Upload
vantram
View
220
Download
0
Embed Size (px)
Citation preview
1
Tools for detection of Mycoplasma amphoriforme; a primary respiratory pathogen? 1
2
3
Clare L. Linga*, Katarina Oravcovab, Thomas F. Beattieb,c, Dean D. Creerd, Paul Dilworthe, Naomi 4
L. Fultonf, Alison Hardief, Michelle Munro,f Marcus Pond,g Kate Templeton,f David Webster,h 5
Sarita Workman,h Timothy D. McHugh,a Stephen H. Gillespie,b# 6
7
Centre for Clinical Microbiology, Department of Infection, Royal Free Campus, University College 8
London, London, UKa; School of Medicine, University of St. Andrews, St Andrews, UKb; Royal 9
Hospital for Sick Children, Edinburgh, UKc; Respiratory Medicine, Barnet General Hospital, 10
London, UKd; University College London Medical School, University College London, London, 11
UKe; Department of Medical Microbiology, Royal Infirmary, Edinburgh, UKf; Centre for Infection 12
and Immunity, St George’s University of London, London, UKg; Department of Immunology, Royal 13
Free London NHS Foundation Trust, London, UKh 14
15
Running Title: Mycoplasma amphoriforme detection 16
17
#Address correspondence to Stephen H. Gillespie, [email protected] 18
*Present address: Clare L. Ling, Shoklo Malaria Research Unit, Mahidol-Oxford Tropical Medicine 19
Research Unit, Faculty of Tropical Medicine, Mahidol University, Mae Sot, Thailand 20
21
22
23
JCM Accepts, published online ahead of print on 29 January 2014J. Clin. Microbiol. doi:10.1128/JCM.03049-13Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
2
ABSTRACT 24
Mycoplasma amphoriforme is a recently described organism isolated from the respiratory tract of 25
patients with immunodeficiency and evidence of chronic infection. Novel assays for the molecular 26
detection of the organism by real-time quantitative PCRs (qPCR) targeting the uracil DNA 27
glycosylase (udg) gene and 23S ribosomal DNA are described. The analytical sensitivities are 28
similar to the existing conventional 16S rDNA M. amphoriforme PCR with the advantage of being 29
species-specific, rapid and quantitative. Using these techniques we demonstrate the presence of this 30
organism in 17 (19.3%) primary antibody deficient (PAD) patients, 4 (5%) adults with lower 31
respiratory tract infection, 1 (2.6%) sputum sample from patients attending a chest clinic, 23 32
(0.21%) samples submitted for viral diagnosis of respiratory infection, but not in normal adult 33
control subjects. These data show the presence of this microorganism in respiratory patients and 34
suggest that M. amphoriforme may infect both immunocompetent and immunocompromised 35
subjects. Further studies to characterise this organism are required and this report provides the tools 36
that may be used by other research groups to investigate its pathogenic potential. 37
38
39
INTRODUCTION 40
Mycoplasma amphoriforme was first isolated in 1999 from a patient with primary antibody 41
deficiency (PAD) with chronic bronchitis. It has also been isolated subsequently from both 42
immunocompromised and immunocompetent patients with respiratory tract infections (RTI) in 43
London, Denmark, France and Tunisia (1-3). Based on 16S rRNA sequencing M. amphoriforme 44
belongs to the same phylogenetic group as other human pathogenic Mycoplasma species, the 45
pneumoniae group (1, 2). The closest species phylogenetically for which there is a whole genome 46
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
3
sequence is Mycoplasma gallisepticum, a bird pathogen. Phenotypic studies have demonstrated that 47
M. amphoriforme has features in common with this group including: gliding motility, a protruding 48
polar tip resembling that of M. gallisepticum and a cytoskeletal structure at its polar tip with 49
homology to that of M. pneumoniae's attachment organelle (1, 4). 50
51
To understand the role that this novel agent plays in human health, better laboratory tools are 52
required. M. amphoriforme is fastidious, requiring specialised media for cultivation and it takes 53
approximately two weeks for colonies to appear on agar. The colonial morphology resembles 54
granular droplets making the detection difficult as they can blend into the sample matrix and be 55
overlooked. This paper reports the development and evaluation of two real-time PCR (qPCR) 56
assays, an assay targeting M. amphoriforme’s uracil DNA glycosylase (udg) gene and an assay 57
targeting the variable region of 23S rDNA (23S) that is unique to M. amphoriforme. The new qPCR 58
assays were compared with a previously reported 16S rDNA assay (16S) (2) and used to test a range 59
of human samples from the UK. 60
61
62
63
MATERIALS AND METHODS 64
65
Patients, samples and ethical approval 66
Clinical samples from two hospitals were used in this study, the Royal Free London NHS 67
Foundation Trust (RFL), Hampstead and the Royal Infirmary of Edinburgh (RIE). The approvals 68
were obtained from the Ethics committee of the RFL Hampstead and from the Lothian Regional 69
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
4
Ethics Committee (08/S11/02/2) to retain information during anonymisation for epidemiological 70
purposes. 71
72
From 19th October 2000 to 6th September 2005 sputum samples were collected from PAD patients 73
attending the dedicated Primary Immunodeficiency Clinic at the RFL. They attended for either a 74
routine appointment or in cases of clinical deterioration. A sputum sample was collected from any 75
patient with a productive cough and sent for microbiological investigation, including Mycoplasma 76
amphoriforme detection. The age range of all the PID patients tested was 18 to 79 with an average 77
age of 44 years. 78
Sputum and/or throat swab samples were collected from adult patients attending the RFL Chest 79
Clinic and from adult patients (≥18 years) with lower respiratory tract infections (LRTI) that were 80
recruited from two general practices with a multi-ethnic patient population of 15 000 from social 81
classes I–V as described previously (5). All LRTI patients were surgery attendees; no recruitment 82
was undertaken out of hours or on home visits. Acute LRTI was defined as a new or worsening 83
cough and at least one other lower respiratory tract symptom for which there was no other 84
explanation, present for 21 days or less (6, 7). Patients were excluded if they had underlying chronic 85
suppurative lung disease (defined as bronchiectasis, lung abscess or empyema), tuberculosis, 86
immunodeficiency, or previous study participation (three weeks). Age, sex, and season matched 87
controls were recruited from general practice patients attending for non-respiratory and non-88
infective illnesses as well as other healthy volunteers with no history of respiratory tract symptoms 89
for two months prior to recruitment using the same exclusion criteria as previously described for 90
patients (5). 91
Anonymised respiratory samples including sputum, nasopharyngeal secretions and throat swabs 92
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
5
collected at hospital and primary care settings in South East Scotland referred to the RIE Specialist 93
Virology Centre (SVC) from adults and children with suspected respiratory infection and submitted 94
for viral diagnosis were tested. The age of the patients ranged from 0-96 years with a mean of 19.91 95
years. The stored data for these samples included age band, partial postcode, any recorded 96
symptoms or clinical information, referral source, month of sample collection, and results of other 97
virological testing of the sample. 98
99 Control organisms 100
The following control organisms were used to test the specificity of the assays: M. amphoriforme 101
NCTC 11740 and Mycoplasma pneumoniae ATCC 5167 (Mycoplasma Experience Ltd. UK); 102
Mycoplasma testudinis NCTC 11701 and Mycoplasma alvi ATCC 29626 (Leahurst, UK); 103
Acholeplasma laidlawii ATCC 23206, Mycoplasma buccale ATCC 23636, Mycoplasma faucium 104
ATCC 25293, Mycoplasma fermentans ATCC 19989, Mycoplasma genitalium ATCC 33530, 105
Mycoplasma hominis ATCC 23114, Mycoplasma orale ATCC 23714, Mycoplasma pirum ATCC 106
25960, Mycoplasma pneumoniae NCTC 10119 and Mycoplasma salivarium ATCC 23064 (Public 107
Health England, UK); Streptococcus pneumoniae ATCC 49619, Klebsiella spp. ATCC 700603, 108
Staphylococcus aureus NCTC 6571, Escherichia coli NCTC 10418, Pseudomonas aeruginosa 109
NCTC 10662, Haemophilus influenza NCTC 11931, Legionella pneumophila NCTC 11192, 110
Neisseria gonorrhoeae NCTC 12700 and Mycobacterium tuberculosis H37Rv ATCC 27294 111
(Department of Microbiology, Royal Free NHS Trust, UK); coagulase-negative Staphylococcus, 112
meticillin resistant Staphylococcus aureus, Moraxella catarrhalis, Neisseria meningitidis, 113
Bordetella pertussis, Streptococcus pyogenes, Acinetobacter spp, Corynebacterium spp, Proteus 114
mirabilis and Candida albicans clinical isolates (Department of Microbiology, Royal Free London 115
NHS Foundation Trust); Pneumocystis jirovecii clinical isolate (Microbiology Department, 116
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
6
Raigmore Hospital, UK); Pneumocystic jirovecii (RIE SVC, Edinburgh); Candida spp. (RIE SVC, 117
Edinburgh); Aspergillus fumigatus (RIE SVC, Edinburgh); Chlamydia pneumoniae SA2f (Clinical 118
Microbiology Department, University College London Hospitals NHS Foundation Trust, UK); and 119
viruses (all from RIE SVC, Edinburgh): influenza A, influenza B, RSV, parainfluenza (PIV1-4), 120
human metapneumovirus, human rhinovirus, human coronavirus (hCoV – 229E, OC43, NL63, 121
HKU1, hEV), measles, mumps and human bocavirus (hBoV – 1-4). 122
123
124 Culture 125
Respiratory samples from patients with PAD were inoculated immediately on Mycoplasma 126
Experience agar (Mycoplasma Experience Ltd, Reigate, UK) and incubated at 36°C in gas jars 127
containing CO2 gas packs (Oxoid, Basingstoke, UK). A small number of cultures that had been 128
stored at 4°C for less than 4 days were included as this has been shown previously not to affect the 129
viability of M. amphoriforme (data not shown). Potential M. amphoriforme colonies were detected 130
microscopically with a 40× magnification and their identity was confirmed by the M. amphoriforme 131
16S PCR and sequencing. Primary cultures contaminated with other microorganisms were re-132
cultured using Sputasol treated samples that had been stored at -20°C. Mycoplasma culture was also 133
performed on 16S PCR positive samples from the RFL Chest Clinic, but was not performed on 134
samples from patients with LRTI in general practice as these had been heat killed prior to storage at 135
–70°C and was not performed on RIE respiratory samples submitted for viral diagnosis. 136
137
Extraction of DNA 138
DNA was extracted from control organisms using the Wizard Genomic DNA extraction kit 139
(Promega, Southampton, UK) following manufacturer’s instructions using the protocol for Gram 140
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
7
negative bacteria. Extraction of DNA from sputum and throat swab samples was performed using a 141
Chelex based extraction method: following centrifugation at 13000 × g for 10 min, resulting pellets 142
were washed three times with sterile phosphate buffered saline (PBS), resuspended with PCR grade 143
water (5× the pellet volume) and vortexed with 10 % Chelex (Sigma, Poole, UK) at a ratio of 1:1. 144
After incubation at 56°C for 30 min followed by 94°C for 5 min the samples were vortexed, cooled 145
on ice and then centrifuged at 13000 × g for 2 min with the resulting supernatants being used for 146
PCR. 147
The DNA from respiratory samples for respiratory virus screening was extracted using the 148
easyMAG (bioMérieux, UK) and eluted into 100 μl volume. All extracts were stored at -20°C until 149
used. 150
151
M. amphoriforme 16S PCR 152
All oligonucleotides used in this study are listed in Table 1. The DNA extracts from all patient 153
groups were tested for the presence of M. amphoriforme by the 16S PCR as previously described 154
(2). The identity of the amplicons from at least the first positive sample from each patient was 155
confirmed by sequencing using standard Sanger sequencing protocols. The sequences were analysed 156
using BioNumerics software version 3.5 (Applied Maths) and aligned using the CLUSTAL W 157
multiple sequence alignment programme (8). The consensus sequences were compared to the 16S 158
rDNA sequence obtained from the preliminary contiguous M. amphoriforme strain A39T whole 159
genome sequence obtained from Wellcome Trust Sanger Institute. 160
161
M. amphoriforme qPCRs 162
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
8
The oligonucleotides for the M. amphoriforme udg (Table 1) quantitative real-time PCR were 163
designed and optimised. The optimised M. amphoriforme qPCR protocol consisted of 5μl template 164
DNA, 1x Invitrogen Platinum® QPCR SuperMix-UDG (Invitrogen, UK), 7 mM MgCl2, 0.3 µM 165
primer MAudgF, 0.9 µM primer MAudgR and 0.25 µM probe MAudgP in a final volume of 25 µl. 166
The reactions were performed in a Rotor-Gene 3000 (Qiagen, UK) with cycling conditions of 95°C 167
for 3 min, followed by 35 cycles of 95°C for 15 s and 58°C for 60 s. Results were analysed with the 168
cycle threshold set at 0.03. The standard curves were constructed in two independent experiments on 169
serial ten-fold dilutions of M. amphoriforme DNA in triplicates. The specificity of the assay was 170
confirmed by the amplification of 1 ng of DNA from control organisms listed above in duplicate. 171
The identity of amplicons was confirmed by Sanger sequencing. 172
The udg qPCR was performed on the DNA extracts from patients with PAD. Samples were tested 173
neat, diluted 1/10 and spiked (4 μl of sample and 1 μl pg/μl M. amphoriforme DNA, to detect 174
sample inhibition). Samples positive for both the neat and ten-fold DNA dilution were considered 175
positive, samples that were only positive for either the neat or the ten-fold dilution were considered 176
equivocal. To avoid bias due to sample storage all samples with discrepant results were retested 177
using the 16S PCR. 178
179
A quantitative real-time PCR assay targeting variable region of 23S rDNA unique for M. 180
amphoriforme was designed and optimised. Aliquots of 2 μl template DNA were amplified in a 20 181
μl reaction, using 1× Sso Fast mix (Bio-Rad, UK) and 200 nM of each primer (Table 1). The PCR 182
reactions were carried out in a RotorGene Q thermocycler (Qiagen, UK) set to thermal cycling 183
programme of 95°C, 2 min; 40 cycles of 95°C, 15 s and 60°C, 1 min, and fluorescence detection at 184
(λexc=470 nm, λem=510 nm); and a final melt curve analysis. The specificity of the assay was tested 185
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
9
in silico and in vitro by amplification of non-M. amphoriforme DNA. The detection and 186
quantification limits of the assay were established on M. amphoriforme NCTC 11740 DNA. To 187
further confirm the specificity of the assays the identity of the amplicons was confirmed by 188
sequencing. 189
The 23S PCR was used for M. amphoriforme identification in RIE respiratory samples for viral 190
screening. The DNA was pooled in groups of ten. The DNA from individual samples from positive 191
pools underwent the same 23S PCR amplification to determine individual results. 192
193
194
RESULTS 195
196
Analytical specificity and sensitivity of M. amphoriforme-specific qPCR assays 197
We designed two novel qPCR assays for the identification of M. amphoriforme. Both assays were 198
screened for the specificity in silico and experimentally tested against the DNA of 35 isolates 199
including Mycoplasma spp. and respiratory pathogens. Both qPCR assays were positive only for M. 200
amphoriforme. PCR products were, however, obtained for A. laidlawi, M. alvi and M. genitalium 201
with the 16S PCR. The limit of quantification was 0.01 – 0.1 pg of M. amphoriforme DNA, 202
equivalent to 9-90 organisms per reaction for the udg PCR and 20.6 [2.8 to 149.2, 95% CI] copies 203
per reaction for the 23S PCR, respectively. 204
205
M. amphoriforme in patients attending Immunodeficiency Clinic 206
M. amphoriforme culture, 16S PCR and the udg qPCR were performed on 281 sputum samples from 207
88 patients with PAD attending the RFL Immunodeficiency Clinic. Of these, culture was performed 208
on 278, 16S PCR on 275 and udg qPCR on 263 samples, respectively. M. amphoriforme was 209
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
10
detected by culture and/or PCR in at least one sample of 17 (19.3%) patients. A positive culture was 210
obtained for 10 patients (37 samples of 278, 13.3%), 16S PCR was positive for 17 patients (70/275, 211
25.5%) and qPCR for 14 patients (64/263, 24.3%). The results are summarized in Table 2. The 212
GenBank accession numbers for M. amphoriforme 16S rDNA from this patient group are 213
HM235425 to HM235439. Multiple samples tested positive for 11 of the 13 patients where multiple 214
samples were received with positivity lasting for between 197 and 1627 days. Estimated bacterial 215
loads were ≥ 106 organisms per ml of sputum in at least one sample for 10 positive patients. Routine 216
microbiology results were available for 70 samples from 15 M. amphoriforme positive patients and 217
for 39 samples from 18 matched negative patients. Known respiratory pathogens including H. 218
influenzae, S. pneumoniae, M. catarrhalis and P. aeruginosa were found in more M. amphoriforme 219
negative sputum samples (59%) compared with M. amphoriforme positive samples (24%). H. 220
influenzae was the most commonly isolated pathogen (18% of all samples), and was found 221
significantly less often in M. amphoriforme positive samples (Fisher’s exact test, p=0.003). 222
223
M. amphoriforme in patients attending Chest Clinic 224
A total of 38 sputum samples from 37 patients attending the RFL Chest Clinic were tested. Of the 225
patients, 17 had a diagnosis of chronic obstructive pulmonary disease, 14 had bronchiectasis and one 226
patient had both conditions. Culture results indicated normal respiratory tract flora in 15, H. 227
influenzae in four cases, four samples with S. aureus and samples with single isolates of 228
Acinetobacter, Pseudomonas and Citrobacter spp. In this group, there was a single sample positive 229
for M. amphoriforme (Table 2); a patient who had been taking clarithromycin for an exacerbation of 230
symptoms and in whom no other significant pathogen was found. The GenBank accession number 231
for the M. amphoriforme 16S sequence from this sample is HM235449. 232
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
11
233
M. amphoriforme in patients with suspected LRTI 234
M. amphoriforme was detected in four (5%) out of 80 patients with LRTI recruited from general 235
practices (1/80 throat swabs, 3/50 sputum samples) by 16S PCR (Table 2). The identity of all PCR 236
positive amplicons was confirmed by sequencing (GenBank accession numbers HM235442 to 237
HM235446). None of the control samples (49 throat swabs from healthy individuals) were positive. 238
All four M. amphoriforme positive samples were samples taken from patients with clinical signs of 239
acute LRTI, including raised pulse rates, respiratory rates and CRP concentration compared with the 240
controls. None had a history of recent travel, alcohol consumption or steroid treatment. Other 241
respiratory organisms were detected in two of the M. amphoriforme positive patients; coronavirus, 242
human rhinovirus, H. influenzae plus Streptococcus pneumoniae in the patient with a positive throat 243
swab and enterovirus in a patient with positive sputum. 244
245
M. amphoriforme in patients with suspected respiratory viral infection 246
The respiratory samples screened for suspected LRTI used in this study were collected between 1st 247
March 2011 and 11th March 2012. Out of 10747 (3496 adults and 7251 children) respiratory samples 248
from 7139 patients (2524 adults and 4615 children), 23 samples from 19 patients (6 adults, 13 249
children) tested positive by M. amphoriforme 23S qPCR (Table 2). The positive samples involved 250
nasopharyngeal secretions (6), nose throat swab (1), throat swabs (8), throat swabs for virology (3), 251
sputum (1) and induced sputum (1), and they originated from Accident and Emergency (12), 252
Intensive Treatment Unit / High Dependency Unit (4), Children’s Ward (4), Infectious Diseases (1), 253
Haematology (1) and Neonatal Unit (1). No other respiratory pathogen was found in 13 samples and 254
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
12
10 samples had viral co-infection as detected by real-time PCR: rhinovirus (4), RSV (3), adenovirus 255
and influenza B (1), human metapneumovirus (hMPV) (1) and parainfluenza virus 2 (1). 256
257
258
DISCUSSION 259
To better understand the epidemiology and pathogenesis of M. amphoriforme infection it is 260
necessary to develop new sensitive and quantitative tools for diagnosis. Due to the fastidious growth 261
of human mycoplasmas, sensitive molecular tools are an essential pre-requisite for their 262
identification in order to diagnose infection in a timely manner so that antimicrobial treatment can 263
be initiated. In this paper we describe two real-time PCR assays, define their specificity and evaluate 264
them in a clinical practice environment. 265
266
Specificity of the qPCR assays 267
The qPCR assays target udg gene and M. amphoriforme-specific region of 23S rDNA. Both qPCRs 268
were specific for M. amphoriforme, being negative for all other tested species. In contrast, the 16S 269
PCR was positive for three mycoplasma related species: A. laidlawii, M. genitalium and M. alvi, 270
respectively. A. laidlawii can be found in the human oropharynx and although M. genitalium is 271
primarily a genitourinary tract pathogen of humans, there have been reports of its detection from 272
respiratory samples (9); they may, therefore represent a risk of false positive results. M. alvi has only 273
been found in cattle and there is no evidence of its presence in humans (10). The high specificity of 274
the real time assays was further confirmed by sequencing of products which showed that all positive 275
samples contained M. amphoriforme specific sequence. 276
277
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
13
The assays are able to detect an estimated single to several copies per reaction and can be used to 278
measure the bacterial load. High sensitivity of the qPCR reactions may be important in defining the 279
pathogenic potential of M. amphoriforme in future studies as has been the case for other organisms 280
such as M. genitalium (11, 12). Moreover, a sensitive detection method will improve detection if 281
sub-optimal samples are used, as it is not yet clear what is the primary niche of M. amphoriforme in 282
the human host. 283
284
M. amphoriforme in samples from patients with immunodeficiency 285
The 16S PCR and qPCR provide more sensitive detection than culture, identifying M. amphoriforme 286
in 17 patients (25.5% positive samples) and 14 patients (24.3% positive samples), respectively, 287
versus 10 culture-positive patients (13.3% positive samples). The qPCR gave an equivocal signal for 288
one sample and was negative for another sample for two patients with only a single sample available 289
for the analysis. However, these samples were positive by the 16S PCR but negative by culture. 290
These results may have arisen through undetected inhibition or loss of DNA during extraction. 291
There was a single sample from one patient positive by the 16S PCR that was not available for the 292
qPCR and showed negative by culture. The high incidence of M. amphoriforme (19.3%) in sputa of 293
PAD patients suggests that it may be an important cause of infection in this patient group. Although 294
it is difficult to assign the clinical significance of M. amphoriforme in this complex group of 295
patients, our data show that M. amphoriforme can infect PAD patients chronically and may 296
contribute to LRTI and the pathogenesis of lung disease. Further research should be conducted to 297
characterise M. amphoriforme pathogenicity in this patient group. 298
299
M. amphoriforme from samples from the Chest Clinic and from patients with LRTI 300
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
14
A single sample from 37 patients attending the Chest Clinic was positive for M. amphoriforme. 301
These patients are known to be susceptible to a wide range of pathogens causing chronic sepsis and 302
further studies in larger groups of patients are required. The detection rate of M. amphoriforme (5%) 303
in patients with acute signs of LRTI recruited from general practices was similar to that of other 304
known respiratory pathogens, including Haemophilus influenzae (6%), coronaviruses (6%) and 305
parainfluenza viruses (4%) (5). Co-infections were a common feature of this patient group (22.5% of 306
patients and 4% of controls) and, therefore, the co-infection of the M. amphoriforme positive sample 307
with other organisms does not exclude its aetiological role in LRTI. It was notable that M. 308
amphoriforme was not detected in control subjects as these samples were exclusively throat swabs. 309
It opens the possibility that this observation is due to the sample type or that M. amphoriforme is a 310
primary respiratory pathogen. However, one throat swab from a patient was M. amphoriforme 311
positive in this study and throat swabs are recommended for the detection of other Mycoplasma spp. 312
(13). In addition, other respiratory pathogens such as S. pneumoniae and viral pathogens were 313
detected using these throat swabs at their expected frequency (5). 314
315
M. amphoriforme in samples from patients with suspected respiratory viral infection 316
The largest group in this study was a one-year collection of 10747 respiratory samples from patients 317
with suspected respiratory infection submitted for virological testing. The infection with M. 318
amphoriforme was found to be uncommon within this group with the incidence of 0.21%. 319
The low incidence is not likely to be caused by pooling as this approach has previously proved 320
successful in the detection of hMPV in clinical samples (14). The study described here is a pilot 321
using sampling protocols and DNA extraction methods that are not yet optimised for this organism. 322
Thus, the low detection rate may be because this is not an optimal sample. Additionally, other 323
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
15
Mycoplasma species have periodicity in their detection rate, for example M. pneumoniae infection 324
increases in prevalence every four to seven years (15, 16) The longest study period reported here 325
was one year, thus, longitudinal studies are now required to elucidate the periodicity of M. 326
amphoriforme infection. In this study, positive results were mostly found in children (68% of the 327
positive patients) but this may reflect the distribution of the samples submitted for testing. An age 328
cross-sectional study is now required. Viral co-infection was present in 10 M. amphoriforme 329
positive samples, all from children. Interestingly, viral infection was not detected in any of the M. 330
amphoriforme positive samples from adult patients. The results from this preliminary study will 331
provide the basis for a larger study in a wide range of samples from patients presenting with 332
symptoms and signs of LRTI. 333
334
The results reported here are important pilot data for M. amphoriforme and the first step in 335
understanding its wider pathogenicity. Taken together these data provide support for the idea that M. 336
amphoriforme may be a primary respiratory pathogen. Despite this, these studies should be repeated 337
by other groups in different countries and we are currently working with partners to perform such 338
work. The importance of this paper is that it provides the methodology to assist other groups in 339
diagnosing M. amphoriforme and it is only by increasing the number of patients identified with this 340
organism that we will be able to determine its pathogenic potential with certainty. 341
342
343
ACKNOWLEDGEMENTS 344
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
16
This work was supported by a Peter Samuel Royal Free Fund Grant; the Primary Immunodeficiency 345
Association, the Special Trustees of the Royal Free London NHS Foundation Trust, Hampstead, and 346
the University of St Andrews Medical School. 347
348
349
Table1 Oligonucleotides used in this study. 350
351
Target Oligonucleotide (5’-3’) Product size (bp)
udg MAudgF TGCGGCCGATAAAACCGAAATAT
92 MAudgR TTTCGAAAAGGGTTTGCTACCAA Probe FAM-TTGTGCTCATCCTTCACCCTTTAGTGTGCA-BHQ1
23S rDNA Forward GGGGTTCAAATAACAAGTC
106 Reverse CGTGATATATGGCTCTTCG
16S rDNA Amph-f: AAGCTAGTAAAGGAAATGTTATT Amph-r: ACTATAGAAATATAGTC
594
352
Table 2 M. amphoriforme positive rates for different patient groups tested by culture, 16S PCR and 353
qPCR. 354
355
Patient Group Culture 16S rDNA PCR qPCR Total Positives
Immunodeficiency Clinic
11.36% (10/88) 19.32% (17/88) 16.09% (14/87)
19.32% (17/88)
Chest Clinic NA 2.70% (1/37) NA 2.70% (1/37)
LRTI patients NA 3.08% (4/80) NA 3.08% (4/80)
Suspected viral LRTI NA NA 0.27% (19/7139)
0.27% (19/7139)
356
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
17
357
REFERENCES 358
359 1. Webster D, Windsor H, Ling C, Windsor D, Pitcher D. 2003. Chronic Bronchitis in 360
Immunocompromised Patients: Association with a Novel Mycoplasma Species. European 361 Journal of Clinical Microbiology & Infectious Diseases 22:530–534. 362
2. Pitcher DG. 2005. Mycoplasma amphoriforme sp. nov., isolated from a patient with chronic 363 bronchopneumonia. INTERNATIONAL JOURNAL OF SYSTEMATIC AND 364 EVOLUTIONARY MICROBIOLOGY 55:2589–2594. 365
3. Pereyre S, Renaudin H, Touati A, Charron A, Peuchant O, Hassen AB, Bébéar C, 366 Bébéar CM. 2009. Detection and susceptibility testing of Mycoplasma amphoriformeisolates 367 from patients with respiratory tract infections. Clinical Microbiology and Infection. 368
4. Hatchel JM. 2006. Ultrastructure and gliding motility of Mycoplasma amphoriforme, a 369 possible human respiratory pathogen. Microbiology (Reading, Engl.) 152:2181–2189. 370
5. Creer DD, Dilworth JP, Gillespie SH, Johnston AR, Johnston SL, Ling C, Patel S, 371 Sanderson G, Wallace PG, McHugh TD. 2006. Aetiological role of viral and bacterial 372 infections in acute adult lower respiratory tract infection (LRTI) in primary care. Thorax 373 61:75–79. 374
6. Woodhead M, Blasi F, Ewig S, Garau J, Huchon G, Ieven M, Ortqvist A, Schaberg T, 375 Torres A, van der Heijden G, Read R, Verheij TJM, Joint Taskforce of the European 376 Respiratory Society and European Society for Clinical Microbiology and Infectious 377 Diseases. 2011. Guidelines for the management of adult lower respiratory tract infections - 378 Summary. Clinical Microbiology and Infection 17:1–24. 379
7. NICE. 2009. Respiratory tract infections – antibiotic prescribing 1–121. 380 8. Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. 381
2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res. 382 31:3497–3500. 383
9. Baseman JB, Dallo SF, Tully JG, Rose DL. 1988. Isolation and characterization of 384 Mycoplasma genitalium strains from the human respiratory tract. Journal of Clinical 385 Microbiology 26:2266–2269. 386
10. Pettersson B, Uhlén M, Johansson KE. 1996. Phylogeny of some mycoplasmas from 387 ruminants based on 16S rRNA sequences and definition of a new cluster within the hominis 388 group. Int. J. Syst. Bacteriol. 46:1093–1098. 389
11. Taylor-Robinson D, Jensen JS. 2011. Mycoplasma genitalium: from Chrysalis to 390 multicolored butterfly. Clinical Microbiology Reviews 24:498–514. 391
12. Edberg A, Jurstrand M, Johansson E, Wikander E, Höög A, Ahlqvist T, Falk L, Jensen 392 JS, Fredlund H. 2008. A comparative study of three different PCR assays for detection of 393 Mycoplasma genitalium in urogenital specimens from men and women. Journal of Medical 394 Microbiology 57:304–309. 395
13. Dorigo-Zetsma JW, Zaat SA, Wertheim-van Dillen PM, Spanjaard L, Rijntjes J, van 396 Waveren G, Jensen JS, Angulo AF, Dankert J. 1999. Comparison of PCR, culture, and 397 serological tests for diagnosis of Mycoplasma pneumoniae respiratory tract infection in 398 children. Journal of Clinical Microbiology 37:14–17. 399
14. Manning A, Russell V, Eastick K, Leadbetter GH, Hallam N, Templeton K, Simmonds 400
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from
18
P. 2006. Epidemiological profile and clinical associations of human bocavirus and other 401 human parvoviruses. J. Infect. Dis. 194:1283–1290. 402
15. Bébéar C, Pereyre S, Bébéar CM. 2006. Principles and Practice of Clinical Bacteriology, 403 pp. 305–315. In Gillespie, SH, Hawkey, PM (eds.), Second Edition. John Wiley & Sons, Ltd, 404 Chichester, UK. 405
16. Jacobs E. 2012. Mycoplasma pneumoniae: now in the focus of clinicians and 406 epidemiologists. Euro Surveill. 17. 407
408
on March 21, 2018 by guest
http://jcm.asm
.org/D
ownloaded from