Salzburger et al. 1
Annotation of expressed sequence tags for the East
African cichlid fish Astatotilapia burtoni and
evolutionary analyses of cichlid ORFs
Walter Salzburger1,2
*, Susan C. P. Renn
3*, Dirk Steinke
1,4*, Ingo Braasch
1,5 , Hans A.
Hofmann6 and Axel Meyer
1¶
1Lehrstuhl für Zoologie und Evolutionsbiologie, Department of Biology, University of
Konstanz, 78467 Konstanz, Germany 2present address: Zoological Institute, University of Basel, 4051, Switzerland
3Department of Biology, Reed College, Portland, Oregon 97202, USA
4present address: Guelph Centre for DNA Barcoding, Biodiversity Institute of Ontario,
University of Guelph, Guelph, Ontario N1G 2W1, Canada 5present address: Physiological Chemistry I, Biozentrum, University of Würzburg, 97074
Würzburg, Germany 6Section of Integrative Biology, University of Texas at Austin, Austin, Texas 78712,
USA
*These authors contributed equally to this work ¶Corresponding author
Email addresses:
SCPR: [email protected]
HAH: [email protected]
Salzburger et al. 2
Abstract
Background
The cichlid fishes in general, and the exceptionally diverse East African haplochromine
cichlids in particular, are famous examples of adaptive radiation and explosive
speciation. Here we report the collection and annotation of more than 12,000 expressed
sequence tags (ESTs) generated from three different cDNA libraries obtained from the
East African haplochromine cichlid species Astatotilapia burtoni and Metriaclima zebra.
Results
We first annotated more than 12,000 newly generated cichlid ESTs using the Gene
Ontology classification system. For evolutionary analyses, we combined these ESTs with
all available sequence data for haplochromine cichlids, which resulted in a total of more
than 45,000 ESTs. The ESTs represent a broad range of molecular functions and
biological processes. We compared the haplochromine ESTs to sequence data from those
available for other fish model systems such as pufferfish (Takifugu rubripes and
Tetraodon nigroviridis), trout, and zebrafish. We characterized genes that show a faster
or slower rate of base substitutions in haplochromine cichlids compared to other fish
species, as this is indicative of a relaxed or reinforced selection regime. Four of these
genes showed the signature of positive selection as revealed by calculating Ka/Ks ratios.
Conclusions
About 22 % of the surveyed ESTs were found to have cichlid specific rate differences
suggesting that these genes might play a role in lineage specific characteristics of
cichlids. We also conclude that the four genes with a Ka/Ks ratio greater than one appear
as good candidate genes for further work on the genetic basis of evolutionary success of
haplochromine cichlid fishes.
Salzburger et al. 3
Background
The exceptionally diverse species flocks of cichlid fishes in the East African Great Lakes
Tanganyika, Malawi and Victoria are prime examples for adaptive radiations and
explosive speciation [1-3]. More than 2,000 cichlid species have evolved in the last few
million years in the rivers and lakes of East Africa [1, 4-6]. Together with an additional
~1,000 species that are found in other parts of Africa, in South and Central America, in
Madagascar, and in India, the family Cichlidae represents one of the most species-rich
families of vertebrates. In addition to their unparalleled species-richness, cichlids are
famous for their ecological, morphological and behavioral diversity [1, 2, 7], for their
propensity for rapid speciation [5], for their capacity for sympatric speciation [8, 9], and
for the formation of parallel characters in independently evolved species flocks [10-12].
For these reasons, the cichlid fishes are an excellent model system to study basic
dynamics of evolution, adaptation and speciation. However, while the phylogenetic
relationships between the main cichlid lineages are largely established and some of the
cichlids’ evolutionary innovations have been identified (see e.g., [1, 2, 4, 7, 14]), little is
known about the genomic and transcriptional basis of the evolutionary success of the
cichlids.
The cichlid model system provides many advantages for evolutionary genomic
research. The hundreds of closely related yet morphologically diverse species in East
Africa’s cichlid species flocks are even more powerful than a ‘mutagenic screen’ (to
which these species assemblages have been compared to [1, 12]) in that they represent
combinations of alleles that confer a selective advantage under various ecological
pressures. Because of the possibility to produce viable crosses between different cichlid
Salzburger et al. 4
species in the lab [15], these alleles can be tied to particular phenotypic traits by means of
classical genetic experiments (see e.g., [16-19]). The close relatedness of the different
species allows the design of primer sets for the amplification of particular genomic DNA
regions such as candidate gene loci, microsatellites, or SNPs, which are applicable to a
wide range of species (see e.g., [18, 20-22]). The same is true for expression profiling
with cDNA microarrays that, once developed for one species, can be used for any East
African cichlid species [23].
A variety of genomic resources have already been established for East African
cichlid species. Genetic maps are available for the Nile tilapia Oreochromis niloticus [24,
25] and the Lake Malawi species Metriaclima zebra [18]. BAC libraries have been
constructed for O. niloticus [26] and M. zebra (available at the Hubbard Center for
Genome Studies), for the Lake Victoria haplochromine Paralabidochromis chilotes [27]
and for Astatotilapia burtoni from Lake Tanganyika and surrounding rivers [28]. cDNA
microarrays are available for A. burtoni [23] and for Lake Victoria haplochromines [29,
30]. Also, EST sequencing projects have been initiated (see e.g., [31]), and a BLAST
server for cichlid resources has been established
(http://cichlids.cgr.harvard.edu/cichlidblast/). Recently, the National Institute of Health
(NIH) has committed to sequencing four cichlid genomes. A detailed description of
genomic resources developed for cichlid fishes is available at
http://www.cichlidgenome.org.
Expressed sequence tags (ESTs) derived from the partial sequencing of cDNA
clones provide an economical approach to identify large numbers of genes that can be
used for comparative genomic and gene expression studies as well as for the detection of
Salzburger et al. 5
splice variants (see e.g. [32, 33]). Furthermore, EST projects facilitate genome annotation
and are therefore often applied in addition to genome sequencing projects. Due to the
large amount of data available in public databases, ESTs emerge as important resources
for comparative genome-wide surveys both among closely and more distantly related
taxa [34, 35]. A series of software applications have been developed to date to perform
such EST-based analyses (see e.g., [36-38]). Since ESTs reflect the coding portions of a
genome, they can also be used to test for different evolutionary rates in particular genes
when comparing different lineages, and to detect genes that have undergone positive
selection [34]. It is generally assumed that genes with a statistically significant increase in
substitution rates have experienced relaxed functional constraints, while genes, which
have not undergone accelerated substitution rates, have experienced purifying selection
and, thus, could not accumulate substitutions at random. Positive Darwinian selection, on
the other hand, is a phenomenon where selective pressure is favoring change. Natural
selection is commonly thought of as a process of editing genetic change so that only a
small number of mutational events are retained in natural populations. Under positive
selection, the retention of mutations is much closer to the rate at which mutations occur.
Here we report the collection and annotation of more than 12,000 ESTs generated
from two different cDNA libraries obtained from the East African cichlid species
Astatotilapia burtoni, as well as a smaller cDNA library from the Lake Malawi species
Metriaclima zebra. Astatotilapia burtoni has long been used as a model system to study
cichlid spawning behavior [7, 39, 40], social interactions [40-43], neural and behavioral
plasticity [44, 45], endocrinology [46], the visual system [47], as well as cichlid
development and embryogenesis [48]. In addition, the phylogenetic position of A. burtoni
Salzburger et al. 6
makes this species an ideal model system for comparative genomic research [28].
Astatotilapia burtoni, which belongs to the most species-rich lineage of cichlids, the
haplochromines, was shown to be a sister group to both the Lake Victoria region
superflock (~ 600 species) and the species flock of Lake Malawi (~ 1,000 species) [4, 5,
49, 50]. Three highly specialized haplochromine species from two species assemblages,
Paralabidochromis chilotes and Ptyochromis sp. “redtail sheller” from Lake Victoria and
Metriaclima zebra from Lake Malawi, have already been established as genomic models
[17, 27, 29, 31]. Important insight into cichlid (genome) evolution will be afforded by the
comparison of their genomes to that of A. burtoni, which has a more generalist life style
and is likely to resemble the ancestral lineage that seeded the cichlid adaptive radiations
in these two lakes [4, 7].
For EST sequencing, we utilized a cDNA library from A. burtoni brain tissue
(‘brain’) that was used for the construction of a cDNA microarray [23] and a newly
generated normalized cDNA library constructed from different A. burtoni tissues at
different developmental stages (‘pinky’). We annotated the ESTs on the basis of
similarity searches with BLAST and using the structured vocabulary provided by the
Gene Ontology Consortium [51], based on molecular studies of gene function in various
model organisms [52]. For evolutionary analyses, we combined our newly generated
ESTs with all available sequence data for haplochromine cichlids [31] and a previously
constructed library from skin tissue of the Lake Malawi species Metriaclima zebra (W.
Salzburger, H. A. Hofmann & A. Meyer; unpublished data), which resulted in a total of
more than 45,000 ESTs. We then compared the haplochromine ESTs to sequence data
from two pufferfish species (Takifugu rubripes and Tetraodon nigroviridis), trout, and
Salzburger et al. 7
zebrafish, and identified those ESTs with cichlid specific differences in evolutionary rates
with EverEST [36].
Salzburger et al. 8
Results
The 14,592 initial sequences were trimmed of vector and low-quality sequences and
filtered for minimum length (200 bp cut-off), identifying 12,070 high-quality ESTs
(Table 1). More than 11,000 of these ESTs (from 13,056 initial sequences) are derived
from two different Astatotilapia burtoni cDNA libraries – one made from brain tissue
(‘brain’), the other one from different tissues (‘pinky’) including brain, muscle, skin and
fin. The overall quality as measured by sequencing success rate and read-length was
better in the ‘pinky’ library. Also, there was much less redundancy in the ‘pinky’ library
(16% versus 30%), which might be the consequence of the normalization step applied to
this library or the use of different source tissues.
A total of 8,636 A. burtoni sequences assembled into EST contigs have an open
reading frame (ORF) of at least 400 bp. Of these, 1,219 (14%) had matches in the
Takifugu database and 7,417 (86%) had no matches when an expected value threshold (e-
value) of < 1 x 10-50 was used. 2,902 (34%) had matches in the Takifugu database with an
expected value threshold of < 1 x 10-15 and 3,460 (40%) had matches with an expected
value of < 1 x 10-5. Similar proportions were retrieved with other databases (Fig. 1).
Among the 8,363 A. burtoni assembled sequences, 2,977 could be annotated
according to Gene Ontology (GO) terms. Supplementary Tables 1, 2 and 3 use the
generic GO slim subset of terms (http://www.geneontology.org/GO.slims.shtml; Generic
GO slim; Mundodi and Ireland; downloaded 04/06/2007) that have been developed to
provide a useful summary of GO annotation for comparison of genomes, microarrays, or
cDNA collections when a broad overview of the ontology content is required. 2,692
ESTs could be assigned to genes listed in the molecular function ontology, 2,532 to genes
Salzburger et al. 9
listed in the biological process ontology, and 2,293 to genes listed in the cellular
components ontology, when using an e-value of < 1 x 10-12. Supplementary Figure 1, 2,
and 3 provide more detail of the specific fine-grained terms. Because a single A. burtoni
assembled sequence may be annotated in all three ontologies and according to multiple
ontology terms, a total of 27,451 annotations have been applied (10,926 among biological
process, 9,414 among molecular function, and 7,111 among cellular component).
For the comparative evolutionary analyses, we combined our newly generated
ESTs with previously published data from Paralabidochromis chilotes and P. sp. “redtail
sheller” [31] and about 1,000 sequences obtained from a Metriaclima zebra skin cDNA
library (W. Salzburger, H. A. Hofmann & A. Meyer; unpublished data). When using this
set of haplochromine cichlid ESTs as reference, we identified 759 open reading frames
that are present in all six databases used for comparative analyses (haplochromine
cichlids, Danio rerio, Homo sapiens, Oncorhynchus mykiss, Takifugu rubripes, and
Tetraodon nigroviridis).
In order to identify sequences that evolve significantly more rapidly or more
slowly in the haplochromine cichlid, we applied the triangle method implemented in
EverEST [36] to calculate the p-distance for each of this 759 ORFs in all fish species
relative to the human ortholog. The relative p-distances for three fish species were then
mapped in ternary diagrams. An example of such a ternary diagram is shown in Fig. 2a,
in this case showing the relative p-distances of cichlid, Takifugu rubripes, and Danio
rerio amino acid sequences with respect to the homologous Homo sapiens genes. Figure
2b depicts a diagram with Oncorhynchus mykiss amino acid sequence divergence instead
of haplochromine cichlid. The ternary diagrams show that in all combinations most genes
Salzburger et al. 10
are clustered around the center of the respective triangle, which indicates that, in general,
the p-distances relative to the human outgroup are similar in all fish species.
When compared to the green-spotted pufferfish (Tetraodon nigroviridis) and fugu
(Takifugu rubripes) (always with human as outgroup), 49 gene fragments appeared to
have a significantly faster rate of evolution in haplochromine cichlids, and 213 had a
slower rate. In the comparison including zebrafish and fugu, 52 genes were found to have
evolved faster and 185 genes slower in cichlids. When trout and zebrafish were used, 69
genes were faster and 139 genes evolved slower. In a comparison including trout and
fugu, 68 genes appeared to have a faster rate in haplochromines, and 132 had a slower
rate. In total 69 genes were found to have evolved faster, and 213 genes appeared to have
evolved with a significantly slower mutation rate in haplochromines compared to other
fish species. Altogether, about 22% of the surveyed ESTs were found to have
haplochromine specific rate differences in at least one of the comparisons suggesting that
these genes might play a role in lineage specific features of haplochromine cichlids. A set
of 170 cichlid genes appeared in all comparisons. Forty-eight cichlid genes were found to
have a higher rate of amino-acid substitution compared to the other fish species included
in this study, while 122 cichlid genes were found to have a slower rate. Cichlid sequences
that match Danio rerio, Takifugu rubripes, Tetraodon nigroviridis, and Oncorhynchus
mykiss genes and have a significantly higher or lower p-distance compared to the other
fish genes relative to the human outgroup are listed in Supplementary Table 4 and 5,
respectively.
A histogram of the abundance of amino acid sequence divergences of all five fish
species with respect to homologous human genes is depicted in Fig. 3. The p-distances
Salzburger et al. 11
appear normally distributed. With 0.211, cichlids show the lowest average distance
followed by Oncorhynchus mykiss (0.216), Danio rerio (0.239), Takifugu rubripes
(0.242), and Tetraodon nigroviridis (0.258). The average distance of all five fish species
to Homo sapiens is 0.233. We also used the 482 redundant sequences that were found in
all three large haplochromine cichlid EST datasets (P. chilotes and P. sp. “redtail sheller”
[31]; Astatotilapia burtoni, this study) to calculate mean pairwise p-distances. Within
these three cichlid species, we found a mean p-distance of 0.14 between A. burtoni and P.
chilotes, 0.17 between A. burtoni and P. sp. “redtail sheller”, and 0.08 between the two
Lake Victoria species P. chilotes and P. sp. “redtail sheller”.
We then calculated Ka/Ks ratios for all of these genes. Ka/Ks ratios greater than
one, which are indicative of positive selection in that gene, were found in four genes that
evolve more slowly in cichlids compared to the other fish species. The highest Ka/Ks ratio
(3.77) was found in the neuroendocrine convertase subtilisin/kexin type 1 that is
responsible for processing large precursor proteins into mature peptide hormones [53,
54]. In claudin 3, a member of the claudin family involved in the formation of tight
junctions in various tissues [55], the Ka/Ks ratio was 1.55. A Ka/Ks ratio of 1.30 was
observed in the catalyzing enzyme glutathione peroxidase 3, and a ratio of 1.19 was
found in ménage a trois 1 (MNAT1), which is a member of the CDK7-cyclin H complex
that functions in cell cycle progression [56], basal transcription, and DNA repair.
Salzburger et al. 12
Discussion
Expressed sequence tags are important genomic resources and their numbers in public
databases such as GenBank are rapidly increasing. Full-length cDNA and EST
sequencing projects typically accompany genome sequencing projects, as these data are
essential for the recognition and annotation of genes, the characterization of the
transcriptome, the identification of intron-exon boundaries and the detection of splice
variants in eukaryotes, etc. (see e.g. [32, 33, 57-59]). In addition, the standardized
procedure of cDNA library construction and normalization, and the comparably low costs
of large-scale DNA sequencing facilitate EST projects in organisms for which the whole
genome sequencing has not (yet) been completed. Thus, EST sequencing projects
outnumber genome-sequencing projects – particularly in groups with larger genome sizes
such as plants and vertebrates – leading to a large body of sequence data available for
comparative analyses. Large-scale EST analyses have been used in many other contexts,
such as primary gene expression assays [60, 61], the estimation of the total number of
genes in an organism [62], cDNA microarray annotations [63], or the construction of
genetic linkage maps [64-66]. Expressed sequence tags can further be used for
phylogenomics [35, 67], and for the identification of microRNAs [68].
Despite their many advantages, there are also some problems associated with
ESTs. For example, EST sequences typically cover only parts of a gene, so that two
sequences of the same gene might not necessarily overlap. That only fragments of a gene
are available also leads to problems with homology-based analyses such as BLAST.
Then, EST sequences often contain the untranslated regions (UTRs) that are present in
mRNAs but do not translate into amino acids. Finally, it is often difficult to figure out the
Salzburger et al. 13
proper reading frame, particularly in shorter ESTs, which impedes certain analyses. A
combination of multiple EST projects (as we have done here) helps to alleviate some of
the shortcomings inherent in EST data.
We have sequenced, annotated and conducted evolutionary analysis of ESTs of
haplochromine cichlids for several reasons. First, this large set of sequence data for
cichlid ORFs provides insight into the genome of a representative of haplochromine
cichlids, which are a main model system for the study of adaptive evolution and
explosive speciation [1-3]. Second, we wanted to extend the existing genomic resources
for Astatotilapia burtoni such as a genomic BAC library [28] by establishing cDNA
libraries from different tissues. Furthermore, these cDNA libraries provide the basis for
annotated cDNA microarrays that are being used for expression analyses in a variety of
cichlid species [23, 29, 69]. Finally, we were interested in identifying genes with a
different evolutionary rate in the rapidly radiating cichlid lineage compared to other fish
species, as well as in identifying genes that show the signature of adaptive evolution in
cichlids.
Of the two A. burtoni cDNA libraries that were used for EST sequencing, the
normalized mixed tissue library (‘pinky’) was of better quality. Not only were there much
fewer redundant sequences as compared to the brain library, which was mainly due to the
normalization step, but also the average insert size was larger and the average read length
was longer. Altogether, about 85% of the sequenced cDNA clones led to high-quality
ESTs of a length of >200 bp (86% in pinky, and 85% in brain). In the BLAST searches
against Takifugu rubripes, Tetraodon nigroviridis, and Danio rerio, between 14% (when
compared to T. rubripes; e-value ! 10-50) and 43 % (when compared to D. rerio; e-value
Salzburger et al. 14
! 10-5) of the A. burtoni ESTs led to hits (Fig. 1). This lies well in the range of other EST
sequencing projects (see e.g., [61, 63, 70]).
About 8,600 A. burtoni ORFs (or 75% of the high quality ESTs) were longer than
400 bp, and about 3,000 sequences could unambiguously be annotated and classified
following the vocabulary provided by the Gene Ontology Consortium (Supplementary
Tables 1-3; Supplementary Figs. 1-3). According to the Gene Ontology classification, it
appears that a broad range of genes involved in functions, processes and compartments
are represented in our EST set. This cichlid specific GO slim offers several advantages.
First, it offers a rapid visual interpretation of gene subsets. Second, because the cichlid
specific slim is built from those sequences used to build a cDNA microarray, it offers
maximal power when testing for over- or under-representation of gene lists while
reducing the need for correction for multiple hypothesis testing. Finally, it allows for a
less experimenter-biased interpretation of microarray results, or other genomics analyses
in a manner that can be easily compared between experiments.
One of our main goals was to characterize genes in haplochromine cichlids that
show a faster or slower rate of base substitutions in cichlids compared to other fish
species, as this is indicative of a relaxed or reinforced selection regime, respectively [34].
To this end, we combined our newly generated ESTs with previously published
sequences for Lake Victoria haplochromine cichlids [31] and about 1,000 sequences
obtained from a Metriaclima zebra skin cDNA library, which resulted in a total of about
45,000 ORFs. By means of homology searches against human, the two pufferfishes,
trout, and zebrafish using local BLAST, we identified a set of 759 ORFs that are present
in all species and that show a sufficient degree of homology (e-value ! 10-50) for further
Salzburger et al. 15
analyses with EverEST [36]. The number of genes with a cichlid-specific faster or slower
rate of molecular evolution (always with human as outgroup) varied when different fish
taxa were used in addition to the cichlid ORFs. However, we found a set of 170 genes (48
“faster” and 122 “slower”; Supplementary Tables 4, 5) that appeared in all comparisons
and are, thus, good candidates for playing an important role in the evolution of
(haplochromine) cichlid fishes.
When characterizing these genes further, by means of calculating Ka/Ks ratios, we
found that four genes (or 2.35 % of all deviating genes) showed the signature of adaptive
evolution in the haplochromine lineage. The highest Ka/Ks ratio (3.77) was found in the
neuroendocrine convertase subtilisin/kexin type 1, followed by claudin 3, (1.55),
glutathione peroxidase 3 (1.50), and ménage a trois 1 (1.19). All gene fragments that
show a Ka/Ks>1 are found among the more slowly evolving genes. These genes are now
candidate genes for further investigations. The gene with the highest Ka/Ks ratio appears
particularly interesting. It is known that neuroendocrine, such as gonadotropin releasing
hormone (GnRH), are involved in regulation of reproduction and behavior in A. burtoni
[54, 71].
In order to generate hypotheses regarding possible mechanisms by which the
rapidly or slowly evolving cichlid genes might contribute to the process of adaptive
radiation, we made use of the GO term annotations and cichlid specific slim. Over- and
under-represented terms were identified among the annotations for the rapidly and slowly
evolving cichlid genes (Table 2). Among the 759 ORFs for which p-distances were
calculated, over 6,000 total annotations were applied to 647, 675, and 619 ORFs
according to biological process, molecular function, and cellular component respectively.
Salzburger et al. 16
Therefore the majority of the 122 slowly evolving and 48 rapidly evolving genes could be
classified bioinformatically.
There was a relatively even distribution of rapidly evolving genes across all GO
categories. Only three terms, “response to stimulus”, “cellular process” and “actin
cytoskeleton” deviated significantly from the distribution expected by chance alone. The
most significant disproportionate under-representation for the rapidly evolving genes was
the category of response to stimulus for which only 1 of the 86 possible annotated ORFs
was included on the list.
The distribution across GO categories was highly non-uniform for the slowly
evolving genes. Many categories from each ontology were represented by significantly
more or fewer ORFs than would be expected by chance. Among those terms over-
represented we found several relating to cellular processes such as protein kinase
cascade, mitosis, and cell signaling as well as growth and cell adhesion, while metabolic
process was under-represented along with the secretory pathway category.
The GO analysis highlights the possible categories of genes that may play an
important role in the evolution of the haplochromine cichlid fishes. This analysis presents
hypotheses to be tested through focused experimental or sequence analysis. An
interesting contrast in GO analysis results was observed between the rapidly evolving
genes that showed little tendency to derive from a particular class and slowly evolving
genes that were more structured in their distribution. The lack of structure to the
distribution of rapidly evolving genes may reflect the possibility that specialization
among cichlids occurs along diverse biological pathways rather than a repeated
divergence of a given biological process or molecular function. The GO categories that
Salzburger et al. 17
are over-represented among slowly evolving genes could represent genes whose
functions are important for phenotypic plasticity or other traits linked to the successful
adaptive radiation, while those categories that are under-represented by slowly evolving
genes represent categories that are not as tightly constrained.
Our p-distance comparisons between the five fish species and human (as
outgroup) also revealed that cichlids show the lowest average p-distance compared to
Homo sapiens (Fig. 3). This might be an artifact that is due to the use of the
haplochromine cichlid sequence as query for all BLAST searches. Alternatively, as we
also found 122 slowly evolving genes in haplochromine cichlids, there might be a
tendency in haplochromines to retain ancestral forms and functions. The pairwise average
p-distance comparisons between the three cichlid species Paralabidochromis chilotes,
Ptyochromis sp. “redtail sheller”, and Astatotilapia burtoni revealed that the coalescence
time between the two Lake Victoria species (0.08) is about half compared to their
coalescence time with A. burtoni (0.14 and 0.17, respectively), which is in concordance
to the phylogenetic relationships between these three taxa [4].
Salzburger et al. 18
Conclusions
Here we report the sequencing and annotation of more than 11,000 ESTs from the East
African haplochrormine cichlid Astatotilapia burtoni. Our EST set comprises a broad
range of genes involved in functions, processes and compartments. By combining the A.
burtoni ESTs with publicly available ORFs from two Lake Victoria haplochromines and
subsequent comparisons to other fish model systems, we identify a set of 170 genes with
haplochromine-specific differences in evolutionary rates. These genes appear as good
candidates for playing an important role in the evolution of the exceptional diversity
found in (haplochromine) cichlids. Interestingly, genes that were more slowly evolving in
the cichlid lineage were not evenly distributed across Gene Ontology categories; classes
that are over-represented could represent genes whose functions are important for
successful adaptive radiation. We also identify four genes with a Ka/Ks ratio greater than
one, which are, hence, likely to have undergone positive selection in haplochromines.
The A. burtoni ESTs provide novel insights into the genome of haplochromine cichlids
and will serve as valuable resource for researchers working in the field of (cichlid)
evolutionary genomics, particularly in the light of the forthcoming sequencing of four
cichlid genomes.
Salzburger et al. 19
Methods
Fishes
Astatotilapia burtoni were kept at Stanford, and at the Tierforschungsanlage of the
University of Konstanz under standard conditions (12 h light, 12 h dark; 26°C). For RNA
isolation, fishes were sacrificed after anesthetization with MS 222 (Sigma).
Pinky cDNA Library Construction
For the preparation of the pinky cDNA library, total RNA was isolated from the
following tissues of adult A. burtoni: brain, caudal fin, anal fin (male), lips, muscle, ovary
(female), and skin. Additionally, we isolated total RNA from a juvenile individual (about
30 days after fertilization). Total RNA was isolated by guanidine thiocyanate/phenol-
chlorophorm-isoamyl alcohol extraction and lithium-chloride precipitation. The different
RNA samples were pooled and cDNA was synthesized using the SMART PCR cDNA
Synthesis Kit (Clontech) following the manufacturers protocol. Amplified cDNA was
purified using the QIAquick PCR Purification Kit (Qiagen) and concentrated by ethanol
precipitation. The pellet was dissolved in 10 !l H2O. For normalization, three microliters
of purified cDNA were mixed with 1 !l hybridization buffer (200 mM HEPES-HCl, pH
8.0; 2 M NaCl) and incubated at 95°C for 5 minutes and at 70°C overnight. Then, 1 !l of
DNAse buffer (500 mM Tris-HCl, pH 8.0; 50 mM MgCl2, 10 mM DTT) and 0.5 !l of
DSN enzyme (duplex-specific nuclease; Evrogen, Russia) were added, and the mix was
incubated at 65°C for 20 minutes. The normalization reaction was terminated by adding 1
!l 50 mM EDTA and incubation at 95°C for 7 minutes. Normalized cDNA was PCR
amplified (20 cycles) and cloned into pAL 16 vectors.
Salzburger et al. 20
Brain cDNA Library Construction
A full-length, directional (EcoRI – XhoI) cDNA library was constructed in Lambda ZapII
phage vector (Stratagene) with mRNA from A. burtoni brains (both sexes at all stages of
development and social condition were included). Construction of this library has
previously been described in ref. [23]. For cDNA sequencing, we used 2!l of purified
PCR products, which were also used for the construction of a cDNA microarray [23].
DNA-sequencing and Sequence Analysis
For sequencing of the normalized pinky cDNA library we used purified plasmid DNA
from 1 ml colonies that were grown overnight. Plasmid DNA was directly sequenced
using T7 primers and the BigDye Termination Reaction Kit v3.0 (Applied Biosystems)
on ABI 3730 and ABI 3100 automated capillary DNA sequencers (Applied Biosystems).
Sequences of the brain cDNA library were determined on an ABI 3100 DNA sequencer
after cycle sequencing reactions from purified PCR products that were available from the
construction of a cDNA microarray [23] using the primer CSVP3 (5’ –
AAGCGCGCAATTAACCCTCACTA – 3’) and the BigDye Termination Reaction Kit
v3.0 (Applied Biosystems).
Base-calling and quality trimming were performed with PHRED
(http://www.genome.washington.edu/UWGC/analysistools/Phred.cfm) using a quality
score >20. Vectors were trimmed with Sequencher 4.2.2 (Genecodes). Those ESTs
having a total length of >200 bp after quality and vector trimming were considered “high-
quality ESTs”. Screens for possible contaminations were conducted by blastn searches
against the E. coli genome, and the EST_human, EST_mouse and EST_others databases
Salzburger et al. 21
(downloaded in March 2005). Sequences have been deposited in GenBank under
accession numbers CN468542 – CN472211 (brain library) and DY625779 – DY 632420
(pinky library).
Annotation of A. burtoni ESTs
High quality A. burtoni ESTs were screened by tblastx searches against protein data from
Danio rerio (Zebrafish Sequencing Group at the Sanger Institute), Homo sapiens
(GenBank) and Takifugu rubripes (JGI Fugu v3.0) as well as ESTs from Oncorhynchus
mykiss and Tetraodon nigroviridis (GenBank) using the standard vertebrate code for
translation into amino acids. The expected value thresholds (e-values) were set to < 1 x
10-5
, < 1 x 10-15
, and < 1 x 10-50
. The proper open reading frame for A. burtoni ESTs was
determined with EverEST [36], based on the results from these BLAST searches.
For functional annotation of A. burtoni ESTs, we followed the vocabulary
provided by the Gene Ontology Consortium using the GO database
(http://www.geneontology.org). Gene Ontology terms were applied to the cichlid
assembled sequences by BLAST comparison to the Gene Ontology database (release
200704), which represents protein sequence for all contributed genes for which at least
one GO annotation has been applied based on experimental evidence rather than only
inferred electronic annotation of sequence. All GO annotations at any confidence level
were then transferred from the single best-hit gene using e-value < 10-12
as a threshold.
The collection of GO terms used was "slimmed" in order to produce useful summaries of
the annotations.
Salzburger et al. 22
This cichlid specific slim (Supplementary Figs. 1-3) is based upon statistical
consideration for analysis of microarray results. The leaf most nodes have been selected
for which 20 or more A. burtoni assembled sequences were annotated with this term.
Parent nodes were retained only when an additional 20 A. burtoni assembled sequences
were included. To assess the enrichment of particular classes of genes among the genes
showing deviating rate of molecular evolution, Gene Ontology annotation terms were
tested for significant over- and under-representation in either the higher or lower p-
distance list using a hypergeometric test implemented in the BINGO plugin [72] for
Cytoscape (http://www.cytoscape.org/). Due to the exploratory nature of this analysis and
controversial application of correction techniques [73], reported p-values are not
corrected for multiple testing. Only the representation for the leaf most node is reported
except in cases when a larger, parent node showed increased significance. The directed
acyclic graphs (DAGs) were created using hierarchical visualization in Cytoscape and
manually adjust to facilitate comprehension.
Evolutionary Analyses
For evolutionary analyses of ESTs from haplochromine cichlids, we combined our newly
generated high-quality ESTs from A. burtoni with previously published ESTs from
Paralabidochromis chilotes and Ptyochromis sp. “redtail sheller” [31] and with about
1,000 ESTs obtained from a cDNA library made from Metriaclima zebra skin tissue (W.
Salzburger, H. A. Hofmann & A. Meyer, unpublished). The combined dataset, including
more than 45,000 ESTs, was BLASTed against protein data from Danio rerio, Homo
sapiens and Takifugu rubripes as well as ESTs from Oncorhynchus mykiss and Tetraodon
Salzburger et al. 23
nigroviridis (see above for source of data) using the translated BLAST routine and the
standard vertebrate code. BLAST searches were performed with an e-value of < 1 x 10-50
in order to achieve high levels of confidence in the similarity searches. The cichlid query
sequences and the best hits from every single BLAST search against the different
databases were imported into EverEST [36].
In order to identify coding sequences showing a deviating rate of molecular
evolution in haplochromine cichlids compared to other fish lineages we applied the
triangle method implemented in EverEST. In this approach, the query sequences are
aligned to their best BLAST hits in two ingroup and one outgroup taxa using the T-
Coffee algorithm [74] as implemented in EverEST [36]. This reveals multiple sequence
alignments consisting of four taxa. Then, uncorrected pairwise p-distances are calculated
for all taxon pairs in each alignment, which are used to construct neighbor-joining trees
and, after rooting with the outgroup sequences, for a global ternary representation. A
relative rate test was applied to each of the orthologous groups. We applied the
nonparametric rate test developed by Tajima (ref. [75]), and compared the genes with
their human and their fish orthologs in order to identify higher or lower substitution rates.
For these analyses, we used the human sequences as outgroup since tetrapods are
valid outgroup taxa for teleost fish and the human genome is the most complete and best
annotated genome among those. In addition to our haplochromine cichlid query
sequences, we used different sets of ingroup taxa in order to minimize biasing effects due
to sparse taxon sampling. We used the following combinations of taxa for our
evolutionary rate analyses using 759 ORFs that have been found in all datasets: (human,
(haplochromine cichlid, Danio rerio, Takifugu rubripes)) (Fig. 2a), (human,
Salzburger et al. 24
(haplochromine cichlid, Danio rerio, Tetraodon nigroviridis)) (not shown), (human,
(haplochromine cichlid, Danio rerio, Oncorhynchus mykiss)) (not shown). As a control,
we also analyzed a data set without the cichlid-query sequences for the same set of ORFs
(human, (Danio rerio, Oncorhynchus mykiss, Takifugu rubripes)) (Fig. 2b). We note that
this approach might lead to an underestimation of the number of faster evolving genes, as
genes that accumulated too many mutations are likely to not get chosen in the stringent
initial BLAST searches.
For orthologous groups, where the p-distance in the haplochromine cichlids were
significantly (p < 0.05) higher or lower compared to other fish, the ratio of the number of
nonsynonymous substitutions per nonsynonymous site (Ka) to the number of synonymous
substitutions per synonymous site (Ks) was calculated based on a likelihood approach
[76] to evaluate the selective forces acting on those proteins. The Ka/Ks ratio is an
indicator of the form of sequence evolution, with Ka/Ks >>1 providing strong evidence
that positive selection has acted to change the protein sequence.
We also constructed a histogram of amino acid sequence divergence of all five
fish datasets with respect to homologous human sequences. We finally used the
redundant sequences in the three datasets P. chilotes, P. sp. “redtail sheller”, and A.
burtoni to calculate pairwise average p-distances.
List of abbreviations used:
DAG, directed acyclic graph; EST, expressed sequence tag; GO, gene ontology; ORF,
open reading frame
Salzburger et al. 25
Author’s contributions
WS, HAH and AM designed the study. WS and HAH were involved in library
construction; WS and IB carried out the molecular work; WS, DS, SCPR, and IB
performed the analyses. All authors contributed to the preparation of the manuscript.
They read and approved the final version.
Acknowledgements
We thank E. Hespeler for technical assistance in the laboratory, P. Jantzen for assistance
with GO figures and tables, and R. D. Fernald, in whose laboratory the brain cDNA
library was constructed; W.S. was supported by a Marie Curie Fellowship of the EU, and
grants from the Landesstiftung-Baden Württemberg gGmbH and the Center for Junior
Research Fellows, University of Konstanz; S.C.P. R was supported by an NIH-NRSA
grant; H.A.H. was supported by a NIH-NIGMS grant GM068763, the Bauer Center for
Genomics Research at Harvard University and the Institute for Cellular and Molecular
Biology at the University of Texas, Austin; A.M. was supported by the Deutsche
Forschungsgemeinschaft (DFG) and the University of Konstanz.
Salzburger et al. 26
References 1. Kocher TD: Adaptive evolution and explosive speciation: the cichlid fish
model. Nature Reviews Genetics 2004, 5:288-298.
2. Salzburger W, Meyer A: The species flocks of East African cichlid fishes:
recent advances in molecular phylogenetics and population genetics.
Naturwissenschaften 2004, 91:277-290.
3. Kornfield I, Smith PF: African Cichlid Fishes: Model systems for evolutionary
biology. Annu Rev Ecol Syst 2000, 31:163-196.
4. Salzburger W, Mack T, Verheyen E, Meyer A: Out of Tanganyika: Genesis,
explosive speciation, key-innovations and phylogeography of the
haplochromine cichlid fishes. BMC Evolutionary Biology 2005, 5:17.
5. Verheyen E, Salzburger W, Snoeks J, Meyer A: Origin of the superflock of
cichlid fishes from Lake Victoria, East Africa. Science 2003, 300:325-329.
6. Genner MJ, Seehausen O, Lunt DH, Joyce DA, Shaw PW, Carvalho GR, Turner
GF: Age of cichlids: new dates for ancient lake fish radiations. Mol Biol Evol
2007, 24:1269-1282.
7. Fryer G, Iles TD: The cichlid fishes of the Great Lakes of Africa: Their biology
and Evolution. Edinburgh: Oliver & Boyd; 1972.
8. Barluenga M, Stolting KN, Salzburger W, Muschick M, Meyer A: Sympatric
speciation in Nicaraguan crater lake cichlid fish. Nature 2006, 439:719-723.
9. Schliewen UK, Tautz D, Paabo S: Sympatric speciation suggested by
monophyly of crater lake cichlids. Nature 1994, 368:629-632.
10. Kocher TD, Conroy JA, McKaye KR, Stauffer JR: Similar morphologies of
cichlid fish in lakes Tanganyika and Malawi are due to convergence. Mol
Phylogenet Evol 1993, 2:158-165.
11. Stiassny MLJ, Meyer A: Cichlids of the Rift Lakes. Scientific American 1999,
280:64-69.
12. Meyer A: Phylogenetic relationships and evolutionary processes in East
African cichlids. Trends in Ecology and Evolution 1993, 8:279-284.
13. Barlow GW: The Cichlid Fishes. Nature's Grand Experiment in Evolution.
Cambridge, MA: Perseus Publishing; 2000.
14. Liem KF: Evolutionary strategies and morphological innovations: cichlid
pharyngeal jaws. Systematic Zoology 1973, 22:425-441.
15. Crapon de Caprona MD, Fritzsch B: Interspecific fertile hybrids of
haplochromine Cichlidae (Teleostei) and their possible importance for
speciation. Netherlands Journal of Zoology 1984, 34:503-538.
16. Albertson RC, Kocher TD: Genetic architecture sets limits on transgressive
segregation in hybrid cichlid fishes. Evolution Int J Org Evolution 2005,
59:686-690.
17. Streelman JT, Albertson RC, Kocher TD: Genome mapping of the orange
blotch colour pattern in cichlid fishes. Mol Ecol 2003, 12:2465-2471.
18. Albertson RC, Streelman JT, Kocher TD: Directional selection has shaped the
oral jaws of Lake Malawi cichlid fishes. Proc Natl Acad Sci U S A 2003,
100:5252-5257.
Salzburger et al. 27
19. Albertson RC, Streelman JT, Kocher TD, Yelick PC: Integration and evolution
of the cichlid mandible: the molecular basis of alternate feeding strategies.
Proc Natl Acad Sci U S A 2005, 102:16287-16292.
20. Terai Y, Morikawa N, Okada N: The evolution of the pro-domain of bone
morphogenetic protein 4 (Bmp4) in an explosively speciated lineage of East
African cichlid fishes. Mol Biol Evol 2002, 19:1628-1632.
21. Sugie A, Terai Y, Ota R, Okada N: The evolution of genes for pigmentation in
African cichlid fishes. Gene 2004, 343:337-346.
22. Carleton KL, Kocher TD: Cone opsin genes of african cichlid fishes: tuning
spectral sensitivity by differential gene expression. Mol Biol Evol 2001,
18:1540-1550.
23. Renn SC, Aubin-Horth N, Hofmann HA: Biologically meaningful expression
profiling across species using heterologous hybridization to a cDNA
microarray. BMC Genomics 2004, 5:42.
24. Lee BY, Lee WJ, Streelman JT, Carleton KL, Howe AE, Hulata G, Slettan A,
Stern JE, Terai Y, Kocher TD: A Second Generation Genetic Linkage Map of
Tilapia (Oreochromis spp.). Genetics 2005, 170:237-244.
25. Kocher TD, Lee WJ, Sobolewska H, Penman D, McAndrew B: A genetic linkage
map of a cichlid fish, the tilapia (Oreochromis niloticus). Genetics 1998,
148:1225-1232.
26. Katagiri T, Asakawa S, Minagawa S, Shimizu N, Hirono I, Aoki T: Construction
and characterization of BAC libraries for three fish species; rainbow trout,
carp and tilapia. Anim Genet 2001, 32:200-204.
27. Watanabe M, Kobayashi N, Fujiyama A, Okada N: Construction of a BAC
library for Haplochromis chilotes, a cichlid fish from Lake Victoria. Genes
Genet Syst 2003, 78:103-105.
28. Lang M, Miyake T, Braasch I, Tinnemore D, Siegel N, Salzburger W, Amemiya
CT, Meyer A: A BAC library of the East African haplochromine cichlid fish
Astatotilapia burtoni. J Exp Zoolog B Mol Dev Evol 2006, 306B:35-44.
29. Kijimoto T, Watanabe M, Fujimura K, Nakazawa M, Murakami Y, Kuratani S,
Kohara Y, Gojobori T, Okada N: cimp1, a novel actin family metalloproteinase
gene from East African cichlids, is differentially expressed between species
during growth. Mol Biol Evol 2005, 22:1649-1660.
30. Kobayashi N, Watanabe M, Kijimoto T, Fujimura K, Nakazawa M, Ikeo K,
Kohara Y, Gojobori T, Okada N: magp4 gene may contribute to the
diversification of cichlid morphs and their speciation. Gene 2006, 373:126-
133.
31. Watanabe M, Kobayashi N, Shin-i T, Horiike T, Tateno Y, Kohara Y, Okada N:
Extensive analysis of ORF sequences from two different cichlid species in
Lake Victoria provides molecular evidence for a recent radiation event of the
Victoria species flock: identity of EST sequences between Haplochromis
chilotes and Haplochromis sp. "Redtailsheller". Gene 2004, 343:263-269.
32. Gibson G, Muse SV: A Primer of Genome Science. Sunderland, MA: Sinauer
Associates, Inc.; 2002.
33. Gerhold D, Caskey CT: It's the genes! EST access to human genome content.
Bioessays 1996, 18:973-981.
Salzburger et al. 28
34. Steinke D, Salzburger W, Braasch I, Meyer A: Many genes in fish have species-
specific asymmetric rates of molecular evolution. BMC Genomics 2006, 7:20.
35. Steinke D, Salzburger W, Meyer A: Higher teleostean relationships revealed
from genome-wide phylogenetic analyses. J Mol Evol 2006, in press.
36. Steinke D, Salzburger W, Meyer A: EverEST - a phylogenomic EST database
approach. PhyloInformatics 2004, 6:1-4.
37. Wasmuth JD, Blaxter ML: prot4EST: translating expressed sequence tags
from neglected genomes. BMC Bioinformatics 2004, 5:187.
38. Nilsson RH, Rajashekar B, Larsson KH, Ursing BM: galaxieEST: addressing
EST identity through automated phylogenetic analysis. BMC Bioinformatics
2004, 5:87.
39. Wickler W: 'Egg-dummies' as natural releasers in mouth-breeding cichlids.
Nature 1962, 194:1092-1093.
40. Wickler W: Zur Stammesgeschichte funktionell korrelierter Organ- und
Verhaltensmerkmale: Ei-Attrappen und Maulbrüten bei afrikanischen
Cichliden. Zeitschrift für Tierpsychologie 1962, 19:129-164.
41. Wickler W: Haplochromis burtoni (Cichlidae) Ablaichen. In Encyclopedia
Cinematographica. Göttingen: Institut für den wissenschaftlichen Film; 1969.
42. Crapon de Caprona MD: Olfactory communication in a cichlid fish,
Haplochromis burtoni. Zeitschrift für Tierpsychologie 1980, 52:113-134.
43. Grosenick L, Clement TS, Fernald RD: Fish can infer social rank by
observation alone. Nature 2007, 445:429-432.
44. Hofmann HA, Fernald RD: What cichlids tell us about the social regulation of
brain and behavior. Journal of Aquariculture and Aquatic Sciences 2001, 9:1-
15.
45. Hofmann HA: Functional genomics of neural and behavioral plasticity. J
Neurobiol 2003, 54:272-282.
46. Robison RR, White RB, Illing N, Troskie BE, Morley M, Millar RP, Fernald RD:
Gonadotropin-releasing hormone receptor in the teleost Haplochromis
burtoni: structure, location, and function. Endocrinology 2001, 142:1737-
1743.
47. Kroger RH, Campbell MC, Fernald RD: The development of the crystalline
lens is sensitive to visual input in the African cichlid fish, Haplochromis
burtoni. Vision Res 2001, 41:549-559.
48. Hagedorn M, Mack AF, Evans B, Fernald RD: The embryogenesis of rod
photoreceptors in the teleost fish retina, Haplochromis burtoni. Brain Res
Dev Brain Res 1998, 108:217-227.
49. Meyer A, Kocher TD, Basasibwaki P, Wilson AC: Monophyletic origin of Lake
Victoria cichlid fishes suggested by mitochondrial DNA sequences. Nature
1990, 347:550-553.
50. Salzburger W, Meyer A, Baric S, Verheyen E, Sturmbauer C: Phylogeny of the
Lake Tanganyika cichlid species flock and its relationship to the Central and
East African haplochromine cichlid fish faunas. Syst Biol 2002, 51:113-135.
51. Consortium TGO: Creating the gene ontology resource: design and
implementation. Genome Res 2001, 11:1425-1433.
Salzburger et al. 29
52. Ashburner M, Ball CA, Blake JA, Botstein D, Butler H, Cherry JM, Davis AP,
Dolinski K, Dwight SS, Eppig JT, et al: Gene ontology: tool for the unification
of biology. The Gene Ontology Consortium. Nat Genet 2000, 25:25-29.
53. Jansen E, Ayoubi TA, Meulemans SM, Van de Ven WJ: Neuroendocrine-
specific expression of the human prohormone convertase 1 gene. Hormonal
regulation of transcription through distinct cAMP response elements. J Biol
Chem 1995, 270:15391-15397.
54. Hofmann HA: Gonadotropin-releasing hormone signaling in behavioral
pasticity. Current Opinion in Neurobiology 2006, 16:343-350.
55. Morita K, Furuse M, Fujimoto K, Tsukita S: Claudin multigene family
encoding four-transmembrane domain protein components of tight junction
strands. Proc Natl Acad Sci U S A 1999, 96:511-516.
56. Talukder AH, Mishra SK, Mandal M, Balasenthil S, Mehta S, Sahin AA, Barnes
CJ, Kumar R: MTA1 interacts with MAT1, a cyclin-dependent kinase-
activating kinase complex ring finger factor, and regulates estrogen receptor
transactivation functions. J Biol Chem 2003, 278:11676-11685.
57. Gupta S, Zink D, Korn B, Vingron M, Haas SA: Strengths and weaknesses of
EST-based prediction of tissue-specific alternative splicing. BMC Genomics
2004, 5:72.
58. Banfi S, Borsani G, Rossi E, Bernard L, Guffanti A, Rubboli F, Marchitiello A,
Giglio S, Coluccia E, Zollo M, et al: Identification and mapping of human
cDNAs homologous to Drosophila mutant genes through EST database
searching. Nat Genet 1996, 13:167-174.
59. Bailey LC, Jr., Searls DB, Overton GC: Analysis of EST-driven gene
annotation in human genomic sequence. Genome Res 1998, 8:362-376.
60. Schmitt AO, Specht T, Beckmann G, Dahl E, Pilarsky CP, Hinzmann B,
Rosenthal A: Exhaustive mining of EST libraries for genes differentially
expressed in normal and tumour tissues. Nucleic Acids Res 1999, 27:4251-
4260.
61. Habermann B, Bebin AG, Herklotz S, Volkmer M, Eckelt K, Pehlke K, Epperlein
HH, Schackert HK, Wiebe G, Tanaka EM: An Ambystoma mexicanum EST
sequencing project: analysis of 17,352 expressed sequence tags from
embryonic and regenerating blastema cDNA libraries. Genome Biol 2004,
5:R67.
62. Ewing B, Green P: Analysis of expressed sequence tags indicates 35,000
human genes. Nat Genet 2000, 25:232-234.
63. Whitfield CW, Band MR, Bonaldo MF, Kumar CG, Liu L, Pardinas JR,
Robertson HM, Soares MB, Robinson GE: Annotated expressed sequence tags
and cDNA microarrays for studies of brain and behavior in the honey bee.
Genome Res 2002, 12:555-566.
64. Smith JJ, Kump DK, Walker JA, Parichy DM, Voss SR: A Comprehensive EST
Linkage Map for Tiger Salamander and Mexican Axolotl: Enabling Gene
Mapping and Comparative Genomics in Ambystoma. Genetics 2005.
65. Scheetz TE, Raymond MR, Nishimura DY, McClain A, Roberts C, Birkett C,
Gardiner J, Zhang J, Butters N, Sun C, et al: Generation of a high-density rat
EST map. Genome Res 2001, 11:497-502.
Salzburger et al. 30
66. Lorenzen MD, Doyungan Z, Savard J, Snow K, Crumly LR, Shippy TD, Stuart JJ,
Brown SJ, Beeman RW: Genetic linkage maps of the red flour beetle,
Tribolium castaneum, based on bacterial artificial chromosomes and
expressed sequence tags. Genetics 2005, 170:741-747.
67. Philippe H, Lartillot N, Brinkmann H: Multigene analyses of bilaterian animals
corroborate the monophyly of Ecdysozoa, Lophotrochozoa, and Protostomia.
Mol Biol Evol 2005, 22:1246-1253.
68. Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA: Identification and
characterization of new plant microRNAs using EST analysis. Cell Res 2005,
15:336-360.
69. Aubin-Horth N, Desjardins JK, Martei YM, Balshine S, Hofmann HA:
Masculinized dominant females in a cooperatively breeding species. Mol Ecol
2007, 16:1349-1358.
70. Rise ML, von Schalburg KR, Brown GD, Mawer MA, Devlin RH, Kuipers N,
Busby M, Beetz-Sargent M, Alberto R, Gibbs AR, et al: Development and
application of a salmonid EST database and cDNA microarray: data mining
and interspecific hybridization characteristics. Genome Res 2004, 14:478-490.
71. Trainor BC, Hofmann HA: Somatostatin regulates aggressive behavior in an
African cichlid fish. Endocrinology 2006, 147:5119-5125.
72. Maere S, Heymans K, Kuiper M: BiNGO: a Cytoscape plugin to assess
overrepresentation of gene ontology categories in biological networks.
Bioinformatics 2005, 21:3448-3449.
73. Ge YC, Dudoit S, Speet TP: Resampling-based multiple testing for microarray
data analysis. Test 2003, 12:1-77.
74. Notredame C, Higgins DG, Heringa J: T-Coffee: A novel method for fast and
accurate multiple sequence alignment. J Mol Biol 2000, 302:205-217.
75. Tajima F: Simple methods for testing the molecular evolutionary clock
hypothesis. Genetics 1993, 135:599-607.
76. Yang Z: Likelihood ratio tests for detecting positive selection and application
to primate lysozyme evolution. Mol Biol Evol 1998, 15:568-573.
Salzburger et al. 31
Tables
Table 1 - Expressed sequence tag (EST) summary
Total sequences 13,056
High quality sequences 12,070 (between 200 and 1,564 bp)
Brain library (A. burtoni) 4,570
Mixed tissue library (A. burtoni) 6,541
Skin library (P. zebra) 959
Salzburger et al. 32
Table 2 - Gene Ontology terms which are over- or under-represented among the
rapidly or slowly evolving cichlid ORFs. Hypergeometic p-values are reported
uncorrected for multiple testing. The number of ORFs of deviating evolutionary rate (#)
relative to the number of core set ORFs (total) is given.
Representation GO-ID p-value # total Description
biological process 42 with higher p-distance (647 annotated)
over none
under GO:0050896 0.0161 1 86 response to stimulus
GO:0009987 0.0439 12 273 cellular process
molecular function 44 with higher p-distance (675 annotated)
none
cellular component 40 with higher p-distance (619 annotated)
over GO:0015629 0.0327 6 39 actin cytoskeleton
under none
biological process 103 with lower p-distance (647 annotated)
over GO:0009987 0.0024 57 273 cellular process
over GO:0007243 0.0052 8 19 protein kinase cascade
over GO:0007155 0.0205 7 19 cell adhesion
over GO:0040007 0.0208 6 15 growth
over GO:0007154 0.0230 25 109 cell communication
over GO:0007267 0.0071 7 16 cell-cell signaling
over GO:0016477 0.0290 5 12 cell migration
over GO:0040008 0.0290 5 12 regulation of growth
over GO:0007409 0.0308 3 5 axonogenesis
over GO:0007610 0.0308 3 5 behavior
over GO:0015674 0.0308 3 5 di-, tri-valent inorganic cation transport
over GO:0019752 0.0376 10 35 carboxylic acid metabolic process
over GO:0007067 0.0402 4 9 mitosis
over GO:0007417 0.0402 4 9 central nervous system development
under GO:0008152 0.0016 63 477 metabolic process
under GO:0046907 0.0180 2 44 intracellular transport
under GO:0045045 0.0295 0 20 secretory pathway
under GO:0009117 0.0421 0 18 nucleotide metabolic process
molecular function 110 with lower p-distance (675 annotated)
over GO:0004930 0.0157 4 7 G-protein
over GO:0003774 0.0233 6 15 motor activity
over GO:0005262 0.0264 2 2 calcium channel
over GO:0008047 0.0324 6 16 enzyme activator activity
over GO:0005509 0.0333 12 43 calcium ion binding
over GO:0019899 0.0435 4 9 enzyme binding
under GO:0005525 0.0116 1 36 GTP binding
under GO:0005198 0.0407 8 85 structural molecule activity
under GO:0051082 0.0467 0 17 unfolded protein binding
under GO:0003743 0.0467 0 17 translation initiation factor activity
under GO:0003924 0.0481 1 27 GTPase activity
under GO:0003676 0.0483 17 147 nucleic acid binding
cellular component 97 with lower p-distance (619 annotated)
over GO:0016021 0.0096 22 88 integral to membrane
over GO:0015630 0.0388 5 13 microtubule cytoskeleton
over GO:0005625 0.0479 6 18 soluble fraction
over GO:0005615 0.0479 6 18 extracellular space
under GO:0032991 0.0001 19 222 macromolecular complex
under GO:0043234 0.0015 18 195 protein complex
under GO:0043226 0.0089 56 425 organelle
under GO:0030529 0.0139 4 65 ribonucleoprotein complex
under GO:0005829 0.0267 3 51 cytosol
under GO:0005739 0.0311 6 75 mitochondrion
Salzburger et al. 33
Figures Figure 1 - The proportion of assembled haplochromine cichlid sequences with and
without BLAST matches compared to three databases (Takifugu rubripes, Danio
rerio, and Oncorhynchus mykiss). The pie charts indicate the relative number of
BLAST hits (blue) versus the percentage fraction, for which no BLAST hit was retrieved
(red) for three different e-values (< 10-50
, < 10-15
, and <10-5
, respectively).
Salzburger et al. 34
Figure 2 - Ternary representation of relative distances of ORFs of three fish
species compared to their human orthologs. (a) Haplochromine cichlid, Danio rerio,
and Takifugu rubripes, (b) Danio rerio, Oncorhynchus mykiss, and Takifugu rubripes.
Each dot represents a single ORF, the position of the dot within the ternary diagram
indicates the relative distance of this ORF in each of the three fish species compared to
the orthologous ORF in human. We were interested in identifying those ORFs that show
a faster or slower rate of molecular evolution in the haplochromine cichlids.
Salzburger et al. 35
Figure 3 - Histogram of the abundance of amino acid sequence divergences of all
five fish species (haplochromine cichlid, Danio rerio, Takifugu rubripes, Tetraodon
nigroviridis, and Oncorhynchus mykiss) with respect to human genes. P-distances
have been calculated for a set of 759 ORFs found in all five fish species and plotted in
categories of 0.1.
Salzburger et al. 36
Supplementary Tables
Supplementary Table 1 - Gene ontology (generic GO slim subset for molecular
function). The classification is hierarchical. Indented terms are children of parent terms
listed above. For each term, the number of A. burtoni assembled sequences that match
genes to which Gene Ontology annotations have been assigned at, or below, this general
level is given. Note that genes may be assigned to more than one term and child terms
may have more than one parent term. For parent terms, the total number of A. burtoni
assembled sequences is given in parentheses. Match means that the annotation derives
from a gene that was the “best hit” for the A. burtoni sequence at and e-value <10-12
.
Salzburger et al. 37
Molecular Function 2692
antioxidant activity 18
binding 684 (2097)
calcium ion 154
carbohydrate binding 43
chromatin binding 21
lead ion binding 0
lipid binding 82
nucleic acid binding 130 (586)
DNA binding 193 (227)
transcription factor activity 89
RNA binding 293
translation factor activity, nucleic acid binding 55
nucleotide binding 459
oxygen binding 24
protein binding 1096 (1183)
cytoskeletal protein binding 52 (110)
actin binding 65
receptor binding 110
triplet codon-amino acid adaptor activity 0
catalytic activity 574 (1239)
electron carrier activity 98
hydrolase activity 396 (473)
nuclease 9
peptidase activity 117
phosphoprotein phosphatase 25
transferase activity 229 (277)
kinase activity 103 (125)
protein kinase activity 55
chaperone regulator activity 4
enzyme regulator activity 127
motor activity 35
nutrient reservoir activity 0
protein tag 1
signal transducer activity 63 (170)
receptor activity 116
structural molecule activity 382
transcription regulator activity 116 (167)
translation regulator activity 5 (59)
transporter activity 338 (415)
ion channel activity 84
neurotransmitter transporter activity 4
Salzburger et al. 38
Supplementary Table 2 - Gene ontology (generic GO slim subset for biological
process). The classification is hierarchical. Indented terms are children of parent terms
listed above. Genes may be assigned to more than one term. For each term, the number of
A. burtoni assembled sequences that match genes to which Gene Ontology annotations
have been assigned at, or below, this general level is given. Note that genes may be
assigned to more than one term and child terms may have more than one parent term. For
parent terms, the total number of A. burtoni assembled sequences is given in parentheses.
Match means that the annotation derives from a gene that was the “best hit” for the A.
burtoni sequence at and e-value <10-12
.
Salzburger et al. 39
Biological Process 2532
anatomical structure morphogenesis 131 (152)
cell growth 26
behavior 24
cell communication 9 (437)
cell-cell signaling 83
signal transduction 381
cell cycle 163
cell differentiation 166 (283)
cell death 138
cell homeostasis 132
cell proliferation 88
cell recognition 8
cellular component organization and biogenesis 359 (659)
cytoplasm organization and biogenesis 1
organelle organization and biogenesis 189 (353)
cytoskeleton organization and biogenesis 159
mitochondrion organization and biogenesis 13
death 0 (138)
growth 18 (42)
metabolic process 213 (1731)
biosynthetic process (583)
translation 313
catabolic process 194
generation of precursor metabolites and energy 82 (299)
electron transport 226
primary metabolic process 0 (1425)
amino acid and derivative metabolic process 65
carbohydrate metabolic process 123
lipid metabolic process 81
nucleobase, nucleoside, nucleotide and nucleic acid metabolic process 230 (563)
DNA metabolic process 146
transcription 288
protein metabolic process 335 (805)
protein modification process 240
secondary metabolic process 83
multicellular organismal development 330 (365)
embryonic development 67
regulation of biological process 660
regulation of gene expression, epigenetic 7
reproduction 66
response to abiotic stimulus 46
response to biotic stimulus 34
response to endogenous stimulus 68
response to external stimulus 41
response to stress 180
symbiosis, encompassing mutualism through parasitism 1
transport 522 (746)
ion transport 305
protein transport 155
viral reproduction 5
Salzburger et al. 40
Supplementary Table 3 - Gene ontology (generic GO slim subset for cellular
component). The classification is hierarchical. Indented terms are children of parent
terms listed above. Genes may be assigned to more than one term. For each term, the
number of A. burtoni assembled sequences that match genes to which Gene Ontology
annotations have been assigned at, or below, this general level is given. Note that genes
may be assigned to more than one term and child terms may have more than one parent
term. For parent terms, the total number of A. burtoni assembled sequences is given in
parentheses. Match means that the annotation derives from a gene that was the “best hit”
for the A. burtoni sequence at and e-value <10-12
.
Salzburger et al. 41
Cellular Component 2293
cell 804 (2216)
intracellular 540 (1883)
chromosome 49 (62)
nuclear chromosome 20
cilium 7
cytoplasm 488 (1367)
cytoplasmic membrane-bound vesicle 61
cytosol 343
endoplasmic reticulum 104
endosome 10
Golgi 65
microtubule organizing center 15
mitochondrion 414
peroxisome 8
plastid 4
ribosome 244
vacuole 13 (39)
lysosome 27
cytoskeleton 204 (216)
nucleus 576 (630)
nuclear envelope 31
nucleolus 60
nucleoplasm 87
plasma membrane 252
extracellular region 62 (184)
extracellular space 134
proteinaceous extracellular matrix 35
organelle 17 (1538)
protein complex 808
unlocalized protein complex 1
Salzburger et al. 42
Supplementary Table 4 - ESTs where the p-distance between Homo sapiens and
haplochromine cichlid amino acid sequences is significantly higher as compared
to other fish species (Danio rerio, Takifugu rubripes, Tetraodon nigroviridis and
Oncorhynchus mykiss). Annotation means that the Homo sapiens gene was “best hit”
for the cichlid sequence (and e-value <10-50
).
Homo sapien best hit
GenBank
acc. cichlid
Ka/Ks
ratio p-dist.
|NP_742034.1| retinol dehydrogenase 10 BJ671564 0.0035 0.27
|NP_057267.2| ribosomal protein P0-like protein; ribosomal protein, large, CN470249 0.0038 0.26
|NP_000017.1| adenylosuccinate lyase; adenylosuccinase BJ673035 0.0044 0.251
|XP_030559.1| PREDICTED: PAR-6 beta BJ697326 0.0044 0.272
|NP_003272.2| troponin I, skeletal, slow; Troponin-I, skeletal, slow DY629797 0.0044 0.385
|NP_001210.1| calumenin precursor DY627455 0.0072 0.424
|NP_003583.2| cullin 1 CN468603 0.0219 0.317
|NP_059133.1| cleavage and polyadenylation specific factor 2; cleavage and BJ683745 0.0267 0.25
|NP_009097.1| phosphatidylinositol-binding clathrin assembly protein; clathrin BJ691629 0.0295 0.469
|NP_001959.1| eukaryotic translation initiation factor 4E; eukaryotic translation BJ686392 0.0302 0.306
|NP_002063.2| guanine nucleotide binding protein (G protein), q polypeptide BJ698454 0.0432 0.301
|NP_056170.1| joined to JAZF1 CN469599 0.0438 0.257
|NP_036265.1| coatomer protein complex, subunit gamma 2; coat protein, BJ672808 0.0484 0.272
|NP_006764.3| DEAD (Asp-Glu-Ala-Asp) box polypeptide 18; Myc-regulated DEAD box BJ700024 0.0547 0.286
|NP_055205.1| staphylococcal nuclease domain containing 1; EBNA-2 co-activator BJ673580 0.0561 0.255
|NP_060104.2| potassium channel tetramerisation domain containing 9 BJ687766 0.0564 0.331
|NP_001737.1| calnexin BJ685700 0.0574 0.4
|NP_006612.2| S-adenosylhomocysteine hydrolase-like 1; S-adenosyl homocysteine DY632021 0.061 0.374
|NP_036205.1| chaperonin containing TCP1, subunit 5 (epsilon) [Homo sapiens] BJ698817 0.0619 0.275
|NP_003679.1| calcium/calmodulin-dependent serine protein kinase (MAGUK family) BJ682470 0.0639 0.286
|NP_612639.1| taube nuss; TAF8 RNA polymerase II, TATA box binding protein BJ703081 0.0664 0.298
|NP_114366.1| poly(rC)-binding protein 2 isoform b; alpha-CP2; poly(rC)-binding CN468947 0.0699 0.327
|NP_036475.2| nicotinamide nucleotide transhydrogenase DY629769 0.0733 0.325
|NP_003926.1| topoisomerase (DNA) III beta; topoisomerase III beta BJ701292 0.0736 0.328
|NP_060802.1| DDX19-like protein; RNA helicase DY625929 0.0757 0.256
|NP_689953.1| 3-hydroxyisobutyrate dehydrogenase BJ690821 0.0759 0.282
|NP_005854.2| neuroepithelial cell transforming gene 1; guanine nucleotide BJ680834 0.0772 0.28
|NP_003793.1| myosin, heavy polypeptide 13, skeletal muscle; extraocular muscle BJ679618 0.0778 0.318
|NP_003306.1| DnaJ (Hsp40) homolog, subfamily C, member 7; tetratricopeptide BJ676351 0.0798 0.31
|NP_078939.3| aminopeptidase-like 1 DY629835 0.0836 0.254
|NP_002586.2| PCTAIRE protein kinase 2; serine/threonine-protein kinase BJ703098 0.0868 0.286
|NP_001410.2| ELAV-like 1; embryonic lethal, abnormal vision, drosophila, BJ685085 0.0871 0.25
|NP_003743.1| eukaryotic translation initiation factor 3, subunit 8, 110kDa; DY626506 0.0895 0.434
|NP_002289.1| L-plastin; plastin 2; Lymphocyte cytosolic protein-1 (plasmin) BJ696087 0.0906 0.283
|NP_002070.1| aspartate aminotransferase 1 BJ700931 0.0944 0.263
|NP_057388.1| ribosomal protein L24-like; homolog of yeast ribosomal like protein DY625961 0.1002 0.323
|NP_000174.1| hydroxyacyl dehydrogenase, subunit B; 3-ketoacyl-Coenzyme A DY627495 0.1026 0.269
|NP_002568.2| p21-activated kinase 2; S6/H4 kinase BJ692414 0.1037 0.405
|NP_443133.1| solute carrier family 25 (mitochondrial carrier; phosphate DY629151 0.1174 0.297
Salzburger et al. 43
|NP_006383.2| nucleolar protein 5A; nucleolar protein 5A (56kD with KKE/D repeat) DY626311 0.1251 0.25
|NP_001961.1| eukaryotic translation initiation factor 5A; eIF5AI BJ692285 0.1317 0.273
|NP_004362.1| coatomer protein complex, subunit alpha; xenin; alpha coat protein BJ690224 0.1395 0.286
|NP_115915.1| 5'-nucleotidase, cytosolic IA; cytosolic 5' nucleotidase, type 1A; BJ701030 0.1501 0.379
|XP_377129.2| PREDICTED: similar to golgi autoantigen, golgin subfamily a, 7 BJ686655 0.1522 0.284
|NP_006400.2| actin related protein 2/3 complex subunit 1A; actin binding protein DY630466 0.1682 0.359
|NP_006730.2| minichromosome maintenance deficient protein 5; DNA replication BJ690838 0.1858 0.284
|NP_039234.1| chloride intracellular channel 4; chloride intracellular channel 4 BJ701465 0.1977 0.402
|NP_060103.1| chromosome 6 open reading frame 37; retinal expressed gene C6orf37 BJ674373 0.2952 0.259
Salzburger et al. 44
Supplementary Table 5 - ESTs where the p-distance between Homo sapiens and
haplochromine cichlid amino acid sequences is significantly smaller as compared
to other fish species (Danio rerio, Takifugu rubripes, Tetraodon nigroviridis, and
Oncorhynchus mykiss). Annotation means that the Homo sapiens gene was “best hit”
for the Cichlid sequence (and e-value <10-50
).
Homo sapien best hit
GenBank
acc. cichlid
Ka/Ks
ratio
p-
distance
|NP_000276.1| Xaa-Pro dipeptidase; proline dipeptidase DY628286 0 0.006
|NP_000060.1| calcium channel, voltage-dependent, L type, alpha 1S subunit; calcium DY627704 0 0.025
|NP_002492.1| nuclear factor I/X (CCAAT-binding transcription factor) BJ684881 0.0188 0.037
|NP_006574.1| peropsin DY628165 0.6 0.04
|NP_694592.1| protein-tyrosine kinase fyn isoform b; proto-oncogene CN469350 0.0121 0.044
|XP_371813.2| PREDICTED: kinesin family member C1 DY627797 0.5 0.051
|NP_742055.1| eyes absent 1 isoform b; Eyes absent, Drosophila, homolog of, 1; BJ693416 0.0349 0.058
|NP_000977.1| ribosomal protein L24; 60S ribosomal protein L24; ribosomal protein BJ684650 0.0419 0.059
|NP_001264.1| chromodomain helicase DNA binding protein 4; Mi-2b BJ687855 0.0305 0.068
|NP_057399.1| GULP, engulfment adaptor PTB domain containing 1; engulfment CN469384 0.0219 0.073
|NP_061133.1| peroxisomal membrane protein 2, 22kDa; peroxisomal membrane protein DY628735 0.4231 0.074
|NP_004437.1| glutamyl-prolyl tRNA synthetase; glutamate tRNA ligase BJ676918 0.012 0.08
|NP_001924.2| dihydrolipoamide S-succinyltransferase (E2 component of BJ679359 0.0255 0.094
|NP_001369.1| dynein, cytoplasmic, intermediate polypeptide 2 BJ703324 0.0073 0.099
|NP_077022.1| mitogen-activated protein kinase associated protein 1; ras DY626351 0.0353 0.101
|NP_073557.3| DiGeorge syndrome critical region gene 8 CN469327 0.0364 0.104
|NP_002075.2| plasma glutathione peroxidase 3 precursor DY627877 1.3043 0.106
|NP_004495.2| HIV-1 Rev binding protein; nucleoporin-like protein RIP; Rab, CN468756 0.0241 0.107
|NP_056067.1| NPF/calponin-like protein; EH domain-binding protein 1 CN469453 0.0015 0.108
|NP_003984.2| CDC-like kinase 2 isoform 1; dual specificity protein kinase CLK2; BJ699169 0.0544 0.109
|NP_056371.1| signal-induced proliferation-associated 1 like 1; signal-induced BJ668716 0.0063 0.11
|NP_000993.1| ribosomal protein P0; 60S acidic ribosomal protein P0; acidic BJ701638 0.053 0.111
|NP_001297.1| claudin 3; Clostridium perfringens enterotoxin receptor 2; rat DY631785 1.5556 0.115
|NP_004312.2| axonal transport of synaptic vesicles; kinesin, heavy chain, member DY632057 0.0393 0.123
|NP_005494.2| amyloid beta A4 precursor protein-binding, family A, member 2; CN469652 0.02 0.127
|NP_006304.1| ubiquitin specific protease 15; deubiquitinating enzyme BJ693203 0.048 0.128
|NP_004969.2| Shaw-related voltage-gated potassium channel protein 4 isoform a; DY631758 0.7808 0.13
|NP_057365.2| STE20-like kinase; STE2-like kinase BJ685775 0.0266 0.137
|NP_783860.1| synaptotagmin IX CN470765 0.0194 0.14
|NP_003281.1| tropomyosin 4 BJ674753 0.0384 0.145
|NP_000981.1| ribosomal protein L27a; 60S ribosomal protein L27a BJ682982 0.0861 0.145
|NP_001261.1| chromodomain helicase DNA binding protein 1 BJ671483 0.0072 0.147
|NP_005075.2| phospholipase A2, group VII; platelet-activating factor DY628278 0.7794 0.15
|NP_000430.3| proprotein convertase subtilisin/kexin type 1 preproprotein; CN469887 3.7763 0.15
|NP_004244.1| phospholipase A2-activating protein; phospholipase A2 activating BJ703212 0.0631 0.15
|NP_056271.2| cofactor of BRCA1; negative elongation factor protein B BJ689040 0.0374 0.153
|NP_001545.2| cysteine-rich, angiogenic inducer, 61; cysteine-rich, anigogenic BJ692405 0.0759 0.154
|NP_004073.2| dynactin 1 isoform 1; p150, Glued (Drosophila) homolog; dynactin 1 CN471126 0.0874 0.155
|NP_114072.1| frizzled 8; frizzled (Drosophila) homolog 8 DY626075 0.0422 0.157
Salzburger et al. 45
|NP_542197.1| alpha 1 type XI collagen isoform C preproprotein; collagen XI, BJ668630 0.035 0.159
|NP_078974.1| mitochondrial glutamate carrier 1 BJ688909 0.0905 0.162
|NP_005678.2| phenylalanine-tRNA synthetase-like, beta subunit; phenylalanyl-tRNA BJ692171 0.0757 0.162
|NP_006197.1| platelet-derived growth factor receptor alpha precursor BJ690723 0.0017 0.163
|NP_003240.1| thimet oligopeptidase 1 BJ691014 0.0778 0.164
|NP_009186.1| xylosylprotein beta 1,4-galactosyltransferase 7; BJ695358 0.0745 0.165
|NP_872579.2| fetal Alzheimer antigen isoform 1; fetal Alz-50 reactive clone 1; BJ701592 0.0349 0.165
|NP_057165.2| palladin; CGI-151 protein BJ690747 0.0521 0.166
|NP_004521.1| matrix metalloproteinase 2 preproprotein; gelatinase neutrophil; BJ694547 0.0645 0.166
|NP_056111.1| dedicator of cytokinesis 9 CN469939 0.0667 0.167
|NP_006651.2| ClpX caseinolytic protease X homolog; energy-dependent regulator of BJ673221 0.0162 0.167
|NP_060004.2| myosin, heavy polypeptide 2, skeletal muscle, adult BJ674015 0.0441 0.167
|NP_954580.1| ubiquitin-conjugating enzyme E2 variant 1 BJ685697 0.1036 0.168
|NP_149351.1| surfeit 4; surfeit locus protein 4; surface 4 integral membrane BJ677148 0.0335 0.169
|NP_000503.1| N-acetylgalactosamine-6-sulfatase precursor; chondroitinase; BJ693255 0.0526 0.169
|NP_001164.1| Rho GTPase activating protein 5 BJ686112 0.0363 0.172
|NP_003613.2| PTPRF interacting protein binding protein 1 isoform 1; liprin-beta 1; BJ693077 0.0186 0.172
|NP_001449.1| gamma filamin; filamin C, gamma (actin-binding protein-280); filamin BJ684635 0.063 0.173
|NP_001348.1| DEAH (Asp-Glu-Ala-His) box polypeptide 9 isoform 1; ATP-dependent
RNA DY630855 0.0189 0.174
|NP_000850.1| 3-hydroxy-3-methylglutaryl-Coenzyme A reductase BJ700149 0.0228 0.176
|NP_631898.1| dipeptidylpeptidase 9; dipeptidyl peptidase 9; dipeptidyl peptidase CN470065 0.0915 0.178
|NP_000628.1| glutathione reductase BJ683618 0.0457 0.178
|NP_005955.1| myosin, heavy polypeptide 10, non-muscle; myosin heavy chain, BJ696841 0.0186 0.179
|NP_932332.1| glucosamine-phosphate N-acetyltransferase 1 BJ691214 0.0418 0.182
|NP_002100.2| histidyl-tRNA synthetase; histidine-tRNA ligase; HisRS; histidine BJ694216 0.0521 0.183
|NP_005782.1| M-phase phosphoprotein 10 DY628233 0.7037 0.184
|NP_065116.2| X-prolyl aminopeptidase (aminopeptidase P) 1, soluble; X-prolyl BJ701510 0.0129 0.184
|NP_203750.3| mitogen-activated protein kinase 8 interacting protein 3 isoform 2; CN468708 0.095 0.185
|NP_037457.3| APG4 autophagy 4 homolog B isoform a; autophagin-1 BJ693415 0.0586 0.185
|NP_002878.2| arginyl-tRNA synthetase BJ697670 0.0023 0.186
|NP_006074.1| RED protein; RD element; prer protein; IK factor; DY627427 0.0392 0.187
|NP_031401.1| TAR DNA binding protein; TAR DNA-binding protein-43 CN468754 0.0486 0.188
|NP_476500.1| endothelial differentiation, lysophosphatidic acid DY630256 0.0536 0.188
|NP_003280.2| tropomyosin 2 (beta) isoform 1; arthrogryposis multiplex BJ683045 0.0466 0.189
|NP_001339.1| death-associated protein kinase 3 BJ674422 0.0642 0.19
|NP_002145.3| heat shock 70kDa protein 4 isoform a; heat shock 70kD protein 4 BJ691037 0.0392 0.19
|NP_000180.2| hexokinase 2; hexokinase-2, muscle BJ689488 0.0042 0.191
|NP_061957.2| cyclin J BJ699157 0.0351 0.193
|XP_371474.2| PREDICTED: plexin B2 BJ684903 0.0552 0.195
|NP_004748.2| small inducible cytokine subfamily E, member 1; endothelial BJ685307 0.0541 0.195
|NP_000149.1| glucan (1,4-alpha-), branching enzyme 1 (glycogen branching BJ688578 0.0542 0.195
|NP_542164.2| oxysterol-binding protein-like 1A isoform B; oxysterol-binding CN468818 0.0156 0.197
|NP_001027.2| ryanodine receptor 3 BJ694127 0.0848 0.198
|NP_000084.2| alpha 1 type V collagen preproprotein BJ670714 0.1171 0.2
|NP_055316.1| ubiquitin carrier protein; ubiquitin-conjugating enzyme E2-24 kD; BJ674752 0.0923 0.202
|NP_036322.2| formyltetrahydrofolate dehydrogenase isoform a CN470753 0.2445 0.203
|NP_002787.2| proteasome beta 4 subunit; proteasome subunit, beta type, 4; DY626588 0.1461 0.203
|NP_002513.1| neuronal pentraxin I precursor CN468907 0.0914 0.204
|NP_057531.2| membrane protein, palmitoylated 6; MAGUK protein p55T; protein CN469732 0.0431 0.204
Salzburger et al. 46
|NP_075053.2| zinc transporter ZTL1; zinc transporter 5 BJ700354 0.0023 0.205
|NP_037428.2| G-protein signalling modulator 2 (AGS3-like, C. elegans); LGN BJ695914 0.0205 0.207
|NP_000687.2| aldehyde dehydrogenase 9A1; gamma-aminobutyraldehyde
dehydrogenase; BJ701067 0.0726 0.207
|NP_056323.2| TCDD-inducible poly(ADP-ribose) polymerase DY625879 0.0033 0.208
|NP_115984.1| protein phosphatase 1, regulatory subunit 9B; neurabin II; BJ690319 0.0715 0.209
|NP_004664.1| angiopoietin-like 1 precursor; angiopoietin 3; angiopoietin Y1 BJ690922 0.0204 0.213
|NP_057375.1| inositol hexaphosphate kinase 2; mammalian inositol DY631850 0.0558 0.213
|NP_001223.1| cardiac calsequestrin 2; calsequestrin 2, cardiac muscle; BJ670795 0.0642 0.217
|NP_114402.1| N-myc downstream-regulated gene 3 isoform a; N-myc CN470617 0.0521 0.219
|NP_002422.1| menage a trois 1 (CAK assembly factor); cyclin G1 interacting DY628021 1.1881 0.221
|NP_055179.1| glyceraldehyde-3-phosphate dehydrogenase, spermatogenic; BJ690842 0.1228 0.222
|NP_060729.2| tetratricopeptide repeat domain 17 DY627279 0.0152 0.222
|NP_775105.1| SNF2 histone linker PHD RING helicase; 2610103K11Rik BJ697939 0.0346 0.222
|NP_006138.1| interferon regulatory factor 6; Popliteala pterygium syndrome BJ685456 0.0388 0.223
|NP_002538.1| oligophrenin 1; oligophrenin-1, Rho-GTPase activating protein BJ672227 0.064 0.224
|NP_057456.1| seven transmembrane domain orphan receptor; transmembrane domain DY629566 0.0786 0.226
|NP_006789.1| UDP glycosyltransferase 2 family, polypeptide A1; UDP DY629774 0.0155 0.228
|NP_116262.2| nm23-phosphorylated unknown substrate; SH3 domain-containing 70 kDa BJ693084 0.0885 0.231
|NP_004206.1| estrogen receptor binding site associated antigen 9; cancer BJ701417 0.0706 0.232
|NP_000184.1| sonic hedgehog preproprotein BJ703040 0.0777 0.233
|NP_849189.1| sideroflexin 2 BJ687393 0.1028 0.233
|NP_110448.2| phospholipase A2, group XIIA; group XII secreted phospholipase A2; BJ703348 0.0386 0.235
|NP_001783.2| cadherin 2, type 1 preproprotein; cadherin 2, N-cadherin BJ680852 0.0642 0.237
|NP_071939.1| zinc finger, DHHC domain containing 6 DY628782 0.3895 0.239
|NP_055048.1| upstream binding transcription factor, RNA polymerase I CN470191 0.0785 0.239
|NP_000144.1| galactosylceramidase precursor; galactocerebrosidase; BJ676310 0.0262 0.24
|NP_000689.1| arachidonate 5-lipoxygenase BJ698470 0.0846 0.242
|NP_006613.1| polo-like kinase 2; serum-inducible kinase BJ697217 0.0071 0.243
|NP_003238.2| thrombospondin 2 precursor BJ689989 0.05 0.244
|NP_060752.1| paraspeckle protein 1 CN468873 0.0041 0.244
|NP_001740.1| calpain, small subunit 1; calcium-activated neutral proteinase; BJ670938 0.0626 0.245
|NP_056210.1| DKFZP434B0335 protein BJ695451 0.4116 0.246
|NP_078932.2| hypothetical protein FLJ22329 BJ697568 0.2964 0.246
|NP_056349.1| zinc finger, ZZ domain containing 3 BJ688763 0.1254 0.247
Salzburger et al. 47
Supplementary Figure 1 – Directed acyclic graph (DAG) of the cichlid specific
Gene ontology (GO) slim for molecular function. Molecular function terms were
selected for inclusion in the ontologies such that leaf nodes include approximately 20
annotated genes. Circle size represents relative number of genes annotated to each parent
node.
Salzburger et al. 48
Supplementary Figure 2 – Directed acyclic graph (DAG) of the cichlid specific
Gene ontology (GO) slim for biological process. Biological process terms were
selected for inclusion in the ontologies such that leaf nodes include approximately 20
annotated genes. Circle size represents relative number of genes annotated to each parent
node.
Salzburger et al. 49
Salzburger et al. 50
Supplementary Figure 3 – Directed acyclic graph (DAG) of the cichlid specific
Gene ontology (GO) slim for cellular component. Cellular component terms were
selected for inclusion in the ontologies such that leaf nodes include approximately 20
annotated genes. Circle size represents relative number of genes annotated to each parent
node.