the confirmation of C10-HSL in
leaves (Götz et al., 2007). Furthermore, reportedly long-chain AHLs are faster degraded in
plant tissue compared to short-chain AHLs and therefore it might be possible that their
metabolites are partly transported into the leaves (Götz-Rösch et al., 2015). The systemic
AHL-transport leads to the assumption that further signaling pathways are activated, implying
the induction of phytohormones. Auxin and cytokinin possess a distinct role in root and leaf
morphological development, which was demonstrated by Skoog and Miller (1957). It seems
that higher cytokinin concentrations lead to leaf development and increased auxin levels to
better root formation. Von Rad et al. (2008) demonstrated increased cytokinin concentrations
in leaves and 4-fold induced auxin levels in roots after AHL application, changing the auxin-
cytokinin ratio towards higher auxin concentrations, compared to the control. Similar
reactions can be assumed for barley, leading to the demonstrated biomass gain (see chapter
3.1.1 and summarizing figure 4.1).
We further hypothesize that a stronger branched root system and a larger root surface lead
to better and higher nutrient uptake, which then results in enhanced biomass. The
augmentation of the root system improves nutrient availability and enables the plant to
access new, so far unrooted soil regions. Also rhizobacteria profit and obtain more nutrients
(rhizodeposits) from colonizing new root tissue. This effect results in a positive feedback
loop, where the AHL producing bacteria improve plant growth, fitness, and nutrient supply
while the host plant provides the bacteria with more nutrients and habitat. Therefore,
rhizobacteria might secrete AHLs to create a better living space for themselves, whereas
plants are able to interfere and to direct the microbial signal production, so that no bacterial
overgrowth will occur (Zarkani et al., 2013). Accordingly, a positive impact of microbial
derived molecules on the plant nutrient supply has been demonstrated by Joseph and
Phillips (2003). Here, Phaseolus vulgaris was treated with AHL breakdown products (L-
homoserine), resulting in enhanced stomatal conductance and transpiration. In this context
Palmer et al. (2014) suggest that the growth stimulation of AHLs is dependent on the activity
of a fatty acid amide hydrolase, which cleaves the AHL by obtaining the L-homoserine, the
active compound that demonstrably stimulates transpiration. This enhanced transpiration
implies higher water and nutrient uptake and may lead to growth stimulation (see fig. 4.1,
Palmer et al., 2014).
DISCUSSION
67
Figure 4.1 AHL application leads to root and leaf growth induction and root system augmentation. Possibly, increased cytokinin levels in leaves and increased auxin levels in roots (von Rad et al., 2008) are involved in the total biomass gain and root architecture change. Augmentation of root system may recruit more PGPRs due to more rhizodeposits. AHL-degradation products reportedly increase transpiration and therefore positively influence nutrient uptake (N=nitrogen, P=phosphorus and K+).
4.1.2 AHLs induce a K+ uptake in barley roots
PGPRs positively influence the uptake of various nutrients in plants wherefore numerous
applications as plant growth promoting agents in agriculture can be found (reviewed in
Adesemoye and Kloepper, 2009). The present study demonstrates that the application of
purified microbial signaling molecules enhances the K+ uptake of barley. Thus, 10 µM C8-
HSL increased the K+ uptake by barley roots, whereas 1 and 100 µM C8-HSL fail to induce
any effects on increased K+ uptake (fig. 3.8). In line with our findings is the observation of a
previous study that found no immunomodulatory activities of AHLs at less than 10 μM
(Ritchie et al., 2005) and confirm the speculation that 1 µM C8-HSL is too low to induce any
detectable reaction. Further, the report of Song et al. (2011) corroborates our results,
showing strong increase in cytosolic Ca2+, mediated as well by 10 μM of a short chain (C4-
HSL), but none at 100 μM. The authors relate this to the fact that 10 μM C4-HSL was the
concentration that stimulated growth of Arabidopsis roots. In contrast, our experiments with
the long-chain AHL demonstrate that all tested concentrations (1, 10, and 100 µM) of C12-
HSL were able to mediate a higher ion intake in roots (fig. 3.9). This result contradicts the
aforementioned facts of Ritchie et al. (2005), but in this study all experiments were
conducted with oxo-C12-HSL, suggesting that C12-HSL may act and interact in a different
DISCUSSION
68
way. Here, AHL binding studies to artificial membranes show a concentration and chain-
length dependent binding and an increase in membrane affinity with higher chain length
(Davis et al., 2010). Further, the logP value, which describes the octanol/water partition
coefficient and is frequently used to analyze the molecular lipophilicity of a substance,
indicates with a higher coefficient value an increasing lipophilicity of a molecule and may
explain the different reaction of C12-HSL (Leo et al., 1971). Here, oxo-C12-HSL displays a
logP of 2.23 (Davis et al., 2010), whereas C12-HSL has a logP value of 3.385 (Davis et al.,
2011), revealing that C12-HSL possesses a lower hydrophilicity and a higher attraction to
membranes than oxo-C12-HSL. These facts may potentially explain why K+ influx was
induced at all concentrations of C12-HSL.
K+ occupies a pivotal role in plant physiology, where it is involved in growth and development
and metabolite distribution. It acts as a highly active osmoticum in organ movement by
changing and maintaining the cell turgor and regulating the transpiration by acting on
stomatal opening and closure (Anschütz et al., 2014). Further, being involved in many
enzymatic reactions as well as in protein biosynthesis, it supports negative charges on
proteins and nucleic acids with its chaotropic qualities (Marschner, 1995; Maathuis, 2009).
Especially during elongation growth in the elongation zone of roots, K+ is markedly involved.
Interestingly, maize, also belonging to the Poaceae like barley, showed the highest K+
accumulation in the elongation zone (Sharp et al., 1990), revealing that this zone was the
correct choice for our ion flux measurements. Sano et al (2009) reported that enhanced K+
uptake into tobacco bright yellow-2 cells occurred to regulate and to increase the cellular K+
concentration to further enhance the cellular pressure for root cell elongation. This was
achieved by an active K+ uptake, involving the Nicotiana tabacum K+ transporter 1 (NKT1)
and Nicotiana tabacum K+ channel 1 (NtKC1), 2 inward rectifier K+ channels in tobacco.
Additionally, enhanced NKT1 activity was displayed in the transition phase from G1 to S in
the cell-division cycle (Sano et al., 2007), indicating that K+ uptake is required for a correct
progression of the cell-cycle. These facts support the idea that an enhanced potassium
uptake could contribute to plant growth and could reinforce our hypothesis that the enhanced
K+ uptake is linked to increased plant growth and dry weight. However, differing observations
were made in A. thaliana that had been treated with C10-HSL. These plants displayed an
inhibiting effect on the root meristematic cell division and additionally caused a reduction in
the root length (Ortíz-Castro et al., 2008). This observation was not made in this study,
encouraging speculations that C8- and C12-HSL use a different mode of action in the
monocotyledonous plant barley, as they do in the dicotyle A. thaliana.
Ionic and complexed potassium distributed in the soil reaches the root surface mainly by
diffusion (Oliver and Barber, 1966; Taiz and Zeiger, 2006). Applying the law of diffusion, the
root provides a clear reduction of the K+ concentration along its surface by ion uptake,
DISCUSSION
69
therefore causing an ion gradient in the rhizosphere and bulk soil, which ensures its nutrient
supply by the existing concentration gradient (Taiz and Zeiger, 2006). The application of
AHLs confirmedly enhanced potassium uptake by the root (chapter 3.2.3). Accordingly, after
AHL application, a stronger concentration gradient and an increased K+ supply along the root
surface would appear. Higher availability of K+ would positively impact the growth of the
plant, which is in line with our findings in chapter 4.1.1. If the nutrient uptake of the plant is
higher than the amount of K+ that is available in the soil, nutrient depletion may occur (Taiz
and Zeiger, 2006). But, besides the enhanced potassium uptake, AHLs additionally induced
lateral formation and root growth (see chapter 3.1.2), giving the plant the chance to avoid a
K+ deficit in the soil and to conquer new soil regions to access new sources of K+. Thus, a
multiple application of AHLs could induce a self-perpetuating mechanism, which stimulates
growth.
AHL-mediated root growth may also provide a larger habitat for rhizosphere colonizing
bacteria, as previously mentioned in chapter 4.1.1. A widely extended root system provokes
the production of a higher amount of various exudates which attract additional root colonizing
bacteria, while beyond these a vast number of PGPRs exist (Compant et al., 2010; Vacheron
et al., 2013). PGPRs cause numerous beneficial characteristics, with enhanced nutrient
uptake in plants being one of them, and have been described in several recent publications
(reviewed in Adesemoye and Kloepper, 2009). In a lot of studies, PGPRs mediate an
enhanced uptake / accumulation of nitrate, phosphorous, and some other micronutrients in
plant tissue, whereas the K+ content or uptake was not mentioned or not investigated so far
(Ahemad and Kibret, 2014). The case is different in the publication of Lin et al. (1983), where
the performance of short- and long-term studies with the gram-negative soil bacterium
Azospirillum brasiliense on Zea mays plants reportedly improved growth and the assimilation
of nitrate, K+, and dihydrogen phosphate in maize. In the present study, purified AHLs were
used to locally stimulate K+ uptake in root epidermal cells of barley. An increased K+ uptake
into plants also occurred after inoculation with other PGPRs. Here, Achromobacter sp. and
PGPR strains isolated from wheat rhizosphere were responsible for the nutritive stimulation
in Brassica napus and wheat, respectively (Bertrand et al., 2000; Abbasi et al., 2011).
Unfortunately, these publications failed to refer to quorum sensing and no examinations have
demonstrated an AHL production from these strains. In the present study purified microbial
signaling molecules locally trigger K+ uptake in root epidermal cells. Inoculation experiments
with Serratia marcescens, a PGPR, resulted in phenotypical growth and enhanced nutrient
uptake, while the K+ uptake was enhanced for 26.7 % in wheat seedlings (Selvakumar et al.,
2007). The authors reveal the increased nutritional effect to the auxin-producing ability of the
strain (Selvakumar et al., 2007), but Serratia marcescens was proven to synthesize AHLs
(Ryu et al., 2013). Hence, it is possible that the increased K+ uptake by wheat plants due to
DISCUSSION
70
Serratia marcescens application fall back on the AHL production of the strain. Therefore, the
effect of increased K+ uptake after application of isolated AHLs let these compounds appear
in a new light in the context of agricultural-used plant growth promoting bio-inoculants.
4.1.3 AHLs force a membrane hyperpolarization in epidermal root
cells
The cytoplasmic K+ concentration in plants is maintained at about 100 mM, whereas in the
rhizosphere, close to the root surface, a relatively low concentration with a range between
0.1 and 1 mM K+ prevails (Britto and Kronzucker, 2008; White and Karley, 2010; Schroeder
et al., 1994). Epstein et al. (1963) postulated a model of a dual K+ transport system that is
dependent on the external K+ concentration. Specifically, a high- and a low-affinity system
was described to operate at low and high external K+ concentrations, respectively (Epstein et
al., 1963). Furthermore, the uptake of this monovalent ion from soil into the plant occurs
against its concentration gradient and is further supported via different transporter systems,
involving various channel and transporter families (Hedrich, 2012; Wang and Wu, 2013).
Here, 3 families of K+ channels exist: the Shaker, the Tandem-Pore K+ (TPK), and the K+
inward rectifier (Kir)–like (Sharma et al., 2013).
The Shaker-like family channels respond to voltage and are classified in outward-, inward-,
and weakly-rectifying channels, where they achieve ion efflux during membrane
depolarization, ion influx during membrane hyperpolarization, and ion in- and efflux during
hyperpolarization, respectively (Wang and Wu, 2013). The inward-rectifying Shaker-like
channels display a low and high- affinity system activity as aforementioned. Accordingly, K+
concentrations above 0.3 mM in root medium reportedly activate the low-affinity Shaker-like
channels (Schroeder et al., 1994; Wang and Wu, 2013; Nieves-Cordones et al., 2014). In our
experiments the external K+ concentration amounted to 0.5 mM and we could demonstrate
that the application of 10 µM C8-HSL led to a hyperpolarization event of the membrane
potential in barley epidermal root cells (chapter 3.2.4). Further, it is known that inward
rectifying Shaker K+ channels are expressed in the root epidermis, root hairs, and cortex
(Wang and Wu, 2013). Thus, it can be assumed that the application of the AHLs may
stimulate a hyperpolarization which then triggers K+ uptake by Shaker-like channels
according to our results, which show an increased net K+ uptake after AHL application
(chapter 3.2.3). Membrane hyperpolarization is reportedly induced by the activity of plasma
membrane proton adenosine triphosphatases (H+ ATPases), which create a more negative
membrane potential by H+- extrusion out of the cell and therefore provide the trigger to
activate voltage-gated inward rectifying channels for the uptake of monovalent ions like K+
DISCUSSION
71
(Bellando et al., 1979; Romani et al., 1985; Schon et al., 1990; Elmore and Coaker, 2011;
Nieves-Cordones et al., 2014). Accordingly, Bertrand et al. (2000) reported an enhanced net
H+ efflux and K+ uptake after PGPR inoculations and related this to higher H+ ATPase
activity, potentially leading to membrane hyperpolarization. Further, hyperpolarization-
activated inward currents in root hairs of Triticum aestivum were shown to be K+ selective
(Gassmann and Schroeder, 1994). Similarly, an application of boron induced a
hyperpolarization of the membrane potential in sunflower roots and also caused higher K+
concentration in the root tissue (Schon et al., 1990). The authors suggest that boron
enhances the driving force for K+ uptake via the stimulation of membrane bound H+
ATPases, which then are responsible for the membrane hyperpolarization and thus for the
activation of current-gated inward rectifying K+ channels. Accordingly, AHL treatment may
stimulate proton pumps and membrane hyperpolarization leading to the activation of voltage-
gated inward rectifying ion channels and increased K+ uptake. Furthermore, that the
hyperpolarization occurred in the elongation zone is consistent with our findings of enhanced
potassium uptake because this shows the demand for nutrients, needed for cellular
elongation growth in this zone. Elongating BY-2 tobacco cells also appeared hyperpolarized
during enhanced potassium uptake (Sano et al., 2007).
The Arabidopsis thaliana K+ transporter 1 (AtAKT1), an inward rectifier K+ channel of the
shaker family, is involved in high and low affinity K+ uptake into roots (Véry and Sentenac,
2003). The activity of AtAKT1 is regulated in a Ca2+-dependent manner. Hereby, cytosolic
Ca2+ signals trigger the Ca2+ sensors of the calcineurin B-like (CBL) family, CBL1 and CBL9,
which then activate the CBL-interacting serine/threonine-protein kinase 23 (CIPK23).
Subsequently, the latter then phosphorylates AtAKT1 to initiate K+ uptake (Li et al., 2006a;
Xu et al., 2006). In co-expression studies of AKT1 with CBL1/9 and CIPK23 in Xenopus
oocytes, AKT1-generated K+ inward currents were activated under hyperpolarized conditions
(Xu et al., 2006). There, the activity of the inward rectifier was clearly dependent on the
interplay of all 3 proteins. In barley root tissue the AtAKT1 homologue, HvAKT1, was found
and characterized (Boscari et al., 2009). Expression studies revealed that HvAKT1
generated K+ currents occurred during hyperpolarized conditions. Further, inward rectifying
K+ currents were only observed in the co-expression with the proteins CBL1/9 and CIPK23 of
A. thaliana. These findings show that HvAKT1 is an inward-rectifying K+ channel, which is
possibly regulated by the CBL/CIPK signaling pathway, as it appears in A. thaliana. It is likely
that barley plants display a Ca2+-regulated CBL/CIPK network as it is described for A.
thaliana (Boscari et al., 2009), because in barley expressed sequence tags encoding 9 CBLs
and 14 CIPKs members were found (Kolukisaoglu et al., 2004). Interestingly, 10 µM C4-HSL
was found to induce Ca2+ signaling in A. thaliana roots, while concentrations below or higher
DISCUSSION
72
did not (Song et al., 2011). Here, 6 s after AHL application, a rapid cytosolic calcium peak
occurred under hyperpolarized conditions. With inhibitor studies it was demonstrated that the
calcium release into the cytosol occurred from external Ca2+ stores, while the authors
suggest the involvement of plasma membrane bound Ca2+ channels (Song et al., 2011). In
mammalian cells, relatively high concentrations (250 µM - 1mM) of oxo-C12-HSL induced
cytosolic Ca2+ elevation, whereas a lower concentration range caused only a weak induction
(Shiner et al., 2006). It has been shown that Ca2+ was released from the endoplasmatic
reticulum and not from external stores as already mentioned above (Shiner et al., 2006). In
tomato cells and in epidermal cells of the elongation zone of A. thaliana, hyperpolarization
activated Ca2+ currents have been reported (Gelli and Blumwald, 1997; Kiegle et al., 2000).
Further, chitosan, yeast elicitor, and the race-specific elicitor avr5 from Cladosporium fulvum
induced cytosolic directed Ca2+ currents under hyperpolarized conditions in A. thaliana and
tomato, respectively (Gelli et al., 1997; Klüsener et al., 2002). AHLs are produced by
pathogenic and non-pathogenic bacteria, and are recognized as “bacteria-derived” by plants
and elicit a specific plant response (Hartmann et al., 2014). In this context, it was
demonstrated that PGPRs induce a broad systemic resistance in plants, determined as
rhizobacteria-induced systemic resistance (Mariutto and Ongena, 2015; Pieterse and van
Wees, 2015). AHLs are also already discussed as elicitors that transfer the plant in a primed
status (Schikora et al., 2011; Hernández-Reyes et al., 2014; Schenk and Schikora, 2015).
Thus, in the present work, the membrane potential hyperpolarization could be a possible
activator of Ca2+ inward currents and also the trigger for the activation of the inward rectifying
K+ channels.
The best example elucidating and proving that a hyperpolarization event is involved in K+
uptake is the blue light induced stomatal opening (Shimazaki et al., 1986). Blue light is the
trigger which activates plasma membrane bound H+ ATPases to pump H+ out of the guard
cell. The H+ extrusion causes a stronger negative electrical potential in the cell and therefore
a hyperpolarization of membrane potential, which leads to the opening of voltage-dependent
inward-rectifying K+ channels. The influx of K+ implicates a water intrusion in the cell, which
then leads via turgor increase to stomata opening (Shimazaki et al., 2007; Ward et al., 2009).
These findings suggest that possibly the AHL-mediated hyperpolarization is the driving force
for the displayed nutrient uptake in barley roots. Further, the time lapse of both events
emphasizes that one follows the other. Directly after AHL application, the membrane
potential starts to drop and reach within 10 min an Em of -134.6 mV at which it stays for 8 min
until beginning of the repolarization, while the K+ influx started to increase around 10 min
after AHL application (chapter 3.2.3).
DISCUSSION
73
Figure 4.2 Schematic illustration of a proposed model for regulating K+ uptake by AHLs in a barley root epidermal cell. Proposed order of the mechanism is indicated by numbers 1 to 5. In this model AHL recognition (1) triggers an H+ ATPase mediated H+ extrusion (2), which is leading to membrane hyperpolarization (3). A hyperpolarization induced Ca2+ burst (4, Song et al, 2011) then activates a Ca2+ regulated CBL/CIPK network (5), leading to potassium uptake via HvAKT1.
All these facts lead to following model: The inward rectifying HvAKT1 showed K+ uptake
under hyperpolarized conditions (Boscari et al., 2009). As aforementioned, mainly an H+
ATPase mediated H+ extrusion is leading to membrane hyperpolarization. In the present
study, the hyperpolarization occurred directly after short-chain AHL application and Song et
al, (2011) demonstrated a Ca2+ burst directly after short-chain AHL treatment in A. thaliana.
The Ca2+ burst may be the trigger to activate the CBL/CIPK controlled HvAKT1 opening in
the barley root, as it was demonstrated in co-expression studies in Xenopus oocytes (Xu et
al., 2006). Interestingly, K+ uptake via OsAKT1 is also modulated by the CBL1-CIPK23
complex in rice (Li et al., 2014). Since rice and barley belong to the monocotyledons and
barley demonstrably possess CIPK and CBL members (Kolukisaoglu et al., 2004), it can be
assumed that AHL application is leading via a yet unknown mechanism to hyperpolarized
conditions and Ca2+ burst, which then induce the HvAKT1 mediated potassium uptake.
Beside the hypothesis of a calcium-/ hyperpolarization-mediated activation of potassium
channels, also auxin could be a key regulator. During auxin-induced cell wall expansion, a
membrane hyperpolarization and enhanced potassium intake are involved. Here, in line with
the ’acidic growth theory’, the phytohormone stimulates the catalytic activity of the plasma
membrane bound H+ ATPase and thereby increases the H+ extrusion which is followed by a
DISCUSSION
74
hyperpolarization and the acidification of the cell wall. The acidification of the apoplastic
space then regulates the activity of cell wall loosening enzymes (Hager, 2003). The
expansion is dependent on the voltage-gated K+ inward rectifyers KAT1 (K+ channel
Arabidopsis thaliana 1) and KAT2 (K+ channel Arabidopsis thaliana 2), which are activated
by the hyperpolarization of the plasma membrane (Philippar et al., 2004). Thus, because the
auxin driven cell wall expansion has prerequisites that we have shown to be activated by
AHL, it is plausible that auxin plays a role. However, investigations in recent publications
tend to differ in their findings and are displayed in table 4-1. Previous studies on A. thaliana
showed that the modification of the root system architecture through unsubstituted AHLs and
alkamides is likely auxin-independent (Ramírez-Chávez et al., 2004; Campos-Cuevas et al.,
2008; Ortíz-Castro et al., 2008; Méndez-Bravo et al., 2010; Morquecho-Contreras et al.,
2010). In contrast, Mathesius et al. (2003) demonstrated that oxo-group substituted long-
chain AHLs, oxo-C12-HSL and oxo-C16-HSL, induce an auxin-inducible GH3 promotor in
Trifolium repens, and additionally a differential accumulation level of auxin-responsive
proteins in the root tissue of Medicago truncatula. In accordance with these findings, von Rad
et al. (2008) detected differential regulation of auxin responsive genes and increased auxin
concentrations in root and leaf tissue of A. thaliana after treatment with C6-HSL. In addition,
the results of Bai et al. (2012) reinforce that oxo-group substituted AHLs, such as oxo-C8-,
oxo-C10-, and oxo-C12-HSL, promote polar auxin transport in adventitious root formation in
mung bean, whereas oxo-C10 HSL showed the strongest effect. Further the author displayed
that the unsubstituted analogue of each aforementioned AHL did not or only slightly induce
any auxin reaction. The same findings were made with the investigations of auxin-responsive
genes in mung bean (Bai et al., 2012). The application of oxo-C6-, oxo-C8-, oxo-C10- and
oxo-C12-HSL and additionally the amide hydrolysis product L-homoserine, occurring by AHL
degrading enzymes, were able to induce the DR5:GUS auxin reporter in A. thaliana (Palmer
et al., 2014).
DISCUSSION
75
Table 4-1 Auxin dependent and independent reactions in plants induced by different AHL derivatives
Over all recent publications, there are conflicting investigations whether auxin is involved in
root system alterations or not, but it is obvious that an intact lactone ring is not important for
auxin induction in plants. Moreover, mainly the substitution with an oxo-group at the AHL
acyl-chain length seems to be the crucial factor in defining their biological activity. Non-
substituted AHLs and alkamides, which show high structure similarity to non-substituted
AHLs, promote root system alterations in an auxin independent way, while C6-HSL could
constitute an exception. Hence, it is suggested that the observed hyperpolarization-
dependent K+ uptake is regulated in an auxin-independent mechanism and that the prior
mentioned model (fig. 4.2) can be assumed.
4.1.4 AHL-induced NO accumulation in barley roots
Ortíz-Castro et al. (2008) showed that the C10-HSL mediated induction of lateral root
primordia formation is followed by lateral root generation. NAEs and alkamides, a group of
fatty acid amides structurally related to AHLs, reportedly also modified the root system
architecture by promoting the initiation of lateral root primordia and the emergence of
adventitious and lateral roots (Ramírez-Chávez et al., 2004; López-Bucio et al., 2006;
Campos-Cuevas et al., 2008). Moreover, the stimulation of adventitious and lateral roots has
been associated with NO accumulation (Campos-Cuevas et al., 2008; Méndez-Bravo et al.,
2010). Similar findings were described for mung bean explants, where different short- and
long-chain AHLs, with and without an additional oxo-group at the C3 position, were tested for
adventitious root induction, with the strongest root modifying effect achieved by oxo-C10-
DISCUSSION
76
HSL (Bai et al., 2012). Oxo-C10 HSL also caused the generation of NO in mung bean
explants, while oxo-C12- and oxo-C8-HSL weakly did as well, whereas all their unsubstituted
analogues did not (Bai et al., 2012). In the present study, 1, 10, and 100 µM C8- and C12-
HSL led to NO accumulation in the root tip (calyptra and the elongation zone) of barley roots
(fig. 3.5), while the short chain AHL generated a stronger NO response than the long chain
AHL in the same incubation time. The data clearly show that AHL treatment induces an
accumulation of NO in the root tissue, which could be confirmed by the result that the NO
scavenger cPTIO effectively suppressed NO accumulation (fig. 3.6). The fact that AHL
treatment leads to NO accumulation and the formation of lateral roots at a later growth stage,
suggests that this root morphogenetic effect is associated with previous NO production,
which would then act as a signal inducing compound. Further, it is likely that AHLs and/ or its
initiated signaling cascade are able to interfere with the mechanism and/ or compounds of
lateral root initiation, as it is suggested for alkamides (Campos-Cuevas et al., 2008). The
formation of lateral roots emerges in the phloem pole pericycle and endodermal cells and
occurs post-embryonically via polar auxin transport and the activation of auxin-responsive
genes. Also hormonal interplays, that affect cell division and cell organization may be
involved (reviewed in Nibau et al., 2008; Yu et al., 2016). Accordingly, requirement of NO in
the auxin mediated lateral root formation has been proposed (Pagnussat et al., 2002;
Correa-Aragunde et al., 2004). Experiments with an NO-donor and an additional treatment
with an inhibitor of polar auxin transport displayed that NO alone was able to induce lateral
root formation, whereas the loss of endogenous NO production caused a delay in lateral root
formation (Correa-Aragunde et al., 2004). Adding the specific NO-scavenger cPTIO to auxin-
treated cucumber explants leads to the absence of adventitious roots (Pagnussat et al.,
2002). These findings suggest that NO and auxin partly share the pathway of root
generation. However, the contradictory aspects that have been described in chapter 4.1.3,
emerge again. On the one hand, auxin-independent lateral and adventitious root formation
has been discovered (Ramírez-Chávez et al., 2004; Campos-Cuevas et al., 2008; Ortíz-
Castro et al., 2008; Méndez-Bravo et al., 2010; Morquecho-Contreras et al., 2010), while on
the other hand, it has recently been determined that auxin is involved in the NO-mediated
adventitious root formation in mung bean (Bai et al., 2012). Whether auxin is involved in the
lateral root formation in barley has to be investigated, but most evidence suggests that NO
acts downstream of auxin (Pagnussat et al., 2002; Correa-Aragunde et al., 2006; Méndez-
Bravo et al., 2010). It can be assumed that AHLs initiate the lateral root formation via NO
accumulation. Méndez-Bravo et al. (2010) determined that NO-mediated lateral root growth
follows de-novo formation of lateral root primordia after alkamide treatments in roots and a
higher density of lateral root primordia was discovered after C10-HSL treatments (Ortíz-
Castro et al., 2008). Studies with maize mutants, defective in only one subtype (e.g. primary,
DISCUSSION
77
seminal, or lateral root) of roots revealed that separated genetic pathways are involved in
both lateral and adventitious root formation (Hochholdinger et al., 2004; Malamy, 2005). This
suggests that the bacterial signaling molecules, which reportedly induce lateral and
adventitious roots, interfere with different pathways in the plant development.
Overall, the C12-HSL mediated NO production was lowest in the calyptra and the 3 mm
zone. Reasons can be possibly found in the difference of the molecule structure, compared
to C8-HSL. Previous studies have shown direct interactions of AHLs with membranes (Davis
et al., 2010) and a subsequent integration into supported bilayers (Barth et al., 2012;
Jakubczyk et al., 2012). Furthermore, C8 and C10-HSL and their corresponding degradation
products were found in root tissues, indicating that the quorum sensing molecules can pass
through membranes, either by diffusion or by active transport via ABC transporters
(Jakubczyk et al., 2012; Sieper et al., 2014; Götz-Rösch et al., 2015). The hydrophilic short-
chain AHLs attach less to the root surface than the long-chain AHLs, which leads to more
rapid membrane passage and transport in the symplast (Sieper et al., 2014). These
characteristics may explain the stronger NO responses to short-chain AHLs in barley roots.
Moreover, the longer carbon side chain of the C12-HSL molecule which shows higher
lipophilicity and therefore lower symplastic transport rates, causes smaller increases in the
subsequent NO production during the same incubation time. This fact is reflected by the
investigation of Sieper et al. (2014), where it was displayed that C10-HSL is transported
slower than C8-HSL in barley. Furthermore, C12-HSL is distinguished from the C10-HSL
compound by the presence of an additional C2H5 group, which provides a higher logP value
(3.385 ± 0.44, Davis et al., 2011) and therefore a greater lipophilicity compared to C10-HSL
(logP 2.96, Götz et al., 2007). Another important fact that could help to explain our higher NO
accumulation in the elongation zone is the result of autoradiography experiments with tritium-
labeled AHLs in root cross sections of maize seedlings (Sieper et al., 2014). Here, higher
radioactive signals were detected in the zone behind the root tip compared to the root middle
cross sections, revealing that AHLs are absorbed behind the root tip. These observations
suggest that the present notably higher fluorescence in the calyptra and the elongation zone
reflect local and intense interactions of AHLs with the root surface (see chapter 3.2.1).
The AHL induced NO accumulation also could have arisen as part of an elicitor-recognized
mechanism in the plant root. As AHLs are produced by pathogenic and non-pathogenic
bacteria (Brelles-Mariño and Bedmar, 2001), they could serve as a general identifying
feature that tells the plant whether there are either pathogenic or beneficial bacteria
(Hartmann et al., 2014). Indeed, the treatment with an elicitor of Botrytis cinerea led to NO
accumulation in grapevine (Vandelle et al., 2006). Also, cryptogein, a fungal elicitor of
Phytophthora cryptogea (Foissner et al., 2000), induced an NO response in tobacco.
DISCUSSION
78
Exudates of Gigaspora margarita, a mutualistic mycorrhizal symbiont of Medicago truncatula,
mediated NO accumulation as well (Calcagno et al., 2012). The application of
lipopolysaccharides which are used as elicitor representatives of gram-negative bacteria,
induced NO response in A. thaliana within 10 min after application (Ali et al., 2007), similar to
observations of T. Sieper. There, she detected the increase of NO accumulation around 10
min after C8-HSL application (Sieper, 2012), which is in accordance with the demonstrated
NO accumulation in barley roots after C8- and C12-HSL treatment in this study. Sieper
(2012) already discussed NO as a possible signaling compound from root to shoot, to induce
systemic reactions. The AHL-mediated NO bursts in barley roots occurred 10 to 20 min after
application, indicating a time slot of 10 min before the NO accumulation occurs (Sieper,
2012) and suggesting the occurrence of a more rapid mechanism for AHL recognition.
Previous studies of grapevine and A. thaliana have demonstrated that elicitor treatments
induce Ca2+ influxes in cells with following NO production (Vandelle et al., 2006; Ma et al.,
2008). Moreover, in experiments with oxo-C12-HSL, which is a typical AHL of the
opportunistic pathogen Pseudomonas aeruginosa, induced apoptosis in mammalian cells via
intracellular calcium signaling was demonstrated (Shiner et al., 2006). Furthermore, Song et
al. (2011) observed that 10 µM C4-HSL treatments elevate intracellular Ca2+ concentrations
within 6 s in A. thaliana roots. In agreement with Ali et al. (2007), NO production follows Ca2+
bursts, which are reportedly inducible with C4-HSL in A. thaliana roots (Song et al., 2011).
These data suggest that NO accumulated in barley roots in consequence of an AHL-
mediated Ca2+ burst.
4.1.5 Cell viability
As shown in chapter 3.2.1, AHLs induce accumulation of NO in barley roots. NO is the main
reactive oxygen intermediate involved in the induced hypersensitive response, which causes
local cell death (Delledonne et al., 1998; Delledonne et al., 2001). This fact gave rise to the
investigation of the viability of root cells after AHL treatment in the present study. The
establishment of appropriate cultivation conditions and the demand of viable epidermal cells
for K+ ion flux measurements also required the examination of the cell viability. In the present
study, all epidermal cells were intact after application of 100 µM C8-HSL (fig. 3.7 E+F), as
indicated by green fluorescence. Thus, the AHL-mediated NO accumulation did not affect the
integrity of root cell membranes. Furthermore, the cell integrity and viability was not disturbed
after termination of the K+ ion flux measurement (fig. 3.7 H). This gives proof that all
measurements were conducted with living root epidermal cells. Similarly, the application of
purified AHL derivatives, produced by the opportunistic human pathogen Pseudomonas
aeruginosa, did not influence the viability of T-lymphocytes (Davis et al., 2010). Also,
DISCUSSION
79
treatments with the NO donor SNP, with concentration ranges between 20 to 60 µM, did not
induce any cell membrane destructions which could lead to cell death in A. thaliana
(Méndez-Bravo et al., 2010). Interestingly, in the present study, the cultivation in tap water
induced cell lesions in the root elongation and differentiation zone, displayed by red
fluorescence in figure 3.7 A. All electrophysiological experiments were conducted in
Barcelona, where a chlorination of the tap water for disinfection is applied (Villanueva et al.,
2001). Adding chlorine to water leads to the production of hypochlorous acid and
hypochlorite, while further byproducts like trihalomethanes and haloacetic acids are formed
as well (Nieuwenhuijsen et al., 2000). These substances may possibly affect cell viability.
Additionally, it could be observed that barley cultivated in half strength Hoagland solution
developed cell damage (fig. 3.7 C). In contrast, cucumber plants that were grown in full
strength Hoagland solution did not show any cell damage (Yuan et al., 2016). The cultivation
of barley in the different growth media was conducted under aerated conditions. Possibly, the
aeration in the cultivation pot was not sufficient so that hypoxia occurred, which reportedly
causes cell damage (Zeng et al., 2014).
4.2 AHL induced reactions in the upper plant part
4.2.1 Defense compounds and plant phytohormones in ISR
Plants evolved constitutive and inducible defense mechanisms to protect themselves against
pathogen attacks. Phenylpropanoid compounds such as phenolics, lignin, phytoalexins, and
flavonoids are the end-products of the PAL regulated phenylpropanoid pathway (MacDonald
and D’Cunha, 2007). Both the phenylpropanoids and the PAL are mainly involved in plant
defense and restrict pathogen spreading (Dixon et al., 2002). In the present work, short- and
long-chain AHLs increased the PAL activity 12 h after their application (see chapter 3.3.4).
Interestingly, the PAL transcript (MLOC_64900) was down-regulated 6 h (log 2 fold -1.72)
and up-regulated 12 h (log 2 fold 1.82) after C12-HSL treatment, whereas no transcript
accumulation occurred after C8-HSL treatment. Schenk et al. (2014) could not detect any
PAL transcript, but up-regulated transcripts of the flavonoid metabolism and elevated levels
of secondary metabolites such as lignin and phenolics. Increased levels of these compounds
suggest an elevated PAL enzyme activity because PAL is the gateway and regulatory
enzyme of these metabolites. In the present study no increased levels of the flavonoids
lutonarin and saponarin were determined. Thus, the demonstrated increased PAL activity
was not leading to enhanced concentration of these secondary compounds. Therefore, a role
of these metabolites in the defense of barley against Xtc (chapter 3.3.5) can be ruled out. But
in the context of defense, it was observed that the suppression of PAL in tobacco diminished
DISCUSSION
80
the expression of SAR (Pallas et al., 1996). Furthermore, the PAL activity and its potential
role in plant defense could be demonstrated in benzo-(1,2,3)-thiadiazole-7-carbothioic acid
S-methyl ester (BTH)- and β-aminobutyric acid (BABA)-treated plants after subsequent
pathogen challenge (Stadnik and Buchenauer, 2000; Wang et al., 2016). Additionally, BTH-
treatment resulted in the accumulation of cell wall bound and soluble phenolics (Stadnik and
Buchenauer, 2000), as it has been reported by Schenk et al. (2014). Therefore, the authors
relate the BTH-mediated resistance, which could be achieved by a faster accumulation of
phenolic compounds, to increased PAL activity (Stadnik and Buchenauer, 2000). Possibly,
AHLs induce a similar reaction in barley and an enhanced PAL activity could contribute to the
demonstrated resistance against Xtc (chapter 3.3.5). Furthermore, PAL catalyzes the initial
steps and the precursors of SA, whereby chorismate-derived phenylalanine is transformed
into SA via either benzoate intermediates or coumaric acid via several enzymatic reactions
(Vlot et al., 2009; Liu et al., 2015). Various studies revealed that increased PAL activity is a
decisive factor for SA-induced pathogen resistance (reviewed in Liu et al., 2015). In the
present study, elevated SA levels were determined 4 h after short- and long-chain AHL and
additionally 12 h after long-chain AHL treatment, while the PAL activity peak occurred 12 h
after AHL application. Thus it seems reasonable that the enzyme activity is maybe involved
in the SA accumulation at the 12 h time point but not at the 4 h time point.
Two leading mechanisms of systemic resistance, SAR and ISR are known to be dependent
on SA and JA/ET signaling, respectively. The phytohormones salicylic acid, jasmonate,
ethylene, and abscisic acid interact in a weaving network with and/or against each other and
take over a complex role in the alleviation of biotic and abiotic stressors (Pieterse and van
Wees, 2015). In the ISR-model system A. thaliana-Pseudomonas fluorescens WCS417r,
resistance was triggered in an SA-independent way without activating the accumulation of
PR proteins, whereas JA and/or ET seem to play a pivotal regulatory role in the systemic
immunity (De Vleesschauwer and Höfte, 2009; Pieterse et al., 2014). This SA-independency
has been investigated in a large amount of ISR-mediating plant-microbe interactions (van
Loon and Bakker, 2006), but the molecular basis of ISR is still not completely understood.
Furthermore, certain PGPR strains have been demonstrated to trigger ISR in a SA-
dependent way (De Vleesschauwer and Höfte, 2009). In the present study, the root
treatment with C8- and C12-HSL induced a SA accumulation in barley leaves after 4 h of
application (fig. 3.15), while JA and JA-IIe were not influenced at this time point (see fig
3.16). Additionally, an increase of the SA content was observable after 24 h in the control
sample. Here, an improper harvesting of the samples could be a possible trigger, as these
samples were only mock inoculated. The PGPR strains Bacillus N11.37 and
Stenotrophomonas N6.8 reduced disease symptoms of Xanthomonas campestris CECT 95
in A. thaliana in an SA-dependent manner (Domenech et al., 2007). Similar findings could be
DISCUSSION
81
determined in tomato leaves, where a PGPR-primed defense reaction led to 3-fold elevated
SA levels within 3 days, which was not achieved when plants were inoculated with the AHL-
deficient PGPR mutant. Additionally, the root-inoculation with C6-HSL resulted in elevated
SA levels in tomato root tissue (Schuhegger et al., 2006), which demonstrates that single
AHL-application is sufficient to induce a systemic phytohormone response. Interestingly,
inoculation of A. thaliana solely with oxo-C14-HSL did not result in elevated SA levels, only
the second trigger with Pseudomonas syringae pv. tomato DC3000 was sufficient to be SA
inducible (Schenk and Schikora, 2015). Hereby, the SA levels were analyzed after 3 days of
oxo-C14-HSL treatment, but the same time point in the study of Schuhegger et al. (2006)
revealed higher SA concentration without additional pathogen challenge. In the present study
the phytohormone concentration was determined within a time frame of 24 h after pure AHL
application. Interestingly, the oxo-C14-HSL mediated resistance requires a functioning SA
pathway demonstrating a JA-independent resistance induction (Schenk et al., 2014).
Recent publications reportedly showed that AHLs are able to transfer plants into a priming
state and prepare them with an enhanced cellular defense response against upcoming
pathogens (Schikora et al., 2011; Pieterse et al., 2014). The state of priming can be divided
in 3 sub-states: (pre-challenge) primed state, post-challenge primed state, and
transgenerational primed state (Balmer et al., 2015). The first state, to which our results
belong to as it is the time slot before the pathogenic challenge, is characterized by changes
in the primary metabolism of compounds such as amino acids, tricarboxylic acid derivatives,
and sugars. Inactive protein kinases, inactive defense-metabolite conjugates, and (inactive)
plant hormone conjugates also occur (Pastor et al., 2014). Comparative investigations with
the effect of BABA and the avirulent Pseudomonas syringae pv. tomato (PstAvrRpt2) on A.
thaliana´s priming state revealed the production of SA with a simultaneously repression of
JA, while BABA induced a slight induction of oxophytodienoic acid (OPDA, Pastor et al.,
2014). These results support the present response pattern in barley and reflect the
phytohormonal crosstalk between SA and JA, where JA suppression follows SA
accumulation (Koornneef and Pieterse, 2008; Pieterse et al., 2012). This gives rise to the
assumption that AHLs transfer barley into a primed state via an SA-dependent mechanism,
which allows stronger fight back against upcoming pathogens. It can be excluded that the SA
accumulation occurred due to wounding, because in the examination of the cell viability no
damaged root cells were demonstrated (fig. 3.7 E+F). The same findings were reported by
Schuhegger et al. (2006). AHLs mediate the elevated SA levels and the systemic resistance
not via wounding, as it is demonstrated in SAR. Moreover, recent findings indicated that the
AHL-induced resistance, also termed as AHL priming, is dependent on the SA/OPDA
pathway, causing a cell wall reinforcement of A. thaliana leaves due to accumulation of
DISCUSSION
82
phenolic compounds, lignin, and callose, as well as in the increased stomatal closure in
response to pathogen challenge (Schenk et al., 2014; Schenk and Schikora, 2015).
In the present study elevated ABA concentrations occurred in barley leaves 4 h after C12-
HSL application, whereas the short-chain C8-HSL did not induce ABA accumulation. ABA is
a key regulator in abiotic stress-related stomata closure to prevent water loss (Lee and Luan,
2012), while ABA-driven stomatal closure is also part of a plant innate immune response to
prevent pathogen invasion. Recently, Melotto et al. (2006) demonstrated that the stomatal
defense response, which functions as physical barrier, requires the functionality of SA and
ABA. Thus, the increased SA and ABA accumulation could be involved in stomatal closure
just after AHL application, but investigations revealed higher transpiration rates of plants after
L-homoserine treatment, an AHL degradation product (Joseph and Phillips, 2003; Palmer et
al., 2014). However, the signaling pathways of both phytohormones were involved in the
stomatal closure promoted by the beneficial PGPR Bacillus subtilis FB17 (Kumar et al.,
2012). In the present study, the ABA induction occurred until 10 h past AHL application and
was below control values at 22 h past AHL treatment. The leaf pathogen Xtc invades plants
through stomata (Graham et al., 1992). As Xtc is introduced into barley leaves via syringe-
infiltration 24 h after AHL treatment, the bacteria already entered the plant tissue and an
ABA-mediated stomatal closure would not have been restrictive, while furthermore ABA
negatively regulates resistance (Xu et al., 2013). But induction of ABA in the first 10 h could
display a subsequent and fast reaction leading to a general pathogen defense in the sense of
stomata closure and induction of callose deposition, which has been discovered 24 h after
AHL/flg22-challenge (Schenk et al., 2014). Even if the author suggests a SA/OPDA-
dependent cell wall reinforcement mechanism and a non-expression of ABA-dependent
genes, studies revealed an ABA-dependent callose deposition in function of BABA-primed
plants (Ton et al., 2005). Also, demonstrably, AHL treatment transfers plants in a primed
state (Schikora et al., 2016). The cell wall reinforcement, e.g. callose deposition, in the
primed plants increases the physical barriers that an upcoming pathogen has to overcome so
that the plant gains time to initiate further pathogen appropriate defense mechanisms (Voigt
and Somerville, 2009).
Recent findings demonstrated that ABA functions antagonistically to the
phytohormone SA, while it suppresses the SA-mediated defense response (Asselbergh et
al., 2008; Xu et al., 2013). Interestingly, in the present system both phytohormones are up-
regulated following AHL application. A plant system which shows similar findings is the vtc1
mutant of A. thaliana, displaying a vitamin c deficiency (Pastori et al., 2003; Barth et al.,
2004). This mutant possesses up-regulated SA and ABA levels, which confer resistance
induction against Pseudomonas syringae pv. maculicola ES4326 and Peronospora parasitica
pv. Noco (Barth et al., 2004). This example confirms that both phytohormones can be
DISCUSSION
83
Figure 4.3 Prospective model summarizing defense compounds involvement in ISR after AHL application.
simultaneously up-regulated and are involved in resistance induction. Interestingly barley
responds with enhanced formation of HR after bacterial produced oxo-C4-HSL treatment and
displayed increased papillae formation, while a reduction of powdery mildew induced disease
symptoms occurred (Schikora et al., 2011; Hernández-Reyes et al., 2014). Treatment of
barley with ABA resulted in papillae-mediated resistance against the fungus Blumeria
graminis f. sp. hordei, which causes powdery mildew disease (Wiese et al., 2004). However,
papillae formation, which accompanies HR, is SA-independent in barley (Hückelhoven et al.,
1999), but still examples give a key role to SA in HR (Shirasu et al., 1997; Tenhaken and
Rubel, 1997). It has been reported that the SA/OPDA-pathway is involved in cell wall
reinforcement and callose deposition (Schenk et al., 2014), while papillae generally contain
callose (Chowdhury et al., 2014). Due to these facts, it is possible that both phytohormones
play a role in defense, but further studies in barley have to be undertaken.
There is still the open question, why only C12-HSL induces an ABA-response in barley while
C8-HSL does not. This fact points out that barley differentiates between short- and long-
chain AHLs, wherefore the plant responds in a different manner but ends up in the same
result: an induced resistance against Xtc. It is likely that the transportability of C8-HSL plays
a crucial role. Thus, C8-HSL could initiate the resistance signaling directly in the leaf but in a
different way, while long-chain, non-transportable AHLs induce resistance in a MAPK
dependent signaling pathway (Schikora et al., 2011).
DISCUSSION
84
4.2.2 Differential gene regulation after AHL application
The present investigations confirmed the assumption that AHLs induce systemic resistance:
the application of C8- and C12-HSL confer resistance against the biotrophic leaf pathogen
Xtc through a SA-dependent ISR. Typically, the occurrence of ISR is not accompanied by the
activation of PR genes (van Wees et al., 1999). An increased level of resistance against
various pathogens is achieved by a more strongly sensitized plant tissue, meaning that the
systemic distal plant part is able to induce faster and stronger basal defense responses to
pathogenic intruders, a phenomenon known as priming (Conrath et al., 2002). Pieterse and
Van Wees (2015) assume that the SA-dependent ISR most probably follows the SAR
signaling pathway, which usually implies increased SA levels and the activation of PR genes,
of which several possess antimicrobial activity (Datta and Muthukrishnan, 1999; Ebrahim et
al., 2011). In barley, bacteria induced SAR is not associated with SA and HvNPR1
upregulation, which stands in contrast to SAR in dicots (Vlot et al., 2009; Dey et al., 2014).
The typical SAR genes (of dicots) PR1 and Non-Expressor of Pathogenesis Related Genes 1
(NPR1; Vlot et al., 2009) were not confirmed by the RNA seq in barley leaves after AHL
application, but PR5 was differentially up-regulated 12 h and 24 h after C8- and C12-HSL
treatment, respectively (see appendix table 7-2). Furthermore, several other PR-genes and
stress related genes were expressed which will be described and discussed in the following.
In the present study, the expression profile of 6 genes was studied by qRT-PCR, among
them a basic helix-loop-helix DNA-binding superfamily protein (AK371210), a chitinase family
protein (MLOC_68184), a subtilisin-chymotrypsin inhibitor 2A (MLOC_2643), a chaperone
protein DnaJ (MLOC_22770), a 60 kDa jasmonate-induced protein (MLOC_25773.1), and a
leaf specific thionin 2.2 (AK252675.1).
The bHLH proteins are transcription factors that have been well characterized in Drosophila,
C. elegans, and mammals, while the phylogenetic relationship as well as structural and
functional analyses have also been elucidated (Ledent and Vervoort, 2001). In mammals, the
bHLH proteins possess key regulatory function in processes such as cell proliferation and
differentiation, lineage commitment, and sex determination (Massari and Murre, 2000), while
this transcription factor superfamily is also described in plants with functions in phytochrome
signaling, regulation of the anthocyanin pathway and synthesis, and abiotic stress regulation
(Toledo-Ortiz et al., 2003; Kiribuchi et al., 2005; Li et al., 2006b; Bai et al., 2011; Xu et al.,
2014). This protein family is characterized by the bHLH signature domain, which contains 60
amino acids with 2 functionally distinct regions. The N-terminal located basic region functions
as a DNA binding motif and the C-terminal located helix-loop-helix region functions as a
dimerization domain conferring the formation of homo- or heterodimers (Murre et al., 1989;
Ferré-D’Amaré et al., 1994). The submission of the bHLH coding sequence (CDS) to the
DISCUSSION
85
NCBI nucleotide BLAST database resulted in 2 interesting hits. First, an 83 % sequence
identity was revealed to the CDS of the bHLH transcription factor HvIRO2 (Hordeum vulgare
iron-related transcription factor 2). HvIRO2 regulates the iron deficiency response in barley
and its transcript was up-regulated in barley upon cadmium exposure, which induces
responses similar to iron deficiency (Astolfi et al., 2014). Accordingly, the expression of the
HvIRO2 homologue in rice OsIRO2 (Oryza sativa iron-related transcription factor 2) was
strongly induced in both roots and shoots during iron deficiency stress (Ogo et al., 2006).
Second, the nucleotide blast resulted in a 72 % sequence identity to an ORG3-like
transcription factor of Zea mays, while the protein blast resulted in a 93 % amino acid
sequence identity to the transcription factor ORG2 of Triticum urartu. The transcription factor
ORG3 of A. thaliana, also named AtbHLH39, encodes a protein containing the bHLH
domain, and has approximately 80 % amino acid sequence identity in common with ORG2,
also named AtbHLH38 (Kang et al., 2003). Interestingly, both genes are homologs of
HvIRO2 and OsIRO2 (Feller et al., 2011), responsive to iron deficiency, to SA application,
and are suggested to be transcription factors due to their containment of bHLH-DNA-binding
motif (Kang et al., 2003; Wang et al., 2007). ORG2 and ORG3 were expressed in roots and
leaves, where their transcript started to accumulate from 6 h, reaching their maximum at 24
h, which is in accordance to the bHLH transcription factor transcript profile (fig 3.14) and the
AHL induced SA accumulation (fig. 3.15) in the present study. Wang et al. (2007) suggest
that the expression of bHLH transcription factors in leaf tissue is caused by a systemic
signal, while the SA-dependent induction of ORG2 and ORG3 might play an important role
(Kang et al., 2003). In the early signaling cascade of the Pseudomonas fluorescens
WCS417r and Trichoderma asperellum T34 induced resistance, the transcription factor
MYB72 plays a pivotal role (Van der Ent et al., 2008; Alizadeh et al., 2013), while this
molecular player is also induced in roots under iron-deficiency conditions (van de Mortel et
al., 2008; Palmer et al., 2013). This gives rise to the assumption of a connecting point
between iron homeostasis and the induction of ISR (Pieterse et al., 2014). Additional
supporting evidence of an ISR-iron homeostasis linkage is the activation of AtbHLH39
(ORG3) by MYB72 in A. thaliana in response to colonization by ISR-inducing Pseudomonas
fluorescens WCS417 (Zamioudis et al., 2014). Furthermore, Zamioudis et al. (2015)
demonstrated that the ability of PGPRs to mediate ISR is associated with their capability to
induce iron deficiency response by activation of the transcription factor MYB72, the iron-
deficiency marker genes FRO2 (ferric reduction oxidase 2), a Fe3+ chelate reductase, and
IRT1 (iron transport protein 1), a Fe2+ transport protein in A. thaliana. Interestingly, under iron
deficiency conditions FRO2 and IRT1 are regulated by the bHLH transcription factor FIT
(FER-like iron deficiency-induced transcription factor), which regulates their gene expression
through the hetero-dimerization with AtbHLH38 (ORG2) and AtbHLH39 (ORG3; Yuan et al.,
DISCUSSION
86
2008; Wang et al., 2013). Additionally, Zamioudis et al. (2015) demonstrated that the
treatment with volatile organic compounds of Pseudomonas fluorescens WCS417 induced
the transcription factors FIT, AtbHLH38, and AtbHLH39. There is also evidence that MYB72
is regulated by these transcription factors as well as FRO2 and IRT1. The application of C8-
and C12-HSL induced resistance against Xtc and led to the induction of the bHLH DNA-
binding protein (AK371210), which shows sequence identity to genes with a functional role in
the iron deficiency and an involvement in the MYB72- mediated ISR. Hence, it is likely that
the AHL-mediated ISR correlates with an iron deficiency response. Furthermore, it has to be
considered that a biological function of `protein dimerization` is assigned to the bHLH DNA
binding protein in this present study (see chapter 3.3.2.3) as, as already mentioned above,
FIT produces hetero-dimers with AtbHLH38 and AtbHLH39. Support for the hypothesis that
AHLs might induce an iron deficiency response is given in the result of the RNA seq (see
table 7-2), where further genes involved in iron deficiency are regulated: the transcription
factor ORG2 (MLOC_36351) was up-regulated at 24 h after C8- and C12-HSL treatment and
the transcript of the 2-oxoglutarate and Fe(II)-dependent oxygenase gene (MLOC_77560)
was up-regulated 12 h after C8-HSL, and 12 and 24 h after C12-HSL treatment. In A.
thaliana the transcript of the 2-oxoglutarate and Fe(II)-dependent oxygenase gene
(At3g12900) was also strongly up-regulated due to iron deficiency (Buckhout et al., 2009). In
the present study, the transcript deregulation of the gene ferritin 4 (MLOC_69295) might also
indicate that an iron deficiency response is induced by AHLs. The transcript was down-
regulated 24 h after long-chain AHL application (see table 7-2), similar to A. thaliana in iron
starvation conditions (Buckhout et al., 2009; Pan et al., 2015). An iron deficiency induced by
the cultivation medium could be excluded, because on the one hand the concentration of
ferrous sulfate amounts to 97 µM and the media of control plants of iron-deficiency
experiments contains 50 µM of this micro-nutrient (Wang et al., 2007). On the other hand, a
low pH favors the acquisition of iron (Morrissey and Guerinot, 2009). These conditions are
obtained because barley lowers the pH of the cultivation medium to 4.1 through the excretion
of acidic root exudates (Götz-Rösch et al., 2015).
The root application of C12-HSL for 6 and 12 h induced the transcript of the chitinase family
protein (MLOC_68184). The submission of the chitinase family protein CDS (MLOC_68184)
to the Ensemble genome annotation system resulted in the annotation of chitinase 2a
(Kersey et al., 2015). Chitinases of class 2 belong to the PR3 family (Ebrahim et al., 2011). In
plants, chitinases mainly play an important role in the defense of the organism against
pathogens, while the main substrate of these enzymes is chitin, which is a natural
homopolymer of β-1,4- linked N-acetylglucosamine residues present in the cell walls of fungi,
algae, and bacteria, (van Loon and van Strien, 1999; Kasprzewska, 2003; Ebrahim et al.,
DISCUSSION
87
2011) Conducting a protein sequence blast, the chitinase 2a could be classified to the
glycosidase family 19, which has acidic properties and is regulated by SA (Van Kan et al.,
1995; Kasprzewska, 2003). The activation of an acidic chitinase after 5 h of short-chain AHL
application could be demonstrated in tomato, while additionally elevated SA levels were
determined (Schuhegger et al., 2006). In the present study, the root application of C12-HSL
enhanced the systemic expression of an acidic chitinase (PR3) and also induced SA
accumulation in barley leaves until 12 h after treatment. In contrast to the findings of
Schuhegger et al. (2006), here, only the long-chain AHL was able to differentially regulate
the PR3 gene. The up-regulation of PR3, which is a marker of SAR in dicotyle (van Loon and
van Strien, 1999), is consistent with the assumption that SA-dependent ISR most probably
follows the SAR signaling pathway (Pieterse and Van Wees, 2015). Interestingly, the
chemical priming substance BABA caused a many fold induction of an acidic chitinase in
tomato leaves (Roylawar et al., 2015) and induced a concentration dependent priming and/or
fully induction of a chitinase with and without subsequent pathogen challenge in strawberry
fruits (Wang et al., 2016). Accordingly, priming with BABA in lime resulted in elevated
chitinases transcripts and subsequently conferred resistance against Xanthomonas citri
subsp. citri infection (Sharifi-Sirchi et al., 2011). As AHLs possess a crucial role in priming,
like the above mentioned chemical substances (Schikora et al., 2016), it is likely that the
enhanced gene expression in the present study follows a similar mechanism.
Among the 17 PR gene members, 4 so called PR peptides, more specifically PR6, PR12,
PR13, and PR14 with the properties of proteinase inhibitor, defensin, thionin and lipid-
transfer protein, respectively exist (Sels et al., 2008). The transcript of two of them, PR6 and
PR13, are differentially regulated in barley leaves after AHL application (see fig. 3.14). The
protein sequence blast of PR6, which represents the subtilisin-chymotrypsin inhibitor 2A
(MLOC_2643), indicated that this protein has the potato inhibitor 1 family motif. This allows it
to be classified to the potato inhibitor I family of serine protease inhibitors (PIs) which are
grouped in the family of PR6, and possess inhibitory activity against the serine proteinases
chymotrypsin, trypsin, and subtilisin of plant-attacking pathogens (Datta and Muthukrishnan,
1999). Accordingly, PIs detectable in leaves have a distinct role in plant defense against
herbivore insects by inhibiting their digestive enzymes in the guts, while they have been
described to be highly active in the defense against various phytopathogenic microorganisms
(Ryan, 1990; Pautot et al., 1991; Koiwa et al., 1997; Jamal et al., 2013). This phenomenon
has been determined in the interaction of both disease-susceptible and disease-resistant
Lycopersicon esculentum cultivars with the bacterial pathogen Pseudomonas syringae pv.
tomato, which resulted in increased accumulation of the serine proteinase inhibitor I and II
transcript (Pautot et al., 1991). In germinating embryos of the monocotyledonous plant
DISCUSSION
88
maize, an induction of a PI occurred due to infection of Fusarium moniliforme (Cordero et al.,
1994) but root-applied PGPRs are able to induce systemic PI expression as well (Wang et
al., 2005). Grapevine cell cultures respond to SA application with protease inhibitor
accumulation, while the gene expression was enhanced after PGPR and non-host bacteria
inoculation. Furthermore, the microbial inoculation also led to enhanced SA levels (Bordiec et
al., 2011). The enhanced expression of a PI, the SA accumulation in barley leaves, and an
ISR against Xtc in the present study show similarity to previous examples. It is likely that the
PR6 gene expression is induced as an early response to AHL application in barley and may
prime and supply the plant with stronger fight back for upcoming pathogens.
The other PR peptide, the leaf specific thionin, was induced 6 h and 24 h after short- and
long-chain AHL application, respectively, thus both AHLs were able to stimulate a thionin
induction, but at 2 distinct time points. The thionins are 6 kDa small peptides that exist in
monocotyledonous and dicotyledonous plants (Bohlmann and Apel, 1991; Andresen et al.,
1992; Stec, 2006). The nucleotide sequence blast of the thionin (MLOC_46400) resulted in
the annotation of the BTH6 gene, a barley leaf specific thionin that belongs to the type 2
class of Poaceae thionins, which is consistent with the RNA seq annotation thionin 2.2
(Florack and Stiekema, 1994; Kersey et al., 2015). Interestingly, the mRNA of thionin 2.2 of
A. thaliana is also expressed in leaf tissue (Sels et al., 2008). Furthermore, these cysteine-
rich polypeptides are classified to the family of PR13 (Ebrahim et al., 2011) and possess
antimicrobial activity, which is consistent with an important role in plant defense against
various phytopathogenic bacteria and fungi (Fernandez de Caleya et al., 1972; Bohlmann et
al., 1988; Florack et al., 1993; Datta and Muthukrishnan, 1999). Chemical and abiotic
substances, which includes heavy metals, JA, and 2,6-dichloroisonicotinic acid (INA), a SAR
inducer, reportedly activate the accumulation of thionin transcripts (Fischer et al., 1989;
Andresen et al., 1992; Wasternack et al., 1994). On the contrary, the application of the
endophytic PGPR Herbaspirillum seropedicae repressed the thionin transcript during a
successful colonization process in rice roots, indicating that these rhizobacteria are able to
interfere with the plants’ defense alarm system (Brusamarello-Santos et al., 2012). Mainly,
thionin accumulation is JA-responsive. Therefore, these polypeptides belong to the family of
jasmonate-inducible proteins (JIPs) of barley, while the barley leaf thionin is characterized as
a JIP6 because of a protein size of 6 kDa (Andresen et al., 1992; Reymond and Farmer,
1998). Interestingly, SA application is also able to trigger thionin mRNA accumulation in
barley leaves (Kogel et al., 1995). Here, in the present study, SA, but not JA, could be
verified in barley leaves subsequently after AHL application, which could imply that SA is
also involved in the stimulation of an enhanced level of thionin transcripts. Furthermore, the
thionin protein is expressed in the cell wall of epidermal cells (Reimann-Philipp et al., 1989)
DISCUSSION
89
and has been demonstrated to display its toxicity with a membrane lytic activity towards
pathogens (Datta and Muthukrishnan, 1999). It is likely that an increased transcript
accumulation leads to higher amounts of expressed protein to fight against impending
pathogens like Xtc. The transcript accumulation could also constitute the already mentioned
priming state of the plant, leading to the production of ‘ready to use’ thionin precursors that
just have to be post-translationally processed for activity (Florack and Stiekema, 1994), as it
was mentioned for inactive AtMPK3 accumulation after BTH-priming (Beckers et al., 2009).
Besides JIP6, a second JIP that is involved in defense was differentially regulated: the JIP60.
The protein sequence blast of JIP60 (MLOC_25773) discovered a ribosome-inactivating
protein domain at the N-terminal region. Indeed, the JIP60 is classified to the ribosome
inactivating proteins (RIPs), which are toxins and act as N-glycosidases that irreversibly
inhibit the protein translation in JA-treated and stressed plant tissue (Chaudhry et al., 1994;
Reinbothe et al., 1994; Schrot et al., 2015). At this point it becomes clear that the
characterization with a biological process of translation inhibition and a molecular function of
hydrolase and rRNA glycosylase activity is correct (result of ensemble data base annotation;
Kersey et al., 2015). RIP classification proposes the main types RIP 1 and 2, while JIP60
possesses an exceptional position due to its different protein structure and belongs to the
RIP type 3, also termed as peculiar RIP1 (de Virgilio et al., 2010). The transcript of JIP60
accumulated in barley leaves after sorbitol, methyl-jasmonate, and desiccation treatment,
while also ABA and senescence dependent accumulation was demonstrated (Becker and
Apel, 1993; Reinbothe et al., 1994). JIP60 cleaves the polysomes from stressed leaf tissue,
so that the dissociation into their ribosomal subunits occurs and consequently an interruption
of protein translation (Reinbothe et al., 1994). In the present study, the JIP60 transcript was
systemically up-regulated in barley leaves 12 h after C8- and C12-HSL treatment. SA and
hydrogen peroxide were demonstrated to induce 2 RIPs type 1 in sugar beet (Girbés et al.,
1996; Iglesias et al., 2005). Interestingly, besides a local induction after various biotic and
abiotic stresses (Jiang et al., 2008), also a systemic induction of type 1 RIPs in un-stressed
tissue after local wounding as well as after JA and ABA treatment was observed (Song et al.,
2000). As SA and ABA are potential RIP inducers and these phytohormones display elevated
levels in barley leaves (chapter 3.3.3), a possible involvement in JIP60 transcript regulation is
therefore suggested. A dual function for JIP60 is proposed and involves a defense molecule
function against non-plant ribosomes (e.g. from bacteria, fungi and viruses) and in a later
stage a degradation function of ‘self’ ribosomes that are ubiquitinated for degradation
(Reinbothe et al., 1994). RIPs display antiviral activities (Barbieri et al., 1993), but also
antibacterial and -fungal activities of tobacco RIPs were demonstrated recently (Sharma et
al., 2004). The diverse regulators and the potential antimicrobial activity are reasons to
DISCUSSION
90
regard JIP60 as a protein with supposed defense function for plant protection, as it is for the
abovementioned chitinase, leaf thionin, and proteinase inhibitor.
Molecular chaperons are important players in the cellular homeostasis in plants and animals
and are also termed heat-shock-proteins (HSPs) because their expression was mainly found
after high temperatures (heat shock), but as well after biotic or abiotic stress conditions, such
as salinity, cold, and water stress (Lindquist and Craig, 1988; Boston et al., 1996; Wang et
al., 2004). In eukaryotes 5 main HSP families are determined due to their molecular weights,
namely HSP100, HSP90, HSP70, HSP60, and small HSP (Wang et al., 2004; Park and Seo,
2015). The molecular chaperons are generally located in cytoplasm but also appearances in
mitochondria, chloroplasts, ER, and nucleus have been reported (Vierling, 1991; Boston et
al., 1996; Wang et al., 2004). In the present study, a differential regulation of HSP40 after 6 h
of C12-HSL treatment could be determined. Interestingly, the HSP40, annotated as chaperon
protein DNAJ 10 in the RNA seq results, also termed J-domain-containing protein, is an
important co-chaperon of HSP70 (Park and Seo, 2015). The co-chaperons are required to
increase the ATPase activity of HSP70 and to regulate correct protein folding, substrate
binding and release (Bukau and Horwich, 1998; Frydman, 2001; Fan et al., 2003; Wang et
al., 2004). Both HSP40 and HSP70 were reported to be involved in plant resistance and
susceptibility to pathogen infection (Park and Seo, 2015). The molecular chaperon and its
co-chaperon are involved in viral cell-to-cell movement and disease spreading (Soellick et
al., 2000; Boevink and Oparka, 2005). Recently, contrary observations have been reported.
The HSP70 transcript accumulated in pepper leaves and was involved in the hypersensitive
response against Xanthomonas campestris pv. vesicatoria, while the HSP70 transcript
silencing caused a susceptibility of pepper towards Xanthomonas campestris pv. vesicatoria
(Kim and Hwang, 2015). Additionally, an overexpression of HSP40 was leading to
hypersensitive response-like cell death and salt tolerance in Nicotiana benthamiana and A.
thaliana, respectively (Zhichang et al., 2010; Liu and Whitham, 2013). All these investigations
were found in locally stressed tissue, but also systemic HSP induction could be determined:
In Nicotiana attenuate the application of heat shock, mechanical damage, or methyl-
jasmonate in distant leaves induced the accumulation of HSPs in systemic, unstressed
leaves (Hamilton and Coleman, 2001). In the present study, the root application of C12-HSL
induced a systemic HSP40 transcript accumulation in barley leaves. The accumulation of
mRNA transcripts suggests translation into protein, which possibly leads to higher cellular
HSP40 levels. As HSP40 and HSP70 mostly co-locate in the organelles and HSP70 requires
HSP40 for chaperon activity (Fan et al., 2003), it is likely that a higher supply of HSP40
protein will lead to a more intense HSP70 interaction and higher HSP70 activity may be
DISCUSSION
91
Figure 4.4 Expression of AHL responsive genes in barley leaves. AHL-responsive genes that were analyzed by qRT-PCR are presented and are organized due to their expression time point by each AHL derivative. Except for HSP40, all genes can be associated with an SA induction.
registered. Therefore, the AHL-mediated priming may prepare the systemic tissue for
upcoming biotic and abiotic stressors via HSPs.
All 6 aforementioned genes are involved in plant defense in a particular way and it is likely
that their up-regulation may therefore contribute to the demonstrated resistance against Xtc
(see fig. 4.3). All genes displayed a slight induction and not an excessive fold up-regulation
as it occurs after pathogen challenge, which proposes a systemic priming effect on barley by
AHLs. The following figure underlines the expression pattern induced by both AHL
derivatives.
In the present study, the genes PR3, PR6, and PR13 were differentially expressed upon AHL
exposure. The transcriptome analysis of A. thaliana, pre-treated with AHL-producing
rhizobacteria and afterwards challenged with Pseudomonas syringae pv. tomato DC3000,
revealed an up-regulation of 2 typical SAR genes, PR2 and PR3 (Klein, 2007). Furthermore,
AHL and salicylic acid treatment led to systemic up-regulation of PR1, PR3, and PR6
transcripts in tomato leaves (Schuhegger, 2003). These studies already discussed a
prospective priming effect of AHLs on plants and reflect the presented data. Additionally, in
the present work the up-regulation of JIP60 could be linked to an AHL induced priming effect,
equipping plants for upcoming pathogens.
DISCUSSION
92
Furthermore, in this thesis, the differential expression of a bHLH transcription factor gives a
possible link between an AHL triggered ISR and an iron deficiency response. An ISR-iron
homeostasis linkage was already recently discussed in Pseudomonas fluorescence WCS417
treated A. thaliana (Zamioudis et al., 2014).
Moreover, in the present work the expression of HSP40, the co-chaperon of HSP70, was
triggered upon C12-HSL application. Molitor et al. (2011) reported a mycorrhiza-induced
systemic resistance in barley after Piriformospora indica inoculation, where, interestingly, the
fungus mediated an up-regulation of HSP70, the counterpart to HSP40, in leaf tissue. The
same findings were demonstrated after oxo-C14-HSL treatment in A. thaliana (Schenk et al.,
2014).
Besides increased HSP40 expression, a further observation of this thesis is the differential
expression of PR13, coding for a leaf specific thionin. The transcript of a plant thionin family
protein and of a DNAJ heat shock N-terminal domain-containing protein were reportedly up-
regulated after short and long chain-AHL application (Schenk et al., 2014), which supports
the data of the current investigations. Altogether, plants respond differentially to the presence
of AHLs where, possibly, related regulation pathways are triggered in dicotyledons and
monocotyledons after AHL application.
4.2.3 AHL induced systemic resistance against Xanthomonas
translucens
In modern agriculture, concepts of biological pest control and enhancement of plants
resistance are implemented (Berg, 2009). Chemical (e.g.: β-Aminobutyric acid, probenazole,
phosphite) and biological (e.g. mycorrhizal fungi, PGPRs, algal extracts) activators, for which
a growing market exist, were found to confer resistance of crop plants towards various
pathogens (Berg, 2009; Walters et al., 2013). The colonization of the plant root by PGPRs
led to resistance in distal parts of various plants to different bacterial and fungal pathogens,
whereby the term rhizobacteria-induced systemic resistance (ISR) arose (van Loon, 1998;
De Vleesschauwer and Höfte, 2009; Balmer et al., 2012). This preparation of the plant to
efficiently combat any further biotic or abiotic attack is termed priming and is characterized by
an augmented sensitization and activation of cellular defense mechanism, which may lead to
enhanced resistance (Conrath et al., 2002; Conrath, 2011). Several PGPR-mediated ISRs
are based on this priming state and provide plants with an enhanced cellular defense
response against upcoming pathogens (Pieterse et al., 2014). Diverse microbial-derived
molecules have been determined as elicitors of the rhizobacteria-induced systemic
resistance, among them lipopolysaccharides, siderophores, exopolysaccharides, and also
AHLs (De Vleesschauwer and Höfte, 2009; Balmer et al., 2012). In the present study, the
DISCUSSION
93
application of 10 µM short- and long-chain AHL to the root system of barley caused a
systemic reduction of the biotrophic pathogen Xtc in barley leaves compared to controls, thus
inducing systemic resistance. The mean value of the 4 biological replicates shows credible
Xtc titer reduction after previous 24 and 96 h of AHL treatment. If all single experiments were
analyzed separately, also the 72 h incubation with AHL led to credible reduction of Xtc, but
this effect was lost when creating the mean value over all conducted experiments.
Furthermore, it was observable that the bacterial titer of controls and AHL treatments
decreased between the 24 h and 96 h time point (fig. 3.20 B). As AHLs did not interfere with
the Xtc growth and also the control treatment showed this total titer decrease, the findings of
Dey et al. (2014) that Xtc is mobile in barley, could be causal.
The involvement of AHLs in PGPR-mediated ISR was already discovered in the
interaction of tomato with the AHL-producing rhizobacteria Serratia liquefaciens MG1, which
enhanced the systemic resistance against the necrotrophic fungus Alternaria alternata in
tomato. The resistance was induced after 72 h of the inoculation with the PGPR strain.
Serratia liquefaciens MG44, a bacterial mutant impaired in AHL production, did not induce
resistance in distal leaf parts (Schuhegger et al., 2006). Accordingly, Serratia liquefaciens
MG1 led to a reduction of the spreading of Pseudomonas syringae pv. tomato DC3000 in A.
thaliana leaves, but this effect was not significant (von Rad et al., 2008). Further
investigations with Serratia plymuthica HRO-C48 achieved ISR to the necrotrophic Botrytis
cinerea, which causes the grey mold disease in bean and tomato plants, whereas AHL-
deficient mutants of this bacterial strain showed weaker infection containment (Pang et al.,
2009). Also here, an incubation of 3 days with the PGPR strain conferred the systemic
resistance. Serratia plymuthica HRO-C48 also rescued cucumber plants against damping-off
disease caused by the oomycete Pythium aphanidermatum. These data reveal that bacterial
signaling compounds are required to increase systemic resistance to pathogens. Serratia
liquefaciens MG1 produces the short-chain AHLs C4- and C6-HSL, while Serratia plymuthica
HRO-C48 produces the same AHLs and additionally oxo-C6-HSL, showing that short-chain
AHLs are able to confer resistance induction. In this context, the oxo-C8-HSL producing
bacterial strain Rhizobium etli 11541 was not effective in resistance induction against the
hemibiotrophic Pseudomonas syringae pv. tomato DC3000 in A. thaliana (Zarkani et al.,
2013), whereas in the present study, the purified short-chain C8-HSL is sufficient to enhance
systemic resistance against Xtc in Hordeum vulgare. Moreover, the authors investigated that
Sinorhizobium meliloti Rm2011, producing the long-chain oxo-C14-HSL, stopped the
spreading of the tomato bacterial speck caused by Pseudomonas syringae pv. tomato
DC3000 (Zarkani et al., 2013). These data give reason to the assume that rhizobacteria,
which produce short- or long-chain AHLs are able to induce resistance, but that this effect is
dependent on the corresponding host plant and pathogen lifestyle. Moreover, recent
DISCUSSION
94
investigations displayed that the application of commercially produced AHLs is enough to
increase the resistance against various pathogens, which reinforce the results of this present
study. A 3-day oxo-C14-HSL-treatment of A. thaliana and barley enhanced the defense
against the obligate biotrophic powdery mildews Golovinomyces orontii and Blumeria
graminis, respectively (Schikora et al., 2011). Resistance reinforcement against the
hemibiotrophic Pseudomonas syringae pv. tomato DC3000 in A. thaliana was also induced
after 3 days of oxo-C12-, hydroxy-C14- and oxo-C14-HSL, whereas the strongest effect was
achieved by oxo-C14-HSL. But, no resistance effect turned out after C6-HSL application (von
Rad et al., 2008; Schenk et al., 2012; Schenk et al., 2014), revealing an AHL chain length
and substitution dependent effect in A. thaliana. To sum up, application of commercially
produced long-chain AHLs (oxo- C12-/ C14-HSL and hydroxyl-C14-HSL) reduced disease
symptoms of hemi- and biotrophic pathogens, but not of necrotrophic ones, while
rhizobacteria, producing short-chain (C4-, C6- and oxo-C6-HSL) and long-chain AHLs (oxo-
C14) did so against necrotrophic, biotrophic, and hemibiotrophic pathogens. Commercially
available C6-HSL was not able to induce the plant defense against Pseudomonas syringae
pv. tomato DC3000 in A. thaliana (von Rad et al., 2008). In the present in vitro system,
commercial C8- and C12-HSL reduced the titer of the biotrophic leaf pathogen Xtc, thus no
chain length dependent effect could be displayed. Furthermore, the endophyte
Gluconacetobacter diazotrophicus caused the protection to Xanthomonas albilineans in its
beneficial interaction with sugarcane (Arencibia et al., 2006). The authors discuss that the
endophyte could possess and/or produce elicitors, which induce the sugarcane defense
response. Recently, Nieto-Peñalver et al. (2012) demonstrated that Gluconacetobacter
diazotrophicus produces AHLs, among them also C8- and C12-HSL, which gives reason to
speculate that these microbial signaling molecules could be involved in the abovementioned
induced resistance and resemble the same AHL molecules that are applied in the present
study.
Interestingly, in all above mentioned PGPR / AHL-inoculation experiments an
exposure of 3 days was necessary to show ISR. The application of 10 µM C8- and C12-HSL
credibly reduced the Xtc titer in barley leaves after 24 h, lost in strength at an exposure time
of 48 h, and reached the ISR effect after 96 h again, while in the single biological
experiments the bacterial titer reduction was already achieved after 72 h of AHL exposure.
Partly, the present results are in accordance with the 3-day achieved resistance, but PGPR
application even conferred resistance in radish after 1 day (Leeman et al., 1995b).
Schikora et al. (2011) proved that root-applied oxo-C14-HSL was not detectable in
the leaf tissue, which is in accordance to the findings of Götz et al. (2007) and Sieper et al.
(2014), that only short-chain AHLs are transported but long-chain AHLs are not. If the AHL-
transport is the crucial factor for resistance induction, why and/or how could the long-chain
DISCUSSION
95
AHL induce resistance barley leaves? Since C8- and C12-HSL induced ISR in barley, a root-
to-shoot signal acting as second messenger should exist. Thus, the NO accumulation that
occurred in barley roots after AHL treatment (chapter 3.2.1) could be a possible mediator for
ISR induction. NO is a diffusible gas and is known to act as a systemic signaling compound.
A root derived stimulus of NO-donor solution led to a rapid activation of kinases in leaves
(Capone et al., 2004), while reportedly mitogen-activated protein kinases (MAPK) are
involved in systemic resistance (Viterbo et al., 2005). Also, Schikora et al. (2011)
demonstrated that MAPKs are necessary for an AHL-induced resistance in A. thaliana.
Furthermore, NO increases SA levels which is the key regulator in SAR and was reported to
be involved in induced systemic resistance upon rhizobacteria inoculation (Durner et al.,
1998; Wendehenne et al., 2001; Schuhegger et al., 2006). Elevated SA concentrations were
detected after 4 h of 10 µM C8- and C12-HSL treatment (chapter 3.3.2). Moreover, as
already discussed in chapter 4.1.4, short chain AHLs elevated intracellular Ca2+
concentrations in A. thaliana roots and, reportedly, NO production follows Ca2+ bursts (Ali et
al., 2007; Song et al., 2011). But interestingly, long-chain AHL signaling seems to be
calmodulin independent in the root tissue (Zhao et al., 2015) All these facts lead to the
assumption that short-chain AHL induced resistance occurs at first by a rapid induction of a
Ca2+ burst, triggering the production of NO, and the accumulation of SA in leaves, which then
activates further signaling cascades (e.g. defense gene regulation), leading to the
establishment of a systemic resistance against biotrophic pathogens like Xtc. For long-chain
AHLs it seems that they trigger an NO accumulation in the root tissue, induce MAPKs in
leaves and activates further signaling cascades (e.g. defense gene regulation), via an
accumulation of SA and ABA in leaves, which then leads to the establishment of a systemic
resistance against biotrophic pathogens like Xtc.
DISCUSSION
96
Figure 4.5 Model summarizing AHL induced reactions in barley. AHLs are recognized in the root tissue via a yet unknown mechanism and induce a membrane hyperpolarization in root epidermal cells, which is likely to activate root K+ uptake. Higher nutrient uptake and a NO-dependent lateral root formation are possibly responsible for root and shoot biomass gain. Additionally, NO accumulates in roots after AHL application, probably in consequence to a Ca2+ burst that was investigated by Song et al. (2011). NO probably acts as a root-to-shoot signal, leading to a systemic priming effect. Also, short-chain AHL transport (Götz et al., 2007; Sieper et al., 2014) and MAPKs (Schikora et al., 2011) could be involved. As a consequence, SA and ABA are accumulated and result in PAL and defense gene activation. It is suggested that priming and a SA-dependent ISR are the basis for this AHL-induced resistance.
4.3 Big picture and future perspectives
In general, the results of the present study show that both short and long-chain AHLs are
recognized by barley and that the plant is able to differentiate between these 2 microbial
signaling compounds. The following illustration summarizes the AHL induced reactions in
barley:
With regard to a novel application of AHLs in the context of plant growth promoting bio-
inoculants in agriculture, the tested AHLs positively influenced the morphology of barley.
Besides increased root and leaf growth, the formation of lateral roots was promoted as well,
DISCUSSION
97
whereby long- and short-chain AHLs were almost equally effective. Furthermore, the AHL-
induced NO accumulation in barley roots was linked to lateral root formation. Also, the AHL-
mediated plasma membrane hyperpolarization seems to be a fundamental mechanism of
enhanced K+ uptake of barley root epidermal cells. Besides the growth effects of both AHL
derivatives, the microbial compounds mediated a systemic resistance response in barley,
which is suggested to rely on an AHL-mediated priming effect. It is likely that the AHL
induced NO accumulation could have risen as part of an elicitor-recognized mechanism in
the plant root, serving as a root-to-shoot signal. Acting as a second messenger, NO transfers
barley into a systemically primed state and induces the accumulation of phytohormones. It is
likely that increased SA and ABA levels in barley leaves are causative for the induction of
primed defense genes. Because of this, the AHL application induced a resistance against the
biotrophic leaf-pathogen Xanthomonas translucens pv. cerealis.
The possibility to induce accelerated growth and resistance through pure AHL application
may lead to a new view of AHLs in the context of biocontrol and growth promoting agents in
agriculture. Future approaches have to identify whether the increased K+ uptake would
actually lead to better K+ nutrition in barley and whether the uptake of other major
macronutrients is altered, as it was demonstrated by the application of PGPRs (Selvakumar
et al., 2007). Furthermore, field-application of PGPRs as biofertilizers in agriculture
demonstrated beneficial effects for various crops, including plant strengthening, protection,
and resistance developing effects (Berg, 2009; Vacheron et al., 2013; Pérez-Montaño et al.,
2014). Thus, further studies are required to assess synergistic effects of PGPRs and AHLs,
and the potential impacts on beneficial endophytes. Additionally, in the context of this work,
AHL-regulated barley genes were identified. The results indicate an AHL-mediated priming
effect and lead to speculation how these molecules are recognized in the plant tissue and
how in the context of pathogen-derived AHL production the final plant defense is activated.
Moreover, through further studies it has to be clarified how different AHL concentrations and
a mixture of various AHL derivatives affect growth and resistance properties of plants. The
identification of important set screws possibly enables an application of AHLs in agriculture.
SUMMARY/ZUSAMMENFASSUNG
98
5 SUMMARY/ ZUSAMMENFASSUNG
N-Acyl-D/L-homoserine lactones (AHLs) are produced as microbial signaling compounds
during bacterial intra- and inter-specific communication in the rhizosphere. Thus, plants are
naturally exposed to these compounds and respond with tissue-specific reactions. In the
present study the impact of AHLs on the monocot barley (Hordeum vulgare L.) was
investigated.
The treatment with C8- and C12- homoserine lactones (HSL) resulted in root and shoot
biomass gain as well as in the formation of lateral roots. It is assumed that nitric oxide (NO)
has an impact on the lateral root formation. Both AHL derivatives induced the accumulation
of NO in the root tissue, while the C12-HSL mediated NO production was lower.
Furthermore, investigations on the nutrient uptake underpin increased plant growth. It was
determined that 10 µM C8-HSL was the only tested concentration to induce K+ uptake in root
epidermal cells. In contrast, all tested concentrations of C12-HSL could stimulate a K+ uptake
in roots. It is hypothesized that an AHL-mediated plasma membrane hyperpolarization is the
fundamental mechanism of the K+ influx.
Systemic induced AHL reactions were also investigated. An RNA seq based transcriptome
analysis revealed that C8-HSL treatment induced gene transcripts involved in cell
metabolism and partly in defense, while after C12-HSL mainly defense genes were
differentially regulated. The investigation of the expression pattern of 6 significantly regulated
genes by qRT-PCR revealed a systemic regulation of important defense and PR genes that
is mainly caused by salicylic acid (SA). These are a bHLH transcription factor that might be
involved in iron-deficiency response; an acidic chitinase (PR3), a subtilisin-chymotrypsin
inhibitor 2A (PR6), a leaf specific thionin (PR13), a ribosome-inactivating protein JIP60, and
a chaperon protein DnaJ (HSP40).
As a systemic response upon AHL exposure, the phytohormone SA accumulated in barley
leaves, while the jasmonic acid and jasmonic acid isoleucine content remained unaffected.
Additionally, only C12-HSL induced abscisic acid accumulation in barley leaves. Moreover,
investigations of the phenylalanine ammonia lyase kinetics in barley leaves revealed that this
enzyme reached its highest activity 12 h after AHL application for both AHL derivatives.
Despite the enhanced enzyme activity, the flavonoid content (lutonarin and saponarin) was
not influenced.
A treatment duration of 24 and 96 h with C8- and C12-HSL effected a systemic reduction of
the biotrophic pathogen Xanthomonas translucens pv. cerealis.
Taken together, besides growth, AHLs probably induce an SA-dependent induced systemic
resistance in barley via defense gene priming, while the root-accumulated NO is a possible
second messenger leading to SA-accumulation in barley leaves.
SUMMARY/ZUSAMMENFASSUNG
99
N-Acyl-D/L-Homoserin Laktone (AHLs) werden während der bakteriellen intra- und
interspezifischen Kommunikation in der Rhizosphäre als mikrobielle Signalmoleküle
produziert. Pflanzen sind deshalb diesen Substanzen auf natürliche Weise ausgesetzt und
zeigen gewebespezifische Reaktionen. In der vorliegenden Arbeit wurde der Einfluss von
AHLs auf die monokotyledone Pflanze Gerste (Hordeum vulgare L.) untersucht.
Die Behandlung mit C8- und C12- Homoserin Laktonen (HSL) führte zu einem
Biomassezuwachs in Wurzel und Blatt sowie zur Ausbildung von Seitenwurzeln. Hierbei wird
angenommen, dass Stickstoffmonoxid (NO) einen Einfluss auf die Seitenwurzelbildung hat.
Es konnte gezeigt werden, dass beide AHL Derivate eine NO Akkumulation im
Wurzelgewebe induzieren, wobei durch C12-HSL eine schwächere Reaktion ausgelöst
wurde. Weiterhin sollte untersucht werden, ob eine erhöhte Nährstoffaufnahme in der Wurzel
für das gezeigte Pflanzenwachstum verantwortlich ist. Es stellte sich heraus, dass bei den
kurzkettigen C8-HSL 10 µM die einzige getestete Konzentration war, die zu einem K+ Flux in
die Wurzelzelle führte. Im Gegensatz hierzu konnten alle getesteten Konzentration von C12-
HSL eine höhere K+ Aufnahme in die Wurzel bewirken. Wahrscheinlich ist eine AHL-
induzierte Membranhyperpolarisation der grundlegende Mechanismus für den K+ Flux.
Es wurden ebenfalls systemisch induzierte AHL Reaktionen untersucht. Hierbei zeigte eine
RNA seq basierte Transkriptomanalyse, dass durch C8-HSL Behandlung Zellmetabolismus
und Abwehrgene induziert wurden, während durch eine C12-HSL Behandlung überwiegend
Abwehrgene differentiell reguliert wurden. Die Untersuchung des Expressionsmusters von 6
signifikant regulierten Genen durch qRT-PCR konnte zeigen, dass unter AHL Applikation
eine systemische Regulation von wichtigen Abwehrgenen und PR-Genen ausgelöst wurde,
die überwiegend durch Salicylsäure (SA) erfolgte. Diese umfassen einen bHLH transcription
factor, dem möglicherweise eine Rolle in der Antwort auf Eisenmangel zukommt, eine acidic
chitinase (PR3), ein subtilisin-chymotrypsin inhibitor 2A (PR6), ein blattspezifisches thionin
(PR13), ein Ribosom inaktivierendes Protein JIP60 und ein chaperon protein DnaJ (HSP40).
Das Phytohormon SA akkumulierte in Gerstenblättern als systemische Antwort auf die AHL
Behandlung, wobei Jasmonsäure und Jasmonsäure-Isoleucin Gehalte unverändert blieben.
Zusätzlich löste eine Behandlung mit C12-HSL eine Abscisinsäure-Akkumulation in
Gerstenblättern aus. Weiterhin wurde die Kinetik der Phenylalanin Ammoniak Lyase in
Gerstenblättern untersucht, wobei das Enzym seine höchste Aktivität 12 h nach AHL Zugabe
erreichte. Trotz erhöhter Enzymaktivität konnten keine erhöhten Gehalte an den Flavonoiden
Lutonarin und Saponarin beobachtet werden.
Letztendlich konnte eine Behandlungsdauer von 24 und 96 h mit C8- und C12-HSL eine
systemische Reduktion des biotrophen Pathogens Xanthomonas translucens pv. cerealis in
den Gerstenblättern induzieren.
Man kann also schlussfolgern, dass AHLs neben Wachstum wahrscheinlich über priming von
Abwehrgenen eine SA-abhängige systemische Resistenz in Gerste induzieren, wobei NO als
möglicher Botenstoff in Frage kommt, der zu einer Erhöhung der SA-Konzentration in den
Blättern führt.
REFERENCES
100
6 REFERENCES
Abbasi MK, Sharif S, Kazmi M, Sultan T, Aslam M (2011) Isolation of plant growth promoting rhizobacteria from wheat rhizosphere and their effect on improving growth, yield and nutrient uptake of plants. Plant Biosyst 145: 159–168
Adesemoye AO, Kloepper JW (2009) Plant-microbes interactions in enhanced fertilizer-use efficiency. Appl Microbiol Biotechnol 85: 1–12
Ahemad M, Kibret M (2014) Mechanisms and applications of plant growth promoting rhizobacteria: current perspective. J King Saud Univ - Sci 26: 1–20
Alexa A, Rahnenführer J (2014) Gene set enrichment analysis with topGO. 1–26
Ali R, Ma W, Lemtiri-Chlieh F, Tsaltas D, Leng Q, von Bodman S, Berkowitz GA (2007) Death don’t have no mercy and neither does calcium: Arabidopsis CYCLIC NUCLEOTIDE GATED CHANNEL2 and innate immunity. Plant Cell 19: 1081–1095
Alizadeh H, Behboudi K, Ahmadzadeh M, Javan-Nikkhah M, Zamioudis C, Pieterse CMJ, Bakker PAHM (2013) Induced systemic resistance in cucumber and Arabidopsis thaliana by the combination of Trichoderma harzianum Tr6 and Pseudomonas sp. Ps14. Biol Control 65: 14–23
Andresen I, Becker W, Schlater K, Burges J, Parthier B, Apel K (1992) The identification of leaf thionin as one of the main jasmonate-induced proteins of barley (Hordeum vulgare). Plant Mol Biol 19: 193–204
Anschütz U, Becker D, Shabala S (2014) Going beyond nutrition: regulation of potassium homoeostasis as a common denominator of plant adaptive responses to environment. J Plant Physiol 171: 670–687
Arencibia AD, Vinagre F, Estevez Y, Bernal A, Perez J, Cavalcanti J, Santana I, Hemerly AS (2006) Gluconacetobacter diazotrophicus elicits a sugarcane defense response against a pathogenic bacteria Xanthomonas albilineans. Plant Signal Behav 1: 265–273
Asselbergh B, De Vleesschauwer D, Höfte MM (2008) Global switches and fine-tuning—ABA modulates plant pathogen defense. Mol Plant-Microbe Interact 21: 709–719
Astolfi S, Ortolani MR, Catarcione G, Paolacci AR, Cesco S, Pinton R, Ciaffi M (2014) Cadmium exposure affects iron acquisition in barley (Hordeum vulgare) seedlings. Physiol Plant 152: 646–659
Bai X, Todd CD, Desikan R, Yang Y, Hu X (2012) N-3-oxo-decanoyl-L-homoserine-lactone activates auxin-induced adventitious root formation via hydrogen peroxide- and nitric oxide-dependent cyclic GMP signaling in mung bean. Plant Physiol 158: 725–736
Bai Y, Pattanaik S, Patra B, Werkman JR, Xie CH, Yuan L (2011) Flavonoid-related basic helix-loop-helix regulators, NtAn1a and NtAn1b, of tobacco have originated from two ancestors and are functionally active. Planta 234: 363–375
Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM (2006) The role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Biol 57: 233–266
Balcke GU, Handrick V, Bergau N, Fichtner M, Henning A, Stellmach H, Tissier A, Hause B, Frolov A (2012) An UPLC-MS/MS method for highly sensitive high-
REFERENCES
101
throughput analysis of phytohormones in plant tissues. Plant Methods 8: 47
Balmer A, Pastor V, Gamir J, Flors V, Mauch-Mani B (2015) The “prime-ome”: towards a holistic approach to priming. Trends Plant Sci 20: 443–452
Balmer D, Planchamp C, Mauch-Mani B (2012) On the move : induced resistance in monocots. J Exp Bot 63: 1–13
Barbieri L, Battelli MG, Stirpe F (1993) Ribosome-inactivating proteins from plants. Biochim Biophys Acta 1154: 237–282
Barth C, Jakubczyk D, Kubas A, Anastassacos F, Brenner-Weiss G, Fink K, Schepers U, Bräse S, Koelsch P (2012) Interkingdom signaling: integration, conformation, and orientation of N -acyl-L-homoserine lactones in supported lipid bilayers. Am Chem Soc 28: 8456–8462
Barth C, Moeder W, Klessig DF, Conklin PL (2004) The timing of senescence and response to pathogens is altered in the ascorbate-deficient Arabidopsis mutant vitamin c-1. Plant Physiol 134: 1784–1792
Bashan Y, De-Bashan LE (2005) Fresh-weight measurements of roots provide inaccurate estimates of the effects of plant growth-promoting bacteria on root growth: a critical examination. Soil Biol Biochem 37: 1795–1804
Bauer WD, Mathesius U (2004) Plant responses to bacterial quorum sensing signals. Curr Opin Plant Biol 7: 429–433
Becker W, Apel K (1993) Differences in gene expression between natural and artificially induced leaf senescence. Planta 189: 74–79
Beckers GJM, Jaskiewicz M, Liu Y, Underwood WR, He SY, Zhang S, Conrath U (2009) Mitogen-activated protein kinases 3 and 6 are required for full priming of stress responses in Arabidopsis thaliana. Plant Cell 21: 944–953
Belandreau J, Knowles R (1978) Interactions between non-pathogenic soil microorganisms
and plants. in Dommergues YR, Krupa SV (Eds), Developments in agricultural and
managed-forest ecology, Ed: 4, Elsevier, Amsterdam
Beligni M V., Lamattina L (2001) Nitric oxide in plants: the history is just beginning. Plant, Cell Environ 24: 267–278
Bellando M, Trotta A, Bonetti A, Colombo R, Lado P, Marre E (1979) Dissociation of H+ extrusion from K+ uptake by means of lipophilic cations. Plant, Cell Environ 2: 39–47
Berg G (2009) Plant-microbe interactions promoting plant growth and health: perspectives for controlled use of microorganisms in agriculture. Appl Microbiol Biotechnol 84: 11–18
Berg G, Grube M, Schloter M, Smalla K (2014) Unraveling the plant microbiome: looking back and future perspectives. Front Microbiol 5: 1–7
Bertrand H, Plassard C, Pinochet X, Touraine B, Normand P, Cleyet-Marel JC (2000) Stimulation of the ionic transport system in Brassica napus by a plant growth-promoting rhizobacterium (Achromobacter sp.). Can J Microbiol 46: 229–236
Bian Z-R, Liu F, Zhang X, Zhang Z, Song S-S (2011) Involvement of GCR1 and GCR2 in the regulation of root growth by N-Acyl-homoserine lactones in Arabidopsis thaliana. Plant Physiol J 47: 175–180
Blancaflor EB, Hou G, Chapman KD (2003) Elevated levels of N-lauroylethanolamine, an
REFERENCES
102
endogenous constituent of desiccated seeds, disrupt normal root development in Arabidopsis thaliana seedlings. Planta 217: 206–217
Boevink P, Oparka KJ (2005) Virus-host interactions during movement processes. Plant Physiol 138: 1815–1821
Bohlmann H, Apel K (1991) Thionins. Annu Rev Plant Physiol Plant Mol Biol 42: 227–240
Bohlmann H, Clausen S, Behnke S, Giese H, Hiller C, Reimann-Philipp U, Schrader G, Barkholt V, Apel K (1988) Leaf-specific thionins of barley-a novel class of cell wall proteins toxic to plant-pathogenic fungi and possibly involved in the defence mechanism of plants. EMBO J 7: 1559–1565
Bordiec S, Paquis S, Lacroix H, Dhondt S, Ait Barka E, Kauffmann S, Jeandet P, Mazeyrat-Gourbeyre F, Clément C, Baillieul F, Dorey S (2011) Comparative analysis of defence responses induced by the endophytic plant growth-promoting rhizobacterium Burkholderia phytofirmans strain PsJN and the non-host bacterium Pseudomonas syringae pv. pisi in grapevine cell suspensions. J Exp Bot 62: 595–603
Boscari A, Clement M, Volkov V, Golldack D, Hybiak J, Miller AJ, Amtmann A, Fricke W (2009) Potassium channels in barley: cloning, functional characterization and expression analyses in relation to leaf growth and development. Plant Cell Environ 32: 1761–1777
Boston RS, Viitanen P V, Vierling E (1996) Molecular chaperones and protein folding in plants. Plant Mol Biol 32: 191–222
Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254
Brelles-Mariño G, Bedmar EJ (2001) Detection, purification and characterisation of quorum-sensing signal molecules in plant-associated bacteria. J Biotechnol 91: 197–209
Brencic A, Winans SC (2005) Detection of and response to signals involved in host-microbe interactions by plant-associated bacteria. Microbiol Mol Biol Rev 69: 155–194
Britto DT, Kronzucker HJ (2008) Cellular mechanisms of potassium transport in plants. Physiol Plant 133: 637–650
Brusamarello-Santos LCC, Pacheco F, Aljanabi SMM, Monteiro RA, Cruz LM, Baura VA, Pedrosa FO, Souza EM, Wassem R (2012) Differential gene expression of rice roots inoculated with the diazotroph Herbaspirillum seropedicae. Plant Soil 356: 113–125
Brychzy A, Rein T, Winklhofer KF, Hartl FU, Young JC, Obermann WMJ (2003) Cofactor Tpr2 combines two TPR domains and a J domain to regulate the Hsp70/Hsp90 chaperone system. EMBO J 22: 3613–3623
Buckhout TJ, Yang TJW, Schmidt W (2009) Early iron-deficiency-induced transcriptional changes in Arabidopsis roots as revealed by microarray analyses. BMC Genomics 10: 1–16
Bukau B, Horwich AL (1998) The Hsp70 and Hsp60 chaperone machines. Cell 92: 351–366
Calcagno C, Novero M, Genre A, Bonfante P, Lanfranco L (2012) The exudate from an arbuscular mycorrhizal fungus induces nitric oxide accumulation in Medicago truncatula
REFERENCES
103
roots. Mycorrhiza 22: 259–269
Campos-Cuevas JC, Pelagio-Flores R, Raya-González J, Méndez-Bravo A, Ortíz-Castro R, López-Bucio J (2008) Tissue culture of Arabidopsis thaliana explants reveals a stimulatory effect of alkamides on adventitious root formation and nitric oxide accumulation. Plant Sci 174: 165–173
Capone R, Tiwari BS, Levine A (2004) Rapid transmission of oxidative and nitrosative stress signals from roots to shoots in Arabidopsis. Plant Physiol Biochem 42: 425–428
Chaudhry B, Müller-Uri F, Cameron-Mills V, Gough S, Simpson D, Skriver K, Mundy J (1994) The barley 60 kDa jasmonate-induced protein (JIP60) is a novel ribosome-inactivating protein. Plant J 6: 815–824
Chinchilla D, Bauer Z, Regenass M, Boller T, Felix G (2006) The Arabidopsis receptor kinase FLS2 binds flg22 and determines the specificity of flagellin perception. Plant Cell 18: 465–476
Chisholm ST, Coaker G, Day B, Staskawicz BJ (2006) Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124: 803–814
Chowdhury J, Henderson M, Schweizer P, Burton RA, Fincher GB, Little A (2014) Differential accumulation of callose, arabinoxylan and cellulose in nonpenetrated versus penetrated papillae on leaves of barley infected with Blumeria graminis f. sp. hordei. New Phytol 204: 650–660
Compant S, Clément C, Sessitsch A (2010) Plant growth-promoting bacteria in the rhizo- and endosphere of plants: Their role, colonization, mechanisms involved and prospects for utilization. Soil Biol Biochem 42: 669–678
Conrath U (2011) Molecular aspects of defence priming. Trends Plant Sci 16: 524–531
Conrath U, Pieterse CMJ, Mauch-Mani B (2002) Priming in plant-pathogen interactions. Trends Plant Sci 7: 210–216
Cordero MJ, Raventós D, San Segundo B (1994) Expression of a maize proteinase inhibitor gene is induced in response to wounding and fungal infection: systemic wound-response of a monocot gene. Plant J 6: 141–150
Correa-Aragunde N, Graziano M, Chevalier C, Lamattina L (2006) Nitric oxide modulates the expression of cell cycle regulatory genes during lateral root formation in tomato. J Exp Bot 57: 581–588
Correa-Aragunde N, Graziano M, Lamattina L (2004) Nitric oxide plays a central role in determining lateral root development in tomato. Planta 218: 900–905
Cui H, Tsuda K, Parker JE (2015) Effector-triggered immunity: from pathogen perception to robust defense. Annu Rev Plant Biol 66: 487–511
Datta SK, Muthukrishnan S (1999) Pathogenesis-related proteins in plants. CRC Press LLC, Boca Raton, Florida
Davis BM, Jensen R, Williams P, O’Shea P (2010) The interaction of N-acylhomoserine lactone quorum sensing signaling molecules with biological membranes: implications for inter-kingdom signaling. Public Libr Sci one 5: 1–10
Davis BM, Richens JL, O’Shea P (2011) Label-free critical micelle concentration determination of bacterial quorum sensing molecules. Biophys J 101: 245–254
REFERENCES
104
Delledonne M, Xia Y, Dixon RA, Lamb C (1998) Nitric oxide functions as a signal in plant disease resistance. Lett to Nat 394: 585–588
Delledonne M, Zeier J, Marocco A, Lamb C (2001) Signal interactions between nitric oxide and reactive oxygen intermediates in the plant hypersensitive disease resistance response. Proc Natl Acad Sci USA 98: 13454–13459
DeLong EF, Pace NR (2001) Environmental diversity of bacteria and archaea. Syst Biol 50: 470–478
De Virgilio M, Lombardi A, Caliandro R, Fabbrini MS (2010) Ribosome-inactivating proteins: from plant defense to tumor attack. Toxins 2: 2699–2737
De Vleesschauwer D, Chernin L, Höfte MM (2009) Differential effectiveness of Serratia plymuthica IC1270-induced systemic resistance against hemibiotrophic and necrotrophic leaf pathogens in rice. BMC Plant Biol. 9: 1-16
De Vleesschauwer D, Cornelis P, Höfte MM (2006) Redox-active pyocyanin secreted by Pseudomonas aeruginosa 7NSK2 triggers systemic resistance to Magnaporthe grisea but enhances Rhizoctonia solani susceptibility in rice. Mol Plant-Microbe Interact 19: 1406–1419
De Vleesschauwer D, Höfte MM (2009) Rhizobacteria-induced systemic resistance. Adv Bot Res 51: 223–281
Dey S, Wenig M, Langen G, Sharma S, Kugler KG, Knappe C, Hause B, Bichlmeier M,
Babaeizad V, Imani J, Janzik I, Stempfl T, Hückelhoven R, Kogel K-H, Mayer KFX,
Vlot AC (2014) Bacteria-triggered systemic immunity in barley is associated with WRKY
and ETHYLENE RESPONSIVE FACTORs but not with salicylic acid. Plant Physiol 166:
2133–2151
Dixon RA, Achnine L, Kota P, Liu CJ, Reddy MSS, Wang L (2002) The phenylpropanoid pathway and plant defence - A genomics perspective. Mol Plant Pathol 3: 371–390
Dobbelaere S, Croonenborghs A, Thys A, Vande Broek A, Vanderleyden J (1999) Phytostimulatory effect of Azospirillum brasilense wild type and mutant strains altered in IAA production on wheat. Plant Soil 212: 155–164
Domenech J, Ramos SB, Probanza A, Lucas GJA, Gutierrez MFJ (2007) Elicitation of systemic resistance and growth promotion of Arabidopsis thaliana by PGPRs from Nicotiana glauca: a study of the putative induction pathway. Plant Soil 290: 43–50
Domingos P, Prado AM, Wong A, Gehring C, Feijo JA (2015) Nitric oxide: a multitasked signaling gas in plants. Mol Plant 8: 506–520
Durner J, Wendehenne D, Klessig DF (1998) Defense gene induction in tobacco by nitric oxide, cyclic GMP, and cyclic ADP-ribose. Proc Natl Acad Sci USA 95: 10328–10333
Eberhard A (1972) Inhibition and activation of bacterial luciferase synthesis. J Bacteriol 109: 1101–1105
Eberhard A, Burlingame AL, Eberhard C, Kenyon GL, Nealson KH, Oppenheimer NJ (1981) Structural identification of autoinducer of Photobacterium fischeri luciferase. Biochemistry 20: 2444–2449
Ebrahim S, Usha K, Singh B (2011) Pathogenesis related (PR) proteins in plant defense mechanism age-related pathogen resistance. in: Mendez-Vilas A (Ed), Science against micobial pathogens: communicating current research and technological advances, Ed:
REFERENCES
105
2, Formatex Research Center, Spain
Elmore JM, Coaker G (2011) The role of the plasma membrane H+-ATPase in plant-microbe interactions. Mol Plant 4: 416–427
Engebrecht J, Nealson K, Silverman M (1983) Bacterial bioluminescence: isolation and genetic analysis of functions from Vibrio fischeri. Cell 32: 773–81
Engebrecht J, Silverman M (1984) Identification of genes and gene products necessary for bacterial bioluminescence. Proc Natl Acad Sci USA 81: 4154–4158
Epstein E, Rains DW, Elzam OE (1963) Resolution of dual mechanisms of potassium absorption by barley roots. Proc Natl Acad Sci USA 49: 684–692
European and Mediterranean Plant Protection Organization (EPPO) Data sheets on quarantine pests: Xanthomonas translucens pv. translucens, https://gd.eppo.int/taxon/XANTTR
Falcon S, Gentleman R (2007) Using GOstats to test gene lists for GO term association. Bioinformatics 23: 257–258
Fan C-Y, Lee S, Cyr DM (2003) Mechanisms for regulation of Hsp70 function by Hsp40. Cell Stress Chaperones 8: 309–316
FAOSTAT Food and agriculture organization of the united nations statictic division (FAOSTAT), http://www.fao.org/faostat/en/#home
Feller A, MacHemer K, Braun EL, Grotewold E (2011) Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J 66: 94–116
Fernandez de Caleya R, Gonzalez-Pascual B, García-Olmedo F, Carbonero P (1972) Susceptibility of phytopathogenic bacteria to wheat purothionins in vitro. Appl Microbiol 23: 998–1000
Ferré-D’Amaré AR, Pognonec P, Roeder RG, Burley SK (1994) Structure and function of the b/HLH/Z domain of USF. EMBO J 13: 180–189
Fischer R, Behnke S, Apel K (1989) The effect of chemical stress on the polypeptide composition of the intercellular fluid of barley leaves. Planta 178: 61–68
Flor HH (1971) Current status of the gene-for-gene concept. Annu Rev Phytopathol 9: 275–296
Florack DEA, Visser B, Vries PM, Vuurde JWL, Stiekema WJ (1993) Analysis of the toxicity of purothionins and hordothionins for plant pathogenic bacteria. Netherlands J Plant Pathol 99: 259–268
Florack DE, Stiekema WJ (1994) Thionins: properties, possible biological roles and mechanisms of action. Plant Mol Biol 26: 25–37
Foissner I, Wendehenne D, Langebartels C, Durner J (2000) In vivo imaging of an elicitor-induced nitric oxide burst in tobacco. Plant J 23: 817–824
Frydman J (2001) Folding of newly translated proteins in vivo: the role of molecular chaperones. Annu Rev Biochem 70: 603–647
Fu ZQ, Dong X (2013) Systemic acquired resistance: turning local infection into global defense. Annu Rev Plant Biol 64: 839–863
Fuller DQ (2007) Contrasting patterns in crop domestication and domestication rates: recent
REFERENCES
106
archaeobotanical insights from the old world. Ann Bot 100: 903–924
Fuqua C, Parsek MR, Greenberg EP (2001) Regulation of gene expression by cell-to-cell communication: acyl-homoserine lactone quorum sensing. Annu Rev Genet 35: 439–68
Galloway WRJD, Hodgkinson JT, Bowden SD, Welch M, Spring DR (2011) Quorum sensing in gram-negative bacteria: small-molecule modulation of AHL and AI-2 quorum sensing pathways. Chem Rev 111: 28–67
Gamir J, Sánchez-Bel P, Flors V (2014) Molecular and physiological stages of priming: how plants prepare for environmental challenges. Plant Cell Rep 33: 1935–1949
Gassmann W, Schroeder JI (1994) Inward-rectifying K+ channels in root hairs of wheat. Plant Physiol 105: 1399–1408
Gelli A, Blumwald E (1997) Hyperpolarization-activated Ca2+ -permeable channels in the plasma membrane of tomato cells. J Membr Biol 155: 35–45
Gelli A, Higgins VJ, Blumwald E (1997) Activation of plant plasma membrane Ca2+-permeable channels by race-specific fungal elicitors. Plant Physiol 113: 269–279
Gill US, Lee S, Mysore KS (2015) Host versus nonhost resistance: distinct wars with similar arsenals. Phytopathology 105: 580–587
Girbés T, de Torre C, Iglesias R, Miguel Ferreras J, Méndez E (1996) RIP for viruses. Nature 379: 777–778
Givskov M, de Nys R, Manefield M, Gram L, Maximilien R, Eberl L, Molin S, Steinberg PD, Kjelleberg S (1996) Eukaryotic interference with homoserine lactone-mediated prokaryotic signalling. J Bacteriol 178: 6618–6622
Götz-Rösch C, Sieper T, Fekete A, Schmitt-Kopplin P, Hartmann A, Schröder P (2015) Influence of bacterial N-acyl-homoserine lactones on growth parameters, pigments, antioxidative capacities and the xenobiotic phase II detoxification enzymes in barley and yam bean. Front Plant Sci 6: 205–17
Götz C (2008) Quorum sensing in der Rhizosphäre . Interaktion von N-Acyl-Homoserinlactonen mit Gerste (Hordeum vulgare L.) und Yambohne (Pachyrhizus erosus (L.) Urban) unter besonderer Berücksichtigung von Enzymen des antioxidativen und des glutathionabhängigen Entgiftungsstoffwechsels. doctoral thesis, TUM, http://mediatum.ub.tum.de?id=652400
Götz C, Fekete A, Gebefuegi I, Forczek ST, Fuksová K, Li X, Englmann M, Gryndler M,
Hartmann A, Matucha M, Schmitt-Kopplin P, Schröder P (2007) Uptake, degradation
and chiral discrimination of N-acyl-D/L-homoserine lactones by barley (Hordeum
vulgare) and yam bean (Pachyrhizus erosus) plants. Anal Bioanal Chem 389: 1447–
1457
Gozzo F, Faoro F (2013) Systemic acquired resistance (50 years after discovery): moving from the lab to the field. J Agric Food Chem 61: 12473–12491
Graham JH, Gottwald TR, Riley TD, Achor D (1992) Penetration through leaf stomata and growth of strains of Xanthomonas campestris in citrus cultivars varying in suceptibility to bacterial disease. Am Phytopathol Soc 82: 1319–1325
Grant M, Lamb C (2006) Systemic immunity. Curr Opin Plant Biol 9: 414–420
Gunsé B, Poschenrieder C, Rankl S, Schröder P, Rodrigo-Moreno A, Barceló J (2016)
REFERENCES
107
A highly versatile and easily configurable system for plant electrophysiology. MethodsX 3: 436–451
Gunsé B, Rodrigo A, Poschenrieder C (2010) Desarrollo de un sistema electrofisiológico con control automatizado del posicionamiento de los microelectrodos. Natl Instruments Spain 1–3
Hager A (2003) Role of the plasma membrane H+-ATPase in auxin-induced elongation growth: historical and new aspects. J Plant Res 116: 483–505
Hahlbrock K, Scheel D, Logemann E, Nürnberger T, Parniske M, Reinold S, Sacks WR, Schmelzer E (1995) Oligopeptide elicitor-mediated defense gene activation in cultured parsley cells. Proc Natl Acad Sci USA 92: 4150–4157
Halim VA, Altmann S, Ellinger D, Eschen-Lippold L, Miersch O, Scheel D, Rosahl S (2009) PAMP-induced defense responses in potato require both salicylic acid and jasmonic acid. Plant J 57: 230–242
Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acid Symp Ser 41: 95–98
Hamilton EW, Coleman JS (2001) Heat-shock proteins are induced in unstressed leaves of Nicotiana attenuata (Solanaceae) when distant leaves are stressed. Am J Bot 88: 950–955
Hartmann A, Rothballer M, Hense BA, Schröder P (2014) Bacterial quorum sensing compounds are important modulators of microbe-plant interactions. Front Plant Sci 5: 1–4
Hartmann A, Rothballer M, Schmid M (2008) Lorenz Hiltner, a pioneer in rhizosphere microbial ecology and soil bacteriology research. Plant Soil 312: 7–14
He P, Shan L, Sheen J (2007) Elicitation and suppression of microbe-associated molecular pattern-triggered immunity in plant-microbe interactions. Cell Microbiol 9: 1385–1396
Heath MC (2000) Nonhost resistance and nonspecific plant defenses. Curr Opin Plant Biol 3: 315–319
Heckman DS, Geiser DM, Eidell BR, Stauffer RL, Kardos NL, Hedges SB (2001) Molecular evidence for the early colonization of land by fungi and plants. Science 293: 1129–1133
Hedrich R (2012) Ion channels in plants. Physiol Rev 92: 1777–1811
Hense BA, Kuttler C, Müller J, Rothballer M, Hartmann A, Kreft J-U (2007) Does efficiency sensing unify diffusion and quorum sensing? Nat Rev Microbiol 5: 230–239
Hernández-Reyes C, Schenk ST, Neumann C, Kogel K-H, Schikora A (2014) N-acyl-homoserine lactones-producing bacteria protect plants against plant and human pathogens. Microb Biotechnol 7: 580–588
Higinbotham N (1973) Electropotentials of plant cells. Annu Rev Plant Physiol 46: 25–46
Hoagland DR, Arnon DI (1950) The water-culture method for growing plants without soil. Calif Agric Exp Stn 347: 1–32
Hochholdinger F, Woll K, Sauer M, Dembinsky D (2004) Genetic dissection of root formation in maize (Zea mays) reveals root-type specific developmental programmes. Ann Bot 93: 359–368
REFERENCES
108
Huang J, Shi Y, Zeng G, Gu Y, Chen G, Shi L, Hu Y, Tang B, Zhou J (2016) Acyl-homoserine lactone-based quorum sensing and quorum quenching hold promise to determine the performance of biological wastewater treatments: an overview. Chemosphere 157: 137–151
Hückelhoven R, Fodor J, Preis C, Kogel K-H (1999) Hypersensitive cell death and papilla formation in barley attacked by the powdery mildew fungus are associated with hydrogen peroxide but not with salicylic acid accumulation. Plant Physiol 119: 1251–1260
Iglesias R, Pérez Y, De Torre C, Ferreras JM, Antolín P, Jiménez P, Rojo MÁ, Méndez E, Girbés T (2005) Molecular characterization and systemic induction of single-chain ribosome-inactivating proteins (RIPs) in sugar beet (Beta vulgaris) leaves. J Exp Bot 56: 1675–1684
Ingle RA, Carstens M, Denby KJ (2006) PAMP recognition and the plant–pathogen arms race. BioEssays 28: 880–889
Ishihama N, Yoshioka H (2012) Post-translational regulation of WRKY transcription factors in plant immunity. Curr Opin Plant Biol 15: 431–437
Jakubczyk D, Barth C, Kubas A, Anastassacos F, Koelsch P, Fink K, Schepers U, Brenner-Weiß G, Bräse S (2012) Deuterium-labelled N-acyl-L-homoserine lactones (AHLs)-inter-kingdom signalling molecules-synthesis, structural studies, and interactions with model lipid membranes. Anal Bioanal Chem 403: 473–482
Jamal F, Pandey PK, Singh D, Khan MY (2013) Serine protease inhibitors in plants: Nature’s arsenal crafted for insect predators. Phytochem Rev 12: 1–34
Jensen MK, Rung JH, Gregersen PL, Gjetting T, Fuglsang AT, Hansen M, Joehnk N, Lyngkjaer MF, Collinge DB (2007) The HvNAC6 transcription factor: a positive regulator of penetration resistance in barley and Arabidopsis. Plant Mol Biol 65: 137–150
Jiang SY, Ramamoorthy R, Bhalla R, Luan HF, Venkatesh PN, Cai M, Ramachandran S (2008) Genome-wide survey of the RIP domain family in Oryza sativa and their expression profiles under various abiotic and biotic stresses. Plant Mol Biol 67: 603–614
Jin G, Liu F, Ma H, Hao S, Zhao Q, Bian Z, Jia Z, Song S (2012) Two G-protein-coupled-receptor candidates, Cand2 and Cand7, are involved in Arabidopsis root growth mediated by the bacterial quorum-sensing signals N-acyl-homoserine lactones. Biochem Biophys Res Commun 417: 991–995
Jones JDG, Dangl JL (2006) The plant immune system. Nature 444: 323–329
Jones KH, Senft JA (1985) An improved method to determine cell viability by simultaneous staining with fluorescein diacetate-propidium iodide. J Histochem Cytochem 33: 77–79
Joseph CM, Phillips DA (2003) Metabolites from soil bacteria affect plant water relations. Plant Physiol Biochem 41: 189–192
Kang HG, Foley RC, Oñate-Sánchez L, Lin C, Singh KB (2003) Target genes for OBP3, a Dof transcription factor, include novel basic helix-loop-helix domain proteins inducible by salicylic acid. Plant J 35: 362–372
Kasprzewska A (2003) Plant chitinases-regulation and function. Cell Mol Biol Lett 8: 809–824
Kersey PJ, Allen JE, Armean I, Boddu S, Bolt BJ, Carvalho-Silva D, Christensen M,
REFERENCES
109
Davis P, Falin LJ, Grabmueller C, et al (2015) Ensembl Genomes 2016: more genomes, more complexity. Nucleic Acids Res 44: 1–7
Kiegle E, Gilliham M, Haseloff J, Tester M (2000) Hyperpolarisation-activated calcium currents found only in cells from the elongation zone of Arabidopsis thaliana roots. Plant J 21: 225–229
Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome bBology 14: 1–13
Kim NH, Hwang BK (2015) Pepper heat shock protein 70a interacts with the type III effector AvrBsT and triggers plant cell death and immunity. Plant Physiol 167: 307–322
Kiribuchi K, Jikumaru Y, Kaku H, Minami E, Hasegawa M, Kodama O, Seto H, Okada K, Nojiri H, Yamane H (2005) Involvement of the basic helix-loop-helix transcription factor RERJ1 in wounding and drought stress responses in rice plants. Biosci Biotechnol Biochem 69: 1042–1044
Klein I (2007) Interaktion von Arabidopsis thaliana mit Rhizosphärenbacterien und deren Quorum-Sensing-Signalen N-Acyl-Homoserinlactonen, doctoral thesis, TUM, http://mediatum.ub.tum.de?id=625748
Klein I, von Rad U, Durner J (2009) Homoserine lactones. Plant Signal Behav 4: 50–51
Kloepper JW, Ryu C-M, Zhang S (2004) Induced systemic resistance and promotion of plant growth by Bacillus spp. Phytopathology 94: 1259–1266
Klüsener B, Young JJ, Murata Y, Allen GJ, Mori IC, Hugouvieux V, Schroeder JI (2002) Convergence of calcium signaling pathways of pathogenic elicitors and abscisic acid in Arabidopsis guard cells. Plant Physiol 130: 2152–2163
Kogel K-H, Langen G (2005) Induced disease resistance and gene expression in cereals. Cell Microbiol 7: 1555–1564
Kogel K-H, Ortel B, Jarosch B, Atzorn R, Schiffer R, Wasternack C (1995) Resistance in barley against the powdery mildew fungus (Erysiphe graminis f.sp.hordei) is not associated with enhanced levels of endogenous jasmonates. Eur J Plant Pathol 101: 319–332
Koiwa H, Bressan RA, Hasegawa PM (1997) Regulation of protease inhibitors and plant defense. Trends Plant Sci 2: 379–384
Kolukisaoglu U, Weinl S, Blazevic D, Batistic O, Kudla J (2004) Calcium sensors and their interacting protein kinases: genomics of the Arabidopsis and rice CBL-CIPK signaling networks. Plant Physiol 134: 43–58
Koornneef A, Pieterse CMJ (2008) Cross talk in defense signaling. Plant Physiol 146: 839–844
Kumar AS, Lakshmanan V, Caplan JL, Powell D, Czymmek KJ, Levia DF, Bais HP (2012) Rhizobacteria Bacillus subtilis restricts foliar pathogen entry through stomata. Plant J 72: 694–706
Ledent V, Vervoort M (2001) The basic helix-loop-helix protein family : comparative genomics and phylogenetic analysis. Genome Res 3: 754–770
Lee SC, Luan S (2012) ABA signal transduction at the crossroad of biotic and abiotic stress responses. Plant, Cell Environ 35: 53–60
REFERENCES
110
Leeman M, van Pelt JA, den Ouden FM, Heinsbroek M, Bakker PAHM, Schippers B (1995a) Induction of systemic resistance against fusarium wilt of radish by lipopolysccharides of Pseudomonas fluorescens. Phytopathology 85: 1021–1027
Leeman M, van Pelt JA, den Ouden FM, Heinsbroek M, Bakker PAHM, Schippers B (1995b) Induction of systemic resistance by Pseudomonas fluorescens in radish cultivars differing in susceptibility to fusarium wilt, using a novel bioassay. Eur J Plant Pathol 101: 655–664
Leo A, Hansch C, Elkins D (1971) Partition coefficients and their uses. Chem Rev 71: 525–616
Li J, Long Y, Qi G-N, Xu Z-J, Wu W-H, Wang Y (2014) The Os-AKT1 channel is critical for K+ uptake in rice roots and is modulated by the rice CBL1-CIPK23 complex. Plant Cell 26: 3387–3402
Li L, Kim B, Cheong YH, Pandey GK, Luan S (2006a) A Ca2+ signaling pathway regulates a K+ channel for low-K response in Arabidopsis. 103: 12625–12630
Li W, Xu Y-P, Zhang Z-X, Cao W-Y, Li F, Zhou X, Chen G-Y, Cai X-Z (2012) Identification of genes required for nonhost resistance to Xanthomonas oryzae pv. oryzae reveals novel signaling components. PLoS One 7: e42796
Li X, Duan X, Jiang H, Sun Y, Tang Y, Yuan Z, Guo J, Liang W, Chen L, Yin J, et al (2006b) Genome-wide analysis of basic / helix-loop-helix transcription factor family in rice and Arabidopsis. Plant Physiol 141: 1167–1184
Lin W, Okon Y, Hardy RW (1983) Enhanced mineral uptake by Zea mays and Sorghum bicolor roots inoculated with Azospirillum brasilense. Appl Environ Microbiol 45: 1775–1779
Lindquist S, Craig EA (1988) The heat-shock proteins. Annu Rev Genet 22: 631–677
Liu F, Bian Z, Jia Z, Zhao Q, Song S (2012) The GCR1 and GPA1 participate in promotion of Arabidopsis primary root elongation induced by N-Acyl-homoserine lactones, the bacterial quorum-sensing signals. Mol Plant-Microbe Interact 25: 677–683
Liu JZ, Whitham SA (2013) Overexpression of a soybean nuclear localized type-III DnaJ domain-containing HSP40 reveals its roles in cell death and disease resistance. Plant J 74: 110–121
Liu X, Rockett KS, Kørner CJ, Pajerowska-Mukhtar KM (2015) Salicylic acid signalling: new insights and prospects at a quarter-century milestone. Essays Biochem 58: 101–113
Llugany M, Martin SR, Barceló J, Poschenrieder C (2013) Endogenous jasmonic and salicylic acids levels in the Cd-hyperaccumulator Noccaea (Thlapsi) praecox exposed to fungal infection and/or mechanical stress. Plant Cell Rep 32: 1243–1249
López-Bucio J, Acevedo-Hernández G, Ramírez-Chávez E, Molina-Torres J, Herrera-Estrella L (2006) Novel signals for plant development. Curr Opin Plant Biol 9: 523–529
Ma W, Smigel A, Tsai Y-C, Braam J, Berkowitz GA (2008) Innate immunity signaling: cytosolic Ca2+ elevation is linked to downstream nitric oxide generation through the action of calmodulin or a calmodulin-like protein. Plant Physiol 148: 818–828
Maathuis FJ (2009) Physiological functions of mineral macronutrients. Curr Opin Plant Biol 12: 250–258
REFERENCES
111
MacDonald MJ, D’Cunha GB (2007) A modern view of phenylalanine ammonia lyase. Biochem Cell Biol 85: 273–282
Malamy JE (2005) Intrinsic and environmental response pathways that regulate root system architecture. Plant, Cell Environ 28: 67–77
Mariutto M, Ongena M (2015) Molecular patterns of rhizobacteria involved plant immunity elicitation. in: Bais H, Sherrier J (Eds.), Advances in botanical research-Plant microbe interactions, Ed: 1, Academic Press-Elsevier, London
Marschner H (1995) Mineral nutrition of higher plants, Marschner P (Ed.), Ed: 3, Academic Press Elsevier, London
Massari ME, Murre C (2000) Helix-loop-helix proteins: regulators of transcription in eucaryotic organisms. Mol Cell Biol 20: 429–440
Mathesius U, Mulders S, Gao M, Teplitski M, Caetano-Anollés G, Rolfe BG, Bauer WD (2003) Extensive and specific responses of a eukaryote to bacterial quorum-sensing signals. Proc Natl Acad Sci USA 100: 1444–1449
Mayer KFX, Waugh R, Langridge P, Close TJ, Wise RP, Graner A, Matsumoto T, Sato K, Schulman A, Muehlbauer GJ, et al (2012) A physical, genetic and functional sequence assembly of the barley genome. Nature 491: 711–717
McGinnis S, Madden TL (2004) BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res 32: W20–W25
Melotto M, Underwood W, Koczan J, Nomura K, He SY (2006) Plant stomata function in innate immunity against bacterial invasion. Cell 126: 969–980
Méndez-Bravo A, Raya-González J, Herrera-Estrella L, López-Bucio J (2010) Nitric oxide is involved in alkamide-induced lateral root development in Arabidopsis. Plant Cell Physiol 51: 1612–1626
Messner B, Schröder P (1999) Burst amplifying system in cell suspension cultures of spruce (Picea abies L. Karst.): modulation of elicitor-induced release of hydrogen peroxide (oxidative burst) by ionophores and salicylic acid. J Appl Bot 73: 6–10
Miller MB, Bassler BL (2001) Quorum sensing in bacteria. Annu Rev Microbiol 55: 165–199
Mishina TE, Zeier J (2007) Pathogen-associated molecular pattern recognition rather than development of tissue necrosis contributes to bacterial induction of systemic acquired resistance in Arabidopsis. Plant J 50: 500–513
Molitor A, Zajic D, Voll LM, Pons-K Hnemann J, Samans B, Kogel K-H, Waller F (2011) Barley leaf transcriptome and metabolite analysis reveals new aspects of compatibility and Piriformospora indica-mediated systemic induced resistance to powdery mildew. Mol Plant Microbe Interact 24: 1427–1439
Morquecho-Contreras A, Méndez-Bravo A, Pelagio-Flores R, Raya-González J, Ortíz-Castro R, López-Bucio J (2010) Characterization of drr1, an alkamide-resistant mutant of Arabidopsis, reveals an important role for small lipid amides in lateral root development and plant senescence. Plant Physiol 152: 1659–1673
Morrissey J, Guerinot M Lou (2009) Iron uptake and transport in plants: the good, the bad, and the ionome. Chem Rev 109: 4553–4567
Mur LAJ, Kenton P, Lloyd AJ, Ougham H, Prats E (2008) The hypersensitive response; the centenary is upon us but how much do we know? J Exp Bot 59: 501–520
REFERENCES
112
Murashige T, Skoog F (1962) A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol Plant 15: 473–497
Murre C, McCaw PS, Baltimore D (1989) A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56: 777–783
Nealson KH, Platt T, Woodland Hastings J (1970) Cellular control of the synthesis and activity of the bacterial luminescent system. J Bacteriol 104: 313–322
Newman IA (2001) Ion transport in roots : measurement of fluxes using ion-selective microelectrodes to characterize transporter function. Plant, Cell Environ 24: 1–14
Nibau C, Gibbs DJ, Coates JC (2008) Branching out in new directions: the control of root architecture by lateral root formation. New Phytol 179: 595–614
Nieto-Peñalver CG, Bertini E V, de Figueroa LIC (2012) Identification of N-acyl homoserine lactones produced by Gluconacetobacter diazotrophicus PAL5 cultured in complex and synthetic media. Arch Microbiol 194: 615–622
Nieuwenhuijsen MJ, Toledano MB, Eaton NE, Fawell J, Elliott P (2000) Chlorination disinfection byproducts in water and their association with adverse reproductive outcomes: a review. Occup Environ Med 57: 73–85
Nieves-Cordones M, Alemán F, Martínez V, Rubio F (2014) K+ uptake in plant roots. The systems involved, their regulation and parallels in other organisms. J Plant Physiol 171: 688–695
Nihorimbere V, Ongena M, Smargiassi M, Thonart P (2011) Beneficial effect of the rhizosphere microbial community for plant growth and health. Biotechnol Agron Société Environ 15: 327–337
Nürnberger T, Lipka V (2005) Non-host resistance in plants: new insights into an old phenomenon. Mol Plant Pathol 6: 335–345
Ogo Y, Itai RN, Nakanishi H, Inoue H, Kobayashi T, Suzuki M, Takahashi M, Mori S, Nishizawa NK (2006) Isolation and characterization of IRO2, a novel iron-regulated bHLH transcription factor in graminaceous plants. J Exp Bot 57: 2867–2878
Oliver S, Barber SA (1966) An evaluation of the mechanisms governing the supply of Ca, Mg, K, and Na to soybean roots (Glycine max). Soil Sci Soc Am J 30: 82–86
Ortíz-Castro R, Contreras-Cornejo HA, Macías-Rodríguez L, López-Bucio J (2009) The role of microbial signals in plant growth and development. Plant Signal Behav 4: 701–712
Ortíz-Castro R, Martínez-Trujillo M, López-Bucio J (2008) N-acyl-L-homoserine lactones: a class of bacterial quorum-sensing signals alter post-embryonic root development in Arabidopsis thaliana. Plant Cell Environ 31: 1497–1509
Pacheco AR, Sperandio V (2009) Inter-kingdom signaling: chemical language between bacteria and host. Curr Opin Microbiol 12: 192–198
Pagnussat GC, Simontacchi M, Puntarulo S, Lamattina L (2002) Nitric oxide is required for root organogenesis. Plant Physiol 129: 954–956
Pallas JA, Paiva NL, Lamb C, Dixon RA (1996) Tobacco plants epigenetically suppressed in phenylalanine ammonia-lyase expression do not develop systemic acquired resistance in response to infection by tobacco mosaic virus. Plant J 10: 281–293
REFERENCES
113
Palmer AG, Senechal AC, Mukherjee A, Ané J-M, Blackwell HE (2014) Plant responses to bacterial N-Acyl l-homoserine lactones are dependent on enzymatic degradation to L-homoserine. ACS Chem Biol 9: 1834–1845
Palmer CM, Hindt MN, Schmidt H, Clemens S, Guerinot M Lou (2013) MYB10 and MYB72 are required for growth under iron-limiting conditions. PLoS Genet 9: 1–9
Pan I-C, Tsai H-H, Cheng Y-T, Wen T-N, Buckhout TJ, Schmidt W (2015) Post-transcriptional coordination of the Arabidopsis iron deficiency response is partially dependent on the E3 ligases RGLG1 and RGLG2. Mol Cell Proteomics 14: 2733–2752
Pang Y, Liu X, Ma Y, Chernin L, Berg G, Gao K (2009) Induction of systemic resistance, root colonisation and biocontrol activities of the rhizospheric strain of Serratia plymuthica are dependent on N-acyl homoserine lactones. Eur J Plant Pathol 124: 261–268
Park C-J, Seo Y-S (2015) Heat shock proteins: a review of the molecular chaperones for plant immunity. Plant Pathol J 31: 323–333
Pastor V, Balmer A, Gamir J, Flors V, Mauch-Mani B (2014) Preparing to fight back: generation and storage of priming compounds. Front Plant Sci 5: 1–12
Pastori GM, Kiddle G, Antoniw J, Bernard S, Veljovic-Jovanovic S, Verrier PJ, Noctor G, Foyer CH (2003) Leaf vitamin C contents modulate plant defense transcripts and regulate genes that control development through hormone signaling. Plant Cell 15: 939–951
Pautot V, Holzer FM, Walling LL (1991) Differential expression of tomato proteinase inhibitor I and II genes during bacterial pathogen invasion and wounding. Mol Plant-Microbe Interact 4: 284–292
Pérez-Montaño F, Alías-Villegas C, Bellogín RA, del Cerro P, Espuny MR, Jiménez-Guerrero I, Lopéz-Baena FJ, Ollero FJ, Cubo T (2014) Plant growth promotion in cereal and leguminous agricultural important plants: from microorganism capacities to crop production. Microbiol Res 169: 325–336
Philippar K, Ivashikina N, Ache P, Christian M, Lüthen H, Palme K, Hedrich R (2004) Auxin activates KAT1 and KAT2, two K+-channel genes expressed in seedlings of Arabidopsis thaliana. Plant J 37: 815–827
Philippot L, Raaijmakers JM, Lemanceau P, van der Putten WH (2013) Going back to the roots: the microbial ecology of the rhizosphere. Nat Rev Microbiol 11: 789–799
Pieterse CMJ, van Wees SCM, Hoffland E, van Pelt JA, van Loon LC (1996) Systemic resistance in Arabidopsis induced by biocontrol bacteria is independent of salicylic acid accumulation and pathogenesis-related gene expression. Plant Cell 8: 1225–1237
Pieterse CMJ (2001) Rhizobacteria-mediated induced systemic resistance: triggering, signaling and expression. Eur J Plant Pathol 107: 51–61
Pieterse CMJ, van der Does D, Zamioudis C, Leon-Reyes A, van Wees SCM (2012) Hormonal modulation of plant immunity. Annu Rev Cell Dev Biol 28: 489–521
Pieterse CMJ, van Wees SCM (2015) Induced disease resistance. in: Lugtenberg B (Ed.), Principles of plant-microbe Interactions: microbes for sustainable agriculture, Springer, Switzerland
Pieterse CMJ, Zamioudis C, Berendsen RL, Weller DM, van Wees SCM, Bakker PAHM (2014) Induced systemic resistance by beneficial microbes. Annu Rev Phytopathol 52:
REFERENCES
114
347–375
Pourkheirandish M, Komatsuda T (2007) The importance of barley genetics and domestication in a global perspective. Ann Bot 100: 999–1008
R Core Team (2014) R: a language and environment for statistical computing. R foundation for statistical computing.
von Rad U, Klein I, Dobrev PI, Kottova J, Zazimalova E, Fekete A, Hartmann A, Schmitt-Kopplin P, Durner J (2008) Response of Arabidopsis thaliana to N-hexanoyl-DL-homoserine-lactone, a bacterial quorum sensing molecule produced in the rhizosphere. Planta 229: 73–85
Ramírez-Chávez E, Lopéz-Bucio J, Herrera-Estrella L, Molina-Torres J (2004) Alkamides isolated from plants promote growth and alter root development in Arabidopsis. Plant Physiol 134: 1058–1068
Rankl S, Gunsé B, Sieper T, Schmid C, Poschenrieder C, Schröder P (2016) Microbial homoserine lactones (AHLs) are effectors of root morphological changes in barley. Plant Sci 253: 130–140
Raven JA, Edwards D (2001) Roots: evolutionary origins and biogeochemical significance. J Exp Bot 52: 381–401
Redfield RJ (2002) Is quorum sensing a side effect of diffusion sensing? Trends Microbiol 10: 365–370
Reimann-Philipp U, Behnke S, Batschauer A, Schäfer E, Apel K (1989) The effect of light on the biosynthesis of leaf-specific thionins in barley, Hordeum vulgare. Eur J Biochem 182: 283–289
Reinbothe S, Reinbothe C, Lehmann J, Becker W, Apel K, Parthier B (1994) JIP60, a methyl jasmonate-induced ribosome-inactivating protein involved in plant stress reactions. Proc Natl Acad Sci USA 91: 7012–7016
Reymond P, Farmer EE (1998) Jasmonate and salicylate as global signals for defense gene expression. Curr Opin Plant Biol 1: 404–411
Ritchie AJ, Jansson A, Stallberg J, Nilsson P, Lysaght P, Cooley MA (2005) The Pseudomonas aeruginosa quorum-sensing molecule N-3-(oxododecanoyl)-L-homoserine lactone inhibits T-cell differentiation and cytokine production by a mechanism involving an early step in T-cell activation. Infect Immun 73: 1648–1655
Rodrigo-Moreno A, Andrés-Colás N, Poschenrieder C, Gunsé B, Peñarrubia L, Shabala S (2013) Calcium- and potassium-permeable plasma membrane transporters are activated by copper in Arabidopsis root tips: linking copper transport with cytosolic hydroxyl radical production. Plant, Cell Environ 36: 844–855
Romani G, Marrè MT, Bellando M, Alloatti G, Marrè E (1985) H+ extrusion and potassium uptake associated with potential hyperpolarization in maize and wheat root segments treated with permeant weak acids. Plant Physiol 79: 734–739
Rothballer MH (2004) In situ Lokalisierung , PGPR-Effekt und Regulation des ipdC-Gens der Azospirillum brasilense Stämme Sp7 und Sp245 bei verschiedenen Weizensorten , sowie endophytische Kolonisierung durch Herbaspirillum sp . N3, doctoral thesis, LMU
Roylawar P, Panda S, Kamble A (2015) Comparative analysis of BABA and Piriformospora indica mediated priming of defence-related genes in tomato against early blight. Physiol Mol Plant Pathol 91: 88–95
REFERENCES
115
Rudrappa T, Czymmek KJ, Pare PW, Bais HP (2008) Root-secreted malic acid recruits beneficial soil bacteria. Plant Physiol 148: 1547–1556
Ryan CA (1990) Protease inhibitors in plants: genes for improving defenses against insects and pathogens. Annu Reviews Phytopathol 28: 425–449
Ryu CM, Choi HK, Lee CH, Murphy JF, Lee JK, Kloepper JW (2013) Modulation of quorum sensing in acyl-homoserine lactone-producing or -degrading tobacco plants leads to alteration of induced systemic resistance elicited by the rhizobacterium Serratia marcescens 90-166. Plant Pathol J 29: 182–192
Ryu CM, Hu CH, Reddy MS, Kloepper JW (2003) Different signaling pathways of induced resistance by rhizobacteria in Arabidopsis thaliana against two pathovars of Pseudomonas syringae. New Phytol 160: 413–420
Ryu CM, Murphy JF, Mysore KS, Kloepper JW (2004) Plant growth-promoting rhizobacteria systemically protect Arabidopsis thaliana against cucumber mosaic virus by a salicylic acid and NPR1-independent and jasmonic acid-dependent signaling pathway. Plant J 39: 381–392
Sano T, Becker D, Ivashikina N, Wegner LH, Zimmermann U, Roelfsema MRG, Nagata T, Hedrich R (2007) Plant cells must pass a K+ threshold to re-enter the cell cycle. Plant J 50: 401–413
Sano T, Kutsuna N, Becker D, Hedrich R, Hasezawa S (2009) Outward-rectifying K+ channel activities regulate cell elongation and cell division of tobacco BY-2 cells. Plant J 57: 55–64
Schenk ST, Hernández-Reyes C, Samans B, Stein E, Neumann C, Schikora M, Reichelt M, Mithöfer A, Becker A, Kogel K-H, Schikora A (2014) N-acyl-homoserine lactone primes plants for cell wall reinforcement and induces resistance to bacterial pathogens via the salicylic acid/oxylipin pathway. Plant Cell 26: 2708–2723
Schenk ST, Schikora A (2015) AHL-priming functions via oxylipin and salicylic acid. Front Plant Sci 5: 1–7
Schenk ST, Stein E, Kogel K-H, Schikora A (2012) Arabidopsis growth and defense are modulated by bacterial quorum sensing molecules. Plant Signal Behav 7: 178–181
Schikora A, Schenk ST, Hartmann A (2016) Beneficial effects of bacteria-plant communication based on quorum sensing molecules of the N -acyl homoserine lactone group. Plant Mol Biol 90: 605–12
Schikora A, Schenk ST, Stein E, Molitor A, Zuccaro A, Kogel K-H (2011) N-acyl-homoserine lactone confers resistance toward biotrophic and hemibiotrophic pathogens via altered activation of AtMPK6. Plant Physiol 157: 1407–1418
Schon MK, Novacky A, Blevins DG (1990) Boron induces hyperpolarization of sunflower root cell membranes and increases membrane permeability to K+. Plant Physiol 93: 566–571
Schroeder JI, Ward JM, Gassmann W (1994) Perspectives on the physiology and structure of inward-rectifying K+ channels in higher plants: biophysical implications for K+ uptake. Annu Rev Biophys Biomol Struct 23: 441–471
Schrot J, Weng A, Melzig MF (2015) Ribosome-inactivating and related proteins. Toxins 7: 1556–1615
Schuhegger RM, Ihring A, Gantner S, Bahnweg G, Knappe C, Vogg G, Hutzler P,
REFERENCES
116
Schmid M, van Breusegem F, Eberl L, Hartmann A, Langebartels C (2006)
Induction of systemic resistance in tomato by N-acyl-L-homoserine lactone-producing
rhizosphere bacteria. Plant, Cell Environ 29: 909–918
Schuhegger RM (2003) Induktion systemischer Resistenz durch N-Acyl-L-homoserinlacton-produzierende Bakterien in der Rhizosphäre von Tomatenpflanzen, doctoral thesis, LMU, http://tumb1.biblio.tu-muenchen.de/publ/diss/ch/2003/schuhegger.html
Segarra G, van der Ent S, Trillas I, Pieterse CMJ (2009) MYB72, a node of convergence in induced systemic resistance triggered by a fungal and a bacterial beneficial microbe. Plant Biol 11: 90–96
Segarra G, Jáuregui O, Casanova E, Trillas I (2006) Simultaneous quantitative LC–ESI-MS/MS analyses of salicylic acid and jasmonic acid in crude extracts of Cucumis sativus under biotic stress. Phytochemistry 67: 395–401
Sels J, Mathys J, De Coninck BMA, Cammue BPA, De Bolle MFC (2008) Plant pathogenesis-related (PR) proteins: a focus on PR peptides. Plant Physiol Biochem 46: 941–950
Selvakumar G, Mohan M, Kundu S, Gupta AD, Joshi P, Nazim S, Gupta HS (2007) Cold tolerance and plant growth promotion potential of Serratia marcescens strain SRM (MTCC 8708) isolated from flowers of summer squash (Cucurbita pepo). Lett Appl Microbiol 46: 171–175
Semenov AM, van Bruggen A, Zelenev VV (1999) Moving waves of bacterial populations and total organic carbon along roots of wheat. Microb Ecol 37: 116–128
Shabala S, Shabala L (2002) Kinetics of net H+, Ca2+ , K+, Na+ , NH4+ , and Cl– fluxes
associated with post-chilling recovery of plasma membrane transporters in Zea mays leaf and root tissues. Physiol Plant 114: 47–56
Shah J (2009) Plants under attack: systemic signals in defence. Curr Opin Plant Biol 12: 459–464
Sharifi-Sirchi GR, Beheshti B, Hosseinipour A, Mansouri M (2011) Priming against asiatic citrus canker and monitoring of PR genes expression during resistance induction. African J Biotechnol 10: 3818–3823
Sharma N, Park S, Vepachedu R, Barbieri L, Ciani M, Stirpe F, Savary BJ, Vivanco JM, Giacomo VS (2004) Isolation and characterization of an RIP (ribosome-inactivating protein)-like protein from tobacco with dual enzymatic activity. Plant Physiol 134: 171–181
Sharma T, Dreyer I, Riedelsberger J (2013) The role of K+ channels in uptake and redistribution of potassium in the model plant Arabidopsis thaliana. Front Plant Sci 4: 1–16
Sharp RE, Hsiao TC, Kuhn Silk W (1990) Growth of the maize primary root at low water potentials II. role of growth and depostition of hexose and potassium in osmotic adjustment. Plant Physiol 93: 1337–1346
Shi CL, Park HB, Lee JS, Ryu S, Ryu CM (2010) Inhibition of primary roots and stimulation of lateral root development in Arabidopsis thaliana by the rhizobacterium Serratia marcescens 90-166 is through both auxin-dependent and -independent signaling pathways. Mol Cells 29: 251–258
Shimazaki K, Doi M, Assmann SM, Kinoshita T (2007) Light regulation of stomatal
REFERENCES
117
movement. Annu Rev Plant Biol 58: 219–247
Shimazaki K, Iino M, Zeiger E (1986) Blue light-dependent proton extrusion by guard-cell protoplasts of Vicia faba. Nature 319: 324–326
Shiner EK, Terentyev D, Bryan A, Sennoune S, Martinez-Zaguilan R, Li G, Gyorke S, Williams SC, Rumbaugh KP (2006) Pseudomonas aeruginosa autoinducer modulates host cell responses through calcium signalling. Cell Microbiol 8: 1601–1610
Shirasu K, Nakajima H, Krishnamachari Rajasekhar V, Dixon RA, Lamb C (1997) Salicylic acid potentiates an agonist-dependent gain control that amplifies pathogen signals in the activation of defense mechanisms. Plant Cell Am Soc Plant Physiol 9: 261–270
Sieper T (2012) Der Einfluss von N-Acyl-Homoserinlactonen in der Rhizosphäre von Hordeum vulgare L. Aufnahme, Transport und pflanzliche Stressantworten. doctoral thesis, TUM, http://mediatum.ub.tum.de?id=1096701
Sieper T, Forczek S, Matucha M, Krämer P, Hartmann A, Schröder P (2014) N-acyl-homoserine lactone uptake and systemic transport in barley rest upon active parts of the plant. New Phytol 201: 545–555
Silverman P, Seskar M, Kanter D, Schweizer P, Metraux JP, Raskin I (1995) Salicylic acid in rice (biosynthesis, conjugation, and possible role). Plant Physiol 108: 633–639
Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp Soc Exp Biol 11: 118–30
Soellick T, Uhrig JF, Bucher GL, Kellmann JW, Schreier PH (2000) The movement protein NSm of tomato spotted wilt tospovirus (TSWV): RNA binding, interaction with the TSWV N protein, and identification of interacting plant proteins. Proc Natl Acad Sci USA 97: 2373–2378
Song S, Choi Y, Moon YH, Kim S, Choi Y Do, Lee S (2000) Systemic induction of a Phytolacca insularis antiviral protein gene by mechanical wounding, jasmonic acid, and abscisic acid. Plant Mol Biol 43: 439–450
Song S, Jia Z, Xu J, Zhang Z, Bian Z (2011) N-butyryl-homoserine lactone, a bacterial quorum-sensing signaling molecule, induces intracellular calcium elevation in Arabidopsis root cells. Biochem Biophys Res Commun 414: 355–360
Soto MJ, Sanjuan J, Olivares J (2006) Rhizobia and plant-pathogenic bacteria: common infection weapons. Microbiology 152: 3167–3174
Spoel SH, Dong X (2012) How do plants achieve immunity? Defence without specialized immune cells. Nat Rev Immunol 12: 89–100
Stadnik M., Buchenauer H (2000) Inhibition of phenylalanine ammonia-lyase suppresses the resistance induced by benzothiadiazole in wheat to Blumeria graminis f. sp. tritici. Physiol Mol Plant Pathol 57: 25–34
Stec B (2006) Plant thionins - The structural perspective. Cell Mol Life Sci 63: 1370–1385
Taiz L, Zeiger E (2006) Mineral Nutrition. in: Plant Physiology, Ed.: 4, Sinauer Associates, pp 73–93
Tenhaken R, Rubel C (1997) Salicylic acid is needed in hypersensitive cell death in soybean but does not act as a catalase inhibitor. Plant Physiol 115: 291–298
REFERENCES
118
Teplitski M, Mathesius U, Rumbaugh KP (2011) Perception and degradation of N-acyl homoserine lactone quorum sensing signals by mammalian and plant cells. Chem Rev 111: 100–16
Teplitski M, Robinson JB, Bauer WD (2000) Plants secrete substances that mimic bacterial N-acyl homoserine lactone signal activities and affect population density-dependent behaviors in associated bacteria. Mol Plant-Microbe Interact 13: 637–648
Thordal-Christensen H (2003) Fresh insights into processes of nonhost resistance. Curr Opin Plant Biol 6: 351–357
Tilman D, Cassman KG, Matson PA, Naylor R, Polasky S (2002) Agricultural sustainability and intensive production practices. Nature 418: 671–677
Toledo-Ortiz G, Huq E, Quail PH (2003) The Arabidopsis basic/helix-loop-helix transcription factor family. Plant Cell 15: 1749–1770
Ton J, Jakab G, Toquin V, Flors V, Iavicoli A, Maeder MN, Métraux J-P, Mauch-Mani B (2005) Dissecting the beta-aminobutyric acid-induced priming phenomenon in Arabidopsis. Plant Cell 17: 987–999
Trapnell C, Hendrickson DG, Sauvageau M, Goff L, Rinn JL, Pachter L (2013) Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat Biotechnol 31: 46–53
Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L (2012) Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 7: 562–578
Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L (2010) Transcript assembly and abundance estimation from RNA-Seq reveals thousands of new transcripts and switching among isoforms. Nat Biotechnol 28: 511–515
Vacheron J, Desbrosses G, Bouffaud M-L, Touraine B, Moënne-Loccoz Y, Muller D, Legendre L, Wisniewski-Dyé F, Prigent-Combaret C (2013) Plant growth-promoting rhizobacteria and root system functioning. Front Plant Sci 4: 1–19
Vandelle E, Poinssot B, Wendehenne D, Bentéjac M, Pugin A (2006) Integrated signaling network involving calcium, nitric oxide, and active oxygen species but not mitogen-activated protein kinases in BcPG1-elicited grapevine defenses. Mol Plant-Microbe Interact 19: 429–440
Van der Ent S, van Hulten M, Pozo M, Czechowski T, Udvardi M, Pieterse CMJ, Ton J (2009) Priming of plant innate immunity by rhizobacteria and beta-aminobutyric acid: differences and similarities in regulation. New Phytol 183: 419–431
Van der Ent S, Verhagen BWM, van Doorn R, Bakker D, Verlaan MG, Pel MJC, Joosten RG, Proveniers MCG, van Loon LC, Ton J, Pieterse CMJ (2008) MYB72 is required in early signaling steps of rhizobacteria-induced systemic resistance in Arabidopsis. Plant Physiol 146: 1293–1304
Van de Mortel JE, Schat H, Moerland PD, Ver Loren van Themaat E, van der Ent S, Blankestijn H, Ghandilyan A, Tsiatsiani S, Aarts MG (2008) Expression differences for genes involved in lignin, glutathione and sulphate metabolism in response to cadmium in Arabidopsis thaliana and the related Zn/Cd-hyperaccumulator Thlaspi caerulescens. Plant, Cell Environ 31: 301–324
REFERENCES
119
Van Kan JA, Cozijnsen T, Danhash N, De Wit PJ (1995) Induction of tomato stress protein mRNAs by ethephon, 2,6-dichloroisonicotinic acid and salicylate. Plant Mol Biol 27: 1205–1213
Van Loon LC (1998) Systemic resistance induced by rhizosphere bacteria. Annu Rev Phytopathol 36: 453–483
Van Loon LC (2007) Plant responses to plant growth-promoting rhizobacteria. Eur J Plant Pathol 119: 243–254
Van Loon LC, Bakker PAHM (2006) Root-associated bacteria inducing systemic resistance. in: Gnanamanickam SS (Ed.), Plant-Associated Bacteria. Springer Netherlands, Dordrecht
Van Loon LC, van Strien EA (1999) The families of pathogenesis-related proteins, their activities, and comparative analysis of PR-1 type proteins. Physiol Mol Plant Pathol 55: 85–97
Van Peer R, Niemann GJ, Schippers B (1991) Induced resistance and phytoalexin accumulation in biological control of fusarium wilt of carnation by Pseudomonas sp. strain WCS417r. Phytopathology 81: 728–734
Van Wees SC, Luijendijk M, Smoorenburg I, van Loon LC, Pieterse CMJ (1999) Rhizobacteria-mediated induced systemic resistance (ISR) in Arabidopsis is not associated with a direct effect on expression of known defense-related genes but stimulates the expression of the jasmonate-inducible gene Atvsp upon challenge. Plant Mol Biol 41: 537–549
Venturi V, Keel C (2016) Signaling in the rhizosphere. Trends Plant Sci 21: 187–198
Verbon EH, Liberman LM (2016) Beneficial microbes affect endogenous mechanisms controlling root development. Trends Plant Sci 21: 218–229
Verhagen BWM, Glazebrook J, Zhu T, Chang H-S, van Loon LC, Pieterse CMJ (2004) The transcriptome of rhizobacteria-induced systemic resistance in Arabidopsis. Mol Plant-Microbe Interact 17: 895–908
Véry A-A, Sentenac H (2003) Molecular mechanisms and regulation of K+ transport in higher plants. Annu Rev Plant Biol 54: 575–603
Vierling E (1991) The roles of heat shock proteins in plants. Annu Rev Plant Physiol Plant Mol Biol 42: 579–620
Villanueva CM, Kogevinas M, Grimalt JO (2001) Chlorination of drinking water in Spain and bladder cancer. Gac Sanit 15: 48–53
Viterbo A, Harel M, Horwitz BA, Chet I, Mukherjee PK (2005) Trichoderma mitogen-activated protein kinase signaling is involved in induction of plant systemic resistance. Appl Environ Microbiol 71: 6241–6246
Vlot AC, Dempsey DA, Klessig DF (2009) Salicylic acid, a multifaceted hormone to combat disease. Annu Rev Phytopathol 47: 177–206
Voigt CA, Somerville SC (2009) Callose in biotic stress (pathogenesis) biology, biochemistry in molecular biology of callose in plant defense: callose deposition and turnover in plant-pathogen interactions. in: Bacic A, Fincher GB, Stone BA (Eds.), Chemistry, biochemistry, and biology of 1-3 beta glucans and related polysaccharides, Ed: 9, Academic Press Elsevier, Oxford, pp 525–562
REFERENCES
120
Walsh P, Bursać D, Law YC, Cyr D, Lithgow T (2004) The J-protein family: modulating protein assembly, disassembly and translocation. EMBO Rep 5: 567–571
Walters DR, Ratsep J, Havis ND (2013) Controlling crop diseases using induced resistance: challenges for the future. J Exp Bot 64: 1263–1280
Wang HY, Klatte M, Jakoby M, Bäumlein H, Weisshaar B, Bauer P (2007) Iron deficiency-mediated stress regulation of four subgroup Ib BHLH genes in Arabidopsis thaliana. Planta 226: 897–908
Wang K, Liao Y, Xiong Q, Kan J, Cao S, Zheng Y (2016) Induction of direct or priming resistance against Botrytis cinerea in strawberries by β-aminobutyric acid and their effects on sucrose metabolism. J Agric Food Chem 64: 5855–5865
Wang N, Cui Y, Liu Y, Fan H, Du J, Huang Z, Yuan Y, Wu H, Ling H-Q (2013) Requirement and functional redundancy of Ib subgroup bHLH proteins for iron deficiency responses and uptake in Arabidopsis thaliana. Mol Plant 6: 503–513
Wang W, Vinocur B, Shoseyov O, Altman A (2004) Role of plant heat-shock proteins and molecular chaperones in the abiotic stress response. Trends Plant Sci 9: 244–252
Wang Y, Ohara Y, Nakayashiki H, Tosa Y, Mayama S (2005) Microarray analysis of the gene expression profile induced by the endophytic plant growth-promoting rhizobacteria, Pseudomonas fluorescens FPT 9601-T 5 in Arabidopsis. Mol Plant-Microbe Interact 18: 385–396
Wang Y, Wu W-H (2013) Potassium transport and signaling in higher plants. Annu Rev Plant Biol 64: 451–76
Ward JM, Mäser P, Schroeder JI (2009) Plant ion channels: gene families, physiology, and functional genomics analyses. Annu Rev Physiol 71: 59–82
Warnes GR, Bolker B, Bonebakker L, Gentleman R, Huber W, Liaw A, Lumley T,
Maechler M, Magnusson A, Moeller S, Schwartz M, Venables B (2015) Various R
programming tools for plotting data. Compr R Arch Netw 1–66
Wasternack C, Atzorn R, Jarosch B, Kogel KH (1994) Induction of a thionin, the jasmonate-induced 6 kDa protein of barley by 2,6-dechloroisonicotinic acid. J Phytopathol 140: 280–284
Waters CM, Bassler BL (2005) Quorum sensing: cell-to-cell communication in bacteria. Annu Rev Cell Dev Biol 21: 319–346
Wei HL, Zhang LQ (2006) Quorum-sensing system influences root colonization and biological control ability in Pseudomonas fluorescens 2P24. Antonie Van Leeuwenhoek 89: 267–280
Weller DM (2007) Pseudomonas biocontrol agents of soilborne pathogens: looking back over 30 years. Phytopathology 97: 250–256
Wendehenne D, Pugin A, Klessig DF, Dumer J (2001) Nitric oxide; comparative synthesis and signaling in animal and plant cells. Trends Plant Sci 6: 177–183
White PJ, Karley AJ (2010) Potassium. in: Hell R, Mendel R-R (Eds.), Cell biology of metals and nutrients, Ed.: 1, Springer Verlag, Berlin/Heidelberg, pp 199–224
Whitehead NA, Barnard AML, Slater H, Simpson NJL, Salmond GPC (2001) Quorum-sensing in gram-negative bacteria. FEMS Microbiol Rev 25: 365–404
REFERENCES
121
Wiese J, Kranz T, Schubert S (2004) Induction of pathogen resistance in barley by abiotic stress. Plant Biol 6: 529–536
Wilcox RR (2005) Introduction to robust estimation and hypothesis testing, Ed.: 2, Elsevier
Williams P (2007) Quorum sensing, communication and cross-kingdom signalling in the bacterial world. Microbiology 153: 3923–3938
Winzer K, Hardie KR, Williams P (2002) Bacterial cell-to-cell communication: sorry, can’t talk now - gone to lunch! Curr Opin Microbiol 5: 216–222
Xu J, Audenaert K, Hofte M, De Vleesschauwer D (2013) Abscisic acid promotes susceptibility to the rice leaf blight pathogen Xanthomonas oryzae pv. oryzae by suppressing salicylic acid-mediated defenses. PLoS One 8: 1–10
Xu J, Li HD, Chen LQ, Wang Y, Liu LL, He L, Wu WH (2006) A protein kinase, interacting with two calcineurin B-like proteins, regulates K+ transporter AKT1 in Arabidopsis. Cell 125: 1347–1360
Xu W, Zhang N, Jiao Y, Li R, Xiao D, Wang Z (2014) The grapevine basic helix-loop-helix (bHLH) transcription factor positively modulates CBF-pathway and confers tolerance to cold-stress in Arabidopsis. Mol Biol Rep 41: 5329–5342
Yan Z, Reddy MS, Ryu C-M, McInroy J a, Wilson M, Kloepper JW (2002) Induced systemic protection against tomato late blight elicited by plant growth-promoting rhizobacteria. Phytopathology 92: 1329–1333
Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden TL (2012) Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC Bioinformatics 13: 1–11
Yu P, Gutjahr C, Li C, Hochholdinger F (2016) Genetic control of lateral root formation in cereals. Trends Plant Sci 20: 1–11
Yuan Y, Wu H, Wang N, Li J, Zhao W, Du J, Wang D, Ling H-Q (2008) FIT interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake gene expression for iron homeostasis in Arabidopsis. Cell Res 18: 385–397
Yuan Y, Zhong M, Shu S, Du N, Sun J, Guo S (2016) Proteomic and physiological analyses reveal putrescine responses in roots of cucumber stressed by NaCl. Front Plant 7: 1–19
Zamioudis C, Hanson J, Pieterse CMJ (2014) ß-Glucosidase BGLU42 is a MYB72-dependent key regulator of rhizobacteria-induced systemic resistance and modulates iron deficiency responses in Arabidopsis roots. J Physiol 204: 368–379
Zamioudis C, Korteland J, van Pelt JA, van Hamersveld M, Dombrowski N, Bai Y, Hanson J, van Verk MC, Ling HQ, Schulze-Lefert P, Pieterse CMJ (2015) Rhizobacterial volatiles and photosynthesis-related signals coordinate MYB72 expression in Arabidopsis roots during onset of induced systemic resistance and iron-deficiency responses. Plant J 84: 309–322
Zarkani AA, Stein E, Röhrich CR, Schikora M, Evguenieva-Hackenberg E, Degenkolb T, Vilcinskas A, Klug G, Kogel K-H, Schikora A (2013) Homoserine lactones influence the reaction of plants to rhizobia. Int J Mol Sci 14: 17122–17146
Zeng F, Konnerup D, Shabala L, Zhou M, Colmer TD, Zhang G, Shabala S (2014) Linking oxygen availability with membrane potential maintenance and K+ retention of barley roots: implications for waterlogging stress tolerance. Plant, Cell Environ 37: 2325–2338
REFERENCES
122
Zhao Q, Zhang C, Jia Z, Huang Y, Li H, Song S (2015) Involvement of calmodulin in regulation of primary root elongation by N-3-oxo-hexanoyl homoserine lactone in Arabidopsis thaliana. Front Plant 5: 1-11
Zhichang Z, Wanrong Z, Jinping Y, Jianjun Z, Xufeng L, Yang Y (2010) Over-expression of Arabidopsis DnaJ (Hsp40) contributes to NaCl-stress tolerance. African J Biotechnol 9: 972–978
Zipfel C, Robatzek S (2010) Pathogen-associated molecular pattern-triggered immunity: veni, vidi...? Plant Physiol 154: 551–554
APPENDIX
123
7 APPENDIX
APPENDIX
124
Figure 7.1 Multi-dimensional scaling plot of RNA-seq data from 3 different treatments (control (D), C8- and C12-HSL). Per treatment 2 replicates, represented by circular and triangular form. In this plot, samples that are near each other in the 2-dimensional space, have similar expression pattern. All samples taken at the time point 24 h are clearly separated from the 6 and 12 h samples. Blue, orange, and green circle mark the respective samples of 6, 12, and 24 h.
APPENDIX
125
Table 7-1 Genes commonly regulated after C8- and C12-HSL treatment. Values displayed, are given in log2 fold change-positive values indicate up-regulation and negative ones down-regulation. Bold marked accession numbers are genes analyzed by qRT-PCR.
Locus/accession number
annotation AHL
C8-6h C8-12h C8-24h C12-6h C12-12h C12-24h
AK251940.1 Meiosis 5 n=2 Tax=Zea mays RepID=B4FTV4_MAIZE
-3,997 -3,232
AK251990.1 Cysteine-rich venom protein 4,10122 2,52556
AK354291 Protein kinase domain containing protein n=4 Tax=Andropogoneae RepID=B6SVF3_MAIZE
2,67123 3,74585
AK355398 14 kDa proline-rich protein DC2.15 n=1 Tax=Triticum urartu RepID=M8A2I4_TRIUA
-3,73474 -3,74562
AK371210 basic helix-loop-helix (bHLH) DNA-binding superfamily protein LENGTH=253
4,19607 2,60268 2,54058 4,91008
AK373131 Wound-induced protein 3,24468 2,1498
MLOC_12906 Expansin-B4 -3,37908 -2,80577
MLOC_18031 Phospholipase A1-II 7 -3,51636 -2,47358
MLOC_2643 Subtilisin-chymotrypsin inhibitor-2A 2,26091 5,5084
MLOC_36351 Transcription factor ORG2 3,03921 3,8623
MLOC_50454 Plant protein 1589 of unknown function LENGTH=91
-1,55407 -1,8713 2,17569
MLOC_5765 UPI0002C3315F related cluster n=1 Tax=unknown RepID=UPI0002C3315F
2,21487 2,19776
MLOC_58861 GDSL esterase/lipase -5,63412 -4,44434
MLOC_62487 ABC transporter G family member 32 -3,72644 -3,0433
MLOC_62746 Glucan endo-1,3-beta-glucosidase 2,83647 2,69616
MLOC_65042 Leucine-rich repeat receptor-like protein kinase family protein LENGTH=1045
-5,80066 -3,26407
MLOC_65114 FASCICLIN-like arabinogalactan-protein 11 LENGTH=246
-2,76891 -2,66617
MLOC_66363 Ribonuclease T2 family protein LENGTH=228 2,18234 5,09799
APPENDIX
126
MLOC_68184 Chitinase family protein LENGTH=280 3,94654 2,73019
MLOC_68318 Enoyl-[acyl-carrier-protein] reductase [NADH] 1 -2,22564 -2,71538
MLOC_69589 Plant basic secretory protein (BSP) family protein LENGTH=225
2,53405 2,63902 4,50517
MLOC_72157 Leucine-rich repeat receptor-like protein kinase family protein LENGTH=1045
2,34838 3,17094
MLOC_72498 Plant basic secretory protein (BSP) family protein LENGTH=225
1,89127 2,89675
MLOC_72837 Chaperone protein dnaJ 10 5,30621 1,74036 6,63898
MLOC_73077 Glucan endo-1,3-beta-glucosidase GI 2,8202 2,27144 2,82624
MLOC_7690 HXXXD-type acyl-transferase family protein LENGTH=484
-4,61537 -3,00594
MLOC_78725 Peroxidase superfamily protein LENGTH=324 -2,95923 -2,41553
Following genes are categorized in “genes down-regulated after 12 h C8- and C12-HSL treatment” because
transcripts could only be identified in the control treatments.
accession
number
description treatment value in
control
value in AHL
treatment
AK357228 3-ketoacyl-CoA synthase 17 LENGTH=487 C12-12 5,7873 0
AK357228 3-ketoacyl-CoA synthase 17 LENGTH=487 C8-12 5,7873 0
AK366997 Ras-related protein Rab-5A C12-12 2,10225 0
AK366997 Ras-related protein Rab-5A C8-12 2,10225 0
AK367518 alpha/beta-Hydrolases superfamily protein LENGTH=313 C12-12 1,46951 0
APPENDIX
127
AK367518 alpha/beta-Hydrolases superfamily protein LENGTH=313 C8-12 1,46951 0
MLOC_39203 bZIP family transcription factor LENGTH=300 C12-12 1,49366 0
MLOC_39203 bZIP family transcription factor LENGTH=300 C8-12 1,49366 0
MLOC_57751 LLA-115 n=1 Tax=Lilium longiflorum RepID=B2BA79_LILLO C12-12 17,506 0
MLOC_57751 LLA-115 n=1 Tax=Lilium longiflorum RepID=B2BA79_LILLO C8-12 17,506 0
MLOC_70140 early nodulin-like protein 14 LENGTH=182 C12-12 1,80765 0
MLOC_70140 early nodulin-like protein 14 LENGTH=182 C8-12 1,80765 0
MLOC_761 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin
superfamily protein LENGTH=110
C12-12 2,65008 0
MLOC_761 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin
superfamily protein LENGTH=110
C8-12 2,65008 0
APPENDIX
128
Table 7-2 Annotation result of the RNA seq of all treatments and time points; NA = not available
accession
number
description condition control treatment log2.fold_change GO-term annotation
MLOC_50454 Plant protein 1589 of unknown function
LENGTH=91
C8_6h 130,329 44,3833 -1,55407 NA
MLOC_2643 Subtilisin-chymotrypsin inhibitor-2A C8_6h 20,8984 100,165 2,26091 serine-type endopeptidase inhibitor
activity, response to wounding
MLOC_29844 n=1 Tax=Oryza sativa subsp. japonica
RepID=Q7XKK3_ORYSJ
C8_6h 0 1,98337 Inf RNA-dependent DNA biosynthetic
process
MLOC_60054 protein n=1 Tax=Oryza sativa subsp.
japonica RepID=C7J9P1_ORYSJ
C8_6h 6,15653 0 -Inf zinc ion binding
MLOC_60765 lipoxygenase 2 LENGTH=896 C8_6h 1,79118 0 -Inf protein binding, oxidation-reduction
process
MLOC_75236 Bifunctional pinoresinol-lariciresinol
reductase 2
C8_6h 1,24305 0 -Inf NA
accession
number
description condition control treatment log2.fold_change GO-term annotation
MLOC_59726 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1124
C8_12h 86,5817 1,39939 -5,95119 NA
MLOC_65042 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1045
C8_12h 103,856 1,8632 -5,80066 protein binding
MLOC_58861 GDSL esterase/lipase C8_12h 39,5805 0,796974 -5,63412 hydrolase activity, acting on ester bonds
APPENDIX
129
AK360133 LLA-115 n=1 Tax=Lilium longiflorum
RepID=B2BA79_LILLO
C8_12h 59,753 1,99026 -4,90798 NA
MLOC_7690 HXXXD-type acyl-transferase family
protein LENGTH=484
C8_12h 27,9353 1,1397 -4,61537 transferase activity, transferring acyl
groups other than amino-acyl groups
AK251940.1 Meiosis 5 n=2 Tax=Zea mays
RepID=B4FTV4_MAIZE
C8_12h 602,057 37,7127 -3,99678 NA
MLOC_62475 beta-D-xylosidase 4 LENGTH=784 C8_12h 13,1593 0,859583 -3,93631 hydrolase activity, hydrolyzing O-glycosyl
compounds
AK252327.1 GDSL esterase/lipase C8_12h 10,7344 0,79742 -3,75075 NA
AK355398 14 kDa proline-rich protein DC2.15 n=1
Tax=Triticum urartu
RepID=M8A2I4_TRIUA
C8_12h 294,112 22,0924 -3,73474 NA
MLOC_62487 ABC transporter G family member 32 C8_12h 15,9892 1,20798 -3,72644 ATPase activity
MLOC_18031 Phospholipase A1-II 7 C8_12h 28,5129 2,4918 -3,51636 lipid metabolic process
AK248244.1 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=134
C8_12h 378,172 34,1362 -3,46967 NA
MLOC_12906 Expansin-B4 C8_12h 47,7299 4,58761 -3,37908 NA
MLOC_62873 Xyloglucan
endotransglucosylase/hydrolase family
protein LENGTH=284
C8_12h 18,7968 2,19369 -3,09906 hydrolase activity, hydrolyzing O-glycosyl
compounds, xyloglucan:xyloglucosyl
transferase activity, cell wall
MLOC_71416 Unknown protein C8_12h 152,982 19,6573 -2,96022 serine-type endopeptidase inhibitor
activity
APPENDIX
130
MLOC_78725 Peroxidase superfamily protein
LENGTH=324
C8_12h 33,9061 4,35975 -2,95923 peroxidase activity, response to oxidative
stress, oxidation-reduction process
AK360353 Protein of Unknown Function (DUF239)
LENGTH=422
C8_12h 17,2533 2,42664 -2,82984 NA
AK362474 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=193
C8_12h 70,611 9,99806 -2,82017 NA
MLOC_65114 FASCICLIN-like arabinogalactan-protein
11 LENGTH=246
C8_12h 37,8858 5,55842 -2,76891 NA
AK250623.1 Defensin-like protein C8_12h 38,0224 6,13437 -2,63187 NA
AK365575 beta-D-xylosidase 4 LENGTH=784 C8_12h 22,9853 3,75297 -2,61461 carbohydrate metabolic process
AK358061 3-ketoacyl-CoA synthase 6
LENGTH=497
C8_12h 12,0658 1,97859 -2,60838 transferase activity, transferring acyl
groups other than amino-acyl groups
MLOC_39328 FASCICLIN-like arabinogalactan-protein
12 LENGTH=249
C8_12h 38,2035 6,31682 -2,59643 NA
MLOC_37378 lipoxygenase 1 LENGTH=859 C8_12h 28,7942 5,06988 -2,50576 oxidation-reduction process
MLOC_54267 pectinesterase family protein
LENGTH=968
C8_12h 43,3343 7,68594 -2,49522 enzyme inhibitor activity, cell wall
modification
MLOC_68318 Enoyl-[acyl-carrier-protein] reductase
[NADH] 1
C8_12h 32,7158 6,99476 -2,22564 NA
MLOC_44630 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1045
C8_12h 38,3629 8,23212 -2,22038 protein binding
MLOC_73233 O-methyltransferase 1 LENGTH=363 C8_12h 86,7925 20,3224 -2,0945 methyltransferase activity
APPENDIX
131
MLOC_66363 Ribonuclease T2 family protein
LENGTH=228
C8_12h 113,46 514,985 2,18234 RNA binding
MLOC_52920 H(+)-ATPase 11 LENGTH=956 C8_12h 1,64915 8,82787 2,42035 catalytic activity, TPase activity, coupled
to transmembrane movement of ions,
phosphorylative mechanism
MLOC_69589 Plant basic secretory protein (BSP)
family protein LENGTH=225
C8_12h 14,2778 82,6962 2,53405 NA
MLOC_61497 2-oxoglutarate (2OG) and Fe(II)-
dependent oxygenase superfamily
protein LENGTH=341
C8_12h 13,4445 77,9506 2,53554 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, 2-oxoglutarate as one
donor, and incorporation of one atom
each of oxygen into both donors,
oxidation-reduction process
MLOC_73077 Glucan endo-1,3-beta-glucosidase GI C8_12h 13,3497 94,283 2,8202 hydrolase activity, hydrolyzing O-glycosyl
compounds
AK373131 Wound-induced protein C8_12h 18,0488 171,079 3,24468 defense response to bacterium, defense
response to fungus, oxidation-reduction
process
AK370002 Cysteine-rich venom protein C8_12h 94,5377 1232,95 3,70508 extracellular region
AK355059 Pathogenesis-related thaumatin
superfamily protein LENGTH=246
C8_12h 13,2905 204,413 3,94303 NA
MLOC_68184 Chitinase family protein LENGTH=280 C8_12h 8,14952 125,649 3,94654 chitinase activity, chitin catabolic process,
cell wall macromolecule catabolic process
AK251990.1 Cysteine-rich venom protein C8_12h 25,8893 444,336 4,10122 NA
AK356012 Peroxidase superfamily protein C8_12h 5,13269 0 -Inf peroxidase activity, response to oxidative
APPENDIX
132
LENGTH=346 stress, oxidation-reduction process
AK357228 3-ketoacyl-CoA synthase 17
LENGTH=487
C8_12h 5,7873 0 -Inf transferase activity, transferring acyl
groups other than amino-acyl groups
AK366997 Ras-related protein Rab-5A C8_12h 2,10225 0 -Inf small GTPase mediated signal
transduction
AK367303 D-arabinono-1,4-lactone oxidase family
protein LENGTH=591
C8_12h 6,44606 0 -Inf oxidation-reduction process
AK373951 UPI0002B47FCE related cluster n=1
Tax=unknown RepID=UPI0002B47FCE
C8_12h 1,69693 0 -Inf NA
MLOC_15383 Eukaryotic aspartyl protease family
protein LENGTH=425
C8_12h 1,88368 0 -Inf aspartic-type endopeptidase activity
MLOC_16295 Disease resistance-responsive (dirigent-
like protein) family protein LENGTH=182
C8_12h 2,53653 0 -Inf NA
MLOC_39203 bZIP family transcription factor
LENGTH=300
C8_12h 1,49366 0 -Inf regulation of transcription, DNA-
templated, transcription factor activity,
sequence-specific DNA binding
MLOC_4180 HXXXD-type acyl-transferase family
protein LENGTH=461
C8_12h 1,93779 0 -Inf transferase activity, transferring acyl
groups other than amino-acyl groups
MLOC_49801 protein n=4 Tax=Oryza
RepID=Q6ZCW7_ORYSJ
C8_12h 2,91012 0 -Inf NA
MLOC_53180 Peroxidase superfamily protein
LENGTH=324
C8_12h 3,53483 0 -Inf peroxidase activity, response to oxidative
stress, oxidation-reduction process
MLOC_53242 UPI000234E604 related cluster n=1
Tax=unknown RepID=UPI000234E604
C8_12h 1,74638 0 -Inf NA
APPENDIX
133
MLOC_57751 LLA-115 n=1 Tax=Lilium longiflorum
RepID=B2BA79_LILLO
C8_12h 17,506 0 -Inf NA
MLOC_65697 Chalcone synthase 6 C8_12h 3,70913 0 -Inf biosynthetic process
MLOC_70140 early nodulin-like protein 14
LENGTH=182
C8_12h 1,80765 0 -Inf copper ion binding
MLOC_71597 Cytochrome P450 superfamily protein
LENGTH=488
C8_12h 6,86544 0 -Inf oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, oxidation-reduction
process
MLOC_75895 Domain of unknown function (DUF303)
LENGTH=260
C8_12h 1,66415 0 -Inf NA
MLOC_761 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=110
C8_12h 2,65008 0 -Inf NA
MLOC_79114 unknown protein C8_12h 2,49262 0 -Inf NA
accession
number
description condition control treatment log2.fold_change GO-term annotation
MLOC_1579 Protochlorophyllide reductase C8_24h 35,212 1,7346 -4,3434 metabolic process
MLOC_72498 Plant basic secretory protein (BSP)
family protein LENGTH=225
C8_24h 43,6699 161,998 1,89127 NA
MLOC_5765 UPI0002C3315F related cluster n=1
Tax=unknown RepID=UPI0002C3315F
C8_24h 12,2569 56,9012 2,21487 NA
APPENDIX
134
MLOC_72157 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1045
C8_24h 69,9849 356,4 2,34838 protein binding
MLOC_69589 Plant basic secretory protein (BSP)
family protein LENGTH=225
C8_24h 8,73291 54,3979 2,63902 NA
AK354291 Protein kinase domain containing protein
n=4 Tax=Andropogoneae
RepID=B6SVF3_MAIZE
C8_24h 21,3159 135,776 2,67123 protein kinase activity
MLOC_62746 Glucan endo-1,3-beta-glucosidase C8_24h 35,4577 253,264 2,83647 hydrolase activity, hydrolyzing O-glycosyl
compounds
MLOC_36351 Transcription factor ORG2 C8_24h 24,6698 202,795 3,03921 regulation of transcription, DNA-templated
AK371210 basic helix-loop-helix (bHLH) DNA-
binding superfamily protein
LENGTH=253
C8_24h 8,17866 149,909 4,19607 regulation of transcription, DNA-
templated, DNA binding
MLOC_72837 Chaperone protein dnaJ 10 C8_24h 1,09995 43,5214 5,30621 electron carrier activity, ron ion binding,
heat shock protein binding, iron-sulfur
cluster binding, unfolded protein binding,
protein folding
AK250230.1 Multidrug resistance protein MdtG C8_24h 0 8,43683 Inf NA
MLOC_58789 Glutaredoxin family protein
LENGTH=102
C8_24h 0 9,69545 Inf electron carrier activity
MLOC_61106 Glutathione S-transferase family protein
LENGTH=227
C8_24h 4,01777 0 -Inf protein binding
accession description condition control treatment log2.fold_change GO-term annotation
APPENDIX
135
number
MLOC_56052 Chlorophyll a-b binding protein,
chloroplastic
C12_6h 141,873 18,7915 -2,91644 NA
MLOC_56051 Chlorophyll a-b binding protein,
chloroplastic
C12_6h 235,46 53,9423 -2,12599 NA
MLOC_945 Chlorophyll a-b binding protein,
chloroplastic
C12_6h 404,872 94,9755 -2,09184 NA
AK248556.1 Chlorophyll a-b binding protein,
chloroplastic
C12_6h 189,309 47,2229 -2,00319 NA
MLOC_50454 Plant protein 1589 of unknown function
LENGTH=91
C12_6h 130,329 35,6223 -1,8713 NA
AK358343 xyloglucan
endotransglucosylase/hydrolase 25
LENGTH=284
C12_6h 71,8708 20,3505 -1,82034 cellular glucan metabolic process, cell
wall, xyloglucan:xyloglucosyl transferase
activity, apoplast, hydrolase activity,
hydrolyzing O-glycosyl compounds
MLOC_64900 phenylalanine ammonia-lyase 2
LENGTH=717
C12_6h 92,3247 28,1783 -1,71213 ammonia-lyase activity
MLOC_72837 Chaperone protein dnaJ 10 C12_6h 35,0906 117,244 1,74036 electron carrier activity, iron ion binding,
heat shock protein binding, iron-sulfur
cluster binding, unfolded protein binding,
protein folding
AK363449 Cysteine-rich receptor-like protein kinase
25
C12_6h 44,5046 153,894 1,78991 NA
MLOC_80270 Transmembrane 9 superfamily member C12_6h 13,7616 54,8523 1,9949 integral component of membrane
APPENDIX
136
4
MLOC_55399 Major facilitator superfamily protein
LENGTH=584
C12_6h 3,58547 15,4584 2,10816 NA
AK373131 Wound-induced protein C12_6h 28,6528 127,151 2,1498 defense response to bacterium, defense
response to fungus
AK252669.1 Peroxidase superfamily protein
LENGTH=358
C12_6h 53,4367 237,139 2,14983 NA
MLOC_34316 RING finger protein 141 C12_6h 7,99054 35,6976 2,15946 NA
MLOC_73077 Glucan endo-1,3-beta-glucosidase GI C12_6h 16,5469 79,8891 2,27144 hydrolase activity, hydrolyzing O-glycosyl
compounds
AK252775.1 RNA-binding protein 1 LENGTH=360 C12_6h 122,093 615,424 2,3336 NA
MLOC_21661 protein n=2 Tax=Oryza sativa
RepID=Q9LGB3_ORYSJ
C12_6h 8,66153 44,4495 2,35947 NA
MLOC_67894 Aquaporin-like superfamily protein
LENGTH=268
C12_6h 4,34347 22,5322 2,37507 transport
AK373816 phosphoglucosamine mutase family
protein LENGTH=614
C12_6h 13,3887 70,8281 2,4033 intramolecular transferase activity,
phosphotransferases
AK364878 glutathione synthetase 2 LENGTH=539 C12_6h 14,2242 75,4005 2,40623 glutathione biosynthetic process
AK373483 alpha/beta-Hydrolases superfamily
protein LENGTH=518
C12_6h 6,84429 36,864 2,42924 lipid metabolic process
MLOC_52167 NifU-like protein 1, chloroplastic C12_6h 12,2132 66,5684 2,44639 iron-sulfur cluster assembly
MLOC_62596 response regulator 2 LENGTH=664 C12_6h 10,5188 58,7582 2,48182 protein binding, regulation of transcription,
DNA-templated
APPENDIX
137
AK366982 Uridylate kinase C12_6h 13,3104 75,0377 2,49506 cellular amino acid biosynthetic process
AK251990.1 Cysteine-rich venom protein C12_6h 18,3765 105,811 2,52556 NA
MLOC_19305 O-methyltransferase family protein
LENGTH=382
C12_6h 3,21888 18,6054 2,53109 methyltransferase activity
MLOC_14761 tubby like protein 10 LENGTH=445 C12_6h 10,2421 59,2225 2,53164 protein binding
MLOC_55663 Peroxidase superfamily protein
LENGTH=324
C12_6h 8,39843 50,7819 2,59612 response to oxidative stress, peroxidase
activity, oxidation-reduction process
AK371210 basic helix-loop-helix (bHLH) DNA-
binding superfamily protein
LENGTH=253
C12_6h 28,5435 173,377 2,60268 regulation of transcription, DNA-templated
MLOC_69781 lipoxygenase 2 LENGTH=896 C12_6h 1,94921 12,229 2,64935 oxidation-reduction process
MLOC_68184 Chitinase family protein LENGTH=280 C12_6h 8,35333 55,4279 2,73019 chitinase activity, chitin catabolic process,
cell wall macromolecule catabolic process
MLOC_14502 Transmembrane amino acid transporter
family protein LENGTH=413
C12_6h 2,47784 17,9605 2,85767 NA
AK369291 Alpha-aminoadipic semialdehyde
synthase
C12_6h 9,43225 71,6902 2,9261 oxidation-reduction process
MLOC_12452 RNA polymerase sigma-C factor C12_6h 4,68931 37,6659 3,00581 sigma factor activity, DNA-templated
transcription, initiation
AK251203.1 Acid phosphatase 1 C12_6h 59,3647 478,632 3,01124 NA
MLOC_14775 Alpha-glucan water dikinase,
chloroplastic
C12_6h 14,8168 130,381 3,13742 NA
MLOC_80476 Unknown protein C12_6h 18,387 168,493 3,19593 NA
APPENDIX
138
AK358648 Chaperone protein DnaJ C12_6h 5,34957 51,4066 3,26446 heat shock protein binding, unfolded
protein binding, protein folding
AK250430.1 GDSL esterase/lipase C12_6h 1,84204 18,7812 3,34991 NA
MLOC_52387 response regulator 1 LENGTH=690 C12_6h 3,53198 43,8672 3,63459 regulation of transcription, DNA-templated
AK252983.1 thionin 2.1 LENGTH=134 C12_6h 522,637 6800,22 3,7017 NA
AK249533.1 thionin 2.1 LENGTH=134 C12_6h 37,6826 501,632 3,73466 NA
AK364659 Subtilisin-chymotrypsin inhibitor CI-1C C12_6h 61,1758 855,112 3,80508 serine-type endopeptidase inhibitor
activity, response to wounding
AK251179.1 Jasmonate induced protein n=1
Tax=Hordeum vulgare
RepID=Q43490_HORVU
C12_6h 16,993 242,86 3,83712 NA
AK359149 thionin 2.1 LENGTH=134 C12_6h 39,5948 573,998 3,85766 defense response
AK251911.1 thionin 2.1 LENGTH=134 C12_6h 138,669 2091,09 3,91454 NA
MLOC_53725 Kelch repeat-containing F-box family
protein LENGTH=478
C12_6h 2,26457 34,4078 3,92542 protein binding
MLOC_61919 Zinc finger protein CONSTANS-LIKE 9 C12_6h 8,32517 137,745 4,04837 protein binding
MLOC_71237 Aquaporin-like superfamily protein
LENGTH=268
C12_6h 21,9267 624,696 4,83239 transport
MLOC_2643 Subtilisin-chymotrypsin inhibitor-2A C12_6h 20,8984 951,278 5,5084 serine-type endopeptidase inhibitor
activity, response to wounding
AK356806 Chaperone protein DnaJ C12_6h 10,2266 615,667 5,91175 iron-sulfur cluster binding, heat shock
protein binding, unfolded protein binding,
protein folding
APPENDIX
139
MLOC_7958 Tetratricopeptide repeat (TPR)-like
superfamily protein LENGTH=552
C12_6h 0,911694 56,4432 5,95211 NA
MLOC_57259 pumilio 7 LENGTH=650 C12_6h 1,43448 142,654 6,63586 RNA binding
AK252675.1 thionin 2.2 LENGTH=134 C12_6h 7,10962 870,249 6,93551 NA
AK250631.1 Cytochrome P450 superfamily protein
LENGTH=513
C12_6h 0 1,22421 Inf NA
AK367303 D-arabinono-1,4-lactone oxidase family
protein LENGTH=591
C12_6h 0 9,83958 Inf oxidoreductase activity, acting on CH-OH
group of donors, oxidation-reduction
process
AK370024 60S ribosomal protein L35a-1 C12_6h 0 8,36186 Inf intracellular, ribosome
AK370779 Cytochrome P450 superfamily protein
LENGTH=513
C12_6h 0 5,92908 Inf oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, oxidation-reduction
process
MLOC_15569 C2H2-type zinc finger family protein
LENGTH=286
C12_6h 0 1,30673 Inf NA
MLOC_3110 Chalcone synthase 2 C12_6h 0 5,43563 Inf biosynthetic process
MLOC_39668 Bowman-Birk type trypsin inhibitor C12_6h 0 2,47033 Inf serine-type endopeptidase inhibitor
activity
MLOC_51393 Bifunctional pinoresinol-lariciresinol
reductase
C12_6h 0 5,71071 Inf NA
MLOC_70921 Late embryogenesis abundant (LEA)
hydroxyproline-rich glycoprotein family
LENGTH=239
C12_6h 0 2,66868 Inf NA
APPENDIX
140
MLOC_74460 Dehydration-responsive element-binding
protein 1H
C12_6h 0 3,3482 Inf regulation of transcription, DNA-templated
accession
number
description condition control treatment log2.fold_change GO-term annotation
AK374555 Non-specific lipid-transfer protein 3 C12_12h 227,532 2,42742 -6,5505 lipid binding; lipid transport
AK251031.1 proline-rich protein 4 LENGTH=448 C12_12h 211,574 4,71794 -5,48686 NA
MLOC_75012 proline-rich protein 4 LENGTH=448 C12_12h 87,3523 3,11273 -4,81059 NA
MLOC_70041 protein n=3 Tax=Oryza
RepID=Q5Z8C7_ORYSJ
C12_12h 33,2427 1,28675 -4,69123 NA
MLOC_58861 GDSL esterase/lipase C12_12h 39,5805 1,81803 -4,44434 hydrolase activity, acting on ester bonds
MLOC_18499 Xyloglucan
endotransglucosylase/hydrolase family
protein LENGTH=284
C12_12h 31,386 1,881 -4,06055 cellular glucan metabolic process; cell
wall; xyloglucan:xyloglucosyl transferase
activity; hydrolase activity, hydrolyzing O-
glycosyl compounds
MLOC_74627 Cathepsin B-like cysteine proteinase 5 C12_12h 181,34 11,4249 -3,98845 cysteine-type peptidase activity
AK355398 14 kDa proline-rich protein DC2.15 n=1
Tax=Triticum urartu
RepID=M8A2I4_TRIUA
C12_12h 294,112 21,9265 -3,74562 NA
MLOC_62475 beta-D-xylosidase 4 LENGTH=784 C12_12h 13,1593 1,10654 -3,57196 hydrolase activity, hydrolyzing O-glycosyl
compounds
MLOC_6767 laccase 7 LENGTH=567 C12_12h 23,2544 2,21883 -3,38964 copper ion binding, oxidoreductase
activity, oxidation-reduction process
APPENDIX
141
MLOC_65042 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1045
C12_12h 103,856 10,8105 -3,26407 protein binding
AK251940.1 Meiosis 5 n=2 Tax=Zea mays
RepID=B4FTV4_MAIZE
C12_12h 602,057 64,0961 -3,23159 NA
AK367001 protein n=3 Tax=Oryza
RepID=Q5Z8C7_ORYSJ
C12_12h 53,6105 6,27706 -3,09435 NA
MLOC_59726 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1124
C12_12h 86,5817 10,1531 -3,09214 NA
MLOC_62487 ABC transporter G family member 32 C12_12h 15,9892 1,93956 -3,0433 membrane; ATPase activity; ATP binding
AK376331 Non-symbiotic hemoglobin C12_12h 142,608 17,6826 -3,01166 heme binding; iron ion binding
MLOC_7690 HXXXD-type acyl-transferase family
protein LENGTH=484
C12_12h 27,9353 3,47756 -3,00594 transferase activity, transferring acyl
groups other than amino-acyl groups
AK362240 UDP-glucose 4-epimerase 3 C12_12h 57,9414 7,50424 -2,94882 cellular metabolic process
MLOC_12906 Expansin-B4 C12_12h 47,7299 6,82607 -2,80577 NA
MLOC_71895 Vacuolar-processing enzyme C12_12h 206,373 31,0325 -2,7334 proteolysis
MLOC_68318 Enoyl-[acyl-carrier-protein] reductase
[NADH] 1
C12_12h 32,7158 4,98133 -2,71538 NA
MLOC_65114 FASCICLIN-like arabinogalactan-protein
11 LENGTH=246
C12_12h 37,8858 5,9687 -2,66617 NA
AK356806 Chaperone protein DnaJ C12_12h 1108,39 181,543 -2,61008 iron-sulfur cluster binding, heat shock
protein binding, unfolded protein binding,
protein folding
MLOC_18031 Phospholipase A1-II 7 C12_12h 28,5129 5,13359 -2,47358 lipid metabolic process
APPENDIX
142
MLOC_78725 Peroxidase superfamily protein
LENGTH=324
C12_12h 33,9061 6,35521 -2,41553 peroxidase activity, response to oxidative
stress, oxidation-reduction process
AK369291 Alpha-aminoadipic semialdehyde
synthase
C12_12h 195,895 37,3444 -2,39112 oxidation-reduction process
AK358648 Chaperone protein DnaJ C12_12h 93,1491 17,9172 -2,3782 heat shock protein binding; unfolded
protein binding; protein folding
MLOC_12581 Cysteine-rich venom protein C12_12h 61,7911 12,1234 -2,34961 NA
MLOC_19305 O-methyltransferase family protein
LENGTH=382
C12_12h 32,9252 7,08324 -2,21671 methyltransferase activity; protein
dimerization activity
AK250129.1 Alpha-1,4-glucan-protein synthase [UDP-
forming] 1
C12_12h 28,6356 6,30372 -2,18354 NA
MLOC_66827 Long-chain-fatty-acid--CoA ligase 1 C12_12h 14,3699 3,20512 -2,1646 catalytic activity, metabolic process
AK252775.1 RNA-binding protein 1 LENGTH=360 C12_12h 944,913 218,501 -2,11254 NA
MLOC_56250 Xyloglucan
endotransglucosylase/hydrolase family
protein LENGTH=284
C12_12h 299,532 71,4179 -2,06835 cellular glucan metabolic process; cell
wall; xyloglucan:xyloglucosyl transferase
activity; hydrolase activity, hydrolyzing O-
glycosyl compounds
AK369026 Adenine nucleotide alpha hydrolases-like
superfamily protein LENGTH=163
C12_12h 61,0127 16,0701 -1,92473 response to stress
MLOC_56245 Pentatricopeptide repeat-containing
protein
C12_12h 82,9875 22,9217 -1,85618 NA
AK370754 lipoxygenase 2 LENGTH=896 C12_12h 245,95 69,5675 -1,82188 protein binding; oxidation-reduction
process; metal ion binding; linoleate 13S-
lipoxygenase activity
APPENDIX
143
MLOC_81543 Glutathione S-transferase family protein
LENGTH=227
C12_12h 78,3892 22,7513 -1,78471 protein binding
AK375253 Mitochondrial substrate carrier family
protein LENGTH=300
C12_12h 22,8299 70,343 1,62348 NA
AK250130.1 ERD (early-responsive to dehydration
stress) family protein LENGTH=756
C12_12h 9,75132 31,8655 1,70833 NA
MLOC_5705 Cytokinin riboside 5'-monophosphate
phosphoribohydrolase LOG
C12_12h 10,5459 35,4818 1,75039 NA
MLOC_5324 Chalcone--flavonone isomerase C12_12h 62,7967 211,69 1,75319 cellular modified amino acid biosynthetic
process
MLOC_36348 UPI0002B41238 related cluster n=1
Tax=unknown RepID=UPI0002B41238
C12_12h 13,905 48,8685 1,8133 transferase activity, transferring acyl
groups other than amino-acyl groups
AK372562 60 kDa jasmonate-induced protein C12_12h 18,8192 68,2794 1,85924 NA
AK250100.1 phenylalanine ammonia-lyase 2
LENGTH=717
C12_12h 12,7362 46,2739 1,86127 NA
MLOC_65295 REF/SRPP-like protein C12_12h 15,012 55,0999 1,87594 NA
AK355290 Mitochondrial substrate carrier family
protein LENGTH=300
C12_12h 24,3229 90,2863 1,89219 NA
MLOC_36391 MLO-like protein 1 C12_12h 13,9079 52,499 1,91639 cell death; integral component of
membrane
AK248746.1 basic helix-loop-helix (bHLH) DNA-
binding superfamily protein
LENGTH=181
C12_12h 194,256 740,099 1,92976 NA
APPENDIX
144
MLOC_15538 Glycogen synthase C12_12h 5,95092 23,1033 1,95691 biosynthetic process
MLOC_81003 Basic-leucine zipper (bZIP) transcription
factor family protein LENGTH=442
C12_12h 9,22454 37,0251 2,00496 regulation of transcription, DNA-
templated, transcription factor activity,
sequence-specific DNA binding
MLOC_4840 Mannose-binding lectin superfamily
protein LENGTH=176
C12_12h 49,0742 211,31 2,10632 NA
MLOC_13463 cellulose-synthase like D2
LENGTH=1145
C12_12h 8,49285 36,6083 2,10785 membrane; cellulose synthase (UDP-
forming) activity; cellulose biosynthetic
process
MLOC_68705 Protein of unknown function (DUF789)
LENGTH=337
C12_12h 3,94183 17,0759 2,11503 NA
AK357180 FUNCTIONS IN: molecular_function
unknown
C12_12h 13,168 57,854 2,13538 NA
AK355461 dicarboxylate transporter 2.2
LENGTH=549
C12_12h 12,3162 54,7324 2,15184 sodium ion transport, transmembrane
transport, membrane, transporter activity
AK250430.1 GDSL esterase/lipase C12_12h 18,5327 83,5349 2,1723 NA
MLOC_44067 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 17,1861 77,4862 2,1727 NA
MLOC_50454 Plant protein 1589 of unknown function
LENGTH=91
C12_12h 26,0857 117,856 2,17569 NA
MLOC_81109 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 71,5489 344,374 2,26697 NA
MLOC_70817 Ribulose bisphosphate
carboxylase/oxygenase activase B,
C12_12h 191,938 937,437 2,28808 ATP binding
APPENDIX
145
chloroplastic
MLOC_16176 galactinol synthase 1 LENGTH=344 C12_12h 5,80364 28,463 2,29406 transferase activity, transferring glycosyl
groups
AK366393 serine carboxypeptidase-like 19
LENGTH=465
C12_12h 8,87997 45,5592 2,35912 serine-type carboxypeptidase activity
MLOC_51434 Cytochrome P450 superfamily protein
LENGTH=490
C12_12h 5,04754 26,1625 2,37385 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen; oxidation-reduction
process; iron ion binding
MLOC_63089 asparagine synthetase 3 LENGTH=578 C12_12h 47,2019 247,47 2,39034 asparagine biosynthetic process
MLOC_64351 Katanin p60 ATPase-containing subunit
A-like 2
C12_12h 2,00352 10,7711 2,42656 ATP binding
MLOC_58866 Biosynthetic arginine decarboxylase C12_12h 3,80604 20,9764 2,4624 catalytic activity
MLOC_54736 ferric reduction oxidase 7 LENGTH=747 C12_12h 22,5692 126,485 2,48654 oxidation-reduction process; iron ion
binding
MLOC_15203 laccase 7 LENGTH=567 C12_12h 25,3113 142,756 2,4957 oxidation-reduction process
AK371210 basic helix-loop-helix (bHLH) DNA-
binding superfamily protein
LENGTH=253
C12_12h 32,529 189,261 2,54058 regulation of transcription, DNA-templated
MLOC_9995 jasmonate-zim-domain protein 1
LENGTH=253
C12_12h 7,85625 46,6756 2,57076 protein binding
MLOC_68131 Chaperonin-like RbcX protein
LENGTH=203
C12_12h 40,7381 243,002 2,57652 NA
APPENDIX
146
MLOC_71840 laccase 3 LENGTH=570 C12_12h 2,21981 13,3446 2,58775 copper ion binding, oxidation-reduction
process, oxidoreductase activity
AK355062 5'-methylthioadenosine/S-
adenosylhomocysteine nucleosidase
C12_12h 203,281 1259,44 2,63124 catalytic activity, nucleoside metabolic
process
MLOC_66904 Class I glutamine amidotransferase-like
superfamily protein LENGTH=251
C12_12h 4,11454 26,3643 2,67978 NA
MLOC_18470 pentatricopeptide repeat 336
LENGTH=408
C12_12h 5,25998 33,7271 2,68078 NA
MLOC_13613 Fatty acyl-CoA reductase 3 C12_12h 3,62255 24,2344 2,74198 oxidoreductase activity, acting on the
aldehyde or oxo group of donors, NAD or
NADP as acceptor
MLOC_4981 Harpin binding protein 1, putative,
expressed n=6 Tax=Oryza
RepID=Q2R1S1_ORYSJ
C12_12h 7,58258 50,8573 2,74569 chloroplast
MLOC_73237 Erythronate-4-phosphate dehydrogenase
family protein LENGTH=315
C12_12h 2,42833 17,5835 2,85618 NA
MLOC_56052 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 15,4756 112,564 2,86268 NA
AK356734 Expressed protein n=3 Tax=Oryza sativa
subsp. japonica
RepID=Q10KE5_ORYSJ
C12_12h 11,5444 85,6768 2,89171 NA
AK358936 Homeobox-leucine zipper protein family
LENGTH=294
C12_12h 5,62926 46,5764 3,04858 transcription factor activity, sequence-
specific DNA binding; regulation of
transcription, DNA-templated; nucleus;
dann BINDING
APPENDIX
147
MLOC_60221 PI-PLC X domain-containing protein C12_12h 7,12818 59,6918 3,06593 NA
MLOC_15730 photosystem II reaction center PSB28
protein LENGTH=198
C12_12h 21,2126 178,026 3,0691 photosynthesis; photosystem II
MLOC_19593 DOF zinc finger protein 1 LENGTH=194 C12_12h 2,42223 20,4931 3,08073 DNA binding
AK374133 Zinc finger protein CONSTANS-LIKE 3 C12_12h 3,30188 28,5926 3,11428 intracellular; zinc ion binding
MLOC_72290 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 60,1822 521,425 3,11505 NA
MLOC_58758 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 20,8737 182,486 3,12803 NA
MLOC_76914 Protein synthesis inhibitor II C12_12h 4,32972 38,1206 3,13823 negative regulation of translation, rRNA
N-glycosylase activity
MLOC_58632 cytochrome P450, family 79, subfamily
B, polypeptide 3 LENGTH=543
C12_12h 3,99716 43,2658 3,43618 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen; oxidation-reduction
process; iron ion binding
AK248556.1 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 13,9167 159,963 3,52285 NA
AK373368 Zinc finger protein CONSTANS-LIKE 1 C12_12h 5,73733 68,7459 3,58282 intracellular; zinc ion binding
MLOC_13672 protein n=1 Tax=Oryza sativa subsp.
japonica RepID=Q5NAB4_ORYSJ
C12_12h 3,77844 51,2187 3,76081 NA
MLOC_56649 Coiled-coil domain-containing protein 25 C12_12h 2,151 29,5477 3,77997 NA
AK252681.1 ribonuclease 3 LENGTH=222 C12_12h 221,046 3250,44 3,87822 NA
MLOC_10319 purple acid phosphatase 10 C12_12h 35,9964 534,222 3,89151 hydrolase activity
APPENDIX
148
LENGTH=468
MLOC_36648 Regulator of chromosome condensation
(RCC1) family protein LENGTH=488
C12_12h 0,807622 12,7239 3,97772 NA
MLOC_66445 Acid beta-fructofuranosidase C12_12h 9,00958 148,308 4,04099 beta-fructofuranosidase activity
AK250005.1 Ribonuclease T2 family protein
LENGTH=228
C12_12h 129,451 2134,38 4,04334 NA
MLOC_57684 Myb-like protein G C12_12h 1,56846 27,6234 4,13847 NA
AK248909.1 Chlorophyll a-b binding protein,
chloroplastic
C12_12h 13,6337 240,759 4,14234 NA
AK364878 glutathione synthetase 2 LENGTH=539 C12_12h 4,48282 79,4381 4,14735 ATP binding
AK361559 Acid beta-fructofuranosidase C12_12h 12,5363 231,426 4,20637 carbohydrate metabolic process;
hydrolase activity, hydrolyzing O-glycosyl
compounds; beta-fructofuranosidase
activity; sucrose alpha-glucosidase
activity
MLOC_77560 2-oxoglutarate (2OG) and Fe(II)-
dependent oxygenase superfamily
protein LENGTH=371
C12_12h 1,50062 29,3813 4,29127 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, 2-oxoglutarate as one
donor, and incorporation of one atom
each of oxygen into both donors
MLOC_5168 beta-amylase 5 LENGTH=498 C12_12h 13,8886 300,907 4,43735 beta-amylase activity; polysaccharide
catabolic process
MLOC_14118 Homeodomain-like superfamily protein
LENGTH=645
C12_12h 7,55385 176,956 4,55003 NA
APPENDIX
149
MLOC_74019 17.9 kDa class I heat shock protein C12_12h 5,48162 144,348 4,7188 NA
MLOC_25773 60 kDa jasmonate-induced protein n=2
Tax=Hordeum vulgare
RepID=JI60_HORVU
C12_12h 0,982122 33,6273 5,09759 negative regulation of translation; rRNA
N-glycosylase activity
MLOC_66363 Ribonuclease T2 family protein
LENGTH=228
C12_12h 113,46 3885,9 5,09799 RNA binding
MLOC_16719 protein n=4 Tax=Oryza
RepID=Q6L5D8_ORYSJ
C12_12h 2,8303 103,573 5,19354 NA
MLOC_34455 germin-like protein 5 LENGTH=219 C12_12h 3,16376 125,132 5,30566 NA
AK251637.1 zinc induced facilitator-like 1
LENGTH=478
C12_12h 0 6,56296 Inf NA
AK368038 WD repeat-containing protein 86 C12_12h 0 2,71487 Inf protein binding
AK369945 nicotianamine synthase 3 LENGTH=320 C12_12h 0 3,11136 Inf nicotianamine synthase activity
MLOC_51846 Collagen, type IV, alpha 5 n=1 Tax=Zea
mays RepID=B6U4E5_MAIZE
C12_12h 0 1,25275 Inf NA
MLOC_64846 UDP-Glycosyltransferase superfamily
protein LENGTH=461
C12_12h 0 1,46588 Inf transferase activity, transferring hexosyl
groups; metabolic process
MLOC_67622 3-ketoacyl-CoA synthase 6
LENGTH=497
C12_12h 0 1,38141 Inf transferase activity, transferring acyl
groups other than amino-acyl groups
AK250631.1 Cytochrome P450 superfamily protein
LENGTH=513
C12_12h 1,94803 0 -Inf NA
AK252852.1 proline-rich protein 4 LENGTH=448 C12_12h 71,4897 0 -Inf NA
APPENDIX
150
AK357228 3-ketoacyl-CoA synthase 17
LENGTH=487
C12_12h 5,7873 0 -Inf membrane; transferase activity,
transferring acyl groups other than amino-
acyl groups; fatty acid; lipid biosynthetic
process biosynthetic process
AK357559 formin homology 1 LENGTH=1051 C12_12h 1,34472 0 -Inf cellular component organization; actin
binding; actin cytoskeleton organization
AK359070 O-methyltransferase family protein
LENGTH=382
C12_12h 4,27052 0 -Inf methyltransferase activity; protein
dimerization activity; O-methyltransferase
activity
AK366997 Ras-related protein Rab-5A C12_12h 2,10225 0 -Inf GTP binding
AK367518 alpha/beta-Hydrolases superfamily
protein LENGTH=313
C12_12h 1,46951 0 -Inf catalytic activity
AK372651 Polyphenol oxidase, chloroplastic C12_12h 2,19878 0 -Inf oxidoreductase activity
MLOC_1260 Cytochrome P450 superfamily protein
LENGTH=513
C12_12h 4,43372 0 -Inf oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen
MLOC_16268 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=170
C12_12h 4,67967 0 -Inf NA
MLOC_218 LLA-115 n=1 Tax=Lilium longiflorum
RepID=B2BA79_LILLO
C12_12h 54,3755 0 -Inf NA
MLOC_34834 HXXXD-type acyl-transferase family
protein LENGTH=482
C12_12h 2,89074 0 -Inf nutrient reservoir activity
MLOC_39203 bZIP family transcription factor
LENGTH=300
C12_12h 1,49366 0 -Inf regulation of transcription, DNA-templated
APPENDIX
151
MLOC_53180 Peroxidase superfamily protein
LENGTH=324
C12_12h 3,53483 0 -Inf peroxidase activity; response to oxidative
stress; oxidation-reduction process
MLOC_57391 chitinase A LENGTH=302 C12_12h 2,73195 0 -Inf carbohydrate metabolic process
MLOC_57612 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=170
C12_12h 3,1786 0 -Inf NA
MLOC_57751 LLA-115 n=1 Tax=Lilium longiflorum
RepID=B2BA79_LILLO
C12_12h 17,506 0 -Inf NA
MLOC_62887 SAUR-like auxin-responsive protein
family LENGTH=150
C12_12h 2,29851 0 -Inf NA
MLOC_6294 GDSL esterase/lipase C12_12h 21,3048 0 -Inf hydrolase activity, acting on ester bonds
MLOC_70140 early nodulin-like protein 14
LENGTH=182
C12_12h 1,80765 0 -Inf copper ion binding
MLOC_761 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=110
C12_12h 2,65008 0 -Inf NA
MLOC_82071 Bifunctional inhibitor/lipid-transfer
protein/seed storage 2S albumin
superfamily protein LENGTH=200
C12_12h 7,11249 0 -Inf NA
accession
number
description condition control treatment log2.fold_change GO-term annotation
MLOC_67531 Acid beta-fructofuranosidase C12_24h 372,729 37,8295 -3,30054 NA
APPENDIX
152
MLOC_58270 Acid beta-fructofuranosidase C12_24h 48,1413 7,89015 -2,60915 beta-fructofuranosidase activity
MLOC_12009 Boron transporter 4 C12_24h 22,1271 4,24064 -2,38346 integral component of membrane
MLOC_72861 phloem protein 2-A1 LENGTH=246 C12_24h 52,5983 11,9546 -2,13745 NA
MLOC_37626 CDGSH iron-sulfur domain-containing
protein 2
C12_24h 136,652 34,3611 -1,99165 2 iron, 2 sulfur cluster binding
MLOC_38447 Plasma membrane proteolipid 3 C12_24h 128,958 35,9692 -1,84206 integral component of membrane
MLOC_57284 ferredoxin 3 LENGTH=155 C12_24h 97,3225 28,8788 -1,75276 electron carrier activity, iron-sulfur cluster
binding, 2 iron, 2 sulfur cluster binding
MLOC_69295 ferritin 4 LENGTH=259 C12_24h 64,5884 19,6604 -1,71598 cellular iron ion homeostasis, ferric iron
binding
AK356193 Protein of unknown function (DUF506)
LENGTH=287
C12_24h 33,3858 102,795 1,62247 NA
AK363968 zinc finger protein-related
LENGTH=1254
C12_24h 21,7762 73,9964 1,7647 zinc ion binding, protein binding
AK353563 23 kDa jasmonate-induced protein C12_24h 2597,44 9118,71 1,81174 NA
AK250417.1 23 kDa jasmonate-induced protein C12_24h 323,071 1143,81 1,82392 NA
AK353827 SPFH/Band 7/PHB domain-containing
membrane-associated protein family
LENGTH=286
C12_24h 25,4272 91,6756 1,85016 membrane
MLOC_56286 Zinc transporter 7 C12_24h 11,0342 40,7042 1,88319 metal ion transmembrane transporter
activity
MLOC_21848 Peroxidase superfamily protein
LENGTH=324
C12_24h 17,021 65,678 1,9481 peroxidase activity, oxidation-reduction
process, response to oxidative stress
APPENDIX
153
MLOC_74856 Pathogen-related protein C12_24h 20,9678 83,9818 2,0019 NA
AK363401 Sorghum bicolor protein targeted either
to mitochondria or chloroplast proteins
T50848 n=3 Tax=Andropogoneae
RepID=C7IVT7_9POAL
C12_24h 74,7039 314,944 2,07584 NA
AK248484.1 Terpenoid cyclases/Protein
prenyltransferases superfamily protein
LENGTH=785
C12_24h 8,02141 36,244 2,17581 NA
MLOC_73656 Bowman-Birk type trypsin inhibitor C12_24h 11,147 50,5266 2,18038 NA
MLOC_5765 UPI0002C3315F related cluster n=1
Tax=unknown RepID=UPI0002C3315F
C12_24h 12,2569 56,2302 2,19776 NA
AK251422.1 Thaumatin-like protein C12_24h 44,6146 210,719 2,23973 NA
MLOC_56891 Major facilitator superfamily protein
LENGTH=557
C12_24h 20,4971 100,461 2,29314 oligopeptide transport, transporter activity
MLOC_71333 Major facilitator superfamily protein
LENGTH=557
C12_24h 8,32135 40,9399 2,29862 oligopeptide transport
AK364878 glutathione synthetase 2 LENGTH=539 C12_24h 21,6471 111,697 2,36735 ATP binding, glutathione biosynthetic
process
MLOC_71349 Abscisic acid receptor PYR1 C12_24h 7,48555 39,3138 2,39286 NA
MLOC_55380 Histidinol-phosphate aminotransferase C12_24h 12,1825 66,5011 2,44856 pyridoxal phosphate binding, transferase
activity, transferring nitrogenous groups
AK362756 Glucan endo-1,3-beta-glucosidase GV C12_24h 113,417 646,439 2,51087 hydrolase activity, hydrolyzing O-glycosyl
compounds
APPENDIX
154
MLOC_66582 Zinc transporter 5 C12_24h 6,31183 37,0659 2,55396 metal ion transmembrane transporter
activity
MLOC_63089 asparagine synthetase 3 LENGTH=578 C12_24h 8,93787 53,1635 2,57243 asparagine biosynthetic process
MLOC_71125 Protein kinase superfamily protein
LENGTH=842
C12_24h 1,94008 11,7599 2,59969 protein phosphorylation, protein kinase
activity
MLOC_74627 Cathepsin B-like cysteine proteinase 5 C12_24h 13,6757 88,1247 2,68793 cysteine-type peptidase activity
MLOC_62746 Glucan endo-1,3-beta-glucosidase C12_24h 35,4577 229,793 2,69616 hydrolase activity, hydrolyzing O-glycosyl
compounds
AK251338.1 Small nuclear ribonucleoprotein family
protein LENGTH=99
C12_24h 70,6845 469,829 2,73267 NA
MLOC_56398 Cytochrome P450 superfamily protein
LENGTH=490
C12_24h 10,8698 72,8265 2,74413 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, oxidation-reduction
process
MLOC_73077 Glucan endo-1,3-beta-glucosidase GI C12_24h 13,8692 98,3632 2,82624 hydrolase activity, hydrolyzing O-glycosyl
compounds
MLOC_72498 Plant basic secretory protein (BSP)
family protein LENGTH=225
C12_24h 43,6699 325,231 2,89675 NA
MLOC_65311 Chitinase family protein LENGTH=280 C12_24h 66,3404 512,519 2,94965 chitinase activity, chitin catabolic process,
cell wall macromolecule catabolic process
AK251179.1 Jasmonate induced protein n=1
Tax=Hordeum vulgare
RepID=Q43490_HORVU
C12_24h 7,44976 61,1606 3,03734 NA
APPENDIX
155
MLOC_77560 2-oxoglutarate (2OG) and Fe(II)-
dependent oxygenase superfamily
protein LENGTH=371
C12_24h 5,74764 47,4761 3,04616 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, 2-oxoglutarate as one
donor, and incorporation of one atom
each of oxygen into both donors,
oxidoreductase activity, oxidation-
reduction process
MLOC_72157 Leucine-rich repeat receptor-like protein
kinase family protein LENGTH=1045
C12_24h 69,9849 630,306 3,17094 protein binding
MLOC_65218 Prolyl endopeptidase C12_24h 26,1488 242,225 3,21153 serine-type endopeptidase activity
MLOC_70020 Epoxide hydrolase 4 C12_24h 2,22329 23,1434 3,37983 NA
AK365789 basic helix-loop-helix (bHLH) DNA-
binding superfamily protein
LENGTH=240
C12_24h 1,55307 17,3121 3,47859 regulation of transcription, DNA-templated
AK354291 Protein kinase domain containing protein
n=4 Tax=Andropogoneae
RepID=B6SVF3_MAIZE
C12_24h 21,3159 285,969 3,74585 protein kinase activity
AK363912 Cytochrome P450 superfamily protein
LENGTH=513
C12_24h 5,32333 74,5025 3,80689 oxidoreductase activity, acting on paired
donors, with incorporation or reduction of
molecular oxygen, oxidation-reduction
process
MLOC_21661 protein n=2 Tax=Oryza sativa
RepID=Q9LGB3_ORYSJ
C12_24h 2,29373 32,371 3,81893 NA
MLOC_36351 Transcription factor ORG2 C12_24h 24,6698 358,785 3,8623 regulation of transcription, DNA-templated
MLOC_43759 Unknown protein C12_24h 5,51718 89,7821 4,02443 NA
APPENDIX
156
MLOC_80476 Unknown protein C12_24h 6,52573 110,198 4,07782 NA
MLOC_69589 Plant basic secretory protein (BSP)
family protein LENGTH=225
C12_24h 8,73291 198,312 4,50517 NA
MLOC_55663 Peroxidase superfamily protein
LENGTH=324
C12_24h 1,38867 40,1963 4,85529 response to oxidative stress, peroxidase
activity, oxidation-reduction process
AK371210 basic helix-loop-helix (bHLH) DNA-
binding superfamily protein
LENGTH=253
C12_24h 8,17866 245,903 4,91008 regulation of transcription, DNA-
templated, DNA binding
MLOC_51301 F-box protein PP2-B1 C12_24h 1,08775 88,6313 6,3484 NA
MLOC_72837 Chaperone protein dnaJ 10 C12_24h 1,09995 109,624 6,63898 electron carrier activity,iron ion binding,
heat shock protein binding, iron-sulfur
cluster binding, unfolded protein binding,
protein folding
AK248455.1 Major pollen allergen Bet v 1-C C12_24h 0 12,3413 Inf NA
AK249152.1 GDSL esterase/lipase C12_24h 0 1,45131 Inf NA
AK253031.1 Nicotianamine synthase 1 C12_24h 0 9,43919 Inf NA
MLOC_24654 Mannose-binding lectin superfamily
protein LENGTH=176
C12_24h 0 1,56875 Inf NA
MLOC_38723 F-box protein PP2-B1 C12_24h 0 41,2137 Inf NA
MLOC_51393 Bifunctional pinoresinol-lariciresinol
reductase
C12_24h 0 2,16914 Inf NA
APPENDIX
157
MLOC_58789 Glutaredoxin family protein
LENGTH=102
C12_24h 0 7,19755 Inf electron carrier activity
MLOC_68972 germin-like protein 4 LENGTH=220 C12_24h 0 1,39632 Inf nutrient reservoir activity
MLOC_77132 FAD-binding Berberine family protein
LENGTH=532
C12_24h 0 1,88305 Inf oxidoreductase activity, oxidation-
reduction process
MLOC_2685 protein n=1 Tax=Oryza sativa subsp.
japonica RepID=Q7XFZ5_ORYSJ
C12_24h 13,8362 0 -Inf NA
158
Danksagung
An dieser Stelle möchte ich bei all denen bedanken, die zum Gelingen dieser Arbeit
beigetragen haben:
Ein großer Dank geht an Prof. Schröder, der mir ermöglichte an diesem Thema in seiner
Arbeitsgruppe zu forschen. Danke für Deinen wissenschaftlichen Rat, Dein offenes Ohr und
der Möglichkeit zum Auslandsaufenthalt.
Weiterhin möchte ich mich bei meinem Zweitprüfer Prof. Hückelhoven bedanken, für den
Beisitz in meinem Thesis Komitee und hilfreiche Diskussionen. Ich danke auch Prof.
Schnyder, der sich dazu bereit erklärt hat, den Vorsitz meiner Prüfung zu übernehmen.
Ein Dank geht auch nach Spanien an Prof. Poschenrieder und ihr geniales Team für die tolle
Betreuung, die vielen Ideen und Diskussionen. Danke für die unvergessliche Zeit mit vielen
Erlebnissen. Danke an COST Action FA1103 für die Finanzierung des Aufenthaltes.
Vielen Dank an Dr. C. Vlot und Marion Wenig für die Unterstützung im Pathogenassay, der
Beantwortung vieler Fragen und der Diskussion der Ergebnisse. Danke auch an Frau Prof.
Hause für die HPLC-Messungen.
Vielen Dank an alle AMPler, die mir mit Rat und Tat zur Seite standen und die Laborarbeit
einfacher und auch lustiger gestaltet haben. Danke für die witzigen, manchmal auch
tiefgründigen „Kaffee-Erholungspausen“. Ein besonderer Dank geht an Berni für die
anfänglich starke Unterstützung bis sie leider die Gruppe verlassen hat. Danke an Rudi,
Angelo, Marlon und Christopher für die Unterstützung im Labor.
Großer Dank auch an meinen letzten Bürokollegen Andrés, der mir ab der zweiten Hälfte der
Dr. Arbeit mit vielen wissenschaftlichen und nicht-wissenschaftlichen Gesprächen zur Seite
stand und Dank seinem spanischen Temperament und Life style meine „Hochs- und Tiefs“
ertragen hat . Andrés und auch Leo, der ja laut seiner Aussage eigentlich das Büro mit mir
geteilt hat, Ihr habt mir definitiv den Alltag versüßt. Danke auch an Rudi, Mike Rothballer,
Andrea & Angelo, Dany und Viviane für tolle Gespräche und die kraftvolle Unterstützung.
Ein besonderer und herzlicher Dank geht an meine Eltern, die mir immer Mut zugesprochen,
mich unterstützt und aufgemuntert haben, mir viel Kraft und einen klaren Kopf in mancher
verzwickten Situation gegeben haben und einfach da waren. Danke, dass ihr immer an mich
geglaubt habt!
Zuletzt möchte ich meinem Freund Jo danken, der in den letzten Jahren mit viel Geduld und
mit Nach-und Einsicht für mich da war; mir zum richtigen Zeitpunkt den „Kopf gewaschen“
hat und eine große Unterstützung in vielen Dingen war und ist. Du hast den Kampfgeist in
mir verstärkt. Danke dir für alles!
159
Curriculum vitae
Persönliche Daten:
Simone Rankl geboren am 23.02.1987 in Nürnberg
Promotion
06/2012 – 07/2016 Promotion Helmholtz Zentrum München (TUM)
Abteilung Environmental Genomics, unter der Leitung von Prof.
Dr. Schröder, Arbeitsgruppe Plant Endophyte Physiology;
Thema: Interkingdom signaling: The role of homoserine
lactones in early responses and resistance in barley (Hordeum
vulgare L.)
Studium
10/2009 – 05/2012 Master of Science in Biologie (TUM)
Masterarbeit am Lehrstuhl für Phytopathologie (Prof. Dr.
Hückelhoven, TUM); Thema: “Characterization of the barley
LIFEGUARD family in biotic stress responses”
10/2006 – 07/2009 Bachelor of Science in Biologie an der Friedrich–Alexander Universität Erlangen–Nürnberg (FAU)
Bachelorarbeit am Lehrstuhl für Molekulare
Pflanzenphysiologie (Prof. Sauer, FAU); Thema:“The role of U–box proteins and ethylene in the senescence in plants”
Schulausbildung
09/1997 – 06/2006 Abitur, Bertolt-Brecht-Schule Nürnberg
160
Auslandsaufenthalt: Auslandsaufenthalt im Institut für Tierbiologie, Pflanzenbiologie und Ökologie der Universitat Autònoma de Barcelona via COST Action FA1103 und HELENA Graduiertenschule (02/2014 – 04/2014; 10/2014 – 12/2014)
Vortrag: Cellular signaling in Hordeum vulgare L. triggered by AHL treatment; at COST Action FA1103 WG1–4 and FA1206 WG3 Signaling in Endophyte/ Plant System, Warschau, Polen (2014)
Poster Präsentationen: Rankl S., Schröder P. Effects of a plant extract on bacterial growth – a pilot study with Serratia liquefaciens swrI mutant MG44; at COST Action FA1103: Endophytes for plant protection: the state of the art; Berlin, Deutschland (2013) Rankl, S., Bartha, B., Schröder, P. Effects of short chain AHLs and secondary plant metabolites in plant signaling and defense – a pilot study with barley seedlings; at COST Action FA1103: Endophytes in biotechnology and agriculture-endophytes: from discovery to application; Trento, Italien (2012)
Publikationen: Rankl, S., Gunsé, B., Sieper, T., Schmid, C., Poschenrieder, C., Schröder, P. Microbial homoserine lactones (AHLs) are effectors of root morphological changes in barley. Plant Science (2016) 253:130-140. Gunsé, B., Poschenrieder, C., Rankl, S., Schröder, P., Rodrigo-Moreno, A., Barceló, J. A highly versatile and easily configurable system for plant electrophysiology. MethodsX (2016) 25: 436-451. Hasselt, K., Rankl, S., Worsch, S., Burkovski, A. Adaptation of AmtR–controlled gene expression by modulation of AmtR binding activity in Corynebacterium glutamicum. Journal of Biotechnology (2011) 154: 156-162.