Vaccinia Virus D4 Mutants Defective in Processive DNA Synthesis

JOURNAL OF VIROLOGY, Dec. 2010, p. 12325–12335 Vol. 84, No. 230022-538X/10/$12.00 doi:10.1128/JVI.01435-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.

Vaccinia Virus D4 Mutants Defective in Processive DNA SynthesisRetain Binding to A20 and DNA�

Abigail M. Druck Shudofsky,1 Janice Elaine Y. Silverman,1†Debasish Chattopadhyay,2 and Robert P. Ricciardi1,3*

Department of Microbiology, School of Dental Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 191041; Center forBiophysical Sciences and Engineering and Department of Medicine, University of Alabama at Birmingham, Birmingham,

Alabama 352942; and Abramson Cancer Center, University of Pennsylvania, Philadelphia, Pennsylvania 191043

Received 9 July 2010/Accepted 10 September 2010

Genome replication is inefficient without processivity factors, which tether DNA polymerases to theirtemplates. The vaccinia virus DNA polymerase E9 requires two viral proteins, A20 and D4, for processive DNAsynthesis, yet the mechanism of how this tricomplex functions is unknown. This study confirms that these threeproteins are necessary and sufficient for processivity, and it focuses on the role of D4, which also functions asa uracil DNA glycosylase (UDG) repair enzyme. A series of D4 mutants was generated to discover which sitesare important for processivity. Three point mutants (K126V, K160V, and R187V) which did not function inprocessive DNA synthesis, though they retained UDG catalytic activity, were identified. The mutants were ableto compete with wild-type D4 in processivity assays and retained binding to both A20 and DNA. The crystalstructure of R187V was resolved and revealed that the local charge distribution around the substituted residueis altered. However, the mutant protein was shown to have no major structural distortions. This suggests thatthe positive charges of residues 126, 160, and 187 are required for D4 to function in processive DNA synthesis.Consistent with this is the ability of the conserved mutant K126R to function in processivity. These mutantsmay help unlock the mechanism by which D4 contributes to processive DNA synthesis.

Poxviruses are large, double-stranded DNA viruses that rep-licate exclusively in the cell cytoplasm in granular structuresknown as virosomes (31). Separated from the host nucleus,they rely on their own encoded gene products for DNA syn-thesis and replication (43). To efficiently synthesize its�200,000-base genome, the poxvirus DNA polymerase mustbe tethered to the DNA template by its processivity factor.DNA processivity factors are proteins that stabilize poly-merases onto their templates for effective genome replication(1, 22). Processivity factors are synthesized by nearly all repli-cating systems, ranging from bacteriophages to eukaryotes, yeteach one is specific to its cognate polymerase. In the presenceof these factors, polymerases are able to incorporate a greatnumber of nucleotides per template binding event; in theirabsence, polymerases detach from their templates too fre-quently to successfully replicate the genome (14, 20). E9, theDNA polymerase of the prototypical poxvirus, vaccinia virus,synthesizes approximately 10 nucleotides before dissociatingfrom the viral DNA template (28). However, it can incorporatethousands of nucleotides when it is associated with its proces-sivity factor (29). This extended strand synthesis, known asprocessivity, is necessary for vaccinia virus to effectively repli-cate its 192-kb genome.

The protein A20 was first reported to be a component of thevaccinia virus processive DNA polymerase (19, 37), yet wewere unable to establish processivity in vitro using only A20and E9. To identify which other proteins were required forprocessivity, we assessed six in vitro-synthesized proteinsknown to be involved in vaccinia virus replication (E9, A20, B1,D4, D5, and H5). We found that the protein D4, a uracil DNAglycosylase (UDG), was required in addition to A20 and E9and that these three proteins are both necessary and sufficientfor vaccinia virus processivity. Indeed, A20 and D4 have beenshown to interact with each other (15, 26), and our findingsupports a report identifying A20 and D4 as forming a het-erodimeric processivity factor for E9 (41). Here, we use mu-tational analysis to examine the role of D4 in processive DNAsynthesis. We report the finding of three D4 mutants which areunable to function in processivity yet retain their UDG enzy-matic activity and their ability to bind both A20 and DNA.

MATERIALS AND METHODS

Cloning replication genes from vaccinia virus. The A20R, B1R, D4R, D5R,E9L, and H5R genes were individually cloned by PCR from the WR strain of thevaccinia virus DNA genome by using the following primer pairs (IntegratedDNA Technologies): A20R forward (5�-CACCATGACTTCTAGCGCTGATTTAAC-3�) and A20R reverse (5�-TCACTCGAATAATCTTTTTTTGAC-3�),B1R forward (5�-CACCATGAACTTTCAAGGACTTGTGTTAACTG-3�) andB1R reverse (5�-TTAATAATATACACCCTGCATTAATATGTG-3�), D4Rforward (5�-CACCATGAATTCAGTGACTGTATCACACGCGCC-3�) andD4R reverse (5�-TTAATAAATAAACCCTTGAGCCC-3�), D5R forward (5�-CACCATGGATGCGGCTATTAGAGGTAATG-3�) and D5R reverse (5�-TTACGGAGATGAAATATCCTCTATG-3�), E9L forward (5�-CACCATGGACGTTCGATGCATTAATTGG-3�) and E9L reverse (5�-TTATGCTTCGTAAAATGTAGG-3�), and H5R forward (5�-CACCATGGCGTGGTCAATTACAAATAAAGCGG-3�) and H5R reverse (5�-TTACTTCTTACAAGTTTTAACTTTTTTACG-3�).

The products derived from these reactions were gel purified (Qiagen) and then

* Corresponding author. Mailing address: University of Pennsylva-nia, School of Dental Medicine, Department of Microbiology, LevyResearch Building Room 221, 240 South 40th Street, Philadelphia, PA,19104. Phone: (215) 898-3905. Fax: (215) 898-8385. E-mail: [email protected].

† Present address: Liver Diseases Branch, National Institute of Di-abetes and Digestive and Kidney Diseases, National Institutes ofHealth, Bethesda, MD 20892.

� Published ahead of print on 22 September 2010.

12325

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

cloned into pcDNA3.2/V5-DEST Gateway expression vectors (Invitrogen). Allresulting plasmids were sequenced to ensure correct insertion.

In vitro transcription/translation. [35S]Methionine-cysteine-labeled and non-labeled vaccinia virus proteins were expressed in vitro using a TNT T7 coupledreticulocyte lysate system (Promega) from pcDNA3.2/V5-DEST expression vec-tors. Reaction mixtures were incubated at 30°C for 1.5 h. The labeled proteinswere fractionated on sodium dodecyl sulfate (SDS)-10% Bis-Tris polyacrylamidegel using MES buffer (Invitrogen), and the translation products were visualizedby PhosphorImager (Molecular Dynamics).

D4 point mutants were generated utilizing a QuikChange site-directed mu-tagenesis kit (Stratagene) and then expressed in vitro as described above. Theprimer pairs used are listed in Table 1 (Integrated DNA Technologies).

DNA synthesis assay. The plate assay described previously (23, 40) was usedto determine which proteins were required for DNA synthesis. A biotinylatedtemplate with uniformly distributed adenines (5�-biotin-GCACTTATTGCATTCGCTAGTCCACCTTGGATCTCAGGCTATTCGTAGCGAGCTACGCGTACGTTAGCTTCGGTCATCCCGTCAGCGGTCATTCATTGGC-3�) was an-nealed to a 20-mer primer (5�-GCCAATGAATGACCGCTGAC-3�) and thenbound to streptavidin-coated wells (Streptawell; Roche Applied Science) byincubation at 37°C for 1.5 h. After the wells were washed extensively, DNAsynthesis reaction mixtures were added. The 60-�l reaction mixture contained100 mM (NH4)2SO4, 20 mM Tris-HCl (pH 7.5), 5 mM MgCl2, 0.1 mM EDTA,0.5 mM dithiothreitol (DTT), 4% glycerol, 40 �g/ml bovine serum albumin(BSA), 5 �M deoxynucleoside triphosphates (dNTPs), 1 �M digoxigenin-11-2�-

deoxyuridine-5�-triphosphate (DIG-dUTP; Roche Applied Science), and in vitro-expressed proteins. All reaction mixtures were incubated at 37°C for 30 min andthen washed extensively with phosphate-buffered saline (PBS). The wells wereincubated with anti-digoxigenin-peroxidase (anti-DIG-POD) antibody (RocheApplied Sciences) for 1 h at 37°C and then washed again with PBS. The substrate2,2�-azino-bis(3-ethylbenzthiazoline)-sulfonate (ABTS; Roche) was added, andplates were gently rocked to allow color development. DNA synthesis was quan-tified by measuring the absorbance of each reaction at 405 nm, which is propor-tional to the amount of DIG-dUTP incorporated in the DNA. Samples were readwith a microplate reader (Tecan GENios Pro).

Processive DNA synthesis assay. To assess processive DNA synthesis, theprimer described above was annealed to a second template (40) containingadenines only at its distal end (5�-biotin-AGCACTATTGACATTACAGAGTCGCCTTGGCTCTCTGGCTGTTCGTTGCGGGCTCCGCGTGCGTTGGCTTCGGTCGTCCCGTCAGCGGTCATTCATTGGC-3�). The primed templatewas bound to streptavidin-coated wells, and the 50-�l reaction mixtures con-tained 100 mM (NH)2S04, 20 mM Tris-HCl (pH 7.5), 3 mM MgCl2, 0.1 mMEDTA, 0.5 mM DTT, 2% glycerol, 40 �g/ml BSA, 5 �M dATP, 5 �M dCTP, 5�M dGTP, 1 �M DIG-dUTP, and in vitro-expressed proteins. The assay wasconducted and results were obtained as described above.

Processivity interference assay. The conditions of the processive DNA syn-thesis assay described above were followed in this assay that included bothwild-type (wt) and mutant D4 in a single reaction. In each reaction, the amountsof A20 and E9 were kept constant. wt D4 was kept constant while increasing

TABLE 1. Primers for construction of mutants

Mutant Primera

D68N.............................................................................F, 5�- GAGTATGTGTGTGCGGTATAAATCCGTATCCGAAAGATGG-3�R, 5�- CCATCTTTCGGATACGGATTTATACCGCACACACATACTC-3�

P71H .............................................................................F, 5�- GGTATAGATCCGTATCACAAAGATGGAACTGGTG-3�R, 5�- CACCAGTTCCATCTTTGTGATACGGATCTATACC-3�

T85A .............................................................................F, 5�- CCGTTCGAATCACCAAATTTTGCAAAAAAATCAATTAAGGAG-3�R, 5�- CTCCTTAATTGATTTTTTTGCAAAATTTGGTGATTCGAACGG-3�

S88A..............................................................................F, 5�- CACCAAATTTTACAAAAAAAGCAATTAAGGAGATAGCTTC-3�R, 5�- GAAGCTATCTCCTTAATTGCTTTTTTTGTAAAATTTGGTG-3�

E91V .............................................................................F, 5�- CCAAATTTTACAAAAAAATCAATTAAGGTGATAGCTTCATCTATATCTAG-3�R, 5�- CTAGATATAGATGAAGCTATCACCTTAATTGATTTTTTTGTAAAATTTGG-3�

SSIS94-97AAIA...........................................................F, 5�- CAATTAAGGAGATAGCTGCAGCTATAGCTAGATTAACCGGAGTAATTG-3�R, 5�- CAATTACTCCGGTTAATCTAGCTATAGCTGCAGCTATCTCCTTAATTG-3�

K126R ...........................................................................F, 5�- CCCTGGAATTATTACTTAAGTTGTAGATTAGGAGAAACAAAAAGTCACG-3�R, 5�- CGTGACTTTTTGTTTCTCCTAATCTACAACTTAAGTAATAATTCCAGGG-3�

K126V ...........................................................................F, 5�- CCCTGGAATTATTACTTAAGTTGTGTATTAGGAGAAACAAAAAGTCACG-3�R, 5�- CGTGACTTTTTGTTTCTCCTAATACACAACTTAAGTAATAATTCCAGGG-3�

L127A ...........................................................................F, 5�- GGAATTATTACTTAAGTTGTAAAGCAGGAGAAACAAAAAGTCACG-3�R, 5�- CGTGACTTTTTGTTTCTCCTGCTTTACAACTTAAGTAATAATTCC-3�

T130A ...........................................................................F, 5�- CTTAAGTTGTAAATTAGGAGAAGCAAAAAGTCACGCGATC-3�R, 5�- GATCGCGTGACTTTTTGCTTCTCCTAATTTACAACTTAAG-3�

K131V ...........................................................................F, 5�- GTTGTAAATTAGGAGAAACAGTAAGTCACGCGATCTAC-3�R, 5�- GTAGATCGCGTGACTTACTGTTTCTCCTAATTTACAAC-3�

S132A............................................................................F, 5�- GTTGTAAATTAGGAGAAACAAAAGCTCACGCGATCTACTGG-3�R, 5�- CCAGTAGATCGCGTGAGCTTTTGTTTCTCCTAATTTACAAC-3�

L158A ...........................................................................F, 5�- CACGTTAGTGTTCTTTATTGTGCGGGTAAAACAGATTTCTCG-3�R, 5�- CGAGAAATCTGTTTTACCCGCACAATAAAGAACACTAACGTG-3�

K160V ...........................................................................F, 5�- GTGTTCTTTATTGTTTGGGTGTAACAGATTTCTCGAATATACG-3�R, 5�- CGTATATTCGAGAAATCTGTTACACCCAAACAATAAAGAACAC-3�

T161A ...........................................................................F, 5�- GTGTTCTTTATTGTTTGGGTAAAGCAGATTTCTCGAATATACG-3�R, 5�- CGTATATTCGAGAAATCTGCTTTACCCAAACAATAAAGAACAC-3�

S164A............................................................................F, 5�- GTTTGGGTAAAACAGATTTCGCGAATATACGGGCCAAG-3�R, 5�- CTTGGCCCGTATATTCGCGAAATCTGTTTTACCCAAAC-3�

S172A............................................................................F, 5�- CGGGCCAAGTTAGAAGCCCCGGTAACTACC-3�R, 5�- GGTAGTTACCGGGGCTTCTAACTTGGCCCG-3�

T175A ...........................................................................F, 5�- GTTAGAATCCCCGGTAGCTACCATAGTCGGAT-3�R, 5�- ATCCGACTATGGTAGCTACCGGGGATTCTAAC-3�

T176A ...........................................................................F, 5�- AGAATCCCCGGTAACTGCCATAGTCGGATATC-3�R, 5�- GATATCCGACTATGGCAGTTACCGGGGATTCT-3�

R187V...........................................................................F, 5�- CCAGCGGCTAGAGACGTCCAATTCGAGAAAG-3�R, 5�- CTTTCTCGAATTGGACGTCTCTAGCCGCTGG-3�

S194A............................................................................F, 5�- CGAGAAAGATAGAGCATTTGAAATTATCAACG-3�R, 5�- CGTTGATAATTTCAAATGCTCTATCTTTCTCG-3�

a F, forward; R, reverse.

12326 DRUCK SHUDOFSKY ET AL. J. VIROL.

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

volumes of mutants were added (wt/mutant ratios of 1:1, 1:2, 1:4, and 1:8). wt andmutant D4 proteins were similarly expressed, as determined by incorporation ofradiolabeled [32P]methionine-cysteine; as such, equivalent volumes reflect com-parable protein levels. Total reticulocyte lysate was held constant in each reac-tion. When excess A20 was present as indicated in Fig. 6, the ratio of wtD4/mutant D4 was 1:4.

M13 DNA synthesis assay. The in vitro M13 DNA synthesis assay was per-formed using a primed M13 template as described previously (41) with modifi-cations. Reaction mixtures (25 �l) containing 10 mM Tris-HCl (pH 7.4), 8 mMMgCl2, 5 mM DTT, 40 mg/ml BSA, 8% glycerol, 0.1 mM EDTA, 20 fmol ofprimed M13mp18 single-stranded DNA, and 750 ng of Escherichia coli single-stranded binding protein were preincubated with in vitro-expressed enzymes and60 �M of dATP, dGTP, and dTTP at 30°C for 3 min. Radiolabeled [32P]dCTP(20 �M) was added, reaction mixtures were incubated for 1 h, and then reactionswere stopped with an equivalent volume of 1% SDS and 40 mM EDTA. Productswere fractionated on a 1.2% agarose gel and visualized by PhosphorImager(Amersham).

DNA glycosylase assay. The DNA glycosylase assay was performed as de-scribed previously (25). A single-stranded 45-base oligonucleotide (5�-AGCTACCATGCCTGCACGAAUTAAGCAATTCGTAATCATGGTCAT-3�) was 5�-end labeled with [�-32P]ATP and purified. Labeled DNA was incubated with invitro-expressed wt or mutant D4, E. coli UDG enzyme (New England BioLabs[NEB]), or Bacillus subtilis UDG inhibitor (UGI; NEB) in buffer containing 1mM EDTA, 1 mM DTT, and 20 mM Tris-HCl (pH 8) for 10 min at 37°C. UDGactivity was stopped at 95°C for 5 min. NaOH (0.1 mM) was added followingglycosylase cleavage to incise the abasic sites, and reaction mixtures were boiledat 95° for 5 min. Reaction products were analyzed by electrophoresis through adenaturing 10% (wt/vol) polyacrylamide gel (7 M urea, 1� Tris-borate-EDTA)and visualized by autoradiography.

Transfection and coimmunoprecipitation. A20 and D4 were cloned intopCMV-3Tag mammalian protein expression vectors with either a three-myc(pCMV-3Tag-2) or a three-flag (pCMV-3Tag-1) (Stratagene) tag using the fol-lowing primer pairs: D4 forward (5�-CGCGGATCCATGAATTCAGTGACTGTATCACACG-3�) and D4 reverse (5�-CCCAAGCTTTTAATAAATAAACCCTTGAGC-3�) and A20 forward (5�-CGCGGATCCATGACTTCTAGCGCTGATTTAAC-3�) and A20 reverse (5�-CCCAAGCTTTCACTCGAATAATCTTTTTTTGACATCG-3�).

Human embryonic kidney 293T cells grown in 100 mM dishes were culturedand maintained in Dulbecco’s modified Eagle’s medium (high glucose) supple-mented with 10% fetal bovine serum and antibiotics. Cells were transfected with10 �g of each plasmid using the calcium phosphate transfection method. At 40to 48 h posttransfection, cells were washed with cold PBS and lysed with cold lysisbuffer (50 mM Tris [pH 7.4], 150 mM NaCl, 1% Triton X-100, protease inhibitor[Roche]). Cell lysates were first incubated with protein G (immunoglobulin G[IgG]) beads (Invitrogen) to eliminate nonspecific binding and then incubatedwith 2 �l of anti-myc (Cell Signaling) or anti-flag (Stratagene) antibody for 1 hat 4°C. The lysate/antibody mixture was then incubated with IgG beads for 2 h at4°C. Beads were washed extensively and then resuspended in LDS sample buffer(Invitrogen) and boiled for 10 min. Samples were fractionated on 12% Bis-Trisgels using MES buffer (Invitrogen) and visualized by Western blotting.

Western blot analysis. Immunoprecipitated materials resolved by SDS-PAGEwere transferred to nitrocellulose membranes. The membranes were blocked in5% dried milk in Tris-buffered saline plus 0.1% Tween 20 (TBS-T) and thenincubated with primary antibody (anti-flag or anti-myc) overnight at 4°C. Afterbeing washed again in TBS-T, the membranes were incubated with anti-mouse(Pierce) or anti-rabbit (Bio-Rad) IgG antibodies conjugated to horseradish per-oxidase. After subsequent washing steps, an enhanced chemiluminescence-basedsignal (SuperSignal West Femto maximum sensitivity substrate; Pierce) was usedfor protein detection.

Competitive DNA glycosylase assay. The DNA glycosylase assay describedabove was performed in the presence of competitor DNA to look indirectly atDNA binding. The unlabeled competitor DNA shared the same sequence as thelabeled strand, but contained a cytosine instead of a uracil (5�-AGCTACCATGCCTGCACGAACTAAGCAATTCGTAATCATGGTCAT-3�). Labeled DNAwas kept constant in each reaction, while competitor DNA was included inincreasing concentrations (1:1, 1:5, 1:10, 1:50, 1:100). Labeled and unlabeledDNAs were incubated together at room temperature before the protein and thereaction buffer were added. Both single-stranded DNA (ssDNA) and double-stranded DNA (dsDNA; annealed to its complement, 5�-ATGACCATGATTACGAATTGCTTAGTTCGTGCAGGCATGGTAGCT-3�) were assessed.

Crystal structure analysis of the R187V mutant. Recombinant R187V mutantD4 with an N-terminal His6 tag was purified as described for wt D4 (39). Purifiedprotein was crystallized by the hanging-drop vapor diffusion method using 1.5 M

ammonium sulfate, 14% glycerol, and 0.1 M HEPES buffer (pH 7.5) in thereservoir. Intensity data extending to a resolution of 2.4 Å were collected in-house. The crystal structure was resolved by molecular replacement using thepolyalanine model built from the coordinates for wt D4 (Protein Data Bank[PDB] accession no. 2OWQ) and refined to final R and free R (Rfree) (see Table3) values of 22.1% and 27.3%, respectively. Programs MOLREP (46),REFMAC5 (33), and COOT (11) were used, respectively, in molecular replace-ment, structure refinement, and model building. The program PyMol was used todepict the cartoon and sphere diagrams (6).

Protein structure accession number. Final atomic coordinates and the struc-ture factors have been deposited in the Protein Data Bank (PDB accession no.3NT7).

RESULTS

D4 is required in addition to A20 for vaccinia virus proces-sive DNA synthesis. The protein A20 has been shown to berequired for vaccinia virus replication. Temperature-sensitiveviruses with mutations in A20 are blocked in DNA replication(16) and are defective in processive DNA synthesis (37). Ad-ditionally, A20 chromatographically purified from vaccinia vi-rus-infected cell extract was identified as a component of theprocessive DNA replication complex based on its ability toenable the polymerase E9 to synthesize extended DNA strandsfrom a primed, single-stranded M13 template (19). Moreover,extracts from vaccinia virus-infected cells overexpressing A20and E9 had increased processive polymerase activity (19).However, when A20 and E9 were expressed in vitro, we did notobserve extended DNA synthesis. Significantly, we and otherswere not able to demonstrate any physical interaction betweenthe two proteins (19, 41; data not shown). It is possible thatwhen A20 and E9 were obtained from infected cell lysate, oneor more additional components required for processivity co-purified with the two replication proteins. To address whetherfurther viral products are required for processive DNA syn-thesis, we cloned and expressed singular vaccinia virus repli-cation proteins.

Six genes known to be important for viral replication (8, 32)were cloned directly from the vaccinia virus genome. Theyencode the following proteins: E9, the replicative DNA poly-merase (18, 44); A20, which has a role in processive DNAsynthesis, as described above (19); B1, a serine/threonine pro-tein kinase (2, 24); D4, a uracil DNA glycosylase (30, 42, 45);D5, a DNA-independent dNTPase (12); and H5, a substrate ofB1 associated with the virosomes (3–5, 7, 32). These proteinswere synthesized individually in an in vitro transcription/trans-lation system. The translated A20, B1, D4, D5, E9, and H5products corresponded in size to their known molecularmasses (Fig. 1A).

Five of the in vitro-translated proteins (A20, B1, D4, D5, andH5) were each evaluated for their ability to increase the DNAsynthesis activity of the translated polymerase E9. It should benoted that synthesizing the vaccinia virus proteins in vitro,rather than attempting to purify them from infected cell ex-tracts, precludes the possible inclusion of associated replica-tion proteins that could obfuscate the results. We employed aDNA synthesis assay developed in our laboratory (23, 40)which quantifies the incorporation of DIG-dUTP on a primed100-nucleotide template that contains uniformly distributedadenines. This provides an opportunity to observe minimalincorporation. As shown in Fig. 1B, when the six proteins weretested individually, only E9 was able to incorporate dNTPs, as

VOL. 84, 2010 VACCINIA VIRUS DNA SYNTHESIS PROCESSIVITY FACTOR D4 12327

Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

expected (lane 6). Notably, when A20 and E9 were combined(lane 8), the extent of nucleotide incorporation did not differfrom that of the polymerase alone, supporting our hypothesisthat there is another component required for processive DNAsynthesis. This premise was substantiated when the presence ofall six proteins in the reaction (lane 9) resulted in a �5-foldincrease in DNA synthesis activity compared to results for thepolymerase alone. Importantly, only minimal nucleotide incor-poration occurred in a reaction mixture containing all of thetranslated proteins except A20, confirming the essential role ofthis protein in DNA synthesis (lane 10). Together, these results

suggest that A20 and at least one other viral protein enhancenucleotide incorporation by E9.

We next determined which viral proteins in addition to A20are required by E9 for processive DNA synthesis. For theseexperiments, we performed the DNA synthesis assay utilizing a100-nucleotide template that permits DIG-dUTP to be incor-porated only at the distal end. As E9 alone can synthesize onlyapproximately 10 nucleotides before dissociating from theDNA (27), this system serves as a more stringent measure ofprocessivity, since efficient incorporation of DIG-dUTP canoccur only when E9 is in the presence of its cognate proces-sivity factors.

To identify replication proteins that are required for proces-sive DNA synthesis, we individually omitted A20, B1, D4, D5,E9, and H5 from DNA synthesis reaction mixtures containingthe five other replication proteins. As seen in Fig. 2A, theelimination of A20 (lane 4) or E9 (lane 8) from the DNAsynthesis reactions prevented increased synthesis, as expected.Withholding B1, D5, or H5 (lane 5, 7, or 9, respectively) had noeffect on DNA synthesis. However, when the protein D4 wasabsent (lane 6), the level of DNA synthesis observed was al-most identical to the level seen when A20 was absent. Thisresult suggested that processive DNA synthesis by the E9 poly-merase requires D4 in addition to A20. Indeed, the triad of E9,A20, and D4 was as effective as all six proteins in stimulatingDNA synthesis (lane 10).

To validate that the DNA synthesis activity observed reflectsprocessive DNA synthesis, the six proteins were used to repli-cate a primed 7,249-nucleotide M13 DNA template in a rig-orous assay in which the newly synthesized reaction productsare visualized on a gel. Synthesis of this extended templaterequires processivity. As shown in Fig. 2B, when all six proteins(A20, B1, D4, D5, E9, and H5) were combined, full-lengthproduct was synthesized (lane 4). This result is in accord withthe results of the processive DNA synthesis plate assay de-scribed above (Fig. 2A) and is the first demonstration thatprocessivity can be achieved with in vitro-translated vacciniavirus proteins. In contrast, when E9 and A20 were the onlyproteins present, no extended DNA product was observed(Fig. 2B, lane 3). Omission of B1, D5, or H5 did not affect theproduction of full-length synthesis product (lane 5, 6, or 10,respectively). However, processive DNA synthesis failed tooccur if A20, D4, or E9 was omitted (lane 7, 8, or 9, respec-tively). Furthermore, extended DNA products were visiblewhen only D4 was added to the necessary proteins A20 and E9(lane 11). These results confirm that A20 and D4 are bothrequired by E9 for processive DNA synthesis and that thisprotein triad is sufficient for processivity to occur.

Construction of D4 point mutants. Although it was shownpreviously that A20 and D4 interact (15, 26, 41), it remains tobe disclosed how these proteins function in processive DNAsynthesis. While processivity is the sole function assigned toA20 thus far, D4 has an additional role as a uracil DNAglycosylase (UDG), a repair enzyme that recognizes andcleaves uracils that either are misincorporated in DNA or aregenerated by cytosine deamination. Significantly, while D4 iscritical for viral replication, its ability to excise uracil is notessential (9, 30, 41, 42, 45). Consequently, the requirement ofD4 in processive DNA synthesis is separate from its ability torepair DNA.

FIG. 1. Increased E9 DNA synthesis activity requires a componentin addition to A20. (A) In vitro-transcribed/translated [35S]methionine-cysteine labeled proteins were fractionated by SDS-PAGE and visual-ized by PhosphorImager. Asterisks denote the position of each trans-lated product. Molecular masses of the full-length proteins are asfollows: A20, 49 kDa; B1, 34 kDa; D4, 25 kDa; D5, 90 kDa; E9, 116kDa; and H5, 36 kDa. Luciferase (61.5 kDa) is included as a control(cont.). The 42-kDa band present in some lanes is due to backgroundlabeling of the reticulocyte lysate used for transcription (17). (B) Invitro-expressed proteins A20, B1, D4, D5, E9, and H5 were evaluatedfor nucleotide incorporation using the DNA synthesis assay. The pro-teins were assessed either individually or in combinations, as indicated.All 6, all six proteins (A20, B1, D4, D5, E9, and H5); All 6 � A20, allof the translated proteins except A20. Luciferase was included as anegative control (Neg control). DNA synthesis was measured by DIG-dUTP incorporation on a template with uniformly incorporated ad-enines. This is a representative experiment in which reactions wereperformed in triplicate.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

To further examine the essential role of D4 in processivity,we sought to identify residues that are important for DNAsynthesis. We generated 21 point mutants throughout thelength of the D4 coding region (Table 2). Most of these mu-tations neutralized the charge of positive residues, while one(P71H) substituted a residue that is present in other UDGs.Additionally, a mutation was introduced in the UDG catalyticsite (D68N), which is known to eliminate UDG activity (9, 10,41). The D4 mutants were expressed in the in vitro transcrip-tion/translation system used above.

Identification of D4 point mutants defective in processivity.The D4 mutants were first evaluated using the processive DNAsynthesis assay. A subset of these results that includes keymutants is shown in Fig. 3, and all of the findings are summa-rized in Table 2. Four mutants (K126V, K131V, K160V, andR187V) were substantially impaired in their ability to enableextended DNA synthesis in the presence of E9 and A20 (lanes6, 8, 9, and 11, respectively). In each of these nonfunctionalmutated proteins, neutral amino acids were substituted forpositively charged ones. However, when a conserved aminoacid was substituted for K126 (lane 5), processive DNA syn-

FIG. 2. D4 is required for processive DNA synthesis. (A) The pro-cessive DNA synthesis assay was used to evaluate combinations of fiveof the six in vitro-transcribed/translated proteins (A20, B1, D4, D5, E9,and H5), excluding the one indicated in lanes 4 to 9. DNA synthesiswas measured by DIG-dUTP incorporation on a template with ad-enines incorporated only at the distal end. In vitro-translated luciferasewas used in the DNA synthesis reaction as a negative control (NegControl). Results are shown as a percentage of nucleotide incorpora-tion relative to that of the reaction mixture containing all six proteins.This is a representative experiment in which reactions were performedin triplicate. (B) Different combinations of five of the six in vitro-expressed proteins, A20, B1, D4, D5, E9, and H5, were tested for theirability to synthesize full-length DNA from a primed 7,249-nucleotideM13 template. Labeled DNA products were separated by electro-phoresis on a 1.2% agarose gel and visualized by PhosphorImager. TheM13 lane contains full-length double-stranded M13 DNA, as detectedby CyberGold. In vitro-translated luciferase was used in the DNAsynthesis reaction as a negative control. The arrow indicates the full-length double-stranded M13 product; the asterisk indicates joint mol-ecule formation (47–49).

TABLE 2. Enzymatic activity of D4 mutants

Mutant Processiveactivity UDG activity

D68N Yes NoP71H Yes YesT85A Yes YesS88A Yes YesE91V Yes YesSSIS94-97AAIA Yes YesK126R Yes YesK126V No YesL127A Yes YesT130A Yes YesK131V No NoS132A Yes YesL158A Yes YesK160V No YesT161A Yes YesS164A Yes YesS172A Yes YesT175A Yes YesT176A Yes YesR187V No YesS194A Yes Yes

FIG. 3. Identification of D4 mutants that are defective in proces-sive DNA synthesis. The processive DNA synthesis assay was used toevaluate the ability of D4 mutants to function in processivity. All lanescontain A20 and E9 in addition to the protein of interest. The resultsshown are from a subset of mutants, and results were normalized tothat for wt D4. This is a representative experiment in which reactionswere performed in triplicate.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

thesis was not diminished. This indicates that it is the positivecharge on residue 126 that is essential for processivity. Also ofnote is D68N, which retains complete processive activity de-spite the mutation in its UDG catalytic site (lane 3). This resultis in keeping with previous findings that the UDG repair ac-tivity of D4 is not required for viral replication (9, 41).

D4 processivity mutants maintain glycosylase function. Allof the D4 mutants were next examined for UDG catalyticactivity. The proteins were incubated with uracil-containing,end-labeled single-stranded DNA, as single-stranded DNA isthe preferential substrate for D4 (38). When D4 recognizesand excises a uracil, the resulting abasic site in the DNA issusceptible to cleavage with NaOH. The cleaved product isvisualized as the faster-migrating product on a denaturingpolyacrylamide gel.

The key findings are presented in Fig. 4A. Of particularinterest are the four mutants (K126V, K131V, K160V,R187V) that were unable to function in the processive DNAsynthesis assay. Three of these mutants, K126V, K160V, andR187V, retained the ability to excise uracil (lanes 6, 13, and15, respectively), though the cleavage efficiencies of K126V

and R187V were partially diminished compared to that ofwild-type (wt) D4. This result demonstrates a separation offunction between the processive and repair activities of D4.While it has previously been shown that the UDG activity ofD4 is not required for viral replication and processivity (9,41), this is the first report that shows, in contrast, that theprocessivity function of D4 is not required for glycosylaserepair activity. The fourth mutant, K131V, had no UDGactivity (lane 10) and was not pursued further, as it wasuncertain whether the substitution caused a major confor-mational change that rendered the protein wholly nonfunc-tional. As expected, D68N, which is altered in the UDGcatalytic site, was incapable of cleaving uracil (lane 16).

In summary, we have generated three D4 mutants (K126V,K160V, and R187V) that lack processive activity but retainUDG catalytic activity. It is important to note that the expres-sion levels of the three mutant proteins are similar to that ofthe wt, ruling out differential expression as the cause of theirinability to function in processive DNA synthesis (Fig. 4B).These are the first D4 mutants reported that fail in processivitybut retain UDG activity.

FIG. 4. Three D4 processivity mutants retain UDG activity. (A) In vitro-expressed wt and mutant D4 proteins were incubated with end-labeledssDNA containing uracil. Following treatment with NaOH, which cleaves abasic sites, reactions were run on a denaturing gel. Shown are the resultsfrom a subset of mutants. E. coli UDG used either alone or with Bacillus subtilis UDG inhibitor served as a positive or negative control,respectively. Unprogrammed reticulocyte lysate used for in vitro expression was included as a control. (B) In vitro-expressed [35S]methionine-cysteine-labeled wt and mutant D4 proteins were analyzed by electrophoresis and visualized by PhosphorImager. The position of D4 is indicatedby the arrow. It is not known why D4 consistently appears as a doublet.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

D4 processivity mutants interfere with wt D4 in processiveDNA synthesis. We next inquired if the D4 mutants K126V,K160V, and R187V preserved any aspect of the processivitymechanism. We designed a processivity interference assay inwhich we examined whether the mutant proteins could inter-fere with wt D4 in the processive DNA synthesis assay. Asshown in Fig. 5, when a constant amount of wt D4 was incu-bated with increasing amounts of each of the processivity mu-tant D4 proteins (at ratios of 1:1, 1:2, 1:4, and 1:8), nucleotideincorporation decreased relative to incorporation achieved bywt D4 alone. In contrast, the inclusion of conserved-chargemutant K126R, which is functional in processive DNA synthe-sis (Fig. 3, lane 5), did not diminish nucleotide incorporation.Additionally, when wt D4 was incubated with itself in a 1:8ratio (Fig. 5, last lane), nucleotide incorporation remained thesame, confirming that interference is not due to mass effect.The abilities of the mutant proteins K126V, K160V, andR187V to interfere with wt D4 in the processive DNA synthesisassay clearly demonstrate that the mutants retain partial func-tion required for processivity.

D4 processivity mutants retain the ability to bind A20.While there are several possibilities to account for how K126V,K160V, and R187V interfere with wt D4 in processive DNAsynthesis, one strong likelihood is that the mutant proteinssequester A20. It is known that D4 interacts with A20 (15, 26,41) and that both are required for processive DNA synthesis(see above; 41). To test this hypothesis, we performed theprocessivity interference assay using a 1:4 ratio of wt/mutantD4. This time, an excess amount of A20 was included in thereactions at a saturating concentration. As shown in Fig. 6A toC, the addition of excess A20 restored nucleotide incorpora-tion in reaction mixtures containing wt and mutant D4 to levelssimilar to that seen with the wt alone. These results suggestthat the processivity mutants K126V, K160V, and R187V areable to bind A20.

To directly examine the interaction between A20 and the D4mutants, we constructed the tagged expression plasmids myc-

A20 and flag-D4 and evaluated their binding following cotrans-fection into 293T cells. When the transfected cell lysates werecoimmunoprecipitated with anti-myc antibody and probed withanti-flag antibody, similar amounts of wt and mutant D4 pro-teins were observed (Fig. 7A). Conversely, when the lysateswere coimmunoprecipitated with anti-flag antibody andprobed with anti-myc antibody, similar amounts of A20 proteinwere observed (Fig. 7B). The expression levels of wt and mu-tant flag-D4 proteins in the transfected cell lysates were com-parable to each other, as were the expression levels of myc-A20in the cotransfected cells (data not shown). These results con-clusively show that the D4 processivity mutants retain the abil-

FIG. 5. D4 mutants interfere with wt D4 in processivity. Increasingamounts of mutant D4 proteins (K126R, K126V, K160V, R187V) wereintroduced into processive DNA synthesis reactions that contain fixedamounts of E9, A20, and wt D4. The relative amounts of wt D4 tomutant D4 used were 1:1, 1:2, 1:4, and 1:8. The last lane represents areaction mixture containing wt D4/wt D4 at a 1:8 ratio, treated in thesame manner as wt D4/mutant D4. Nucleotide incorporation was nor-malized to reaction mixtures containing only wt D4. Shown is a rep-resentative experiment, and all reactions were performed in triplicate.

FIG. 6. Excess A20 restores processivity when both wt and mutantD4 are present. The processivity interference assay was performed inthe presence of E9 and excess A20 with wt D4, mutant D4 (K126V [A],K160V [B], R187V [C]), or a 1:4 ratio of wt D4/mutant D4. Reactionslabeled “no excess” contain a 1:4 ratio of wt D4/mutant D4, E9, and noexcess A20. Results were normalized to reaction mixtures containingwt D4 and excess A20. Shown is a representative experiment in whichreactions were performed in triplicate.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

ity to bind to A20. Significantly, these findings rule out a failureto interact with A20 as an explanation for why the D4 mutantsare incapable of functioning in processive DNA synthesis.

D4 processivity mutants retain the ability to bind DNA.Since processivity factors associate with the DNA template tofacilitate nucleotide incorporation, we inquired whether theK126V, K160V, and R187V mutations affect the capability ofD4 to bind DNA. In its capacity as a UDG repair enzyme, D4searches the template for uracils that are present due to mis-incorporation or cytosine deamination. UDGs are thought toscan DNA with rapid kinetics by sliding or hopping mecha-nisms that are challenging to capture (13, 36). Indeed, attemptsto observe direct UDG-DNA binding have been unsuccessfulor require catalytically inactive mutants (21, 34, 35). Consistentwith this have been our own unsuccessful attempts to measuredirect D4-DNA binding. We thus employed an indirect ap-proach to compare the capacities of wt D4 and the three D4processivity mutants (K126V, K160V, and R187V) to bindDNA. We assessed the uracil excision activities of wt D4 andeach of the mutants in the presence of excess competitor DNA.Specifically, we first incubated the labeled, substrate-contain-ing DNA with unlabeled double-stranded DNA before addingD4 to the reaction. This allowed us to determine whether thepresence of competitor DNA resulted in a decrease of cleavedproduct. As shown in Fig. 8, wt D4 and each of the threemutants acted similarly, excising less uracil in the presence ofincreasing concentrations of competitor DNA. Similar activitywas observed when single-stranded DNA was used as a com-petitor (data not shown). These results indicate that the D4mutants bind DNA in the same manner as wt D4 and that theirinability to function in processivity is not caused by a deficiencyin DNA interaction.

R187V crystal structure indicates only local charge alter-ation. Given the ability of the processivity mutants to bind A20and DNA, we sought to understand the influence of the mu-tations on the three-dimensional structure of D4. Toward thisend, we determined the crystal structure of the R187V mutantat a 2.4-Å resolution (PDB accession no. 3NT7). Details ofdata collection and refinement statistics are provided in Table 3.

FIG. 7. D4 processivity mutants retain A20 binding ability. (A andB) 293T cells were transfected with flag-D4 (wt or mutants) and myc-A20 or control vectors. Cell extracts were coimmunoprecipitated withanti-myc (A) or anti-flag (B) antibody and analyzed by Western blot-ting using anti-flag (A) or anti-myc (B) antibody. �, anti-.

FIG. 8. D4 processivity mutants retain DNA binding ability. D4 (wt and mutant) was incubated with a fixed amount of labeled uracil-containingssDNA and increasing amounts of unlabeled dsDNA competitor DNA (1:1, 1:5, 1:10, 1:50, 1:100). Following treatment with NaOH, which cleavesabasic sites, reactions were run on a denaturing gel. E. coli UDG alone and in the presence of B. subtilis UDG inhibitor was used as a positive andnegative control, respectively.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

The overall structure of the mutant form proved to be verysimilar to that of wt D4 (PDB accession no. 2OWR) (Fig. 9A).Residue 187 lies on a loop which connects the 9 strand tohelix 9. The side chain of the mutated valine residue points tothe hydrophobic side chains of Y180. The region around themutation is flexible; most molecules in both the trigonal (PDBaccession no. 2OWQ) and orthorhombic (PDB accession no.2OWR) forms of the wt protein structure have partial or com-plete disorder in that area (39). For comparison with R187V,we selected one molecule (D) of the orthorhombic crystalform of wt D4 in which residues 180 to 190 were included inthe final refined model. There are notable differences in thedistribution of the surface charge around the mutated resi-due (compare Fig. 9B and C). Interestingly, both K126 andK160 are also located in surface-exposed loop regions of D4(Fig. 9A). As with R187, replacement of these residues withvaline is expected to alter the distribution of the local sur-face charge but to have little effect on the overall structureof the mutant forms.

DISCUSSION

In this study, we have shown that two vaccinia virus proteins,A20 and D4, are necessary and sufficient to enable the vaccinia

virus DNA polymerase E9 to processively synthesize DNA.This finding is in agreement with that of others (41). However,the mechanism of how these three essential proteins functionin replication has yet to be resolved. To gain greater insightinto vaccinia virus processivity, we sought to disclose the roleof D4, which also functions as a uracil DNA glycosylase

FIG. 9. Crystal structure of R187V reveals alteration only in localsurface charge. (A) Cartoon diagram showing the overall similarity ofthe superimposed crystal structures of wt D4 (light pink; PDB acces-sion no. 2OWR) and the R187V mutant (orange; PDB accession no.3NT7). The conservation of the overall structures is reflected in theroot mean square (r.m.s.) deviation for all C-alpha atoms, being ap-proximately 0.5 Å. Residues 126, 160, and 187 are shown in stickmodel. (B and C) Amino acid residues 180 to 190 are shown as spheresin the structures of wt D4 (B) and the R187V mutant (C). Selectedresidues in the vicinity are labeled to show orientation. Carbon, oxy-gen, and nitrogen atoms are colored white, red, and blue, respectively.

TABLE 3. Data collection and refinement statistics

Parametera Value(s)b

Crystal and intensity dataSpace group ...........................................P3221Unit cell (Å) ..........................................a b 85.195, c 139.439

� 90.0, � 120.0°Vm (Å3/Da) ...........................................2.98Solvent content (%)..............................58.41Resolution range (Å)............................20–2.40 (2.44–2.40)Completeness (%).................................89.9 (93.9)Rsym ........................................................0.052 (0.312)Overall I/�(I) .........................................19.6

RefinementResolution range (Å)............................20–2.40 (2.46–2.40)No. of reflections...................................19,959R value....................................................0.221 (0.290)Free R value...........................................0.273 (0.381)No. of atoms ..........................................3,574No. of water molecules.........................73No. of ligands (glycerol).......................2Estimated coordinate errors

(Luzzati plot) .....................................0.391

Deviations from idealityBond distances (Å) ...............................0.009Bond angles (°)......................................1.2

Ramachandran plotCore � allowed � generously

allowed (%)........................................91.0 � 7.9 � 0.5Outliers (%)...........................................0.5

a Vm (Å3/Da), volume of the unit cell (Å3)/molecular mass (Da). Rsym, hkl��Ihkl � (Ihkl)�� hkl(Ihkl), where (Ihkl) is the mean intensity of symmetry-related observations of a unique reflection. I/�(I), �I�/��(I)� where �I� and��(I)� are the average intensity and average errors in intensity, respectively. Rvalue, �Fobs � Fcal�/¥�Fobs�. The free R value is calculated similarly but uses asubset of 5.2% (1,103) of the reflections, which are set aside as a “test set” for thecalculation of the free R value and are not included in refinement.

b Values for the highest-resolution shell are in parentheses.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

(UDG). We generated three D4 point mutants, K126V,K160V, and R187V, which fail to function in processive DNAsynthesis. All of these mutants retain UDG catalytic activity.This specifically demonstrates that UDG catalytic activity andprocessivity are independent functions of D4, which is in ac-cord with the finding that UDG activity is unnecessary forvaccinia virus replication and processive DNA synthesis (9,41). Notably, K126V, K160V, and R187V are the first mutantsshown to be functional in UDG activity but deficient in pro-cessivity. Most importantly, these D4 processivity mutants re-tain the ability to bind A20 and DNA. While the precise rea-sons for their inability to function in processivity remainunclear, these mutants may provide unique insights into themechanistic role of D4 in processive DNA synthesis.

Though the structure of D4 is known, whether D4 has aclassical processivity clamp configuration and how the proces-sivity complex is assembled remain to be determined (39). D4cannot bind directly to the polymerase E9 (41). Instead, thetwo enzymes interact through the protein A20. One model forthe vaccinia virus processivity complex is that A20 serves as abridge, joining D4 to E9. As both D4 and E9 bind to DNA intheir respective roles as a repair enzyme and a polymerase, itis possible that A20 also stabilizes the two proteins to the DNAto diminish their dissociation from the template. Additionally,it has been suggested that A20 acts as a scaffold for otherreplication proteins (41). Whatever the mechanism, it is ap-parent that the interaction between A20 and D4 is critical forprocessivity, as we have demonstrated that E9 is not processivein the presence of only A20. This is substantiated by the D4mutant G179R, which has a reduced capacity to interact withA20 and is not functional in processivity (41). In contrast, thethree processivity mutants reported in this paper, K126V,K160V, and R187V, all retain intact binding to A20. This wasdemonstrated indirectly, as each mutant was able to competewith wt D4 for A20 in the processive DNA synthesis assay, anddirectly, as each was able to pull down A20.

While the D4 binding site on A20 has been mapped to the 25N-terminal residues (15), the A20 binding site on D4 remainsunknown. Information about the D4 residues required forbinding to A20 is scant, and the discovery of these three pro-cessivity mutants may offer new insight into this interaction.The results from this study indicate that D4 residues K126,K160, and R187 are not singly critical for A20 binding, thoughthey, along with other residues, might contribute to the inter-action. It has been suggested that proper folding of A20 isdependent upon its association with D4 (41). In this sense, it ispossible that, though binding can occur, these D4 mutantscannot facilitate the correct conformation of A20 that is nec-essary for a productive interaction with E9 to enable extendedstrand synthesis.

In addition to their ability to bind A20, these mutants displaya DNA binding capability that is similar to that of wt D4, whichadds to the complexity of the failure of the mutants in proces-sive DNA synthesis. A comparison of the experimentally de-termined crystal structure of the R187V mutant with the re-ported structure of wt D4 reveals no significant change in theoverall structure of the protein. The molecular models ofK126V and K160V (data not shown) similarly reveal a preser-vation of structural integrity. This indicates that structural dis-integration is not responsible for lack of processive function

and may account for the retained ability of the mutants to bindA20 and DNA. This observation is in contrast to that formutant G179R, discussed above, which possesses a reducedcapacity to bind to A20 (41). Its structural model predicts thatthe mutation causes significant structural rearrangement toaccommodate the large, basic arginine residue into a hydro-phobic pocket (39). However, while the global structure of thethree processivity mutants reported here remains intact, theirresidue substitutions alter the charge of the local environment.This finding suggests that the effects of these mutations areexerted through changes in the vicinity of the mutated residue.As such, it is possible that a positive charge is required atpositions 126, 160, and 187 for D4 to function in processiveDNA synthesis. Indeed, this idea is supported by the conservedmutant K126R, which maintains a positive charge and is fullyfunctional in processivity.

In summary, we have demonstrated that three proteins, A20,D4, and E9, are necessary and sufficient for vaccinia virusprocessive DNA synthesis. We have generated three D4 pointmutants (K126V, K160V, and R187V) that do not function inprocessivity yet retain all other known functions of D4—A20binding, DNA binding, and UDG catalytic activity, which is notrequired for processivity. Crystal structure analysis and molec-ular modeling reveal that each mutation alters only localcharge distribution, suggesting that the positive charges atthese residues are significant. These D4 mutants may helpclarify the mechanistic role of D4 in the process of vacciniavirus processive DNA synthesis.

ACKNOWLEDGMENTS

This work was supported by National Institutes of Health grant5UO1-AI 082211 to R.P.R., Middle Atlantic Regional Center of Ex-cellence grant U54-AI 057168 from the National Institute of Allergyand Infectious Diseases to R.P.R., and NIH grant T32 AI055400 toA.M.D.S.

We thank Stuart Isaacs, Gary Cohen, and Roselyn Eisenberg forproviding us with the WR strain of vaccinia virus and Mihai Ciustea forpartially cloning A20 and E9. We thank Yan Yuan for providing thepCMV-3Tag expression plasmids and Lorenzo Gonzalez, Yan Wang,and Norbert Schormann for technical assistance. We thank ChristaHeyward for critical readings of the manuscript.

REFERENCES

1. Baker, T. A., and S. P. Bell. 1998. Polymerases and the replisome: machineswithin machines. Cell 92:295–305.

2. Banham, A. H., and G. L. Smith. 1992. Vaccinia Virus gene B1R encodes a34-kDa serine/threonine protein kinase that localizes in cytoplasmic factoriesand is packaged into virions. Virology 191:803–812.

3. Beaud, G., and R. Beaud. 1997. Preferential virosomal location of under-phosphorylated H5R protein synthesized in vaccinia virus-infected cells.J. Gen. Virol. 78:3297–3302.

4. Beaud, G., R. Beaud, and D. Leader. 1995. Vaccinia virus gene H5R encodesa protein that is phosphorylated by the multisubstrate vaccinia virus B1Rprotein kinase. J. Virol. 69:1819–1826.

5. D’Costa, S. M., T. W. Bainbridge, S. E. Kato, C. Prins, K. Kelley, and R. C.Condit. 2010. Vaccinia H5 is a multifunctional protein involved in viral DNAreplication, postreplicative gene transcription, and virion morphogenesis.Virology 401:49–60.

6. Delano, W. L. 2002. The PyMOL molecular graphics system. DeLano Sci-entific, San Carlos, CA.

7. DeMasi, J., and P. Traktman. 2000. Clustered charge-to-alanine mutagen-esis of the vaccinia virus H5 gene: isolation of a dominant, temperature-sensitive mutant with a profound defect in morphogenesis. J. Virol. 74:2393–2405.

8. De Silva, F., and B. Moss. 2005. Origin-independent plasmid replicationoccurs in vaccinia virus cytoplasmic factories and requires all five knownpoxvirus replication factors. Virol. J. 2:23.

9. De Silva, F. S., and B. Moss. 2003. Vaccinia virus uracil DNA glycosylase has


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

an essential role in DNA synthesis that is independent of its glycosylaseactivity: catalytic site mutations reduce virulence but not virus replication incultured cells. J. Virol. 77:159–166.

10. Ellison, K., W. Peng, and G. McFadden. 1996. Mutations in active-siteresidues of the uracil-DNA glycosylase encoded by vaccinia virus are incom-patible with virus viability. J. Virol. 70:7965–7973.

11. Emsley, P., and K. Cowtan. 2004. COOT: model-building tools for moleculargraphics. Acta Crystallogr. D Biol. Crystallogr. 60:2126–2132.

12. Evans, E., N. Klemperer, R. Ghosh, and P. Traktman. 1995. The vacciniavirus D5 protein, which is required for DNA replication, is a nucleic acid-independent nucleoside triphosphatase. J. Virol. 69:5353–5361.

13. Friedman, J. I., and J. T. Stivers. 2010. Detection of damaged DNA bases byDNA glycosylase enzymes. Biochemistry 49:4957–4967.

14. Hingorani, M. M., and M. O’Donnell. 2000. DNA polymerase structure andmechanisms of action. Curr. Org. Chem. 4:887–913.

15. Ishii, K., and B. Moss. 2002. Mapping interaction sites of the A20R proteincomponent of the vaccinia virus DNA replication complex. Virology 303:232–239.

16. Ishii, K., and B. Moss. 2001. Role of vaccinia virus A20R protein in DNAreplication: construction and characterization of temperature-sensitive mu-tants. J. Virol. 75:1656–1663.

17. Jackson, R. J., and T. Hunt. 1983. Preparation and use of nuclease-treatedrabbit reticulocyte lysates for the translation of eukaryotic messenger RNA.Methods Enzymol. 96:50–74.

18. Jones, E. V., and B. Moss. 1984. Mapping of the vaccinia virus DNA poly-merase gene by marker rescue and cell-free translation of selected RNA.J. Virol. 49:72–77.

19. Klemperer, N., W. McDonald, K. Boyle, B. Unger, and P. Traktman. 2001.The A20R protein is a stoichiometric component of the processive form ofvaccinia virus DNA polymerase. J. Virol. 75:12298–12307.

20. Kornberg, A. 1988. DNA replication. J. Biol. Chem. 263:1–4.21. Krusong, K., E. P. Carpenter, S. R. W. Bellamy, R. Savva, and G. S. Baldwin.

2006. A comparative study of uracil-DNA glycosylases from human andherpes simplex virus type 1. J. Biol. Chem. 281:4983–4992.

22. Kuriyan, J., and M. O’Donnell. 1993. Sliding clamps of DNA polymerases. J.Mol. Biol. 234:915–925.

23. Lin, K., and R. P. Ricciardi. 2000. A rapid plate assay for the screening ofinhibitors against herpesvirus DNA polymerases and processivity factors.J. Virol. Methods 88:219–225.

24. Lin, S., W. Chen, and S. S. Broyles. 1992. The vaccinia virus B1R geneproduct is a serine/threonine protein kinase. J. Virol. 66:2717–2723.

25. Lu, C.-C., H.-T. Huang, J.-T. Wang, G. Slupphaug, T.-K. Li, M.-C. Wu, Y.-C.Chen, C.-P. Lee, and M.-R. Chen. 2007. Characterization of the uracil-DNAglycosylase activity of Epstein-Barr virus BKRF3 and its role in lytic viralDNA replication. J. Virol. 81:1195–1208.

26. McCraith, S., T. Holtzman, B. Moss, and S. Fields. 2000. Genome-wideanalysis of vaccinia virus protein-protein interactions. Proc. Natl. Acad. Sci.U. S. A. 97:4879–4884.

27. McDonald, W., and P. Traktman. 1994. Vaccinia virus DNA polymerase: invitro analysis of parameters affecting processivity. J. Biol. Chem. 269:31190–31197.

28. McDonald, W. F., and Traktman, P. 1994. Overexpression and purificationof the vaccinia virus DNA polymerase. Protein Expr. Purif. 5:409–421.

29. McDonald, W. F., N. Klemperer, and P. Traktman. 1997. Characterization ofa processive form of the vaccinia virus DNA polymerase. Virology 234:168–175.

30. Millns, A. K., M. S. Carpenter, and A. M. DeLange. 1994. The vacciniavirus-encoded uracil DNA glycosylase has an essential role in viral DNAreplication. Virology 198:504–513.

31. Moss, B. 2001. Poxviridae: the viruses and their replication, p. 2849–2883. In

D. M. Knipe, P. M. Howley, D. E. Griffin, R. A. Lamb, M. A. Martin, B.Roizman, and S. E. Straus (ed.), Fields virology, 4th ed. Lippincott, Williams& Wilkins, Philadelphia, PA.

32. Murcia-Nicolas, A., G. Bolbach, J.-C. Blais, and G. Beaud. 1999. Identifica-tion by mass spectroscopy of three major early proteins associated withvirosomes in vaccinia virus-infected cells. Virus Res. 59:1–12.

33. Murshudov, G. N., A. A. Vagin, and E. J. Dodson. 1997. Refinement ofmacromolecular structures by the maximum-likelihood method. Acta Crys-tallogr. D Biol. Crystallogr. 53:240–255.

34. Panayotou, G., T. Brown, T. Barlow, L. H. Pearl, and R. Savva. 1998. Directmeasurement of the substrate preference of uracil-DNA glycosylase. J. Biol.Chem. 273:45–50.

35. Panayotou, G., and L. H. Pearl. 2001. Substrate specificity of DNA repairenzymes: accurate quantification using BIAcore SPR analysis. BIAjournal2001:1.11–1.13.

36. Porecha, R. H., and J. T. Stivers. 2008. Uracil DNA glycosylase uses DNAhopping and short-range sliding to trap extrahelical uracils. Proc. Natl. Acad.Sci. U. S. A. 105:10791–10796.

37. Punjabi, A., K. Boyle, J. DeMasi, O. Grubisha, B. Unger, M. Khanna, and P.Traktman. 2001. Clustered charge-to-alanine mutagenesis of the vacciniavirus A20 gene: temperature-sensitive mutants have a DNA-minus pheno-type and are defective in the production of processive DNA polymeraseactivity. J. Virol. 75:12308–12318.

38. Scaramozzino, N., G. Sanz, J. M. Crance, M. Saparbaev, R. Drillien, J.Laval, B. Kavli, and D. Garin. 2003. Characterisation of the substrate spec-ificity of homogeneous vaccinia virus uracil-DNA glycosylase. Nucleic AcidsRes. 31:4950–4957.

39. Schormann, N., A. Grigorian, A. Samal, R. Krishnan, L. DeLucas, and D.Chattopadhyay. 2007. Crystal structure of vaccinia virus uracil-DNA glyco-sylase reveals dimeric assembly. BMC Struct. Biol. 7:45.

40. Silverman, J. E. Y., M. Ciustea, A. M. Druck Shudofsky, F. Bender, R. H.Shoemaker, and R. P. Ricciardi. 2008. Identification of polymerase andprocessivity inhibitors of vaccinia DNA synthesis using a stepwise screeningapproach. Antiviral Res. 80:114–123.

41. Stanitsa, E. S., L. Arps, and P. Traktman. 2006. Vaccinia virus uracil DNAglycosylase interacts with the A20 protein to form a heterodimeric proces-sivity factor for the viral DNA polymerase. J. Biol. Chem. 281:3439–3451.

42. Stuart, D. T., C. Upton, M. A. Higman, E. G. Niles, and G. McFadden. 1993.A poxvirus-encoded uracil DNA glycosylase is essential for virus viability.J. Virol. 67:2503–2512.

43. Traktman, P. 1996. Poxvirus DNA replication, p. 775–798. In M. L.DePamphilis (ed.), DNA replication in eukaryotic cells. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

44. Traktman, P., P. Sridhar, R. C. Condit, and B. E. Roberts. 1984. Transcrip-tional mapping of the DNA polymerase gene of vaccinia virus. J. Virol.49:125–131.

45. Upton, C., D. Stuart, and G. McFadden. 1993. Identification of a poxvirusgene encoding a uracil DNA glycosylase. Proc. Natl. Acad. Sci. U. S. A.90:4518–4522.

46. Vagin, A., and A. Teplyakov. 1997. MOLREP: an automated program formolecular replacement. J. Appl. Cryst. 30:1022–1025.

47. Willer, D. O., M. J. Mann, W. Zhang, and D. H. Evans. 1999. Vaccinia virusDNA polymerase promotes DNA pairing and strand-transfer reactions. Vi-rology 257:511–523.

48. Willer, D. O., X.-D. Yao, M. J. Mann, and D. H. Evans. 2000. In vitroconcatemer formation catalyzed by vaccinia virus DNA polymerase. Virol-ogy 278:562–569.

49. Zhang, W., and D. H. Evans. 1993. DNA strand exchange catalyzed byproteins from vaccinia virus-infected cells. J. Virol. 67:204–212.


Dow

nloa

ded

from

http

s://j

ourn

als.

asm

.org

/jour

nal/j

vi o

n 16

Feb

ruar

y 20

22 b

y 2a

03:7

380:

510:

4:5d

50:6

9b2:

5f59

:6ab

8.

Documents

Vaccinia Virus D4 Mutants Defective in Processive DNA Synthesis