EFFECT OF SMOOTH AND ROUGH STRAIN BRUCELLA ABORTUS LPS
(LIPOPOLYSACCHARIDES) ON IMMUNE STIMULATION OF
BOVINES
By
RAHEELA AKHTAR (2004-VA-143)
DOCTOR OF PHILOSPHY In
PATHOLOGY
Faculty of Veterinary Sciences UNIVERSITY OF VETERINARY AND
ANIMAL SCIENCES, LAHORE-PAKISTAN
2010
DEDICATION Dedicated to my dear parents who devoted their lives to me. My success was made possible by my father who made me learn to fight against failure, and of course my mother as what I am today is all because of her prayers.
DR. RAHEELA AKHTAR
“IN THE NAME OF ALLAH,
THE COMPASSIONATE,
THE MERCIFUL”.
“Behold! In the creation of the heavens and the earth; in the alternation
of night and day; in the sailing of the ships through the ocean for the
benefit of mankind; in the rain which Allah Sends down from the skies,
and the life which He gives therewith to an earth that is dead; in the
beasts of all kinds that He scatters through the earth; in the change of the
winds, and the clouds which they trail like their slaves between the sky
and the earth -- (Here) indeed are Signs for a people that are wise."
(Surah Al-Baqarah, 2:164)
WISDOM IS THE PART AND PARCEL
OF MY RELIGION,
KNOWLEDGE MY WEAPON,
PATIENCE MY DRESS,
FAITH MY DIET,
AND
SINCERITY MY COMPANION.
(HADIS-E-NABVISAW)
EFFECT OF SMOOTH AND ROUGH STRAIN BRUCELLA ABORTUS LPS
(LIPOPOLYSACCHAIRDES) ON IMMUNE STIMULATION OF
BOVINES
RAHEELA AKHTAR 2004-VA-143
A THESIS SUBMITTED IN THE PARTIAL FULFILLMENT OF THE
REQUIREMENT FOR THE DEGREE
Of
DOCTOR OF PHILOSOPHY
(PhD)
In
PATHOLOGY
UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES, LAHORE.
2010
To,
The Controller of Examinations, University of Veterinary and Animal Sciences, Lahore.
We, the supervisory Committee, certify that the contents and form of the
thesis, submitted by RAHEELA AKHTAR, have been found satisfactory and
recommend that it be processed for the evaluation by the External Examiner(s) for
Award of the Degree.
SUPERVISORY COMMITTEE: Chairman/Supervisor: ______________________________ Prof. Dr. Zafar Iqbal Chaudhary Member: ___________________________________ Prof. Dr. Azhar Maqbool Member: ____________________________________ Prof Dr. Mansur ud Din Ahmad
ACKNOWLEDGMENT
I owe special thanks to the most Gracious, Merciful, and Almighty
ALLAH who gave me the inspiration, thoughts and opportunity to complete
this task. I bow before my compassionate endowments to HOLY PROPHET
MUHAMMAD (peace be upon him) who is, ever a torch of guidance and
knowledge for humanity as a whole.
I deem it as my utmost pleasure to avail this opportunity to express the
heartiest gratitude and deep sense of obligation to my dedicated Supervisor,
Professor Dr. Zafar Iqbal Chaudhary, Dean Faculty of Veterinary Sciences,
Bhaud Din Zikria University, Multan, Pakistan, for his valuable suggestions,
keen interest, dexterous guidance, enlightened views, constructive criticism,
unfailing patience and inspiring attitude during my studies, research project,
and writing of this manuscript. Infect his day and night pursuance and sincere
efforts made this work to fruitful conclusion.
I gratefully acknowledge invaluable help render by my reverend co-
supervisor and renowned Brucella worker Prof. Dr. Yongqun Oliver HE,
Associate Professor and his research team (Prof. George W Jourdian, Dr.
Fang Chen, Charles B Larson, Halen, Kerthi, Andrew and Thom) University
of Michigan Medical School, USA, for giving me a chance to work with them
at world’s sixth ranked university. They gave me time, energy and offered me
solace, substances and insight during the conduct of this study. They were
always available when I needed them. In fact I do not hesitate to say that
without their untiring efforts, it would not have been possible for this work to
reach its present effective culmination.
I have the honor to express my deep sense of gratitude and profound
indebtedness to Dr. Beatriz Arellano, Department of Microbiology and
Immunology, National University of Mexico, USA for providing me with
moral support and all around help for the fulfillment of my research project.
I am deeply thankful to DR. Mansur ud Din Ahmad, Dr Aftab Anjum,
Dr Azhar Maqbool, Dr Muhammad Younus, UVAS, Lahore and Dr Nasir
Mehmood, School of Biological Sciences, University of Punjab, Lahore,
Pakistan for their personal interest, and valuable advices in my research
project, infect their advices will always serve as a beacon of light throughout
the course of my life. They always shared his extraordinary knowledge with me
that illuminated complex issues and enabled me to grasp their significance.
A big share of thanks goes to Dr Jean Namzek and her lab fellows
(Christ and Dolla), Unit of Laboratory Animal Medicine, University of
Michigan, USA for their technical guidance in research work and
constructive suggestions during my research.
I have no words to thank Dr Carlos Abril, University of Bern,
Swetzerland for his help in completion of this uphill task. It is imperative for
me to thank Dr David O Challghan, France, Dr Commander Nicky,
Veterinary Laboratory Agency, UK for their valuable suggestions and
guidance.
Last but not least, I am grateful to my family members for their endless
cooperation, assistance and encouragement during this research project.
DR. RAHEELA AKHTAR
ABBREVIATION
ACD: Anticoagulant citrate dextrose
ACK: Ammonium chloride potassium
APS: Ammonium persulfate
Av-HRP: Avidin- Horse Reddish Peroxidase
BCG: Bacillus Calmette-Guerin
CFU: colony forming unit
Con: Concentrated
CRPMI: Complete RPMI medium with supplements
DCs: Dendritic cells
ddH2O: Double distilled water
DMEM: Debcco’s minimal eagle medium
FBS: Fetal bovine serum
GM-CSF: Granulocyte-macrophage colony stimulating factor
HBSS: Hanks Balanced Salt Solution
iNOS: Inducible nitric oxide synthase
Kdo: 2-keto-3-deoxyoctonate
kDa: KilDalton
LPS: Lipopolysaccharide
LPSs: Lipopolysaccharides
LRT: Lysozyme Release Test
LSM: Lymphocyte separating media
LZ: Lysozyme
MOI: Multiplicity of Infection
NAG: N-acetylglucosamine
NAM: N-acetylmuramic acid
NBT: Nitro Tetrazolium blue
NO2: Nitric oxide
OD: Optical density
OPS: O-polysaccharides
PAMPs: Pathogen-associated molecular patterns
PBS: Phosphate buffer saline
PBMC: Peripheral blood mononuclear cells
PMNs: Polymorph nuclear cells
P.i: Post infection
ROI: Reactive oxygen intermediates
ROS: Reactive oxygen species
RNI: Reactive nitrogen intermediates
RI: Refractive Index
RLPS: Rough lipopolysaccharide
RT: Room temperature
SDS-PAGE: Sodium dodecyl sulfate polyacrylamide gel electrophoresis
SG: Specific gravity
SLPS: Smooth lipopolysaccharide
Spp. : Species
TEMED: Tetramethylethylenediamine
µg Microgram
µl: Microliter
WHO: World Health Organization
Acronyms
RPMI 1640: Roswell Park Memorial Institute
TABLE OF CONTENTS
Dedication Acknowledgement List of Tables List of Figures
S. No. Chapters Page no.
1. INTRODUCTION 1
2. REVIEW OF LITERATURE 7
3. MATERIALS AND METHODS 27
4. RESULTS 46
5. DISCUSSION 89
6. SUMMARY 110
LITERATURE CITED 112
ANNEXURES 137
LIST OF FIGURES
Sr. No. Title Page No.
1 Flow Chart of the Study 27
2 Rapid urea positive test for identification of Brucella abortus 47
3 A: SDS-PAGE of Brucella abortus smooth and rough lipopolysaccharides by silver staining.
B: SDS-PAGE of Brucella abortus smooth and rough lipopolysaccharides fractions by Coomassie blue staining.
49
4 4: Standard curve for Rf values of BioRad precision protein marker.
51
5 Purpald standard curves for LPS quantification 52
6 A: Isolated bovine neutrophils at magnification of 10x
B: Densogram showing isolated bovine neutrophils (a & c) and non neutrophils (b& d).
C: Histograms showing the separation of CH138A positive neutrophils and IgG negative control.
53
54-55
56
7 A: Isolated bovine peripheral blood macrophages are visualized at 10x.
B: Bovine isolated macrophages after seven days of culturing are visualized at 100x. Arrow indicates a mature macrophage.
58
8 Subcultured murine RAW 264.7 macrophages magnified at 10x
59
9 Visualization of lysozyme release using the agarose plate assay. The LPS samples are (a) rough RB51 LPS, (b) smooth S2308, and (c) combined S2308+RB51 LPSs. The concentration of LPS fractions were 200µg/mL per well.
61
10 10: Standard curve of lysozyme release test 62
11 A: Induction of Lysozyme from Bovine Macrophages Treated with rough, smooth and combined Brucella LPS Fractions.
B: Induction of Lysozyme from Murine Mcrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
C: Induction of Lysozyme from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
63
64
65
12 A: Induction of Reactive Oxygen Species from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
B: Induction of Reactive Oxygen Species (ROS) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
C: Induction of Reactive Oxygen Species (ROS) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
67
68
69
13 Nitric Oxide Induction from bovine Macrophages Treated with Rough,
71
14 Sodium nitrite standard curve of for nitric oxide determination
71
15 A: Induction of Nitric Oxide by Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
B: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
C: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
72
73
74
16 A: TNF-α Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
B: TNF-α Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
76
17 A: IL-β Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
B: IL-β Production from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
77
78
18 A: IL-6 induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
B: IL-6 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
79
19 A: IL-10 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
B: IL-10 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
81
20 A : IL-12 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
B: IL-12 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
83
21 CFU Analysis for Determination of Intracllular Survival of Brucella in Bovine Macrophages
85
22 A. Intracellular Survival of Brucella in Bovine Macrophages
B. Intracellular Survival of Brucella in Murine Macrophages.
86
23 PCR Amplification Products from Brucella abortus Positive Lymph Node Samples.
88
LIST OF TABLES
Sr. No. Title Page No.
1 Primer Sequences used for the Detection of Brucella abortus 43
2 A: Rf Values and Log Molecular Weight of Marker Bands.
B: Rf Values and Log Molecular Weight of Sample Bands.
50
3
A: Induction of Lysozyme from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
B: Induction of Lysozyme from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
C: Induction of Lysozyme from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
62
63
64
4
A: Induction of Reactive Oxygen Species (ROS) from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
B: Induction of Reactive Oxygen Species (ROS) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
C: Induction of Reactive Oxygen Species (ROS) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
66
67
68
5
A: Induction of Nitric oxide from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
B: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
C: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPSs Fractions.
72
73
74
Introduction
1
Chapter-1
INTRODUCTION
Brucellosis is a spreading disease transmitted to animals and humans mainly
by direct contact between infected hosts or through oral, respiratory, cutaneous,
ocular and sexual routes (Neta et al., 2009). The six Brucella species exhibit variation
in their host specificities and pathogenicities. Frequency of this disease varies from
country to country, but is higher in agrarian countries including the Middle East and
South West Asia (Pappas and Memish, 2007). Several studies demonstrated that
brucellosis is also endemic in Pakistan and its incidence is increasing (Akhtar et al.,
1990; Ahmad and Munir, 1995; Ramazan, 1996; Nasir et al., 2004; Nasir et al., 2005;
Hussain et al., 2008). Brucellosis has a major impact in terms of economic losses due
to abortion of calves, reduced milk yield, infertility in the male, and potential
infection of humans (Greiner et al., 2009).
The etiological agent of brucellosis is a non-motile, non sporforming and
facultative intracellular bacteria of genus Brucella (Jean, 2005). It is a potential agent
for biological warfare. This has sparked a growing interest in its biology (Department
of Army, USA, 1977).
Brucella LPS is a biologically active component present in the cell
membrane and comprised of three domains:
Polysaccharide or O-side chains or O-antigen (non toxic portion)
Core polysaccharide
Lipid A (toxic portion)
O-antigen is a homopolymer consisting of 96-100 units of α 1-2 linked
perosamine. It is considered the immunodominant subunit of LPS (Caroff et al.,
1984; Ugalde et al., 2003). Structurally, the O-antigen resembles with that of Vibrio
cholera LPS, but is totally different from other enterobacteriaceae LPS (Duenas et al.,
Introduction
2
2004). The Middle portion of the LPS, the core polysaccharide, consists of the
trisaccharide 2-ketodeoxy 3-octonate (Kdo). The embedded part of lipid A is
composed of long chain saturated fatty acids and small amounts of hydroxylated fatty
acids, but lack β-OH mystric acid-linked fatty acids (Aragon et al., 1996). Wild type
and attenuated Brucella strains present smooth or rough types of LPS based on the
presence or absence of an O-chain. The virulence of Brucella species has been linked
with the type of LPS present (Zygmunt et al., 2009).
Brucella LPS is released into body fluids where it is readily ingested by
phagocytic cells through pinocytosis or receptor-mediated endocytosis (Poussin et al.,
1998). Two days after ingestion, Brucella LPS molecules are found inside
macrophages in small vacuoles that coalesce together. The lipid A moiety of LPS is
deacylated and dephosphorylated (Wuorela et al., 1993; Leyva-Cobian et al., 1997).
Brucella LPS is designated as a non-classical endotoxin that plays a pivotal role in
pathogenesis and modifies phagocytosis, phagolysosome fusion, cytokine secretion,
and apoptosis (Beninati et al., 2009). In contrast to most endotoxins, it is
nonpyrogenic, does not induce a localized Shwartzman reaction, does not increase the
susceptibility to histamine and does not activate complement to any significant level.
Despite these properties, it is reported as the major antibody-inducing antigen present
in Brucella infections (Zaitseva et al., 1996).
Invading Brucellae are mainly found in and metabolized by short-lived
neutrophils and long-lived macrophages. Two mechanisms are used, non-oxidative or
oxidative pathways. Under non-oxidative conditions, antimicrobial proteins such as
lysozyme (LZ) and peptides are released, while under oxidative conditions,
brucellicidal oxidants are formed. These oxidants are recognized as reactive oxygen
species (ROS), including superoxide anions, hydrogen peroxide, chloramines,
hydroxyl radicals and hydrochlorous acid (Liautard et al., 1996) and reactive nitrogen
intermediates (RNI) (Jinkyung and Splitter, 2003).
Introduction
3
Killing Brucella requires enhanced macrophage and neutrophil stimulation
that augment the release of LZ, ROS, and RNI and ultimately cell mediated
immunity. Lysozyme has the ability to degrade Brucella cell walls by hydrolyzing
constituent peptidoglycan molecule and cleaving the glycosidic bonds between NAG
and NAM (Mc-Ghee et al., 1970; Maria et al., 2003), ROS damages fatty acid side
chains of the Brucella cell wall (Jinkyung and Splitter, 2003). RNI inhibits cellular
respiration (Gross et al., 1998). Therefore, taken together these metabolic functions
(LZ, ROS, RNI) are of importance for antibrucella activity. Additional support for
this statement comes from the observation that treatment of macrophages with
methylene blue (an electron carrier) enhances killing of intracellular Brucellae,
indicating their susceptibility to ROS. Similarly, inhibition of RNI by NG-
monomethyl L-arginine resulted in blocking of macrophage anti-Brucella activity
(Jiang et al., 1993b).
Activation of immune cells (macrophages and neutrophils) can be achieved
with number of stimulators including bacterial cell-wall components,
lipopolysaccharides (LPS), cytokines, interferon-gamma (IFN-γ) and tumor necrosis
factor (TNF-α). Each of these factors acts independently or in combination to elicit
various states of activation (Connelly et al., 2003). Evidence (Goldstein et al., 1992;
Rasool et al., 1992) exists that of the immune cells stimulators listed, Brucella LPS is
of particularly important to study, because it exhibits minimal endotoxic activity
compared to other stimulators (10,000 times less toxic than E. coli LPS and 1000
times less toxic than Salmonella typhimurium LPS). This property may contribute to
its potential use for immune cell stimulation studies and as an adjuvant in Brucella
vaccine (Goldstein et al., 1992). Attention has been focused on the fact that Brucella
LPS can serve as potential cell stimulator without adverse effect.
Previous studies on Brucella smooth and rough LPS have emphasized
extraction procedures (Alina et al., 2007), biological properties (Schurig et al., 1991;
Aragon et al., 1996), anti-LPS antibodies detection (Khatun et al., 2009), vaccine
Introduction
4
design (Apurba et al., 2002), immunogenic mimicking of LPS epitopes (Benninatic et
al., 2009), macrophage activation in an artificial metastasis model (Schultz et al.,
1978) and comparison of the LPS properties of Brucella with the LPSs of other
species (Escherichia coli and Salmonella) (Jarvis et al., 2002). However, the precise
role of LPS in induction of anti-Brucella immunity remains unresolved (Billard et al.,
2007). To better understand the differential immunological roles of smooth and
rough Brucella LPS, it is critical to study their differential stimulatory activities in
treated macrophages and neutrophils.
The present study focuses on the protective immunological properties of
rough Brucella LPS resulting from enhanced production of LZ, ROS, RNI and pro-
inflammatory cytokines. It is hypothesized that smooth and rough Brucella LPSs
utilize differential stimulatory activities on lysozyme resulting in oxidative burst, and
nitric oxide production which in turn could lead to different brucellicidal reactions of
infected cells (macrophages and neutrophils). In this study the rough and smooth
LPSs were used for the first time to study the reaction of immune cells and to
evaluate the differences in stimulatory activities of individual and combined LPSs.
Background of study
The unique properties of low pyrogenicity, minimal endotoxic shock and good
stimulation of immune cells suggests that Brucella abortus LPS has potential as a
candidate for vaccine preparation or as a vaccine carrier (Ayman et al., 2001).
However, most studies have emphasized the interaction of Brucella abortus LPS with
human and murine macrophages. Limited studies have focused on bovine
macrophages and neutrophils. Studies on the immune response of Brucella abortus in
bovines are of utmost importance since they are the major reservoir of brucellosis and
are responsible for transmitting the disease to humans. Moreover, there is a need for
insight into the differential activities of smooth and rough Brucella abortus LPSs, i.e.
which exhibits greater stimulatory activity. The present study also addresses possible
differential interaction of bovine and murine macrophages with Brucella abortus
smooth, rough, and with combined (rough + smooth) LPSs.
Introduction
5
Mice are not the natural host of Brucella and display a certain resistance to infection
(Zhan and Cheers, 1998). Much of the work has been performed in the mouse model
due to its convenient use as compared to other lab animals. In the present study, the
murine macrophages were compared with bovine macrophages after stimulation with
Brucella abortus LPSs.
Introduction
6
Objectives
The present study was designed to achieve the following objectives:
1- To extract, purify and characterize Brucella abortus smooth and rough LPSs.
2- To explore the mechanism of stimulation of bovine macrophages, neutrophils
and murine macrophages by Brucella rough and smooth LPS (separately and
in combination)
3- To determine (a) the outcome of infection by observing the interaction
between the pathogen (Brucella) and (b) LPS stimulated immune cells and to
find out the type of LPS (smooth, rough or combined) and optimal
concentration (00, 0.02, 0.2, 2, 20, 200 µg/ml) of Brucella LPS that yields
maximum stimulatory activity.
4- To compare the susceptibility of murine and bovine macrophages to Brucella
LPS stimulus in order to determine differences in species susceptibility.
5- To determine the major cellular organelles involved in Brucella death by
comparing LPS mediated stimulation of bovine macrophages and neutrophils.
Review of Literature
7
Chapter-2
REVIEW OF LITERATURE
Brucellosis or Malta fever is a serious public health problem caused by a
Gram-negative bacterium of the genus Brucella. The genus contains six species.
These are Brucella abortus, Brucella melitensis, Brucella suis, Brucella neotomae,
Brucella ovis and Brucella canis. Brucellosis has been an emerging disease of interest
since 79 A.D when skeletons of Romans buried with carbonized cheese revealed
brucellosis lesions on examination by scanning electron microscope (Capasso, 2002)
and later the discovery of Brucella melitensis by Bruce in 1887 until the identification
of marine reservoirs (Godfroid et al., 2005). Bovine brucellosis is characterized by
abortion in last trimester of gestation, stillbirth and weak calves. The commonly
observed clinical signs are pyrexia, anorexia, polyarthritis, meningitis, pneumonia
and endocarditis. The postmortem lesions include in placentitis in dam and interstitial
pneumonia in aborted foetus (Sauret and Vilissova, 2002). Human infection is due to
consumption of contaminated and/or unpasteurized milk, and milk products (cheese),
or laboratory acquired infection. (Young, 1983). Brucellosis is currently ranked at
number fifth on the list of important diseases of the world (Corbel, 1997). In some
geographical areas, Brucella melitensis has emerged as a cause of brucellosis
infection in non-bovine species including ovines and caprines. Brucellosis has been
an important animal and health issue in Pakistan from many years (Sheikh et al.,
1967). The incidence of diseases is very high in different districts of Punjab province
(Akhtar et al., 2010c). It not only affects humans zoonotically, but also exerts an
adverse influence on the Pakastani economy by perturbing the livestock sector. This
sector comprises 49.6% of Pakastan’s agriculture income and shares 10.4% of its
national gross domestic product (GDP) (Economy survey 2008-09). Consumption of
Review of Literature
8
contaminated foods and occupational contact with animals remain the major sources
of infection. Human-to-human transmission by tissue transplantation or sexual
contact has been rarely reported. Brucellosis can be diagnosed by culturing and
isolating the pathogen and is standardized by the rose Bengal plate test (RBPT), milk
ring test (MRT), serum agglutination (SAT), complement fixation (CFT) and PCR
assay. Prevention of human brucellosis depends on the control of this disease in
animals.
Extraction and Purification of Brucella abortus Rough and Smooth Strains LPS The presence of LPS as round bodies embedded in Brucella cell wall was
reported by Bobo and Foster, (1964). With the aid of electron microscopy they
proposed that LPS was a subunit of cell wall. They used several sequential treatments
for lysis of Brucella cell wall including trypsin, pronase and lysozyme. These
reagents were more effective for the extraction of LPS than ribonuclease, pepsin,
lipase and non-enzymatic agents. The properties of Brucella LPS were studied by
Nicolas et al., (2006) who demonstrated by biochemical techniques and electron
microscopy that Brucella abortus LPS was recirculated through macrophages.
Furthermore, LPS was shown to act as detergent and was able to remain intact for
many months in macrophages by resisting destruction by methyl β-cyclodextrin
through the development of rigid surface membrane complexes. Many Brucella
workers developed different methods of LPS extraction to observe the relationship
between the extraction procedure and the biological properties of Brucella LPS.
Westphal and Tann, (1965) showed that rough Brucella LPS could isolated from an
aqueous phase whereas smooth LPS could be purified only from the phenol phase.
This was confirmed by Redfearn (1960) who showed that Brucella rough and smooth
LPSs were not only different from each other in their mode of isolation, but also with
respect to their biological properties. Baker and Wilson (1965) compared the
chemical composition and biological properties of B. abortus LPS and E. coli LPS
(based upon nitrogen, phosphorus, fatty acid amides, ester, hexose, hexosamine and
Review of Literature
9
total fatty acids). They found that LPS preparations from E. coli possessed much
greater biological activity of hypoferremia and lethality in mice than B. abortus LPS.
Smooth and rough Brucella LPS preparations were also compared by Moreno et al.,
(1979), using two different modifications of phenol-water extraction method
(Westphal and Tann, 1969). They used chemical, immunological and SDS-PAGE
analysis to determine the difference in properties of Brucella rough and smooth LPS.
They not only revealed differences in the protein contents of two fractions (S-LPS
and R-LPS) but also in their isolation characteristics. The smooth LPS was obtained
from the phenol phase and the rough LPS was obtained from the aqueous phase. The
differences noted in biological activity of LPS were on per mass basis. The LPS
associated proteins were not the part of either LPS structure; rather they were firmly
attached to S-LPS and were not removed during purification.
Differences in the biological properties of smooth and rough Brucella LPSs
found by various laboratories prompted development for more effectual isolation
methods of each LPS. Jones et al., (1976b) demonstrated that both S and R LPS could
not be consistently extracted by previously developed methods as that the aqueous
phase was totally deficient in LPS while phenol phase had chief fraction of LPS.
Darveau and Hancock, (1983) developed an improved method for the extraction of
both smooth and rough LPS with high yields (51 to 81%) and purity. They used a
combination of cell breakage and nucleic acid digestion along with ethanol water
extraction method. The dried bacterial cells were preferred over wet cells for isolation
of large quantity of LPS. The contamination with protein (0.1%), nucleic acids (1%),
lipids (2 to 5%), and other bacterial products was much less than that obtained using
previously used methods. Subsequently, it was affirmed by the studies of Kreutzer et
al., (1979 a) that smooth intermediate (45/0) LPS was present in the aqueous and
phenol phases. Rough LPS (45/20) was only present in the aqueous phase. It was
proposed that in addition to being toxic, the phenol-soluble S-LPS could be a major
virulence factor in intracellular survival of B. abortus. The authors also proposed that
Review of Literature
10
in addition to LPS, the rest of the components of aqueous and phenolic phase also
differed. LPS in the phenolic phase contained nine to 16 times less heptose and lower
amounts of dideoxyaldoses than did the aqueous phase. The major neutral sugars
found were glucose, galactose, and mannose. fβ-hydroxymyristic acid which is a
fatty acid and a common marker of enteric LPS, was absent. The only fatty acids
present, hydroxylated and nonhydroxylated with chain lengths of 16, 18, and 20
carbons respectively (Kreutzer et al., 1979 a), were present in the higher amounts.
Detailed characterization of the LPS from rough B. abortus, B. melitensis, B. ovis and
B. canis LPSs was made by Moreno et al., (1984). These authors also compared the
structural properties of Brucella rough and smooth LPSs side by side and
demonstrated a granular pattern on electron micrograph of Brucella R-LPS. This was
in contrast to characteristic lamellar structures found for S-LPS. The chemical,
physical and serological characteristics of Brucella rough and smooth LPS were
studied and monospecific mouse sera were developed against B. ovis R-LPS. Another
advanced, modified and specific method for Brucella rough LPS extraction was
described by Galanos et al., (1969). The extraction mixture was monophasic,
containing aqueous phenol, chloroform and petroleum ether. This method offers the
advantage that it can be carried out below 10°C and is easy to perform and yields
higher amounts of LPS than phenol-water extraction procedures.
Much of the LPS extraction had been performed with Brucella smooth strains
(Moreno et al., 1981; Caroff et al., 1984; Moriyon and Montanes, 1985; Aragon et
al., 1996) using Moreno’s method. However, this method has some drawbacks.
Therefore, Wu et al., (1987) attempted to modify Moreno’s procedure by employing
quick freezing and thawing to lyse B. abortus cells. This was followed by
ultrasonication to eliminate non-membrane-bound material, extraction with phenol
and washing ten times with water to remove chromogen, polysaccharides and nucleic
acids (Velasco et al., 2000). Protein contamination varied between 16% and 42%
(wt/wt) as estimated by the dye binding test using Coomassie Brilliant Blue (G-250)
Review of Literature
11
as suggested by Bradford et al., 1976, and 17% and 60% by using the Lowry phenol
method (Lowery et al., 1951) with bovine serum albumin as a standard. Contrary to
previous techniques used, a higher yield of smooth LPS (3.6% to 7.7%) was obtained.
Suarez et al., (1988) introduced the use of hot saline for LPS extraction from
rough Brucella LPS. The pelleted LPS was analyzed for lipids, sugars, Kdo content,
and by immunoelectrophoresis and SDS-PAGE methodologies.
By the end of 1980, many techniques for extraction of Brucella rough and
smooth LPS had been reported. In an attempt to select the best technique, Malikov et
al., (1989) compared various methods of LPS extraction. LPS was purified from
Brucella virulent and vaccine strains using phenol water extraction. They used
Bovin's method of LPS extraction (Bovin and Mesrobeanu., 1935) and a mild alkaline
hydrolysis method, separately and in conjunction. Each LPS preparation (rough and
smooth) was analyzed for its chemical composition, immunological characteristics
and serological activity. The results suggested that the mild alkaline hydrolysis
method according to Bovin's protocol was optimal and the resulting LPS preparation
from virulent strains yielded a more consistent and sensitive product for use for the
passive hemagglutination tests than LPS from a vaccinal strain. Their work also
showed that the soluble complex of lipid A obtained from Brucella LPS had
serological activity. Garin-Bastuji et al., (1990) also combined several methods for
the extraction of smooth LPS from different biovars of B. abortus, B. melitensis, and
B. suis. They used a combination of hot phenol-water treatment, hot sodium dodecyl
sulfate followed by treatment with proteinase K and extraction with dimethyl
sulfoxide.
All methodologies that had been used up to this point in time for extraction of
either rough or smooth Brucella LPS were quite laborious and time consuming.
Sunsequently, Yi and Hackett (2000) developed a fast method of LPS extraction
using a commercial RNA-isolating reagent that facilitated the separation of LPS or
lipid A from small amounts of bacterial cells. The method did not require specialized
Review of Literature
12
equipment and permit the use of large numbers of samples. The major constituents of
the commercial RNA isolating reagent (Tri-Reagent) were phenol and guanidinium
thiocyanate contained in aqueous solution. Bacterial cell membranes were lysed with
guanidinium thiocyanate, which eliminated the need for specialized equipment. LPS
and its main components such as lipid A were analyzed and the results compared to
the conventional hot phenol-water extraction. SDS-PAGE analysis revealed that the
LPS fraction was cleaner and less degraded, although loss of phosphate or fatty acyl
side chains from lipid A occurred. This method also yielded preparations with low
free fatty side chains and phosphate content. The total phosphate content was up to
11% by this method compared to 58% by hot phenol-water extraction. This method
required only two days for the isolation of LPS as compared to the hot phenol-water
extraction that took two weeks. Alina et al., (2007) obtained highly purified LPS
preparations by repurification of commercial or laboratory prepared LPS. They used
three methods for the repurification including; heat-detergent promoted
repurification, heat promoted repurification and acid-solvent promoted repurification
method. The last method was further selected and used. They also used triethylamine-
deoxycholate sodium for repurification after extraction of LPS and major
contaminants removal. This method is applicable to various LPS preparations and
does not require the use of phenol. The integrity and purity of the Brucella LPS
obtained was established by SDS-PAGE and matrix-assisted laser desorption
ionization mass spectrometry.
LPS Purification
Brucella LPS was purified by Zygmunt et al., (1988) using ultrafiltration,
repetitive gel filtration, high-performance liquid chromatography, SDS-PAGE, gas-
liquid chromatography mass spectroscopy, and 13C and 1H NMR spectroscopy.
Phillip et al., (1989) found that purification of LPS using proteinase K-treatment was
advantageous since proteinase K did not change the immunochemical, and other
defining properties of LPS. Butanol was used to extract LPS from smooth B. abortus
Review of Literature
13
(S2308 and S-19). These procedures together yielded LPS preparations containing
less than one percent proteins. The LPS obtained was analyzed by chemical analysis,
SDS-PAGE, cesium chloride gradients, electron microscopy and gel
immunodiffusion. Furthermore, the butanol procedure proved the method of choice
for the extraction of LPS from B. abortus. Analysis of proteinase K treated LPS
preparations from sixteen smooth Brucella strains by SDS-PAGE after periodic acid
oxidation and silver staining revealed two differing profiles. LPS from B. abortus
was exhibited as regularly spaced narrow bands; while for theB. meliensis LPS, gels
contained regularly spaced doublets (Dubray and Limet, (1987).
SDS-PAGE Analysis
Sodium dodecyle sulfate polyacrylamide gel electrophoresis (SDS-PAGE)
uses an anionic detergent (SDS) to denature proteins. The protein molecules are
“linearized”. One SDS molecule binds to two amino acids. The charge to mass ratio
of the denatured proteins in a mixture is constant. Therefore, the protein molecules
moves toward the anode in the gel based on their molecular weights only, and thus
are separated.
A modified silver staining method for LPS detection was developed by Tsai
and Frasch, (1982). The silver stain is 500 times more sensitive than periodic acid-
Schiff stain of LPS and is able to detect less than 5 ng of R-LPS. Polypeptide and
polysaccharide components of B. abortus smooth LPS (S99) were analyzed by
Dubray and Charriaut, (1983) using SDS-PAGE gels stained with Coomassie blue or
silver staining. Triton X-100 was used to separate the cell wall from cytoplasmic
material prior to LPS isolation. Triton X-100 is a non-inonic surfactant which has a
hydrophilic polyethylene oxide group. The surface active agents (surfactants) have
been known for many years to possess bactericidal activity and in some cases
bacteriolytic activity as well. The bactericidal effects of ionic surfactants were
attributed to their ability to electrostatically bind to, and denature cellular enzymes
(Volko, 1946) or to disrupt the cellular components (Hotchkiss, 1946). The liquid
Review of Literature
14
effects of surfactants on bacteria; however, require a more complex interpretation due
to the presence of rigid peptidoglycan layer surrounding bacterial cells which is not
present in erythrocytes. Triton X-100 may induce cellular lysis by releasing a lipid
inhibitor of the cellular autolytic enzyme. The SDS-soluble fraction revealed two
major components: a high molecular weight broad band (S-LPS) and a 43kDa
polypeptide band. The B. abortus outer membrane was composed of four major
components: LPS (43kDa) and polypeptides (36-37-38kDa) and glycopeptides (25-
26-27kDa). The S-LPS fraction appeared as broad band of high molecular weight as
compared to the multiple regularly spaced bands of high molecular weight found in
Escherichia coli S-LPS gels. A phenol extracted, alkali-treated LPS preparation from
the vaccine strain (S 19) of B. abortus was analyzed by Sowa et al., (1986) using
SDS-PAGE and silver staining. Their gels revealed ten polydispersed bands.
Nitrocellulose immunoblots showed that all ten reacted with bovine anti-B. abortus
polyclonal sera. Only six bands were antigenically reactive with anti-B. abortus O-
antigen murine monoclonal antibody. These findings are attributed to differences in
either the core or O-antigen side chain structure and covalently bound protein.
Schurig et al., (1991) suggested that the SDS-PAGE profile of Brucella rough (RB51)
LPS was not sufficient evidence for the absence of O-chain. Therefore, they
performed Western blot analysis with a monoclonal antibody (BRU 38) specific for
the O-chain of smooth Brucella LPS. Their results established that R-LPS lacked O-
chain as compared to the parenteral smooth strain 2308, although rough RB51
resembled its parental 2308 strain in its ability to metabolize erythritol. Moreover,
intraperitoneal inoculation of RB51 strain into mice or undergoing in vitro passages
did not convert it back to the smooth form. Freer et al., (1995) measured the
molecular size of each LPS component (O-polysaccharide, core oligosaccharide and
lipid A). SDS-PAGE and Western blotting revealed antigenic heterogeneity in
Brucella LPSs. Three dense high-molecular-weight bands related to S-LPS, a low-
molecular-weight band corresponding to the O-antigen were absent in rough LPS. B.
Review of Literature
15
abortus R-LPS displayed four bands. On other hand, Cloeckaert et al., (2002) found
that RB51 strain produced low levels of a M-like O-antigen. This group used
monoclonal antibodies directed against O-polysaccharide and performed SDS-PAGE
along with Western blots to show that B. abortus RB51 lacked the O-side chain.
Review of Literature
16
Purpald Assay
Although the increasing periodate concentration and reaction time of LPS
with sodium periodate can affect efficacy of this assay, still it is an improved method
for LPS quantification (Quesenberry and Lee 1996). The utility of this method is
shown by low Kdo content attributed to incomplete hydrolysis as well as conversion
of a portion of the Kdo to inert molecular species during hydrolysis (Brade et al.,
1983; McNicholas et al., 1987). These problems were circumvented by using the
purpald assay. Lee and Tsai, (1999) for first time used the purpald assay for the
quantification of lipopolysaccharide. This technique was based on the oxidation of
vicinal glycol groups in Kdo. After reaction with purpald reagent, the formaldehyde
released was measured at 550 nm.
Neutrophil Isolation
Neutrophils are the first line of defense against infections and are considered
the major cells involve in resisting invading Brucella. Several methods for the
isolation of neutrophils from different animal species have been suggested. Isolation
of neutrophils from human blood using enzymes such as Escherichia fmundii endo-β-
galactosidase and neuraminidase along with direct probe mass spectrometry is
possible, but the results are not comparable with the routine dextran isolation method
(Macher and Klock, 1981). A fast and simple magnetic cell sorting system based on
the principle of using specific cell surface markers could be helpful for separation of
large numbers of neutrophils (Forsell et al., (1985). The use of gradient magnetic
columns has been suggested by Milteny et al., (1990). The isolated cells, after
staining with biotinylated antibodies (fluorochrome-conjugated avidin and
superparamagnetic biotinylated-microparticles), were passed through magnetic
column. The labeled cells retained while the unlabelled cells passed through the
column. More than a million cells could be isolated in fifteen minutes. The use of
flow cytometry employing fluorochrome tagged cells and light scattering fluorescent
parameters did not alter the viability and proliferation of the isolated neutrophils. The
Review of Literature
17
findings of Cotter et al., (2001) also suggested the potential of negative selection for
the immunomagnetic separation for the isolation of viable, highly pure and unaltered
neutrophils. They suggested that this technique could be used for in vitro and in vivo
inflammatory studies and provided neutrophils. Blood was incubated with antibodies
specific against surface markers of non-desired cells and subsequently with secondary
antibody-coated magnetic beads. The purity of the neutrophils in the effluent was
>95%, and had with <97% viability. Differences in surface L-selectin and CD18
expression of isolated neutrophils were compared with neutrophils in whole blood
using flow cytometry. On the basis of a comparison of the magnetic separation to
conventional percoll density gradient techniques in terms of neutrophil function,
purity, yield, morphology, oxidative burst and pre-activation, supports the use of
magnetic separation as a simple and fast method. This method yields highly purified
(99%), functional neutrophils. Neutrophils isolated by the percoll method contained
6% eosinophils. Each method yielded preparations contaminated with platelets. Using
magnetic separation, CD11b expression of neutrophil activation was lower than that
found with ficoll separation, but magnetic separation did not change oxidative burst
(Zahler et al., 1997). Another comparative study by Watson et al., (1994) showed that
cells isolated by combined dextran/ficoll procedure had a greater ability to produce
reactive oxygen species (ROS) than cells isolated by a one-step procedure using
Mono-Poly Resolving Medium (M-PRM). Cells isolated by the M-PRM method
could be primed in vitro more efficiently by GM-CSF than cells isolated by ficoll.
The ability of neutrophils for ROS generation and CD11 expression in response to
fMet-Leu-Phe was increased 10-fold if blood was pre-incubated with GM-CSF, rather
than the neutrophils in whole blood.
In order to circumvent problems associated with density gradient material, Oh
et al., (2005) used commercially available separation medium containing sodium
metrizoate and Dextran 500. After layering whole blood over the density gradient
medium, the samples were centrifuged and the residual erythrocytes lysed. The
Review of Literature
18
neutrophils were washed, counted, and resuspended in buffer to desired
concentration. This modified method provided preparations with >95% purity and
>95% viability.
Although the density gradient separation and magnetic separation are the two
most common techniques in use they are not easy to perform because of the laborious
methodology. In order to replace these techniques Dodek et al., (1991) developed a
one step method for neutrophil separation. Perfusate (0.2% gelatin and 0.1 % glucose
in phosphate buffer saline) was pumped into an eluriator rotor at 2370 rpm followed
by loading with twenty milliliters of anticoagulated porcine blood mixed with 60 mL
perfusate. The concentration of neutrophils was measured in each fraction. Percentage
of total neutrophils was plotted against flow rate. This method yielded neutrophil
preparations of 95.1% that retained their morphology and contained intact granules
and lobulated nuclei. The isolated neutrophils produced superoxide in the presence of
phorbol myristate acetate (PMA) and phagocytosed zymogen particles. The
characteristics of neutrophils isolated by this method were not different from cells
obtained by conventional sedimentation methods. Using this method, human
neutrophil preparations were 94% pure.
Redbruch and Recktenwald (1995) isolated peripheral neutrophils, and
reviewed techniques for their isolation and analysis. Most isolation studies for
neutrophils have been performed on human blood samples (Saeed and Georgina
1998; Stickle, 1996).
Murine neutrophils were partially characterized by Gaines et al., (2005). They
studied multiple functional responses such as chemotaxis, adhesion, transmigration
across endothelial cells, phagocytosis, and pathogen destruction.
Stie and Jesatis, (2007) used two isolation procedures for the isolation of
neutrophils: a gelatin-based method and a pyrogen-free dextran-based method.
Neutrophils isolated by the gelatin method stimulated more superoxide generation as
compare to the neutrophils isolated by dextran method. Similarly the percentage of
Review of Literature
19
cell adherence was more in the neutrophils isolated by gelatin based method than the
dextran based method. Similar results were obtained after neutrophil stimulation with
LPS, TNF- and GM-CSF. The authors also concluded that stimulation of suspended
and circulating neutrophils had a relationship with reorganization of the plasma
membrane.
The effect of different anticoagulants such as EDTA, citrate and heparin on
isolation of human neutrophils was studied by Freitas et al., (2008). Each of three
anticoagulant tested yielded different populations of neutrophils. On the basis of their
calcium levels and reaction to phorbol myristic acetate (PMA), EDTA was suggested
to be a superior reagent for the isolation of neutrophils. Rezapour and Majidi., (2009)
found that due to contamination with lymphocytes, commonly used isolation methods
for neutrophils were not acceptable and proposed a new and easy method for
neutrophils isolation using meglumine compound. The neutrophils were not deformed
and of high purity (79.5%) and viability (>97.5%).
Isolation and Culturing of Bovine Macrophages
Price et al., (1990) isolated bovine peripheral blood macrophages and
evaluated their role in natural resistance to bovine brucellosis. They used mammary
and blood derived macrophages from 22 animals including 11 heifers and 11 bulls.
They suggested that macrophages from naturally resistant cattle exhibited a superior
ability to regulate in vitro intracellular replication of B. abortus. Furthermore,
mononuclear phagocytes from more than 80% of resistant cattle regulated
intracellular replication of B. abortus better than mononuclear phagocytes from
susceptible cattle. After isolation and use of various experimental indicies including
phagocytosis, and ROS production, the recovered cells were deemed satisfactory for
experimental use (Bounous et al., 1993). Macrophages from one animal exhibited
decreased levels of phagocytic activity, intracellular killing and ROS production. The
differential ability of macrophages to phagocytize, and to kill B. abortus was not
related to each other, or to oxidant production. Qureshi et al., (1996) obtained
Review of Literature
20
peripheral blood monocyte-derived macrophages from cows for the study of in vitro
replication of Brucella abortus in bovine macrophages. The macrophages from
resistant cows were able to prevent the intracellular growth of Brucella abortus than
the macrophages from susceptible cows. These resistant and susceptible cows were
also challenged with in vivo injections of Brucella abortus strain S2308. The in vivo
results showed that the susceptible cows became more resistant for Brucella infection
after in vivo injection of Brucella abortus strain S2308.
Review of Literature
21
Lysozyme Release Assay
Lysozyme is an enzyme and can catalyze the hydrolysis of the bacterial cell
wall. Cell lysis, or bursting, that usually follows is the basis for lysosome bactericidal
activity in vivo. Most assays for lysozyme are turbidometric, measuring the clearing
of a suspension of dead bacterial cells as their walls break down. The Petri dish
method is somewhat similar in principle to the widely used agarose gel diffusion
assay for antibiotics. The lysozyme produced by macrophages and neutrophils are
diffused into Micrococcus lysodeikticus cells that are spread on agarose producing a
visibly cleared circle within which bacteria have been lysed.
Factors influencing lysozyme production such as phagocytosis were
determined by (Gordon et al., (1974). They noted 70% of lysozyme was sedimented
with azurophilic and specific granules of rabbit neutrophils. High concentrations of
lysozyme were also detected in alveolar macrophages. Further, investigation showed
that lysozyme production increased upon BCG stimulation and phagocytosis. On the
other hand, mouse peritoneal macrophages and human monocytes also secreted
substantial levels of lysozyme. Riley and Robertson, (1984) compared lysozyme
production from azurophil and specific granules of bovine and human neutrophils
stimulated with Brucella smooth-intermediate 45/0 and rough 45/20 strains. They
observed that bovine neutrophils had a greater killing ability against a smooth-
intermediate strain of B. abortus (45/0) than did human neutrophils. However, both
types of neutrophils killed rough Brucella at the same rate. They further found that
smooth-intermediate strains were more resistant to intraleukocytic killing in each type
of neutrophil than were rough strains. B. abortus could not stimulate an effective
level of degranulation for neutrophil stimulation after ingestion as compared to
extracellular organisms such as Staphylococcus epidermidis. Moreover,
myeloperoxidase and lactoferrin released from neutrophils infected with S.
epidermidis were four and two times higher respectively, than neutrophils infected
with B. abortus 45/0. Evidence was presented that B. abortus LPS and lipid A
Review of Literature
22
induced lower levels of ROS and lysozyme in human neutrophils in dose dependent
manner. The low levels of lysozyme induced by Brucella LPS was also confirmed by
Rasool et al., (1992). They postulated that this low induction of lysozyme by Brucella
LPS could contribute to Brucella survival inside phagocytes. Lysozyme production
was increased in the presence of autologus plasma. Brucella LPS and lipid A
stimulation resulted in a 100 fold lower lysozyme release than did Salmonella LPS.
Nitroblue Tetrazolium Assay
Reactive oxygen species (ROS) produced by activated macrophages
and neutrophils reduce Nitroblue tetrazolium (NBT) dye, a colorless compound, to a
dark blue formazan by oxygen metabolites found in immune cells. NBT gives an
indirect measure of oxidative metabolism; as ROS are produced; more formazan is
produced as is indicated by increased absorbance. Activated cells produce increased
levels of reactive oxygen species. Therefore, this assay is used as a parameter to
determine macrophage and neutrophil activation. Canning et al., (1985) reported that
in vitro interaction of Brucella S-LPS with bovine neutrophils lowered NBT
reduction and inhibited the myeloperoxidase-hydrogen peroxide-halide system. This
may be a possible reason for the escape of smooth Brucella from intracellular killing
by neutrophils. On other hand, ROS production was not down regulated by heat-
killed B. abortus. Oxidative metabolism of neutrophils and peritoneal macrophages
increases after experimental infection with sporotrichosis in contrast to non-infected
neutrophils and macrophages (Rodolfo and Mendoza, 1986). In 1988, Canning et al.,
evaluated the ability of nonopsonized B. abortus to stimulate superoxide anion
production in bovine neutrophils. B. abortus stimulation was dependent on presence
of bacterial associated opsonins. The ability of Brucella species to inhibit ingestion
by neutrophils or macrophages explained why the oxidative burst had a significant
role in antibacterial process of phagocytic cells and Brucella survival was related to
evasion from cellular defenses (Liautard et al., 1996). Further, in vivo and in vitro
Review of Literature
23
studies by Baldwin and Parent (2002) also revealed anti-Brucella activity of reactive
oxygen intermediates.
Nitric Oxide Production in Macrophages and Neutrophils
Nitric oxide (NO2) is a product of immune cells and directly involved in
killing of intracellular Brucella. The Griess reaction may be used to determine NO2
concentrations (Becker et al., 2000). The reaction is based on enzymatic conversion
of nitrate to nitrite by nitrate reductase. Stimulated macrophages and neutrophils
produce elevated levels of nitric oxide to counteract infection. Nitric oxide is thought
to be involved as a defense mechanism against Brucella (Margaret et al., 2002), but
the efficiency of Brucella killing is not same in all the cells and also varies in
different species. Gross et al., (1998) described that in mice B. suis was sensitive to
NO2 killing whereas in rat macrophages, B. abortus LPS did not induce high amount
of NO2 and could not kill Brucella. These results explained the acute outcome of
Brucella infection in the rat, the low frequency of septic shock and prolonged
intracellular survival of Brucella (Lupis-Urrutia et al., 2000). The production of nitric
oxide also varies with different stimuli within the same species or same types of cells.
Intracellular survival of B. abortus revealed that as compared to E. coli LPS, it
released less nitric oxide. Nitrite production was increased by 140 μM after 72 hrs
exposure to 10 ng/mL E. coli LPS, while in B. abortus infected macrophages, nitrite
concentration was 60 μM after 72 hrs of infection. The number of surviving Brucella
decreased, from 6 to 24 hrs, in the presence of nitrite accumulation and NO2 increased
killing of intracellular B. abortus Gangtsetse et al., (2003).
When scientists recognized that nitric oxide had remarkable antibrucella
activity, research was conducted to confirm this fact in a number of cell types,
especially Brucella carrying phagocytes. Gross et al., (2003) reported that in human
macrophages, nitric oxide was not effective against Brucella since the NO2
production was not sufficient. Thus, lack of NO2 production in isolated human
macrophages infected with Brucella could not eliminate Brucella. To further explore
Review of Literature
24
the relationship of enhanced nitric oxide production and Brucella survival, three
strains of B. abortus and two macrophage cell lines were studied by Serafino et al.,
(2007). It was found that NO2 production was higher in macrophages infected with
rough RB51 strain than macrophages infected with smooth Brucella strains S19 and
2308. Since these observations were limited to a single bacterial species, Petra et al.,
(2008) compared in vitro nitric oxide induction in rat, bovine and porcine
macrophages, and in vitro upon stimulation with LPS and other stimulators including
phorbol myristate acetate, ionomycin and recombinant interferon gamma. The Griess
reaction showed differences in NO2 production in pulmonary alveolar macrophages
in all the species tested. The highest amount of NO2 was produced by rat
macrophages and the lowest in bovine macrophages. Porcine macrophages failed to
produce NO2.
Cytokine ELISA
Cytokines are protein, and are classified into two categories: pro-
inflammatory cytokines and anti-inflammatory cytokines. The pro-inflammatory
cytokines include TNF-α, IL-1α, IL-1β, IL-6, IL-12 and IFN-γ. The most important
anti-inflammatory cytokine is IL-10.
TNF-α was considered to be necessary for full expression of macrophage
antibrucella activities. Macrophages were able to kill intracellular Brucellae in 12 to
24 hrs following infection (Jiang et al., 1993b). Maurin et al., (2001) observed that
B. suis Omp25 could not induce TNF- in human macrophages due to some non-
identified protein. Negative regulation of TNF- was observed by Bruce et al., (2002)
in human macrophages. They found that B. abortus rough LPS activated the same
mitogen-activated protein kinase signaling pathways (ERK and JNK) for TNF-α as
did E. coli LPS. However, Brucella LPS was found to be a weak agonist of TNF-α as
were most of other pro-inflammatory cytokines. The production of cytokines differs
in different species. For example in mice (infected with Brucella) all Th1 type
cytokine responses helped in reducing infection (Dornand et al., 2002). The human
Review of Literature
25
macrophages infected with B. suis only produced IL-1 and IL-6 cytokines. There was
no production of TNF-α. Other than cellular differences, the type of stimuli used was
also important for cytokine induction. Kariminia et al., (2002) reported an elevated
induction of IL-10 by smooth Brucella LPS. Flow cytometric studies showed that
LPS alone could not stimulate IL-12 expression. Similarly, murine macrophage line
J774 infected with B. abortus smooth strain (S19) produced less IL-6 than when
infected with B. melitensis vaccinal, and virulent strains (Khatammi and Ardestani,
2005).
Detection of Brucella Carrier Animals by PCR
Numerous PCR-based assays have been developed for the diagnosis of
brucellosis. Leal-Klevezas et al., (1995) introduced a novel method for the extraction
of Brucella DNA for PCR studies from body fluids (lymph node aspirates, blood and
milk) of infected animals. They synthesized two oligonucleotide regions of omp-2
gene and used PCR methodology to detect DNA of Brucella species in carrier cattle,
goats and humans. This method is sufficiently sensitive for the diagnosis of
brucellosis in animals and humans. Later, in 2000, Sreevatsan et al., (2000)
developed a multiplex PCR method for the detection of B. abortus DNA. This
method was highly sensitive and economical. It was used as an alternative to
serological tests. Differential PCR based assays are more complex and difficult to
carry out. Therefore, AMOS-PCR (named on basis of species it identifies: abortus,
melitensis, ovis) was developed (Bricker and Halling 1994). The genetic element
targeted is IS711. This work was extended by Hinic et al., (2008) who devised a
novel PCR assay for the rapid detection of Brucella. The assay was able differentiate
all six Brucella species. This method is highly specific for Brucella detection.
Intracellular Survival of Brucella
Most in vivo studies concerned with the intracellular survival of Brucella have
been performed in mice (Limet et al., 1989). Macrophages kill a majority of Brucella
cells at an early stage of infection, but the surviving bacteria are capable of avoiding
Review of Literature
26
brucellacidal action at later stages of infection (He et al., 2006). Most of the active
brucellacidal activity occurred between 0 and 4 hrs post infection. Virulent smooth B.
abortus strain S2308 inhibited apoptosis in murine RAW 264.7 macrophages. B.
abortus strain RB51 induced both apoptotic and necrotic cell death. Similar results
were obtained in in vivo studies in mice immunized intraperitonially with vaccine
strain RB51. Inhibition of macrophage apoptosis may be a factor in the survival of
smooth Brucella cells inside macrophages (Chen and He, 2009).
LPS Mediated Immunity
Wu et al., (1988) studied B. abortus LPS and reported it as the most
immunodominant component among antigens of B. abortus examined. They
demonstrated that its immunochemical reactivity was quite stable and was not altered
prior to, or after non-enzymatic treatment. Goldstein et al., (1992) extracted LPS from
B. abortus by butanol extraction. The product was contaminated with less than 2%
protein, 1% nucleic acid and 1% ketodeoxyoctanic acid. These authors concluded that
B. abortus LPS could be a vaccine component because of its ability to serve as a
superior carrier. It could activate human B cells without involving T cells and was 10,
000 times less toxic than E. coli LPS. It is interesting to note that properties of B.
abortus LPS are similar to those of the whole bacterium.
Materials and Methods
27
Chapter-3
MATERIALS AND METHODS
Experimental Design:
A series of six sets of experiments were conducted to study and explore the
project as described in Fig 1 below.
FLOW CHART OF THE STUDY
Materials and Methods
28
3.1 Extraction, Characterization and Quantification of Brucella abortus
Lipopolysaccharides
3.1.1 Bacterial Strains
Brucella abortus rough attenuated strain RB51 and smooth virulent strain
S2308 were procured from Dr Gerhardt G. Schurig’s laboratory in Virginia Tech,
USA.
3.1.2 Cultivation
Freeze dried cultures of B. abortus were activated in a safety cabinet (class II
BSL lab, University of Michigan, Ann Arbor), in screw capped test tubes containing
tryptic soy broth (TSB), (Annex 01). TSB was prepared following the manufacturer’s
instructions. Tubes were placed in a shaking incubator (New Brunswick Scientific,
Edison NJ, USA) overnight at 37°C. The active cultures (100 µL each) were
transferred to Falcon tubes containing 10 mL of TSB and shaken at 37ºC for 24 hrs.
Brucella cultures (10 mL) were transferred to sterile plastic flasks containing one liter
of TSB and shaken at 37ºC at 180 rpm for 48 hrs, and were centrifuged at 4ºC at
4000 x g for one hour. The supernatant was discarded and the pellet was used for
lipopolysaccharide (LPS) isolation (Fiaori et al., 2000).
3.1.3. Differentiation of Rough and Smooth Brucella abortus Strains:
Differentiation of rough and smooth B. abortus strains was performed as
described by Bandara et al., (2009) using crystal violet staining. Tryptic soy agar
(TSA), (Annex 02) was prepared according to instructions of the manufacturer.
Autoclaved agar was poured in Petri plates and the plate sterility checked in an
incubation at 37ºC for 48 hrs. Plates free from contamination were streaked with
strains of B. abortus and cultured for 48 hrs. Crystal violet stock solution (Annex 03)
was diluted to 1:40 with sterile deionized distilled water and the surface of each plate
flooded with one milliliter of the diluted crystal violet solution and allowed to stand
for 30 seconds to one minute. The crystal violet solution was carefully removed
Materials and Methods
29
Rough colonies stained dark blue and the smooth colonies were unstained (white).
3.1.4 Gram Staining
Smears of Brucella abortus were prepared and heat fixed on glass slides.
Crystal violet solution was poured onto each smear for one minute and then the slide
was washed with water. Gram’s iodine solution was applied to the smears for one
minute followed by decolorization with alcohol for 5-6 seconds. The slides were
washed with water and counter stained with safrinin for 30 seconds. Microscopic
examination of slides revealed red colored coccobacilli rods indicating the Gram
negative character of Brucella.
3.1.5 Biochemical Profile
3.1.5a Catalase Test:
One drop of a fresh solution of 30% hydrogen peroxide was placed onto a
glass slide and a small number of Brucella cells were transferred into the solution.
The release of bubbles indicated a positive reaction.
3.1.5b Urease Test:
This test was used to test for the presence of urease in Brucella abortus
cultures. Brucella cultures were inoculated onto urea agar plates (Annex 04) using a
sterilized inoculating loop and the plates incubated at 37oC for 24 hrs. A change in the
color of the medium to deep pink color was considered positive assay for urease.
3.1.6a Lipopolysaccharides (LPS) Extraction from Brucella abortus Smooth
Strain
LPS from B. abortus smooth strain (S2308) was extracted using the protocol
of Apurba et al., (2002). The Brucella culture from the smooth S2308 strain was
pelleted at 4ºC at 2000 x g for 20 min in a GSA angle head rotor in a Sorvall RC-5B
refrigerated superspeed centrifuge. The Brucella pellet was resuspended in extraction
buffer (Annex 05) at 1:10 ratio. The extraction buffer containing the pellet was stirred
at room temperature for 24 hrs and kept at 5°C for five days until material in the
Materials and Methods
30
pellet changed into a colloidal suspension. This suspension was centrifuged at 4°C at
10,000 x g for 20 min, and supernatant obtained was dialyzed extensively against
cold distilled water. The dialyzed crude extract was filtered through a YM-10
membrane (Cat # 13651, 90 mm ultrafilteration membrane, Amicon corporation,
Ireland). The resulting filterate (25 mL) was centrifuged at 4°C at 105,000 x g for 16
hrs to obtain LPS pellet. The LPS pellet obtained was resuspended in a minimal
amount of distilled water and lyophilized (Section 3.1.8). The lyophilized LPS was
suspended in chloroform/methanol (2:1) and centrifuged at 4°C at 1800 x g for 20
min. The supernatant was poured off and the process was repeated. The resulting
pellet was lyophilized and the dried residue was suspended in water saturated
chloroform/water (1:1) and centrifuged at 4°C at 1800 x g for 15 min. The water
phase was decanted and an equal volume of distilled water added, this suspension was
mixed, re-centrifuged (at 4ºC at 1800 x g for 15 min) and the water phase was
removed. The water phase from the chloroform/water extraction was lyophilized to
obtain partially purified LPS.
3.1.6b Lipopolysaccharide (LPS) Extraction from the Brucella abortus Rough
Strain
Brucella abortus rough strain (RB51) (50g, wet weight) were mixed with 200
mL of extraction mixture (Annex 06), and the suspension was homogenized with an
ultra-Turrax homogenizer (Janke and Kunkel) for two minutes with cooling in ice so
that the temperature remained between 5-20°C. The mixture was centrifuged at 4°C at
2000 x g for 15 min and filtered through filter paper. The yellow brown bacterial
residue was removed by centrifugation and placed in a rotary evaporator at 30-40°C
to remove the remaining petroleum ether and chloroform. To the phenol crystallized
residual material, sufficient water was added to dissolve it. The solution was
transferred to a glass centrifuge tube and water added drop wise until the LPS was
precipitated. The precipitated LPS was centrifuged at 4°C at 1000 x g for 10 min. and
the supernatant was decanted. The precipitate was washed 2-3 times with small
Materials and Methods
31
portions of 80% phenol (about 5 mL). Finally, the precipitate was washed three times
with ether to remove residual phenol, and dried in a vacuum. The LPS was diluted to
50 mL with distilled water, warmed to 45°C and placed under vacuum to remove air.
The resulting viscous solution was placed in an ultra vibrator for five minutes and
centrifuged at 100,000 x g for four hrs. The LPS fraction in the clear, transparent
pellet was dissolved in distilled water and was freeze-dried (Section 3.1.8), (Galanos
et al., 1969).
3.1.6c Lipopolysaccharides (LPS) Extraction by Using a Commercial Kit
LPS was also extracted from smooth and rough Brucella abortus with the
used of a commercial kit. The packed cells were extracted of LPS as described by the
manufacturer (Intron Biotechnology, Cat # 17141).
The kit contained a Lysis buffer 100 mL and a Purification buffer 80 mL. The kit
components were stored at 4°C until used.
The yield of extracted LPS was proportional to the volume of culture. A
maximum yield was obtained when 5 mL of culture medium was used (OD of 0.8-
1.2). The Brucella broth culture was centrifuged at room temperature at 15,7000 x g
for 10 min. On average, 5 mL of packed bacterial cells were obtained. The
supernatants were decanted and one milliliter of lysis buffer was added and
vigorously mixed (vortex F/S-16, Telron Biotech). Chloroform (200 µL) was added,
and the mixture vortexed for 10-20 seconds and incubated at room temperature for
five minutes. Upon the addition of chloroform, a white line formed just beneath the
upper blue layer. This region was comprised of mixture of cell debris, protein, and
DNA and RNA. The addition of chloroform allowed separation of the phenol layer
from aqueous layer. Purification buffer (800 µL) was added with mixing following by
incubation at -20 °C for 10min. The mixture was centrifuged at 4°C at 15,7000 x g
for 10min and 400 µL of the supernatant were transferred to 1.5 mL Eppendroff tubes
and centrifuged. Two layers were formed. A white precipitate containing protein and
DNA was observed at the interface between the two layers. The supernatant was
Materials and Methods
32
carefully removed, avoiding the white precipitate. The supernatants were centrifuged
at 4°C at 15,7000 x g for 15 min and the pellets containing the crude LPS were
washed with one milliliter of 70% ethanol and dried.
3.1.7 LPS Purification
The crude LPS pellets were dissolved in a solution containing 5 mM MgCl2 in
0.1 M Tris-HCl, pH= 7.0 at a level of 10 mg/mL. Each LPS preparation was digested
at 37°C with 50 µg/mL each of DNase and RNase for 30 min. This was followed by
digestion at 55°C with 50 µg/mL of proteinase K for three hours. Digestion with
proteinase K was repeated three times and each time the sample was reisolated after
exposure to proteinase K. The final incubation volume was brought to 26 mL with
distilled water and the suspension centrifuged at 4°C at 100,000 x g for six hours. The
resulting clear gelatinous pellet served as purified LPS (Velacso et al., 2000).
3.1.8 Lyophilization
Purified LPS was suspended in distilled water, transferred to a glass tube,
frozen in a dry ice acetone bath, and lyophilized in a lyophilizer (Freezemobile 12)
(Jones et al., 1976b).
3.2 Characterization of Brucella LPS
Partial characterization of Brucella LPS was performed bySodium dodecyl
sulfate polyacrylamide gel electrophoresis (SDS-PAGE) using the method of
Laemmli, (1970). The methods for preparation of the resolving gel buffer, stacking
gel buffer, and sample buffer are given in Annex 07, 08 and 09 respectively. The
resolving gel contained 15% and the stacking gel contained 4.9% polyacrylamide
(Annex 10 and 11). The composition of tank buffer and gel fixation solution is given
in Annex 12 and 13, respectively. The wells were loaded with a known protein
standard, Precision Plus Protein (Cat # 161-0375, Kaleidoscope Bio RAD) and
various volumes of samples. Electrophoresis was carried out at 80V.
Materials and Methods
33
3.2.1 Staining of gels
3.2.1a Silver staining
The gels were stained using a silver staining kit as recommended by the
manufacturer (Bio-RAD). The resulting bands on the gels were scanned with a
imager (Bio-RAD).
3.2.1b Coomassie Brilliant Blue Staining
Colloidal Coomassie stain (G-250, National Diagnostics) and 95% ethanol were
mixed in 9:1 ratio to prepare the final stain. The gel was placed overnight in this
solution. The staining solution was poured out and water added to overlay the gel for
washing, and the gel was visualized by scanning with HP Scanjet G4050.
3.3 Quantification of LPS
LPS was quantified by the Parpald assay procedure described by Lee and
Tsai. (1999). Fifty microliters of LPS samples were added in duplicate wells in a 96-
well culture plate. Fifty microliters of 32 mM sodium periodate (NaIO4) (Annex 14)
were added, and plates were incubated at 37ºC for 25 min. Parpald reagent (50 µL)
(Annex 15) in 2N sodium hydroxide (NaOH) was added to each well and the plates
were incubated for 20 min. Finally, fifty microliters of 64 mM sodium periodate
(NaIO4) were added and the plates were incubated for another 20 min. Formation of
bubbles in the wells was eliminated by addition of 20 µL of 2-propanol. Absorbance
was measured with an ELISA plate reader (Synergy Tech) at 550 nm. Standard
curves were generated using glycine (70 to 420 µg/mL).
3.4 Stimulation of Bovine Neutrophils and Macrophages
Samples of blood were collected from one hundred healthy bovines (Holstein)
at Green Meadow Farms Inc. Michigan, USA. The samples (20 mL) were taken
aseptically and the syringes contained EDTA for anticoagulation.
3.4.1a Isolation of Bovine Neutrophils
A novel means was developed for isolation of bovine neutrophils using a
modification of the method of Robert and Nauseef (2001). Lymphocyte separating
Materials and Methods
34
media (LSM, Annex 16), (2 mL) was pipetted into a 15 mL Falcon tube and four
milliliters of blood were carefully layered on the LSM. The tubes were centrifuged
(Eppendroff 5810 R) in a swinging bucket rotor and at 4°C at 652 x g for 10 min.
Four distinct layers were formed. The layer at the bottom contained red blood cells,
second layer from bottom had neutrophils followed by lymphocytes and monocytes
together in next layer. The topped layer was only plasma. The sediment was highly
enriched with neutrophils and erythrocytes. The sediment was mixed with equal
volume of 6% dextran contained in 0.9% NaCl. The cell suspension was incubated at
37°C for 45 min to allow sedimentation of the erythrocytes. The erythrocyte fraction
was discarded. The neutrophil-rich supernatant collected was mixed with an equal
volume of Hanks balanced salt solution (HBSS, GIBCO Invitrogen). The reaction
mixture was centrifuged at 4°C at 290 x g for 10 min. The pellet containing the
neutrophils was washed with HBSS and ACK lysing buffer (1 mL, Cat# 10-548E,
I.Onza, Annex 17) was added to lyse any remaining erythrocytes. The tubes were
incubated at 37°C for five minutes. Two volumes of HBSS were added, the tubes
centrifuged at 4°C at 652 x g for 10 min to remove the lysed erythrocyte particles.
3.4.1b Counting of Neutrophils
The neutrophils were resuspended in phosphate buffer saline (PBS) to achieve
an optimal concentration (2 mL). Ten microliters of this suspension were pipetted
onto a hemacytometer and the neutrophils were counted (25 squares inside the central
double lines). The neutrophils were identified by the specific multilobulated structure
of their nuclei. The neutrophil count was multiplied by 0.1mm3 and 1000 to get
number of neutrophils per milliliter (Cotter et al., 2001).
3.4.1c Determination of Neutrophil Viability
Viability of neutrophils was determined as described by Nagahata et al.,
(2004). The neutrophil suspension was mixed with an equal volume of trypan blue
and examined with a microscope. Transparent cells were considered viable. Blue
stained cells were counted as dead. .
Materials and Methods
35
3.4.1d Analysis of Neutrophil Purity.
Neutrophil purity was evaluated by two methods:
1- The use of hemocytometer employing differential counting of neutrophils
vs non-neutrophils. The neutrophils were identified by their multilobular nuclei by
observation with a microscope at 20X to 40X magnification (Kabbur et al., 1995).
2- Flowcytometry using CH138A antibodies.
3.4.1e Determination of Neutrophil Purity by Flow Cytometry
The technique used was that described by Piepers et al., (2009). The
neutrophils were suspended in 2% formaldehyde (2 mL of formaldehyde and 98 mL
of PBS). The cells were spun at 1000 x g for five minutes. The neutrophil fraction
(sediment) and was divided into two aliquots. Each aliquot was mixed with 100µL of
Flow buffer (Annex 18). One aliquot was mixed with 5µL of Anti-bovine granulocyte
IgM monoclonal antibody CH138A (Cat # CH138A VMRD) at a concentration of 2.5
µg/mL per million cells. The other aliquot was mixed with Mouse IgG APC (BD
Biosciences) and served as a negative control, at a concentration of 2.5 µg/ million
cells. The CH138A coated neutrophils and their negative controls lacking CH138A
antibody were placed in the dark at 4ºC for 30 min. The samples were centrifuged at
4ºC at 1000 x g for five minutes. The sediment obtained after centrifugation was
washed with 1X PBS (5 mL), at least two times. The neutrophils were resuspended in
200 µL of 2% (v/v) formaldehyde in PBS. Analyses were performed in a BD LSR II
Flow cytometer (Department of Pathology, University of Michigan) along with
Winlist 6.0 software to analyze the data.
3.4.2a Isolation and Cultivation of Bovine Macrophages:
Blood (30 mL) containing the anticoagulant citrate dextrose (ACD, Annex 19)
was gently poured into sterile centrifuge tubes (Falcon) and centrifuged at 4°C at
1000 x g for 30 min. The percoll working solution was prepared by diluting percoll
stock solution (Annex 20) with isotonic suspensions of desired specific gravities
Materials and Methods
36
containing bovine serum albumin (BSA) (5 mg/mL) (Annex 21) and 13 mM citrate
(Annex 22) using the following formula:
X(a) + 0.1 (b) + 0.1 (c) + (0.8 –X) (d)= desired specific gravity -1
X= mL of PBS/mL of final suspension
0.8-X= mL of stock percoll/mL of final suspension
0.1= mL of albumin and citrate/ml of final suspension
a: specific gravity of PBS-1 (a= 1.0056)
b: specific gravity of 0.5% albumin-1 (b= 1.0227)
c: specific gravity of 13mM citrate-1 (c= 1.0219)
d: specific gravity of stock percoll solution-1 (d= 1.1245)
The desired specific gravity for this study was 1.0770
The recipe for one liter working percoll may be found in Annex 23.
Blood was centrifuged at 4ºC at 1000 x g for 30 minutes. To a white cell
suspension (15 mL), was added 15 mL of PBS-citrate solution (PBS-C) (Annex 24).
The suspension was mixed gently, avoiding mixing the cells with percoll in a final
volume of 45 mL. The tubes were centrifuged at 4ºC at 1000 x g for 30 min. The
white cell fractions were transferred to another tube and PBS-C was added to a final
volume of 50 mL (This step eliminates any remaining percoll). The mixture was
mixed gently and centrifuged at 4°C at 500 x g for 10min. The PBS-C was discarded
and the pellet further processed by addition of ten milliliters of plasma and
homogenized. PBS-C was added to bring the volume up to 50 mL and centrifuged at
4°C at 500 x g for 10 min. This step is repeated twice. The pellet was resuspended in
Complete RPMI (CRPMI, Annex 25) containing 4% bovine calf serum. This
suspension was poured into a Teflon flask and incubated in a humified incubator
flushed with 5-10% CO2 at 37 ºC for 24 hrs. The medium was changed every 3-4
days. Six milliliters of fresh medium was added by keeping one milliliter of old
medium. (Qureshi et al., 1996).
Materials and Methods
37
3.4.2b Harvesting of Macrophages
After seven days of culture, macrophages were harvested with a cell scrapper.
The culture medium with cells was centrifuged at 4°C at 500 x g for 10 min and the
supernatant discarded. The cell number was counted and adjusted as needed in
CRPMI-10% FCS (Omar et al., 2003).
3.4.3 Murine Macrophage Cultivation.
Murine RAW 264.7 macrophages were obtained from the American Type
Culture Collection (ATCC, cell line TIB-71) and as described by Cynthia et al.,
(2002). Macrophages were cultured in 24 well plates in Dulbecco's Modified Eagle
Medium (DMEM) 10% Fetal Bovine serum (FBS) and 1% penicillin, streptomycin
mixture at a concentration of 2.5x105 cells /mL. Composition of DMEM is described
as Annex 26.
3.4.4 Assay of Lysozyme Induction in LPS-Induced Bovine Macrophages,
Neutrophils and Murine Macrophages
The assay was performed with little modification from that described by
method of Stabili et al., (2009). Agarose gel 1% (Annex 27) containing 0.5 mg/mL of
dried Micrococcus lysodeikticus cells was suspended in a 0.1M phosphate citrate
buffer pH 5.8 (Annex 28). Agarose (25 mL) was poured into each plate. After
solidification, holes (35 mm diameter) were punched in the gel. Bovine macrophages
and neutrophils, each at a concentration of 2.5x105 /mL were cultured for in a 24 well
plate 24 hrs, in CRPMI containing 10% FBS. Murine macrophages (2.5x105 /mL)
were cultured for 24 hrs in 24 well plates in Modified Eagle Medium (MEM)
containing 10% FBS. At varying concentrations (0.02. 0.2, 2, 20, 200 µg/mL,
respectively). each LPS (rough, smooth alone or in combination) were added to each
well. The samples were incubated at 37°C for two hours with shaking. The incubation
mixtures were centrifuged at 4°C at 3000 x g for 10 min and supernatants stored at -
70°C until assayed. Sample suspensions of 25 µL were loaded into the wells in the
agarose plates. The plates were incubated at 37°C for 24 hrs. Each plate was scanned
Materials and Methods
38
(HP Scanjet G4050) and the radius of clarified zone around each well was measured
and amount of lysozyme released calculated from a generated standard curve. Each
sample was assayed in triplicate. Egg white lysozyme (0.00 to 16 µg/mL) was used to
generate a standard curve. All background values were obtained using media
(CRPMI) containing FBS and these background values were subtracted from
calculated value of each sample.
3.4.5 Induction of Reactive Oxygen Species (ROS) from LPS-Induced Bovine
Macrophages, Neutrophils and Murine Macrophages
A solution of 0.1% NBT of 200 µL (Annex 29) was added to each well and
the plates incubated at 37°C for 60 min. Following incubation, varying concentrations
of LPS (0.02, 0.2, 2.0, 20, 200 µg/mL, respectively) were added to each well.
Samples were incubated against at 37°C for 30 min. The reactions were stopped by
adding an equal volume (500 µL) of 0.1N HCl (Annex 30). The mixture was
centrifuged at 4°C at 800-1000 x g for 15 min. The resulting pellets obtained were
dried at 37°C in dark. Dioxane (1 mL) was added to each pellet and incubated at
85°C for 20 min. After incubation, the mixture was centrifuged at 4ºC at 800-1000 x
g for 15 min. The optical density of the clarified supernatant was determined at 580
nm with a dual beam spectrophotometer (Beckman Coulter, DU 530) at room
temperature. The polystyrene semimicro cuvettes (Cat# 14-385-942, Fisher
Scientific) were used that can read absorbance between 240-750nm. E. coli LPS and
superoxide dismutase (SOD) served as positive and negative controls, respectively
(Zembala et al., 1980).
3.4.6 Induction of Nitric Oxide from LPS-Induced Bovine Macrophages, and
Neutrophils, and Murine Macrophages
Bovine and murine macrophages and bovine neutrophils were cultured in 96
well plates at a concentration of 2.5x105/mL and incubated at 37ºC in 10% CO2 for 24
hrs. Cultured macrophages were treated with varying concentrations (0.02, 0.2, 2, 20,
200 µg/mL, respectively) of all three types of LPSs {rough, smooth and combined
Materials and Methods
39
(1:1)} and incubated at 37ºC in 10% CO2 for two hours. After incubation, LPS-treated
macrophages were centrifuged at 4ºC at 600 x g for 10 min and supernatant collected.
Supernatants were mixed with an equal volume of Griess reagent (Annex 31) in 96
well plates. The plates were held at 25°C for 10 min and color change (indicative of
nitrite presence) was quantified at OD540 by reading the plates on ELISA plate reader
(Synergy BioTech). Each experiment was performed in triplicate. A standard curve
was generated using increasing concentrations of sodium nitrite (0.3125 to 20 µg/mL)
dissolved in MEM. Macrophages pretreated with E. coli LPS served as a positive
control. Accumulation of nitric oxide was inhibited by NG monomethyl-L-arginine
(L-NMMA) which served as a negative control (Goldstein et al., 1992). Background
values of nitrite production by untreated macrophages were subtracted from sample
values. The absorbance of the standards, controls and test samples was converted to
ng/mL of nitrite by comparison with absorbance of sodium nitrite standards within a
linear curve fit (Waters et al., 2002).
3.4.7 Determination of Cytokines in LPS-Induced Bovine and Murine
Macrophages by Enzyme Linked Immunosorbant Assay (ELISA).
A sandwich ELISA assay was performed to determine the cytokine production
in LPS-activated macrophages (Rittig et al., 2003).
3.4.7a Sample Preparation
Macrophages were cultured at 37ºC in 24 well plates in DMEM containing
10% FBS and 1% penicillin-streptomycin (PS). After 24 to 48 hrs, the medium was
aspirated from the wells and either 200 µg/mL of rough RB51, smooth S2308 or a
combination of rough and smooth Brucella abortus LPSs (100 µg/mL each) were
added and the plates incubated for another 24 hrs. The samples were then centrifuged
at 4°C at 3000 x g for 10 min and the recovered supernatant was frozen prior to the
quantification of cytokines. The following cytokines served as positive controls:
recombinant bovine and murine interleukin-1-beta (IL1-β), interleukin-6 (IL-6),
Materials and Methods
40
interleukin-10 (IL-10), interleukin-12 (IL-12) and tumor necrosis factor alpha (TNF-
α) (Bio-Legend).
3.4.7b Coating of ELISA Plate
Unlabelled, captured antibody (10 µL) was diluted in 10 mL of coating buffer
(Annex 32, 1: 1000 dilution) and 100µL pipetted into a 96 well microtiter plate. The
plate was sealed with parafilm and incubated overnight at 4ºC.
3.4.7c Blocking the Plates
The plates were brought to room temperature for 10 min and the antibody
solution removed. Plate were washed three times with PBS/Tween-20 (Cat# BP337-
100, Fisher Scientific), 0.5% v/v, mentioned in Annex 33. Blocking solution (200 µL,
Annex 34) was added to each well. Plate were sealed with parafilm M and incubated
at room temperature for two hours. The blocking solution was discarded; plates dried
on tissue paper, after washing was repeated three times with PBS/Tween-20 (Annex .
3.4.7d Coating the Antigen
Samples (100 µL) were added to each well of a 96 well plate, sealed with
Parafilm and incubated at room temperature for 4 hrs. The plates were then washed
four times with PBS/Tween-20. After each wash, the plates were blotted with a paper
towel.
3.4.7e Coating with Secondary Antibody
Biotin labeled antibody diluted (1:1000) with blocking solution (100 µL) was
added to each well. The plates were sealed and incubated at room temperature for one
hour and then washed four times with PBS/Tween. Av-HRP conjugate was diluted
1:1000 in blocking buffer. 100 µL was added to each well and incubated at room
temperature for 30 min. The plates were washed six times with PBS/Tween. TMB
reagent A was mixed with TMB reagent B just prior to use and 100 µL of this reagent
were added to each well. The plates were incubated at room temperature for 30 min
and TMB stop solution (100 µL) added to each well. The optical density (OD) was
Materials and Methods
41
recorded with a microplate reader at 450nm. "KC4 software (Biotek Instruments Inc.
Vinooski, VT. U.S.A.) was used to calculate the levels of the cytokines present.
3.5 Determination of Intracellular Survival of Brucella in Bovine, and Murine
Macrophages
Twenty four well plates (Becton Dickinson) were seeded with bovine and
murine RAW 264.7 macrophages at a concentration of 2.5x105/mL and incubated at
37ºC for 24 hrs. After 24 hrs, the cells were stimulated with rough, smooth and
combined Brucella LPS (200 µg/mL) and incubated at 37ºC under 10% CO2 for 24
hrs. After incubation, the macrophages were challenged for one hour at a multiplicity
of infection (MOI) of 1:100 with the following Brucella treatments (Section 3. 5.1):
a) RLPS +macrophages+Brucella, b) SLPS +macrophages+Brucella
c)RLPS+SLPS+macrophages+Brucella d) Negative control (macrophages+Brucella)
3.5.1 Multiplicity of infection.
Cultures of Brucella (100 µL) previously stored at 4ºC were added to ten
mililiters freshly prepared trypticase soy broth and shaken at 37°C overnight. To
aliquots of the culture, were added medium (1 mL), and used to determine absorbance
at OD600. An absorbance of culture at OD600 was determined to be equivalent to 2
x109/mL cells (Sun et al., 2006).
To infect macrophages in most experiments, 2 x107 cells/mL were used (32
µL) per well. Each combination was performed in triplicate. The plates were
centrifuged at 300 x g at room temperature for three minutes, the geometry of the
plate was positioned turned, and the plates were centrifuged again for three minutes.
After centrifugation, plates were incubated at 37°C in a 5% CO2 atmosphere for 1, 6
and 24 hours respectively. Medium was gently aspirated and washed with sterile 1X
PBS (2 mL). DMEM (1 mL) containing 10% FBS and 50 µg of gentamycin was
added to each well and the plates were incubated at 37°C in 5% CO2 for one hour.
The macrophages were osmotically lysed with sterile 0.1% Triton X-100.
Lysates (100 µL) were aspirated from each well and transferred to the first well of a
Materials and Methods
42
96 well plate. Each of the remaining wells contained PBS (90µL). The lysate in well
one were serially diluted by increments of ten. The number of viable bacteria
remaining in the lysate was determined by serial dilution in the same manner,
followed by culture of a suitable aliquot in tryptic soy agar at 37ºC for 24-48 hrs.
3.6 In Vivo Stimulation of Carrier Bovine by Brucella abortus LPS:
3.6.1 Detection of Brucella abortus Carrier Bovine by Polymerase Chain
Reaction (PCR):
Bovines suspected for brucellosis (on the basis of clinical abortion, and
initially positive reactors for the Rose Bengal Plate Test) (Akhtar et al., 2010a) were
selected for in vivo studies. In order to confirm the presence of the infectious agent
(Brucella abortus), the polymerase chain reaction (PCR) was conducted following the
protocol of O’ Leary et al., (2006). Retrophyrengeal lymph node biopsy samples from
these brucellosis suspected bovines were collected following the method of Vitale et
al., (1998). The lymph node aspirates were subjected to PCR in the Molecular
Biology Laboratory, Department of Pathology, Faculty of Veterinary Science,
University of Veterinary and Animal Sciences, Lahore, Pakistan.
3.6.2 DNA Extraction
DNA was extracted from tissue samples using a QIAamp™ DNA mini kit
(Qiagen) as described by the manufacturer. Lymph node aspirates (5 mL) were mixed
with 500 µL of PBS. Suitable aliquots (200 μL) were mixed in a lysis buffer (Annex
35) and allowed to stand for five minutes. The mixture was vortexed, incubated at
70°C for 10 min, and 117 µL of was ethanol added. The mixtures were placed onto
QIAamp spin columns and centrifuged at 1500 x g for five minutes. The DNA pellet
was washed with PBS (2X) and then mixed with DNA hydration buffer (200 μL) and
the extracted DNA stored at -80ºC (Sreevatsan et al., 2000).
3.6.3 DNA Amplification
Extracted DNA was amplified using the method of Hinic et al., (2008). The
sequence of forward and reverse primers used in these studies is presented in table 1.
Materials and Methods
43
Specific primers for genetic element IS711 were used for amplification purposes.
The recipe for the reaction mixture is in Annex (36). The total volume of each
reaction mixture was 25 µL. The following PCR cycling conditions were used: initial
denaturation was performed at 94°C for five minutes. This was followed by 30 cycles
of denaturation at 93°C for 45 seconds. DNA annealing was performed at 48-58°C
for 30 seconds. DNA extension was carried out at 72°C for one minute and the
final extension at 72°C for five minutes. The reaction was stopped at 4°C.
Table 1. Primer Sequences Used for the Detection of Brucella abortus
Primers Primer Sequences* Target Sequence
Expected Size
Forward GCTTGAAGCTTGCGGACAGT
IS711 63 bp
Reverse GGCCTACCGCTGCGAAT
IS711 63 bp
Materials and Methods
44
3.6.4 Agarose Gel Electrophoresis:
Agarose gel electrophoresis was used for visualization of DNA extracted from
lymph nodes and amplified by PCR. A DNA ladder (100 bp, Invitrogen) was used as
standard. Agarose gel (1.8%) was prepared in 1X TAE buffer (Annex 37). The
mixture was boiled and swirled well to dissolve the agarose. Ethidium bromide was
added to the gel to a concentration of 0.5 μg/mL, to facilitate visualization of DNA
after electrophoresis. Molten agarose mixture was allowed to cool at 45ºC. The gel
tray was prepared by sealing the ends of glass plates with scotch tape. Comb was
placed in the gel tray about one inch from one end of the gel tray and positioned
vertically such that the teeth were about 1-2 mm above surface of tray. The gel
solution was poured into tray to a depth of about 5mm and allowed to solidify.
3.6.6 Preparation of Samples:
The 6X loading dye/tracking dye (5 μL, Annex 38) was spotted onto Parafilm
for each sample to be loaded on gel.
3.6.7 Loading of the Samples
The tape was removed from ends of gel chamber and the gel was placed in a
horizontal electrophoresis chamber with the wells towards the negative electrode.
The gel chamber was filled with sufficient 1X TAE buffer such that the level of liquid
just covered the gel. The DNA ladder and samples were loaded in separate wells.
Electrophoresis was performed under a constant current at 100 volts. The
electrophoresis was stopped when the tracking dye had migrated 3/4 of the way
across the gel. DNA bands were detected with an ultraviolet transilluminator and
photographed using of gel documentation system.
3.7 Injection of LPS in Carrier Animals
Brucella abortus positive bovines (six Friesian cows and six Babalus babalis)
confirmed by PCR from Rukh Dera Chahal were selected for further study. For
control purposes, three animals with no history of brucellosis and that gave a negative
PCR result were selected. Carrier animals identified by PCR were injected (10 mL)
Materials and Methods
45
with stimulating concentrations of 200 µg/mL of rough (RB51) LPS. Three days post
injection; the animals were tested for elimination of infection by PCR.
Statistical Analysis
Statistical analysis was performed using the Student’s t test. Comparison of
the two-groups was achieved using SPSS software. A P value of <0.05 was
considered statistically significant.
Results
46
Chapter-4
RESULTS
The present project was designed to study the stimulatory response of bovine
macrophages, neutrophils and murine macrophages to LPS fractions extracted from
smooth and rough strains of Brucella abortus, and combinations of the two LPS
fractions. The levels of lysozyme released, oxidative metabolism, nitric oxide
production, and pro-inflammatory and anti-inflammatory cytokines produced were
determined. In addition, the susceptibility of murine and bovine macrophages to a
Brucella LPS stimulus were studied to determine differences in species susceptibility.
Finally, the comparative stimulation of bovine macrophages and bovine neutrophils
were studied in order to determine the major cell types involved in Brucella
elimination.
4.1 Isolation, Identification and Characterization of Brucella Strains
Both rough and smooth B. abortus strains (RB51 and S2308), obtained from
Virginia Tech, USA, were confirmed on the basis of positive crystal violet staining of
colonies, microscopic characteristics and biochemical profiles. Colonies of B. abortus
(smooth strain) were violet on reaction with crystal violet, whereas the rough strain
colonies were colorless. In biochemical tests, each strain of B. abortus was catalase
positive, and urease positive within two hours of inoculation (Fig 2).
Results
47
Fig 2: Rapid Urea Positive Test for Identification of Brucella abortus
Results
48
4.2 Extraction, Characterization and Quantification of Brucella abortus
Lipopolysaccharides
4.2.1 Lipopolysaccharides (LPS) Extraction from Rough and Smooth Strains
of Brucella abortus
Two methods were used: the conventional phenol extraction method and a
commercial kit method. LPS was isolated from smooth and rough strains of Brucella
abortus. The commercial extraction method was rapid, convenient and efficient as
compared to the conventional phenol extraction method. The phenol water extraction
procedure yielded smooth Brucella LPS (S-LPS) in the phenol phase, and rough
Brucella LPS (R-LPS) was found in the aqueous phase. The commercial method
offered the advantage of a high yield of LPS from small volumes of Brucella culture
in about sixty minutes whereas the phenol extraction procedure took two weeks and
gave a lower recovery of LPS. Brucella LPSs were lypholized and desiccated for
further study.
4.2.2 Characterization of Brucella LPS
The degree of LPS purity and integrity was determined by SDS-PAGE. SDS-
PAGE profiles of Brucella rough and smooth LPS are shown in Fig 3a and 3b. Rough
LPS presented a banded pattern whereas smooth LPS showed smear pattern. Log
molecular weights of samples were calculated from their respective Rf values using a
standard curve. In silver staining gels, the Brucella smooth LPS gave one band of
approximately 81.2 kDa, while Brucella rough LPS samples gave three bands. The
first band was approximately 95.4 kDa while the second band (about 72.4 kDa) was
very clear as compared to other bands and may be the actual LPS band. The third or
last band of Brucella rough LPS was nearly 70.7kDa. Protein contamination was
detected by staining with Coomassie Blue. Each LPS preparation was contaminated
with protein even after exhaustive treatment with protease K (Fig 3b). Brucella rough
LPS did not reveal any protein contamination upon staining with Coomassie blue. On
Results
49
other hand, smooth LPS showed two bands for protein contamination, the first band
was approximately 63kDa, and second was 50.1kDa.
Fig 3a: SDS-PAGE of Brucella abortus Smooth and Rough Lipopolysaccharides
by Silver Staining.
Lanes 1-3: Smooth LPS 5µl, 15µl, and 25µl, respectively; lanes 4-5: rough
LPS 5µl and 7µl, respectively. The M lane contains the molecular weight markers.
Fig 3b: SDS-PAGE of Brucella abortus Smooth and Rough Lipopolysaccharides Fractions by Coomassie Blue Staining.
Lanes 1-3 is rough LPS; lanes 4-6: smooth LPS. The M lane contains the molecular
weight markers.
250
100
75
50
37
25
20
15
10
M 1 2 3 4 5
M 1 2 3 4 5 6
kDa
250
100
75
50
37
25
20
15
10
Results
50
Table 2a: Rf Values and Log Molecular Weight of Marker Bands.
Molecular weight of
marker band
Log molecular
weight
Rf Value
250 2.39 0.17
100 2.0 0.49
75 1.8 0.61
50 1.69 0.76
37 1.56 0.86
25 1.39 0.89
20 1.30 0.93
15 1.17 0.95
10 1.0 0.98
Table 2b: Rf Values and Log Molecular Weight of Sample Bands.
Sample Bands Molecular weight of marker band
Log molecular
weight
Rf Value
Silver stained gel Lanes 1-3: Smooth LPS band Lanes 4-5: Rough LPS band 1 Lanes 4-5: Rough LPS band 2 Lanes 4-5: Rough LPS band 3
81.2
95.4
72.4
70.7
1.91
1.98 1.86
1.85
0.59 0.53 0.58 0.67
Coomassie blue stained gel Lanes 1-3 Rough Brucella LPS Lanes 4-6 Smooth Brucella LPS contaminating proteins band 1 Lanes 4-6 Smooth Brucella LPS contaminating proteins band 2
No bands visible for Rough LPS
63.0
50.1
------
1.80
1.70
-------- 0.69 0.75
Results
51
Standard curve for Rf values of Precison protein marker
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0.45
0.5
0 0.5 1 1.5 2 2.5
Log molecular weight
Rf
valu
es
Rf value
Fig 4: Standard Curve for Rf Values of BioRad Precision Protein Marker.
Results
52
4.2.3 LPS Quantification
The Purpald assay was adapted to quantify the amount of Brucella
smooth and rough LPSs extracted by the phenol extraction, and commercial methods.
A standard curve was constructed using glycine. A linear response was obtained
between 70-420 µg/mL (Fig 5). The amounts of extracted rough and smooth LPSs
extracted by the phenol method were 180µg/mL and 216 µg/mL, respectively. The
amounts of extracted (rough and smooth) LPSs obtained using the commercial
method were 215 µg/mL and 230 µg/mL, respectively.
Standard curve of glycine for LPS quantification
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
0 100 200 300 400 500
Glycine Concentrations ug/mL
Ab
sorb
ance
Absorbance
Figure 5: Purpald standard Curves LPS Quantification
4.3 Isolation of Bovine Neutrophils
A novel method based on the principle of density gradient centrifugation,
using a lymphocyte separating medium was developed for the isolation of neutrophils
from bovine peripheral blood samples. This method yielded preparations of 96.12%
purity based on the identification of the lobulated nuclei of neutrophils (Fig 6a) and
by flow cytometry. The viability of the cells was 95% as determined by trypan blue
exclusion.
Results
53
Figure 6a: Isolated Bovine Neutrophils at Magnification of 10x
Results
54
0 500 1000 1500 2000 2500FSC-A (x 100)
100
101
102
103
104
SS
C-A
R1
( a ) CH138A positive
0 500 1000 1500 2000 2500FSC-A (x 100)
100
101
102
103
104
AP
C-A
R2
(b) CH138A negative
Results
55
0 500 1000 1500 2000 2500FSC-A (x 100)
100
101
102
103
104
SS
C-A
c) CH138A positive
0 500 1000 1500 2000 2500FSC-A (x 100)
100
101
102
103
104
AP
C-A
(d) CH138A negative
Figure 6b: Densogram is Showing the Isolated Bovine Neutrophils (a & c) and Non Neutrophils (b& d).
Results
56
100 101 102 103 104
APC-A
050
010
0015
0020
0025
00
Num
ber
100 101 102 103 104
APC-A
050
010
0015
0020
0025
0030
00
Num
ber
Cell event/number
CH138A APC
Grey shaded IgG control Black dotted line CH138A positives
100 101 102 103 104
APC-A
020
040
060
080
010
00
Num
ber
CH138A positive neutrophils
CH138A negative cells
Figure 6c: Histograms Showing the Separation of CH138A Positive Neutrophils and IgG Negative Control.
100 101 102 103 104
APC-A
050
010
0015
00
Num
ber
Results
57
4.4a Isolation and Culturing of Bovine Macrophages
Matured cultured macrophages were identified by their ability to adhere to the
bottom of cultured flasks (BD Falcon) and their morphological characteristics (Figure
7a & 7b) Greater than 90% of the buffy coatmacrophages isolated by the percoll
method were mononuclear as observed on Wright’s stained slides. The macrophages
were cultured for seven days, harvested and used for subsequent experiments.
Macrophages adhered to plastic surfaces gave better viability than those adhered to
glass surfaces. The morphological and physiological features of the bovine
monocytes were examined during the course of the culture. Cell size, granulation and
cytoplasmic spreading progressively increased. Matured cells developed pseudopods
and or cytoplasmic extensions that increased with time in size and granulation. The
macrophages were detached mechanically from the cultured flasks and counted with a
hemacytometer and used for further experiments.
4.4b Culturing and Subculturing of Murine Macrophages
Murine macrophages were obtained from American Type Culture Collection
ATCC (ATCC # crl-2278) and maintained in DMEM with 10% fetal bovine serum
(FBS) and 1% penicillin/streptomycin (PS). The cells were observed daily for
presence of healthy macrophages and the medium was changed after every two days
(Fig 8).
Results
58
Figure 7a: Isolated Bovine Peripheral Macrophages as Visualized at 10x
magnification.
Figure 7b: Bovine Isolated Macrophages after Seven Days of Culturing are Visualized at 100x. Arrow indicates a Mature Macrophage.
Results
59
Figure 8: Subcultured Murine RAW 264.7 Macrophages Magnified at 10x
magnification
Results
60
The stimulatory activity of Brucella rough and smooth LPS preparations alone
and in combination was determined using bovine cultured macrophages, murine
RAW 264.7 macrophages and bovine neutrophils. Each LPS, or combination thereof
yielded distinct profiles of lysozyme, ROS, RNI and spectrum of cytokines, released
by the challenged cells. These results are described below.
4.5 Induction of Lysozyme from LPS-treated Bovine Macrophages, Neutrophils
and Murine Macrophages
B. abortus rough, smooth and combined (rough + smooth at ratio of 1:1) LPS
contents at concentrations of (0.02, 0.2, 2.0, 20, 200 µg/mL) were used to stimulate
bovine neutrophils, macrophages and murine macrophages. Lysozyme induction by
Brucella rough LPS was not detectable below the LPS concentration of 2.0 µg/mL for
all the LPS treatments. Bovine macrophages treated with rough Brucella LPS at
concentrations of 2.0, 20 and 200 µg/mL yielded lysozyme levels of 1.88, 3.1 and
4.14 µg/mL, respectively, while smooth Brucella LPS at same concentrations of 2.0,
20 and 200 µg/mL yielded lysozyme values 1.0, 1.40 and 2.60 µg/mL for each LPS
concentration respectively. The use of combined rough and smooth Brucella LPS
(1:1) at the same concentrations (2.0, 20, 200 µg/mL) gave lysozyme values of 1.34,
2.20 and 3.13 µg/mL respectively (Figure 9).
Murine macrophages stimulated with the same concentrations of LPS (rough,
smooth and combined LPS) produced lysozyme at levels of 3.70, 5.2, 5.90 µg/mL;
2.60, 3.20, 3.90 µg/mL and 3.0, 3.5, 3.80 µg/mL respectively.
Bovine neutrophils stimulated with rough LPS did not produce detectable
levels of lysozyme at LPS concentrations of 2.0µg/mL and below. The use of higher
concentrations (20 & 200 µg/mL of rough LPS) yielded 0.79 and 2.0 µg/mL of
lysozyme. The use of smooth and combined Brucella LPS concentrations of 200
µg/mL yielded 1.30 and 1.99 µg/mL of lysozyme. Neither smooth nor combined
Brucella LPSs induced lysozyme production at concentrations below 200µg/mL of
LPS. In all instances lysozyme production was significantly higher using rough LPS
Results
61
than smooth and /or combined LPS fractions (p< 0.05). No significant difference in
lysozyme production was observed by using Brucella smooth and combined LPS
fractions (p>0.05).
A comparison among bovine macrophages, bovine neutrophils and murine
macrophages revealed that the highest lysozyme concentration occurred in murine
macrophages (p<0.05) followed by a lower values in bovine macrophages and yet an
even lower amount in bovine neutrophils. A comparison of lysozyme induction in
bovine macrophages and neutrophils revealed that lysozyme induction was higher in
bovine macrophages than bovine neutrophils (p< 0.05). Stimulation was dose
dependent, and increased with increasing concentrations of the LPS fractions used
(Tab 3a, 3b, 3c),
Compared to bovine and murine macrophages, bovine neutrophils produced
negligible amounts of lysozyme. However, the pattern of lysozyme induction was
same, with the highest value by rough LPS, a lesser amount with the combined LPS
mixture, and the lowest amounts with smooth LPS. Only the highest concentrations of
rough Brucella LPS (20 & 200 µg/mL) induced lysozyme release. Smooth and
combined LPS fractions showed induction only at highest concentration of LPS used
(200 µg/mL).
(a) (b) (c)
Figure 9: Visualization of Lysozyme Release using the Agarose Plate Assay. The LPS Samples are (a) Rough RB51 LPS, (b) Smooth S2308, and (c) Combined S2308+RB51 LPSs. The Concentration of LPS Fractions were 200µg/mL per well.
Results
62
Standard Curve of LRT from Egg White Lysozyme
0
1
2
3
4
5
6
7
0 2 4 6 8 10 12 14 16 18
Lysozyme Concentration ug/mL
Rad
ius
of
clea
r zo
ne
(cm
)
Radius of zone
Figure 10: Standard Curve of Lysozyme Release Test
Table 3a: Induction of Lysozyme from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Brucella
LPSs
Concentrations of Brucella LPSs (µg/mL)
0.00 0.02 0.2 2.0 20 200
Rough LPS ND ND ND 1.9 3.1 4.1
Smooth LPS ND ND ND 1.0 1.4 2.6
Combined smooth and rough LPS
ND ND ND 1.3 2.2 3.1
ND= Not detectable
Results
63
Lysozyme induction in bovine macrophages
0
0.5
1
1.5
2
2.5
3
3.5
4
4.5
2µg/mL 20 µg/mL 200 µg/mL
Brucella LPSs concentrations (ug/mL)
Lys
ozy
me
rele
ase
(ug
/mL
)
RB51 LPS
S2308 LPS
RB51+S2308 LPS
Figure 11a: Induction of Lysozyme from Bovine Macrophages Treated with rough, smooth and combined Brucella LPS Fractions.
Table 3b: Induction of Lysozyme from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Brucella LPS Concentrations of Brucella LPS (µg/mL)
0.00 0.02 0.2 2.0 20 200
Rough LPS ND ND ND 3.70 5.2 5.90
Smooth LPS ND ND ND 2.60 3.2 3.90
Combined smooth and rough LPS
ND ND ND 3.0 3.5 3.80
ND= Not detectable
Results
64
Lysozyme induction in murine macrophages
0
1
2
3
4
5
6
7
2 µg/mL 20 µg/mL 200 µg/mL
Brucella LPSs concentrations (ug/mL)
Lys
ozy
me
rele
ase
(ug/m
L)
RB51 LPS
S2308 LPS
RB51+S2308 LPS
Figure 11b: Induction of Lysozyme from Murine Mcrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Table 3c: Induction of Lysozyme from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Brucella LPS Concentrations of Brucella LPS (µg/mL)
0.00 0.02 0.2 2.0 20 200
Rough LPS ND ND ND ND 0.79 2.0
Smooth LPS ND ND ND ND ND 1.30
Combined smooth and rough LPS
ND ND ND ND ND 1.99
ND= Not detectable
Results
65
Lysozyme induction in bovine neutrophils
-0.5
0
0.5
1
1.5
2
2.5
2 µg/mL 20µg/mL 200µg/mL
Concentrations of Brucella LPSs ug/mL
Ly
so
zym
e r
ele
as
e(u
g/m
L)
RB51 LPS
S2308 LPS
RB51+S2308 LPS
Figure 11c: Induction of Lysozyme from Bovine Neutrophils Treated with
Rough, Smooth and Combined Brucella LPS Fractions.
4.6 Induction of Reactive Oxygen Species (ROS) from LPS-Treated Bovine
Macrophages, Neutrophils and Murine Macrophages
The differences in ROS production and nitroblue tetrazolium (NBT) reduction
in bovine macrophages, neutrophils and murine macrophages treated for 24 hrs with
Brucella rough, smooth and combined LPSs were determined. Since ROS induction
is directly proportional NBT reduction or absorbance, these terms have been
alternatively used in this assay. Bovine macrophages stimulated by various
concentrations of rough Brucella LPS (0.02, 0.2, 2.0, 200 µg/mL) yielded
significantly higher (p<0.05) absorbance values than those values obtained with
Brucella smooth LPS or Brucella combined LPS with the same concentrations of LPS
(Fig 12a, 12b & 12c).
Murine macrophages treated with rough LPS at the same concentrations
described above yielded approximately double the absorbance values of those
obtained with smooth LPS and combined LPS fractions. Bovine neutrophils produced
Results
66
lower amounts of ROS and at the highest concentrations of LPS used (2.0, 20, 200
µg/mL).
A comparison of the ROS levels induced in bovine macrophages and
neutrophils showed that the ROS levels were two times higher in bovine macrophages
than in neutrophils. No significant difference was observed in a production of ROS
between murine macrophages and bovine macrophages (Tables 4a, 4b & 4c).
Table 4a: Induction of Reactive Oxygen Species (ROS; as measured by nitroblue tetrazolium reduction) from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Concentrations of Brucella LPS µg/mL
Brucella LPSs 0.00 0.0.2 0.2 2 20 200
Rough LPS 0.05
0.049
0.052
0.081
0.077
0.079
0.089
0.092
0.091
0.33
0.32
0.34
0.46
0.46
0.46
0.60
0.61
0.60
Av 0.05 0.079 0.090 0.33 0.46 0.60
SE 0.001 0.001 0.001 0.005 0 0.003
Smooth LPS 0.049
0.051
0.053
0.06
0.07
0.05
0.073
0.073
0.073
0.14
0.14
0.15
0.21
0.20
0.20
0.36
0.35
0.35
Av 0.051 0.06 0.073 0.14 0.20 0.35
SE 0.009 0.005 0 0.004 0.004 0.004
Combined
Rough and
smooth LPSs
0.051
0.052
0.052
0.072
0.072
0.073
0.081
0.078
0.085
0.22
0.21
0.21
0.33
0.31
0.30
0.42
0.45
0.44
Av 0.051 0.072 0.081 0.22 0.31 0.43
SE 0.0004 0.0003 0.001 0.004 0.01 0.01
AV= Average SE= Standard Error
Results
67
NBT reduction in bovine macrophages
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0µg/mL 2µg/mL 20µg/mL 200µg/mL
Brucella LPSs Concentrations (ug/mL)
Ab
sorb
ance RB51 LPS
S2308 LPS
RB51+S2308 LPSs
Figure 12a: Induction of Reactive Oxygen Species (ROS) from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions. NBT= nitroblue tetrazolium
Table 4b: Induction of Reactive Oxygen Species (ROS; as measured by nitroblue tetrazolium reduction) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Concentrations of LPS µg/mL
Brucella LPSs 0.00 0.0.2 0.2 2 20 200
Rough LPS 0.077
0.078
0.076
0.11
0.12
0.10
0.029
0.026
0.032
0.43
0.42
0.44
0.55
0.54
0.56
0.78
0.78
0.78
Av 0.077 0.11 0.29 0.43 0.55 0.78
SE 0.005 0 0.002 0.005 0.005 0
Smooth LPS 0.077
0.077
0.077
0.083
0.083
0.082
0.12
0.12
0.11
0.25
0.26
0.24
0.31
0.32
0.29
0.43
0.43
0.43
Av 0.077 0.082 0.11 0.25 0.31 0.43
SE 0 0.004 0.02 0.0066 0.011 0
Combined
Rough and
smooth LPSs
0.078
0.077
0.079
0.090
0.091
0.094
0.14
0.15
0.19
0.31
0.31
0.31
0.42
0.41
0.40
0.53
0.54
0.55
Av 0.078 0.091 0.16 0.31 0.41 0.55
SE 0.006 0.02 0.02 0 0.006 0.006
Results
68
NB T reduc tion in murine mac rophag es
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
0µg/mL 2µg/mL 20µg/mL 200µg/mL
Brucella L P S s C oncentra tions (µg /mL )
Absorbance RB51 LPS
S 2308 LPS
RB51+S 2308 LPS s
Figure 12b: Induction of Reactive Oxygen Species (ROS) from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions. NBT= nitroblue tetrazolium
Table 4c: Induction of Reactive Oxygen Species (ROS; as measured by nitroblue tetrazolium reduction) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Concentrations of LPS µg/mL
Types of LPSs 0.00 0.0.2 0.2 2 20 200 Rough
Brucella RB51 LPS
ND ND ND 0.095 0.096 0.096
0.33 0.34 0.33
0.43 0.42 0.42
Av 0.096 0.33 0.42 SE 0.0003 0.003 0.003
Smooth Brucella S2308
LPS
ND ND ND 0.051 0.052 0.050
0.1 0.11 0.1
0.21 0.19 0.2
Av 0.051 0.1 0.2 SE 0.005 0.004 0.006
Combined Rough and
smooth Brucella LPSs RB51+S2308
ND ND ND 0.072 0.072 0.072
0.22 0.21 0.21
0.29 0.28 0.29
Av 0.072 0.21 0.28 SE 0 0.004 0.004
Results
69
NBT reduction in bovine neutrophils
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
0.4
0.45
2µg/mL 20µg/mL 200µg/mL
Brucella LPSs concentrations (ug/mL)
Ab
sorb
ance RB51 LPS
S2308 LPS
RB51+S2308 LPSs
Figure 12c: Induction of Reactive Oxygen Species (ROS) from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions. NBT= nitroblue tetrazolium reduction)
4.7 Induction of Nitric Oxide from LPS-Treated Bovine Macrophages,
Neutrophils and Murine Macrophages
The nitric oxide (NO2) content of culture supernatants of bovine macrophages,
murine macrophages and bovine neutrophils treated with Brucella rough, smooth and
combined (rough and smooth) LPSs was determined by Griess reaction (Fig 13).
Higher levels of NO2 were observed in supernatants of rough LPS-treated cells
compared to smooth or combined LPS-treated cells (Fig 15a, 15b, 15c). In bovine
macrophages, the amounts of nitric oxide production induced by rough Brucella LPS
(at concentrations of 0.02, 0.2, 2.0, 20, 200 µg/mL) were significantly higher while
these values at same concentrations of Brucella smooth and combined LPS-treated
bovine macrophages were lower and least respectively (Table 5a, 5b, 5c).
Although murine macrophages produced higher levels of nitric oxide than
bovine macrophages (p<0.05), the pattern for nitric oxide induction by LPSs was the
same as in bovine macrophages; highest by rough, low by combined and lowest by
Results
70
smooth LPS. Bovine neutrophils also followed the same trend. Murine macrophages
yielded significantly higher levels of nitric oxide than bovine macrophages and
bovine neutrophils (p<0.05), while there was not a significant difference between
nitric oxide values of bovine macrophages and bovine neutrophils (p>0.05).
These results suggest that rough Brucella LPS activates macrophage and
neutrophils. Untreated cells showed negligible NO2 production. For all the LPSs, dose
dependent stimulation was obtained in response to each LPS administered. At the
lowest LPS concentrations, nitrite production was low while at higher concentrations
(200 µg/mL) it was markedly elevated (p<0.05).
Results
71
Figure 13: Nitric Oxide Induction from Bovine Macrophages Treated with
Rough, Smooth and Combined Brucella abortus LPSs Measured by Griess
Reaction
Lanes 1-3: Nitric oxide induction by rough Brucella LPS, Lanes 5-7: Nitric oxide
induction by smooth Brucella LPS, Lanes 9-11 Nitric oxide induction by combined
Brucella LPS.
S tandard C urve for Nitric Oxide Determination
0
5
10
15
20
25
30
35
0 1 2 3 4
Abs orbance
Concentrations of Sodium
Nitrite (ng/m
l)
con
Fig 14: Sodium Nitrite Standard Curve of for Nitric Oxide Determination
Results
72
Table 5a: Induction of Nitric oxide from Bovine Macrophages Treated with
Rough, Smooth and Combined Brucella LPS Fractions.
Concentrations of LPS µg/mL
Brucella LPSs 0.00 0.0.2 0.2 2 20 200
Rough LPS 11
12
10
16
15
15
29
29
29
33
31
33
89
88
88
233
236
238
Av 11 15.3 29 32.3 88.3 235
SE 0.5 0.44 0 0.88 0.44 1.5
Smooth LPS 11
11
11
13
12
11
16
16
16
19
19
18
46
47
46
99
96
94
Av 11 12 16 18.6 46.3 96.3
SE 0 0.66 0 0.44 0.33 1.77
Combined
Rough and
smooth LPSs
10
12
11
14
13
12
20
21
22
29
26
29
62
61
61
166
169
173
Av 11 13 19 28 61.3 169.3
SE 0.66 0.66 0.66 1.33 0.44 2.44
Nitric Oxide Induction in LPS Stimulated Bovine Macrophages
0
50
100
150
200
250
0µg/mL 2µg/mL 20µg/mL 200µg/mL
Brucella LPSs Concentrations ug/mL
Nitri
c O
xide
Conce
ntr
atio
ns
(ng/m
L)
RB51 LPS
S2308 LPS
RB51+S2308 LPSs
Figure 15a: Induction of Nitric Oxide from Bovine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Results
73
Table 5b: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Concentrations of LPS µg/mL
Brucella LPSs 0.00 0.0.2 0.2 2 20 200 Rough LPS 18
18 18
29 31 27
48 52 44
82.4 82.4 82.4
266.6 226.6 226.6
312 313 311
Av 18 29 48 82.4 226.6 312 SE 0 1.33 2.66 0 0 0.66 Smooth LPS 17
17 17
21 21 21
32 30 36
42 43 41
92.1 92.1 92.1
213.3 213.3 213.3
Av 17 21 32.6 42 92.1 213.3 SE 0 0 2.22 0.5 0 2.8E-14 Combined Rough and smooth LPSs
18 17 19
23 24 25
37 37 37
58.6 58.6 58.6
116.3 116.3 116.3
244 245 243
Av 18 24 37 58.6 116.3 244 SE 0.5 0.66 0 0 0 0.66
Nitric Oxide Induction in L PS S timulated Murine
Macrophages
0
50
100
150
200
250
300
350
0 2 20 200
Brucella LPSs Concentrations µg/mL
Nit
ric
Oxi
de
Co
nce
ntr
atio
n
(ng
/mL
)
RB51 LPS
S 2308 LPS
RB51+S 2308 LPS s
Figure 15b: Induction of Nitric Oxide from Murine Macrophages Treated with Rough, Smooth and Combined Brucella lps Fractions.
Results
74
Table 5c: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPSs Fractions.
Concentrations of LPS µg/mL
Brucella LPS 0.00 0.0.2 0.2 2 20 200 Rough LPS 10
10 10
13 12 13
24 22 21
27.5 28
27.7
41 43 42
89 90 90
Av 10 12.3 23.3 27.7 42 89.6 SE 0 0.5 0.35
Smooth LPS 11 10 10
11 10.6 10
11 12.6 12.9
16.8 16.9 17
29 29 28
53 54 54
Av 10.3 10.53 12.16 16.9 28.6 53.6 SE 0.44 0.35 0.44
Combined Rough and
smooth LPSs
10 11 10
11 11 11
16.6 17.2 17.5
22.9 23.2 23.6
36 34 34
76 76 75
Av 10.3 11 17.1 23.2 36.4 75.6 SE 0.44 0.5 0.44 0 0 0.44
Nitric oxide production in bovine neutrophils
0
10
20
30
40
50
60
70
80
90
100
22ug/ml 20ug/ml 200ug/ml
Brucella LPSs concentrations (ug/ml)
Nit
ric
oxi
de
con
cen
trat
ion
(n
g/m
l)
RB51 LPS
S2308 LPS
RB51+S2308 LPSs
Fig 15c: Induction of Nitric Oxide from Bovine Neutrophils Treated with Rough, Smooth and Combined Brucella LPS Fractions.
Results
75
4.8 Measurement of Pro-inflammatory and Anti-inflammatory Cytokines in
LPS Induced Bovine and Murine Macrophages.
The cytokine contents (TNF-α, IL-1β, IL-6, IL-10 and IL-12) of cell culture
supernatants of bovine and murine RAW 264.7 macrophages (pre-treated with
200µg/mL of Brucella rough, smooth or combined LPSs) were measured to examine
the influence of Brucella LPS on cytokine production in macrophages. Medium and
vehicle control wells lacking LPS produced low to undetectable levels of each
cytokine. Brucella rough LPS induced significantly enhanced levels of pro-
inflammatory cytokines including TNF-α, IL-1β, IL-6 and 1L-12 (Fig 16a, 16b, 17a,
17b, 18a, 18b, 20a, 20b). Smooth Brucella LPS induced elevated levels of anti-
inflammatory cytokine (IL-10) (Fig 19a and 19b). The use of combined Brucella LPS
also enhanced the pro-inflammatory cytokines and decreased the anti-inflammatory
cytokines, but the values obtained were lower than those obtained with rough
Brucella LPS. The cytokine profile of rough Brucella LPS stimulated macrophages
(bovine and murine) released the ability of rough LPS to stimulate immune cells. This
finding strengthens the results of LRT, NBT and NO2 assay. Smooth LPS treated
cells failed to induce sufficient levels of tumor necrosis factor alpha (TNF-α) to allow
the cells to elicit an immune response.
In bovine macrophages, almost twice the amount of TNF-α was induced by
rough Brucella LPS (1049.33 pg/mL) than what was obtained with combined LPS
(633.6 pg/mL) (p<0.05) and three times more than the amount induced by smooth
LPS (341 pg/mL) (p<0.05). Similarly, murine macrophages stimulated with rough
Brucella LPS yielded twice the amount of TNF-α (3950 pg/mL) observed with
combined LPS (1970.6 pg/mL) and three times higher than that induced by smooth
LPS (630 pg/mL). No distinct difference in TNF-α production was found between
smooth LPS stimulated and unstimulated cells (Fig 16a and 16b).
Results
76
TNF-alpha induction in bovine macrophages
0
200
400
600
800
1000
1200
Rough LPS Smooth LPS Rough+Smooth
LPS
Cells PBS
Brucella LPSs treatments (200ug/mL)
TN
F-a
lph
a p
g/m
LRough LPS
Smooth LPS
Rough +Smooth LPS
Cells
PBS
Figure 16a: TNF-α Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
TNF-alpha induction in murine macrophages
0
500
1000
1500
2000
2500
3000
3500
4000
4500
Rough LPS Smooth LPS Rough+SmoothLPS
Cells PBS
Brucella LPSs treatments (200ug/mL)
TN
F-a
lpha
pro
duct
ion (pg/m
L)
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Figure 16b: TNF-α Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
Results
77
Other than TNF-α, IL-1β is the major interleukin involved in cellular defense
against brucellosis (Zhan et al 1991). While overall IL-1β production was low, from
bovine and murine macrophages with all LPS combinations used, the yield was
approximately five times higher with the rough Brucella LPS than with the combined
or smooth LPS in both types of macrophages (p<0.05). No significant difference was
observed in TNF-α induction with smooth or combined LPS (p>0.05). Unlike bovine
macrophages, murine macrophages yielded significantly higher amounts of IL-1β
(p<0.05). The highest level was induced by rough Brucella LPS (2.201 pg/mL), with
the levels of induction for combined LPS (0.521 pg/mL) and smooth LPS (0.329
pg/mL) substantially less (Fig 17a and 17b). Rough LPS induced the production of
four times more IL-1β than that found with combined and/or smooth LPS.
Statistically, no significant differences were found between IL-1β stimulated by
smooth or combined LPS (p>0.05).
IL-1 beta induction in bovine macrophages
0
0.2
0.4
0.6
0.8
1
1.2
Rough LPS Smooth LPS Rough+SmoothLPS
Cells PBS
Brucella LPSs treatments (200 ug/mL
IL-1
bet
a p
g/m
L
Rough LPSSmooth LPSRough+Smooth LPSCellsPBS
Figure 17a: IL-β induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
Results
78
IL-1 beta induction in LPS stimulated murine macrophages
‐0.5
0
0.5
1
1.5
2
2.5
Rough LPS Smooth LPS Rough+Smooth
LPS
Cells PBS
B rucel la L PS s treatm ents (ug /m L )
IL-1β
(p
g/m
L)
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Figure 17b : IL-β Production from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
The highest levels of IL-6 release occurred from bovine macrophages when
the cells were treated with rough Brucella LPS (17.78 pg/mL) (p<0.05). This value
approximated three times that induced by smooth LPS (5.58 pg/mL) or combined
LPS (7.83 pg/mL). The use of combined LPS did not produce a significantly higher
level of the cytokine than found with smooth LPS stimulated cells (p>0.05).
Murine macrophages stimulated by rough Brucella LPS produced
approximately twice the amount of IL-6 (53.5 pg/mL) than did macrophages
stimulated with smooth (19.1 pg/mL) and/or combined LPSs (26.8 pg/mL). Murine
macrophages stimulated with Brucella smooth and combined LPSs yielded similar
amounts of IL-6 (Fig 18a and 18b). Marginally higher values were obtained with
combined LPS (p>0.05). Approximately, three times higher levels of IL-6 were
induced in murine macrophages than in bovine macrophages (p<0.05).
Results
79
IL-6 induction in bovine macrophages
0
2
4
6
8
10
12
14
16
18
20
Rough LPS Smooth LPS Rough+SmoothLPS
Cells PBS
Brucella LPSs treatments (200ug/mL)
IL-6
pg
/mL
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Figure 18a: IL-6 induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
IL ‐6 induc tion in murine mac rophag es
0
10
20
30
40
50
60
70
Rough LPS Smooth LPS Rough+Smooth
LPS
Cells PBS
Brucella L P S s trea tments (200 µg/mL )
IL‐6 (pg/m
L)
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Figure 18b: IL-6 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
Higher levels of IL-10 were induced in bovine and murine macrophages when
stimulated by smooth Brucella LPS (Fig 19a & 19b). In bovine macrophages, the
smooth LPS induced approximately three times higher levels of IL-10 in the cells
(95.32 pg/mL) than rough Brucella LPS (31.16 pg/mL) or combined LPS (33.37
Results
80
pg/mL). The induction of IL-10 with smooth or combined LPS was not statistically
different.
As with bovine macrophages and murine macrophages the highest levels of
IL-10 production were induced using smooth Brucella LPS (47.62 pg/mL). Lesser
amounts of IL-10 were induced with combined (16.75 pg/mL) and rough LPS (11.61
pg/mL). The levels of IL-10 detected in smooth LPS treated cells was approximately
four times that found for cells treated with rough LPS (p<0.05). IL-10 production in
macrophages stimulated with combined LPS stimulated macrophages was not
significantly higher than the IL-10 production in cells treated with rough LPS
(p<0.05). Murine macrophages produced approximately half the amount of IL-10
produced by bovine macrophages. This finding supports the concept that bovine
macrophages themselves prevent the pro-inflammation and Brucella elimination
while the murine macrophages are more efficient in this regard.
Results
81
IL-10 induction by LPS stimulation in bovine macrophages
0
20
40
60
80
100
120
Rough LPS Smooth LPS Rough+SmoothLPS
Cells PBS
Brucella LPS s treatments (200 ug/mL)
IL-1
0 (p
g/m
L)
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Fig 19a: IL-10 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
IL-10 induction by LPS stimulation in murine macrophages
0
10
20
30
40
50
60
Rough LPS Smooth LPS Rough+SmoothLPS
Cells PBS
Brucella LPSs treatments (200ug/mL)
IL-1
0 p
g/m
L Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Fig 19b: IL-10 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
Results
82
IL-12 production in bovine macrophages pre-treated with rough Brucella LPS
approximated twice (1133.3 pg/mL) that produced by induction with combined LPS
(678 pg/mL), a value greater than double that produced by smooth LPS (452.2
pg/mL). There was little difference in IL-12 induction using combined and/or smooth
LPSs (p>0.05).
The IL-12 production in murine macrophages was approximately doubled
(2285 pg/mL) that produced when the cells were treated with rough LPS compared to
that obtained with combined (1400 pg/mL) or smooth LPS (978 pg/mL). Smooth and
combined LPSs induced IL-12 in similar amounts; however, murine macrophages
were more efficient in IL-12 induction than where bovine macrophages (p<0.05) (Fig
20a & 20b).
Results
83
IL-12 induction in LPS stimulated bovine macrophages
0
200
400
600
800
1000
1200
Rough LPS Smooth LPS Rough+SmoothLPS
Cells PBS
Brucella LPSs treatments (200ug/mL)
IL-1
2 p
g/m
L
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Figure 20a : IL-12 Induction from Bovine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
IL ‐12 induc tion in L P S stimula ted in murine macrophages
0
500
1000
1500
2000
2500
3000
Rough LPS Smooth LPS Rough+Smooth
LPS
Cells PBS
Brucella L P S s trea tments (200 µg/mL )
1L‐12 (pg/m
L)
Rough LPS
Smooth LPS
Rough+Smooth LPS
Cells
PBS
Figure 20b: IL-12 Induction from Murine Macrophages Treated with Brucella Rough, Smooth and Combined LPS Fractions.
Results
84
4.9 Intracellular Survival of Brucella from Bovine and Murine Macrophages
The intracellular survival of Brucella was determined in bovine and murine
macrophages pre-treated with rough, smooth and combined Brucella LPS (1:1)
preparations. A colony forming unit assay (CFU) was used as evidence to support the
concept previously suggested by the results of assays (lysozyme release assay,
nitroblue tetrazolium assay, nitric oxide assay and a cytokine ELISA assay) showing
stimulatory activity of rough Brucella LPS.
At one hour post-infection when bovine and murine macrophages infected
with Brucella were pre-treated with rough LPS, few viable Brucella were found
(5.1x104 from bovine macrophages; 1.7x104 from murine macrophages). After six to
24 hours post infection, no bacteria were retrieved from either type of macrophage,
suggesting that a majority of the bacteria were phagocytosed and killed, and
indirectly suggesting that substantial activation of macrophages has occurred (Figure
21). In contrast, at one hour post infection, macrophages stimulated with smooth
Brucella LPS retained viable Brucella cells (4.7x105 in bovine macrophages, 1.3x105
in murine macrophages), and after six hours post-infection the survival level was
2.8x105 in bovine macrophages and 9.5x104 in murine macrophages. At 24 hrs post-
infection, 1.9x105 viable bacteria retained in bovine macrophages, and 5.5x104 viable
bacteria in murine macrophages. In contrast, pre-treatment of bovine and murine
macrophages with a combination of smooth and rough Brucella LPSs (1:1) resulted in
a decreased number of viable bacteria (2.0x105, 9.5x104 and 6.4x104 in bovine
macrophages and 6.6x104, 2.9x104 and 1.8x104 cells in murine macrophages at one,
six and twenty four hours post-infection, respectively) as compared to the pre-
treatment with Brucella smooth LPS. Among each of the three LPS treatments, rough
LPS stimulated macrophages contained the least number of live Brucella after
infection. In this experiment, unstimulated cells served as a positive control. There
was a slight decrease in viable Brucella obtained during the first hour and then the
number remained stable (Fig 22b and 22b).
Results
85
These results varify the hypothesis that rough and smooth Brucella LPSs act
in a distinictly different manner in terms of their stimulatary activities and the
resulting brucellacidal capabilities of treated macrophages.
Figure 21: CFU Analysis for Determination of Intracllular Survival of Brucella in Bovine Macrophages. The Plate on Top Right Shows No Growth of Brucella in Macrophages After Treatment with Rough Brucella LPS.
Results
86
C FU ana lysis in bovine macrophages
0
1
2
3
4
5
6
7
0 10 20 30Hours
CFU/well RB51
2308
R+S
control
Figure 22a. Intracellular Survival of Brucella in Bovine Macrophages
CFU Analysis in Murine Macrophages
0
1
2
3
4
5
6
0 5 10 15 20 25 30
Hours post-infection
CF
U/w
ell
RB51
2308
R+S
control
Figure 22b. Intracellular Survival of Brucella in Murine Macrophages.
Results
87
These results showed that LPS from Brucella rough strain (RB51) is more
potent than LPS from Brucella smooth strain (S2308) and the combination of LPS
from both strains (RB51LPS + S2308 LPS)in ability to stimulate the killing of
Brucella by macrophages. The combination of both types of LPSs (1:1) did not
generate a better stimulus in cells. This confirms that the idea for combined LPS
vaccine or multi LPS vaccine may not be successful. It would be better to incorporate
rough LPS than smooth LPS in a Brucella vaccine. Murine macrophages were found
to be more active in releasing higher amounts of lysozyme, ROS, nitric oxide and
pro-inflammatory cytokines than bovine macrophages. These findings strengthen the
hypothesis that the reduced level of induction of these products in bovine immune
cells may be the reason for prolong survival of smooth Brucella strains in these
macrophages. The use of LPS at a level higher than 200 µg/mL was not practical as it
did not fall at the upper level sensitivity for the standard curve.
4.10 In Vivo Stimulation of Carrier Bovines by Brucella abortus LPS:
One hundred animals were tested for the presence of Brucella abortus by the
touch down PCR assay at the livestock farm Rukh Dera Chahal, Lahore, Pakistan.
Twenty seven animals (27%) were found positive on the basis of a positive PCR
assay with an amplicon size of 63bp specific for IS711 genetic element of Brucella
abortus. A higher percentage of agarose gel was used (approximately 1.8 %) in order
to separate primer dimers (approximately 40 bp size) from the amplified product
(Figure 23). At the higher percentage of agarose, the resolution of marker bands was
poor. This was attributed to the increased percentage of agarose. When the pore size
of agarose gel was reduced, a lower resolution of the high molecular weight marker
bands resulted. The low molecular weight PCR fragment (63 bp) can only be resolved
from 40 bp primers dimers if a high percentage of agarose gel is used. The results of
the in vitro experiments were confirmed by the in vivo study of the most stimulating
concentration of rough Brucella LPS (200 µg/mL) in carrier bovines. Only positive
testing animals were treated with immunostimulatory doses of Brucella LPS. Three
Results
88
63bp
days after injecting rough LPS, the infected animals were again examined by lymph
node biopsy and subsequent PCR for elimination of infection. The results of PCR
indicated that infection was still there. Attempts were not made to further investigate
the in vivo effect of Brucella LPS.
1 M 2
Figure 23: PCR Amplification Products from Brucella abortus Positive Lymph
Node Samples.
Lane 1: amplified product is merged with primers; M: DNA marker; Lane 2: 63bp
amplified product.
Primers merged with amplified product
Discussion
89
Chapter-5
DISCUSSION
Brucellosis is caused by the intracellular pathogen Brucella abortus. This
bacterium interferes with the normal function of phagocytic cells (neutrophils and
macrophages). Lipopolysaccharides are present in all Gram-negative bacteria;
however, Brucella lipopolysaccharides contents are unique in their structures and
function. The Brucella LPS is considered as an immunodominant component of this
pathogen (Plommet et al., 1987). The present study was conducted to investigate the
interaction of Brucella LPS contents (isolated from smooth and rough strains) with
phagocytic cells (bovine macrophages, neutrophils and murine macrophages). The
results of this study support the hypothesis that the LPS from smooth and rough
strains behave differently on the phagocytic cells. The stimulatory activity effects of
these LPSs were monitored by measuring of the production of lysozyme, reactive
oxygen species (ROS), nitric oxide (NO2) and cytokines.
A higher production of lysozyme, ROS, NO2 and pro-inflammatory cytokines
was observed in the cells stimulated with rough Brucella LPS than with smooth LPS.
When the LPS contents of rough and smooth strains were used in combination for
immunostimulation, the cellular immune response obtained was lower than the
immune response obtained by using rough LPS. The stimulation of immune response
by LPS preparations was confirmed by establishing the killing index of the bacterium.
5.1 Brucella LPS Extraction, Purification and Characterization
Bucella LPS fractions have been isolated by modification of the phenol
extraction method by number of researchers as described in methods and/or
background (Redfearn, 1960; Westphal and Tann, 1965). This procedure is laborious
and time consuming. However, attempts to replace this technique were not successful.
Recently, a commercial LPS extraction kit (Intron biotechnology) has become
Discussion
90
available. The two extraction methods were compared in terms of convenience, LPS
yield, purity and product integrity. The kit method proved more convenient, quicker,
economical and efficient. The yield of LPS was measured by the Purpald assay. The
phenol extraction method yielded 180 µg of smooth LPS/mL of packed cells and 214
µg of rough LPS/mL of packed cells. The kit method yielded 215 µg of smooth LPS
and 230 µg of rough LPS. The higher yields of smooth LPS over those of rough LPS
may be associated with their hydrophilic and hydrophobic properties, respectively,
since rough LPS is isolated in aqueous phase and smooth LPS in phenol phase
(Backer and Wilson, 1965; Diaz et al., 1968; Bowser et al., 1974; Moreno et al.,
1979).
In addition to phenol, published methods for Brucella LPS purification have
utilized enzymes, detergents and chaotropic agents (Zygmunt et al., 1988). In the
present study proteinase K, a potent protease, was used to remove a majority of
proteins associated with the LPS preparations (Phillip et al., 1989). A LPS
purification scheme lacking proteinase treatment was reported by Wu Am et al.,
(1987), however, the LPS contained 16-42% protein. In the present study, proteinase
K treatment reduced the protein content to <1% as determined with Coomassie blue
gel method. These results are in agreement with those of Phillip et al., (1989) who
reported a 1-15% protein contamination after treatment with proteinase K.
Furthermore, there were no detrimental effects on the immunogenic properties of
LPS. The tight binding of protein to Brucella smooth LPS over that observed with
Brucella rough LPS may be attributed to the observation that there exist stronger
charge-charge interacts between the protein and the S-LPS. This hypothesis may
further be confirmed by various experiments such as segregation of S-LPS and its
associated proteins using different digestive enzymes and column chromatography.
Further use of individual components (S-LPS and proteins) for in vitro immune cell
activation may reveal the fact. Moreover, S-LPS and its associated proteins should
also be tried in vivo to determine the inhibitory effect of proteins.
Discussion
91
The use of lysis step in the kit method eliminated the need of using a
ultracentrifuge and French press, in the preparation of LPS. These items lacking in
many laboratories and the kit avoids the use of chemicals and reagents that might be
harmful for the integrity of LPS. Phenol is not suitable for the industrial isolation of
LPS (Alina et al., 2007).
Smooth Brucella LPS appears as a dense and diffuse smear on an SDS-gel as
compared to the clean ladder type appearance of rough Brucella LPS. This
observation correlates with previous reports of Robinson and Badway, (1994); Wen et
al., (2004) who found that smooth LPS migrated as having a large molecular weight
on SDS-PAGE gels. The large molecular weight of smooth LPS is largely associated
with the O-chain and associated proteins which are not removed after treatment with
proteinase K (Phillip et al., 1989; Rittig et al., 2003).
A SDS-PAGE profile of rough Brucella LPS revealed a fast migrating band
that co-migrated with the low molecular weight lipid A and core oligosaccharide.
These findings are in agreement with the studies of Schurig et al., (1991) and
Cloeckaert et al., (2002) who reported the absence of an O-chain in rough LPS
contents by SDS-PAGE analysis.
5.2 Isolation of Bovine Neutrophils
Neutrophils are prominent members of host defense system and have an
innate capacity to release a variety of toxic agents against Brucella including
lysozyme, reactive oxygen species (ROS) and reactive nitrogen intermediates (RNI).
The production of ROS and RNI is triggered by phagocytosis or exposure to certain
biological components such as LPS (Robinsons and Badwey, 1994, Fang, 1997). In
the present study, neutrophils were isolated using a novel method to study the effect
of Brucella LPSs stimulation on the release of the above mentioned brucellicidal
products (lysozyme, ROS and NO2).
Comparative studies were undertaken to examine bovine and human
neutrophils for potential differences in regulatory mechanisms (Gennaro et al., 1978).
Discussion
92
Studies of Forsell et al., (1985), Styrt et al., (1989) and Nakata et al., (2010)
suggested that bovine neutrophils lack a N-formyl-peptide chemotactic receptor,
exhibit large cytoplasmic granules and contain antibacterial peptides. However,
because of these differences in biological responses of bovine neutrophils, the
isolation procedures used for those of human neutrophils may not necessarily be
identical to those used for isolating bovine neutrophils.
Several procedures have been used for the isolation of bovine neutrophils
(Ganz, 1987). The currently available methods for neutrophil isolation are based on
two principles, i.e., taking advantage of specific gravity of cell types using density
gradient methodology (Coxon et al., 1999) and using a neutrophil specific migratory
stimulus (Hartt et al., 1999).
The use of density gradient materials such as ficoll-hypaque does not yield
homogenous neutrophil populations due to differences in buoyancy of within the
leukocyte population. Moreover, hematological variation between animal species
limits the usefulness of this technique (Roussel and Gingras, 1997). In addition,
according to the results of Zahler et al., (1997) the use of improper densities of ficoll
alters the morphology of cells and results in a high level of erythrocyte
contamination. The negative immunomagnetic separation method of Cotter et al.,
(2001) yields highly enriched neutrophil preparations, but it is not economical. In
addition, there exists, a lack of antibodies against specific markers, secondary
antibody coated magnetic beads and magnetic columns making this application more
theoretical than practical. The bulk of the related published literature suggests that
neutrophil isolation methods, including the sedimentation of whole blood through
dextran, centrifugation of leukocyte-rich plasma and lysis of erythrocytes are
imprecise methods that either alter neutrophil function or result in low recovery of
these cells. In short, none of these methods are satisfactory in terms of purity,
viability and numbers of quiescent neutrophils isolated. The development of newer
Discussion
93
and novel techniques for isolation of different species’s neutrophils is important to the
study of characteristics of neutrophils and their usage in applied immunology.
In the current study, a comparatively simple, convenient and economical
method was developed by modification of the method of Robert and Nauseef (2001).
Since the heparin anticoagulant yields inconsistent results, EDTA was preferred as an
anticoagulant (Robert, 1997). This novel method requires only small blood samples
(4 mL) and the neutrophils isolated are less than 3% contaminated with erythrocytes
and greater than 95% neutrophils were viable. The reagents used in this method are
readily available in most laboratories. This method proved very useful for the
isolation of enriched, viable human and bovine neutrophils (Akhtar et al., 2010b).
5.3. Isolation and Cultivation of Bovine Macrophages.
The interaction of Brucella LPS fractions and isolated bovine peripheral
macrophages was studied in vitro. Macrophages are one of the important phagocytic
and antigen presenting cells. They play a critical role in the induction of the immune
response (Rosenthal, 1978). The functional, morphological and metabolic diversity of
macrophages depends on the site of their origin, stage of differentiation, activation
status and as well may be affected by the isolation procedure utilized. For isolation of
peripheral blood derived monocytic cells (PBMC) the percoll method was used. The
purified cells were cultured in vitro using Dulbecco’s Modified Eagle Medium,
DMEM, Invitrogen GIBCO containing 10% FBS. Optimal survival and propagation
of bovine macrophages were observed when the cells were cultured in disposable
polysterene cell culture flasks (BD Falcon) rather than glass borosilicate Roux flasks,
findings in agreement with Johnson et al., (1977). The cells were cultured for a
maximum period of one week, as prolonged culturing causes contraction of cells (Zhu
et al., 2001).
Discussion
94
5.4 Induction of Lysozyme from LPS-Induced Bovine Macrophages, Neutrophils
and Murine Macrophages
Lysozyme is a glycosidase which hydrolyses N-acetylhexosaminicdic
linkages in chitin, a αβ (1-4) linked linear polymer of N-acetyl glucosamine in the
bacterial cell wall (Sharon, 1967). Macrophage lysozymes are secretory enzymes.
The secretion of lysozyme increases upon cell stimulation. Ralston et al., (1961)
described lysozyme penetration in Brucella and ultimate killing of this organism.
Voss, (1964) also reported that Gram-negative bacteria undergo lysis when treated
with lysozyme in the presence of ethylenediaminetetraacetic acid (EDTA) and tris
buffer. However, lysis is not necessarily produced by the formation of spheroblasts as
the cell wall is damaged. This phenomenon was also confirmed by the studies of
Repaske, (1958) who demonstrated that the cell of a number of unrelated species of
Gram-negative bacteria can be lysed by lysozyme in the presence of EDTA with tis
buffer. Virgilio et al., (1966) reported that when lysozyme is added to cell wall
suspensions, some effects are observed within 2 hrs. The edge of cell wall begins to
dissolve and looses its homogenous circular outline. The cell wall develops irregular
projections and there is loss of thickness and rigidity after 16 hrs. It results in the
partial destruction and disintegrated lysis of the cell wall and thus killing the
organism. From a perspective of enhanced killing of Brucella, macrophage
stimulation would be beneficial since lysozyme also has the ability to degrade the
Brucella cell wall (Maria et al., 2003). It has been postulated that the enhanced
chemotactic responses of macrophages at the site of infection may result in an
elevated serum lysozyme content in infected animals and may mediate increased
phagocytosis (Cardoso et al., 2006). With these observations were kept in mind as
the lysozyme release assay was used to measure cell stimulation.
Elevated levels of lysozyme production were observed in rough LPS-
stimulated bovine macrophages, murine RAW264.7 macrophages, and bovine
neutrophils. Lower levels were found in cells induced with smooth, and a
Discussion
95
combination of both rough and smooth LPSs. The lysozyme content found in cells
treated with rough LPS was almost twice that observed to be induced by either
smooth or combined LPS. The lysozyme contents induced by combined LPS (rough +
smooth in ratio of 1:1) were marginally higher than smooth LPS alone.
The results of the present study suggest that several possibilities may exist for
the observed enhanced induction of lysozyme by Brucella rough LPS. For example,
some membrane determinants may be lacking, such as an O-chain in rough Brucella
LPS (Rittig et al., 2003). Additionally, rough Brucella strains and membrane
associated LPS are rapidly internalized and easily eliminated by immune cells. This
rapid entry of rough Brucella is thought to be associated with the stronger adherence
properties of the bacterium to monocytes and neutrophils (Zwerdling et al., 2009),
and the hydrophilic nature of its LPS as well (Keshav et al., 1991). These properties
may also be responsible for the “triggering” of lysosome and their elevated induction
of lysozyme in macrophages and neutrophils. Chen et al., (2009) suggested that
prevention of macrophage apoptosis by Brucella smooth S2308 strains may play a
role in the prolonged survival of these bacteria inside macrophages. Rough Brucella
strain RB51 could promote apoptosis and necrotic cell death, and were killed along
with host cells. It is entirely possible that the increased release of apoptotic enzymes
induced by rough Brucella is associated with an increased release of lysozyme. On
other hand, smooth Brucella LPS did not induce a significant amount of lysozyme in
any cell type tested (bovine macrophages, neutrophils and murine macrophages). This
observation may be explained by the fact that smooth Brucella LPS can induce
enhanced cAMP production and therefore, may inhibit phagosome-lysosome fusion
resulting in lysozyme induction in immune cells (Canning et al., 1986; Fernendez-
Parada et al., 2003). A decrease in the induction of lysozyme may explain prolonged
survival of Brucella smooth strains in phagocytes (Rasool et al., 1992). The authors
showed that myloperoxidase and lactoferrin released from neutrophils infected with
extra-cellular organisms were four and two times respectively, higher than those of
Discussion
96
neutrophils infected with smooth Brucella. The increased production of lysozyme by
rough Brucella LPS may also be due to lack of an O-side chain or O-antigen, as the
O-chain is involved in virulence of Brucella, and protects Brucella from bactericidal
peptides, complement lysis and phagosome-lysosome fusion.
Lysozyme induction in cells stimulated with combined Brucella LPSs (rough
+ smooth) was lower than that obtained with Brucella rough LPS. However, the
values of lysozyme induced by Brucella combined LPS were higher than that
obtained with smooth LPS. It is suggestive that rough LPS has greater stimulatory
activity alone than that when rough and smooth LPSs are administered together.
There is circumstantial evidence from the present study that the outcome of
Brucella infection is related to macrophage/Brucella interactions. Although the
macrophages were activated for antibrucella activity in both species, this activation
was lower in the more susceptible species (bovines). The higher values of lysozyme
induced in murine macrophages, than in bovine macrophages could be due to an
association between macrophages size and lysozyme production, as murine
macrophages are bigger than bovine macrophages. It may depend on the intra-
macrophagic pH, as certain authors have reported an internal pH difference
betweenbovine, and murine macrophages. Porte et al., (1999) established that
acidification of phagosome was essential for replication of Brucella inside the
macrophages. This may explain the differential release of lysozyme in macrophages
of the two species. Moreover, bovines are the main reservoirs of brucellosis;
therefore it is not surprising that they have greater susceptibility, and an infection
rate, than murine. A comparison of lysozyme induction in bovine macrophages and
bovine neutrophils revealed a much lower level of lysozyme in neutrophils that can
be attributed to faulty degranulation of neutrophils by either smooth or rough
Brucella LPS. Riley and Robertson, (1984) found that B. abortus could not
degranulate neutrophils up to an effective level of stimulation as compared to an
extracellular parasite.
Discussion
97
5.5 Induction of Reactive Oxygen Species (ROS) from LPS-Induced Bovine
Macrophages, Neutrophils and Murine Macrophages
Stimulated macrophages and neutrophils induce reactive oxygen species as
well as other non-oxygen dependent products when stimulated with LPS. These
constitute an essential mechanism of host defense against infectious agents, including
Brucella (Robinson and Badway., 1994). Therefore, determination of the oxidative
burst is a suitable tool to measure immune cell activation (Lecaroz et al., 2006).
Oxygen and related forms may act as a toxicant. Gerschman (1959) demonstrated that
toxicity of oxygen is due to generation of reactive oxygen species (ROS). The
phagocytic cells upon proper stimulation increase their utilization of oxygen
(respiratory burst) and convert oxygen to ROS (Robinson and Badwey, 1994). ROS
and related toxic products may contribute significantly to the destruction of extra-
cellular as well as intracellular pathogens, including Brucella (Babior 1987). As a
defense mechanism, Brucella decreases the production of ROS by production of
enzymes including catalase, superoxide dismutase and peroxide. These enzymes
detoxify ROS. In addition, DNA repair enzymes and stress response proteins that
repair oxidatively damaged components of Brucella are synthesized (Hornback et al.,
2006).
The present study assessed ROS induction from bovine macrophages,
neutrophils and murine macrophages after stimulation with Brucella rough, smooth
and combined (rough + smooth) LPS. Elevated levels of ROS induction were
observed with rough Brucella LPS, over the levels found with smooth and combined
Brucella LPSs. These findings may be due to different regulatory mechanisms for
ROS induction by smooth and rough LPSs. It may be possible that rough Brucella
LPS induces a lower amount of catalse and superoxide dismutase (SOD) than smooth
LPS required for neutralization of ROS. Further, studies are needed to confirm this
hypothesis. It is also possible that the NADPH oxidase and myeloperoxidase systems
Discussion
98
present in the rough strain are more actively expressed, and induce more ROS than
smooth Brucella LPS (Riley and Robertson, 1984; Gorvel et al., 2002).
The observed lower amounts of ROS induced by smooth Brucella LPS is in
agreement with the previous studies of Iyankan et al., (2002); Bertram et al., (1986)
and Price et al., (1990). These authors reported that smooth Brucella was able to
inhibit respiratory burst and hypothesized that some components of smooth Brucella
other than LPS might be responsible for the low oxidative metabolism. This
hypothesis is consistent with the previous observations of Porte et al., (2003) who
suggested that virulent smooth strains of Brucella inhibit the metabolic burst
accompanying phagocytosis. This idea was supported by demonstrating the
interference of myloperoxidase.
A higher level of ROS induction was observed in murine macrophages when
compared with bovine macrophages. These findings are in agreement with those of
Jiang and Baldwin (1993a) who found in murine macrophages, resistance to Brucella
was mediated by an increase ROS induction, particularly in the levels of superoxide
anion and hydrogen peroxide. As the macrophages, upon proper stimulation, increase
their utilization of oxygen (respiratory burst) and convert oxygen to reactive oxygen
species or ROS (Robinson and Badwey, 1994), the increased ROS induction in
murine macrophages as compare to bovine macrophages could be due to the
increased utilization of oxygen by the murine macrophages as compare to bovine
macrophages.
ROS induction in bovine macrophages was greater than that found in bovine
neutrophils. These results are comparable with the findings of Gallego-Ruiz and
Lapena-Honso, (1989) who reported that low levels of ROS were induced by
Brucella LPS in caprine neutrophils. Differences in the isolation procedure of
neutrophils may explain the differences in ROS induction in neutrophils from that
found in macrophages (Watson et al., 1994). These investigations found that ROS
induction was increased in neutrophils isolated by dextran/ficoll procedure over that
Discussion
99
than found by the one step procedure of mono-poly resolving medium. The findings
of present study are not in agreement with the findings of Iyankan et al., (1998).
These investigations reported complete inhibition of the respiratory burst in bovine
neutrophils after stimulation with Brucella LPS. The present study also opposes the
findings of Kreutzer et al., (1979) and Bertram et al., (1986) who found ROS
induction was inhibited in ovine neutrophils treated with Brucella LPS compared that
found with cytosolic antigens and heat killed Brucella.
5.6 Induction of Nitric Oxide from LPS-Induced Bovine Macrophages,
Neutrophils and Murine Macrophages
Nitric oxide (NO2) is one of the most important mediators of immune cells,
with potent antibrucella activity (Gross et al., 1998; Zaki et al., 2005). The nitric
oxide killing of Brucella was described by Jinkyung and Splitter (2003). Nitric oxide
synthase has three isoforms. The isoform iNOS is responsible for high output of NO2
production. The present studies revealed an increased induction of nitric oxide in
bovine macrophages, neutrophils and murine macrophages activated with rough
Brucella LPS. iNOS may be expressed differentially in the presence of smooth or
rough LPS of Brucella. This idea is in agreement with the findings of Jimenez-de-
Baques et al., (2005). These investigators demonstrated that macrophages infected
with attenuated rough Brucella strains induced elevated amounts of nitric oxide
compared to macrophages infected with smooth Brucella strains, the latter strains
neither expressed iNOS nor released nitric oxide. The increased level of nitric oxide
may be due to the fact that all maturation expression markers and co-stimulatory
factors (CCR7, CD83, CD40, CD86) are powerfully induced by the Brucella rough
strain as compared to the Brucella smooth strain (Billard et al., 2007).
These results are in agreement with those of Serafino et al., (2007) who
demonstrated that NO2 production was higher in macrophages infected with rough
strain RB51 than a smooth S2308 or S19 strains. Gangtsetse et al., (2003) extracted
smooth LPS from B. melitensis and found that it did not induce NO2 in RAW264.7
macrophages. The results of the present study are in agreement with these findings.
Discussion
100
The reduced NO2 induction by macrophages and neutrophils mediated through
smooth Brucella LPS may also be an important mechanism for regulating NO2
synthesis and allowing intracellular survival of smooth Brucella as proposed by
Iyankan et al., (2002). Decreased induction of NO2 by smooth Brucella LPS in
immune cells may be due to interaction of superoxide with RNI resulting in the
synthesis of new products (MeCall et al., 1989; Schmidt et al., 1989). The present
study also suggested that Brucella rough and smooth LPSs act in the same manner as
their respective strains.
The present study showed that greater amounts of nitric oxide are
induced in murine macrophages than bovine macrophages. These findings are in
agreement with the previous findings of Gross et al., (1998) who found that more
NO2 mediated killing of Brucella in murine macrophages. These results are also in
agreement with those of Petra et al., (2008) who compared the NO2 levels in
macrophages of different species. They found NO2 was highest in murine
macrophages and lowest in bovine macrophages. However, the results of the present
study are not in agreement with those of Padgett and Pruett, (1992) who found a low
induction of NO2 in mice. The increased nitric oxide induction in murine
macrophages could be related to the enzyme nitric oxide synthase (NOS). NOS has
three isoenzymes of which iNOS is present in activated macrophages. It may be
predicted that murine macrophages express more iNOS as compared to bovine
macrophages. This correlates with the findings of Green et al., (1991) and Moncada
et al., (1991) who expressed iNOS is induced in activated murine macrophages which
lead to high output of nitric oxide. Bovine macrophages could have metabolic
inhibitors of iNOS. Further studies are needed to see iNOS expression comparison in
these two species by using iNOS specific antibodies. These results also suggest the
functional resemblance of bovine macrophages with human macrophages that are
unable to generate detectable amounts of nitric oxide in vitro as described by
Schneemann et al., (1993).
Discussion
101
A comparison of the NO2 content of bovine macrophages and neutrophils revealed
that the NO2 levels produced by neutrophils is less than that found in macrophages
and correlates with the findings of Goff et al., (1996).
5.7 Determination of Cytokines in LPS-Induced Bovine and Murine
Macrophages
Cytokines produced by bovine and murine macrophages stimulated with
rough, smooth and combined (rough and smooth) Brucella LPS were monitored by
using an ELISA assay procedure (BioLegend) for the determination of TNF-γ, IL-1β,
IL-6, IL-10 and IL-12. Elevated levels of the pro-inflammatory cytokines (TNF-α, IL-
1β, IL-6, IL-12) were present in macrophages stimulated with rough Brucella LPS.
Anti-inflammatory cytokines (IL-10) were present, but at a lower level. Macrophages
stimulated with smooth LPS exhibited higher levels of anti-inflammatory cytokine
(IL-10) than pro-inflammatory cytokines. Similar results were reported by Jimenez-de
Baques et al., (2003) who observed elevated levels of pro-inflammatory cytokines
(TNF-α, IL-1β, IL-6, IL-12) induced by rough the Brucella strain in J774 A1
macrophages. However, the results of present study do not correlate with the findings
of Goldstein et al., (1992) and Jarvis et al., (2002) who reported that rough and
smooth Brucella LPSs are at best weak inducers of inflammatory cytokines in
macrophages. This weak induction could be due to the involvement of TLR4 as
opposed to that of TLR2, by lipoprotein stimulation as described by Huang et al.,
(2003).
Cytokine production is dependent on the presence of receptors on
macrophages involved in response to rough and smooth strains of Brucella (Porte et
al., 2003; Rittig et al., 2003). The Brucella rough and smooth strains interact with
different types and numbers of cell receptors and more receptors are involved in
internalization of rough strains with more reactivity. This may explain the greater
reactivity of rough LPS with macrophages and its more potent ability to induce
cytokine release.
Discussion
102
TNF-α is a multifunctional cytokine and is involved in immunity against
Brucella infection. Previous reports suggest that the addition of exogenous TNF-α to
DCs increase immunity and Brucella killing. In this study, rough Brucella LPS
resulted in an increased production of TNF-α. This may be explained by the elevated
level of LPS mediated immunity provided by rough LPS. Furthermore, the results of
the presently described studies correspond to the findings of Pei et al., (2008). These
investigators described the synthesis of elevated levels of TNF-α and IL-1β by the
rough Brucella mutant CA180 over those found with smooth strain S2308, indicating
that macrophages were activated after rough Brucella infection, but not after smooth
Brucella infection. One interpretation of these results might be that O- polysaccharide
(OPS) in smooth Brucella LPS covers the bacterial membrane proteins and thus
blocks the interaction between the Brucella and the macrophages (Bowden et al.,
1995). In contrast, studies of Pei et al., (2004) and Pei et al., (2006) suggested that
Brucella rough mutants invade macrophages via different pathways that smooth
strain, activating macrophages and leading to bacterial destruction.
IL-6 is pro-inflammatory cytokine secreted by T cells and macrophages. IL-6
stimulates immune responses against many chronic inflammatory diseases such as
brucellosis (Volpato et al., 2001). This cytokine is secreted by macrophages in
response to specific microbial molecules referred to as pathogen associated molecular
patterns (PAMPs), including LPSs (Berbaum et al., 2008). Elevated levels of IL-6
induction by rough Brucella LPS stimulated macrophages was found in the present
study. This may be attributed to the same factors responsible for an increase of other
pro-inflammatory cytokines as well. Decreased IL-6 induction by smooth Brucella
LPS demonstrated in the present study correlates with findings of Khatami and
Ardestani, (2005) who found that smooth Brucella LPS induced lower amounts of IL-
6 in J774 murine macrophages.
IL-10, an anti-inflammatory cytokine with ability to block the synthesis of
other pro-inflammatory cytokines (Rajasingh et al., 2006) has been reported to be
Discussion
103
neutralized by anti-IL-10 Ab. This could increase the phagocytic activity of
macrophages (Denis and Ghadirian, 2005) and as such, endogenous IL-10 could
diminish macrophage activity against infection and ultimately result in the down
regulation of immunity (Feng et al., 2002). Rough LPS may serve as a better pro-
inflammatory stimulus for macrophages than smooth or combined LPS, since only
small amounts of IL-10 are induced by rough Brucella LPS.
The increased induction of IL-12 by Brucella rough LPS may be due to an
increase of Th1 immunity by rough LPS. The studies of Sathiyaseelan et al., (2006)
showed that Th1 immunity is more useful against Brucella, and Billard et al., (2007)
explained that cells infected with rough Brucella induced Th1 immunity by producing
elevated levels of IL-12 and stimulated CD4 T-lymphocytes. Additionally, rough
Brucella abortus strains lead to both phenotypic and functional maturation of infected
cells as compared to smooth Brucella abortus strains (Billard et al., 2007). It may be
possible that increased maturation of infected cells is involved in more release of all
anti-brucella components, including pro-inflammatory cytokines.
Our findings are in agreement with those of Dornand et al., (2002) who
demonstrated that Th1 cytokines such as IL-12 and TNF-α stimulated murine cells
and helping in the clearance of a Brucella infection. They found that IL-1β and IL-6
were increased in mice, while in human macrophages IL-10 was increased in addition
to IL-1β and IL-6, and could be responsible for retention of viable Brucella. These
investigators showed that smooth Brucella LPS was a potent inducer of IL-10
synthesis, but did could not induce IL-12, an important participant in Brucella
elimination from cells.
Increased levels of all the pro-inflammatory cytokines were determined in
murine macrophages as compared to bovine macrophages. While the elevated release
of anti-infammatory cytokine (IL-10) by bovine macrophages may explain the
proportional decrease of pro-inflammatory cytokines in the same species, generally it
is considered that if there are more T cell cytokines, there is an increased clearance of
Brucella, as there are more T cells in the spleen of mice. Therefore, this could be the
reason for more cytokine production in murine macrophages. Moreover, mice could
Discussion
104
have more cytotoxic T cells that lyse Brucella- infected macrophages than do
bovines.
In the present studies, bovine macrophages yielded enhanced production of
pro-inflammatory cytokines as compared to bovine neutrophils that are generally
considered as the first line of defense against many infections. Furthermore,
macrophages release a substantial amount of pro-inflammatory cytokines such TNF-
α, IL-1β, while neutrophils and DCs release 5-10 fold smaller quantities of these
cytokines. Data derived from the present study suggests a complementary role for
macrophages with regard to brucellicidal activity, and for induction of an efficient
immune response.
5.8 Determination of Intracellular Survival of Brucella in Bovine and Murine
Macrophages
The enhanced stimulatory activities of rough Brucella LPS were demonstrated
by increased induction of lysozyme, ROS, nitric oxide and pro-inflammatory
cytokines. These findings were affirmed by the lower number of viable Brucella
surviving inside bovine and murine macrophages as established with the colony
forming unit (CFU) assay. The highest positive numbers of CFU units were obtained
with bovine and murine macrophages treated with rough Brucella LPS. Jimenez-de-
Baques et al., (2003) reported that rough Brucella strains showed rapid internalization
and increased killing as compared to smooth Brucella LPS. Our results demonstrated
that the lower stimulatory response induced by smooth Brucella LPS was attributable
to the differential macrophagic stimulatory activities of smooth and rough Brucella
LPSs. These findings are not in agreement with findings of Rittig et al., (2003). These
investigators conducted studies using human monocytes. Administration of smooth
and rough Brucella LPSs reduced the number of intracellular viable bacteria to
similar levels with similar kinetics. The difference in results obtained in these two
studies is probably due to species differences in cell stimulation. Our results are
similar to the findings of Caron et al., (1994) who demonstrated that increased
Discussion
105
stimulation of macrophages by rough Brucella LPS enhanced the phagocytosis of
Brucella suis. Our results are further supported by the experiments of Freevert et al.,
(1998) who observed increased phagocytosis of Brucella in alveaolar macrophages of
rats when stimulated with rough LPS.
In contrast to most previous studies that compared cell stimulations with intact
rough and smooth strains of Brucella, the experiments described in this dissertation
focus on analysis of the differential roles of smooth and rough Brucella LPSs. Our
results suggest consideration of Brucella LPS as a probe to study the process of
phagocytosis and intracellular pathogenesis of smooth vs rough strains of Brucella in
terms of macrophage activation. The low levels of stimulation of macrophages are
thought to be a key factor for the enhanced survival of smooth Brucella strains in
macrophages as compared to rough strains. These findings correlate with the findings
of Price et al., (1990). Riley and Robertson (1984) reported that the increased survival
of smooth strains of Brucella in neutrophils was due to the ability of the smooth
strains of the bacterium to resist killing in phagolysosomes, rather than decreased
granulation as has been established for rough strains.
The host defense and pathogenic mechanisms found in Brucella are
continuously interacting. Brucella uses a wide variety of cellular components
(external and internal) to modulate the host cell environment in order to ensure their
survival. The low level of stimulation by smooth LPS may also explain why these
strains are more virulent and resistant to removal (Tanyel et al., 2009) and as such
provide the basis for the lack, or minimal stimulation of macrophages. The low level
of stimulation by smooth Brucella LPS is consistent with the proposition of non
activation of P38 and ERK1/2MAP kinases pathways during macrophage infection
with Brucella smooth strain (Pei et al., 2008). In addition, a low production of
lysozyme and ROS could favor survival of smooth Brucella strains in phagocytes as
suggested by Rasool et al., (1992). Fernandez-Perada et al., (2003) found that
Brucella with a rough LPS phenotype infects human macrophages more efficiently
than smooth LPS phenotypes, but replication occurs only in the latter instances. The
Th2 immune response has been detected in chronic Brucella infections (Refiei et al.,
Discussion
106
2006) and more of the chronic infections are associated with smooth Brucella strains
that reside inside immune cells for longer periods of time. Therefore, the induction of
the Th2 immune response by smooth Brucella is not very useful for elimination of
infection. However, in all of the previous studies, whole Brucella rough and smooth
strains were used to stimulate the cells. In this study for the first time, Brucella rough
and smooth LPSs were used to stimulate macrophages and to study the exact role of
LPS in intracellular survival of Brucella inside the macrophages.
Since activated macrophages successfully deal with intracellular Brucella, it
may be possible that rough LPS-mediated activation of macrophages can participate
in increasing host defense. These differences in rough, smooth and combinational
Brucella LPSs in their ability to stimulate macrophages are manifestations of stealthy
strategy of virulent smooth Brucella to avoid active immune responses in infected
macrophages (Barquero-Calvo et al., 2007).
5.9 PCR Detection of Carrier Animals and In Vivo Effects of Brucella LPS
The in vitro results of previous experiments demonstrated the potent activity
of rough Brucella LPS in a dose dependent manner. In order to further investigate the
stimulatory role of LPS, in vivo experiments were performed with maximum
concentrations (200 µg/mL) of rough Brucella LPS in carrier bovines. Although a
long list of serological tests was available for diagnosis of bovine brucellosis, the
PCR assay was preferred since it is sensitive, specific, rapid, inexpensive to perform,
simple to design and carry out and can be automated with minimal effort and has the
potential of high output. The highly sensitive and specific polymerase chain reaction
(PCR) permits accurate and fast detection of Brucella species (Lavaroni et al., 2004).
The reaction is based on antigenic detection and consequently there is less risk for
cross reactions with other antibodies (Marianelli et al., 2008). In view of the
important economic and health related impacts of brucellosis and the questionable
reliability of earlier studies, the investigation of brucellosis incidence in Pakistan
remains warranted, specially in Punjab with its major share of Pakistani livestock, of
Discussion
107
49% cattle and 65% buffaloes. O’Leary et al., (2006) suggested that lymph node
aspirates served as a better source for Brucella detection by PCR assay than did milk
or blood; therefore the lymph node aspirates were preferred in this study to screen for
brucellosis employing the touch down PCR assay.
“Touch down” PCR is a simple PCR assay except that the annealing
temperature is used over a broad range. The first five cycles were run at 48ºC, the
next five cycles at 50ºC and so on up to 58ºC. The use of a wide range of annealing
temperatures yielded clear bands with less effort required for standardizing the
annealing temperature (s). The genetic element IS711 was targeted for B. abortus
detection. This element is a commonly used target for PCR-based diagnosis (also
known as IS6501) (Ouahrani et al., 1993). The advantage of using IS711/IS6501
target sequence lies in the natural amplification of the target sequence since all
Brucella species contain at least five, and can carry as many as 35 copies of this
element distributed throughout their genomes (Bricker and Halling, 1994; Bricker et
al., 2000).
After PCR detection of carrier bovines, ten milliliters of the potent in vitro
stimulating agent rough Brucella LPS (200 µg/mL) was injected into the animals and
the animals were again screened by PCR as a test for the elimination of the infection.
While rough Brucella LPS stimulated macrophages and neutrophils, the results of in
vivo studies demonstrated that Brucella LPS alone could not account for elimination
of the infection. The results of in vitro and in vivo experiments demonstrated that
while LPS plays a pivotal role in stimulation of macrophages, it also can act as an
antigen to stimulate immune cells in vitro. However, LPS alone cannot act as an
antigen sufficient to eliminate infection in vivo. This phenomenon may be explained
by the fact that Brucella LPS lacks biological properties of the classical LPS from
other microorganism that cause phagocyte activation in vivo (Freer et al., 1995).
Discussion
108
Conclusions
1. This study provides experimentally supported data that explains how Brucella
LPS acts as an immunogenic agent. This was achieved by measurement of
lysozyme, reactive oxygen species, nitric oxide, pro-inflammatory and anti-
inflammatory cytokines products essential for brucellicidal activity.
2. Smooth, rough and combined Brucella LPSs each exhibited distinct properties
and behaved differently in stimulating phagocytic activity in bovine
macrophages, neutrophils and murine macrophages.
3. These experiments demonstrated that rough Brucella LPS was a more potent
stimulator of lysozyme release, oxidative stress and nitric oxide production
when compared to smooth LPS, or the combination of both smooth and rough
LPSs. The stimulation was dose dependent. This observation may be a key
factor in revealing how different Brucella strains survive within the
macrophages and supports the hypothesis that a link exists between
macrophages activation and Brucella killing.
4. Since activated macrophages deal successfully with intracellular Brucella it is
tempting to hypothesis that LPS-mediated activation of macrophages may
prevent infection by stimulating macrophages and other immune cells thereby
increasing phagocytosis and ultimately host defense.
5. The less effective stimulation of macrophages by smooth LPS may explain
why different Brucella strains are more virulent and resistant to infection due
to improper or minimal stimulation of macrophages. This different stimulatory
activity of different Brucella LPSs may be attributed to different pathogenic
pathways for smooth and rough strains.
6. The use of combined Brucella LPSs had no significant effect on immune cell
stimulation and the use of multiple LPSs for vaccine may not be a fruitful
effort to pursue as has been suggested by others.
Discussion
109
7. The detection of carrier animals provides useful information that can be used
for herd protection and eradication programs, for improved productivity and
reproductivity of animals. This finding has important economic implications
as well.
Recommendations
1. The potential use of Brucella abortus rough LPS is recommended as a
carrier/adjuvant in future Brucella vaccines studies.
2. The use of combined Brucella LPSs had no dramatic effect on immune cell
stimulation. It is therefore suggested that the use of multiple LPS vaccinations
will not be effective.
3. More detailed in vivo studies are required. Chemical conjunction of Brucella
cytoplasmic and/or periplasmic proteins with Brucella rough LPS may offer a
fruitful approach for vaccine preparations for enhancement of immunity.
4. The use of combined LPSs the (smooth and rough LPS) minimized the effect
of each type of LPS. Therefore, the infectious organism type of Brucella
(smooth or rough) present in infected animals should be identified. Animals
infected with rough strains should be treated with rough LPS and the animals
infected with smooth strains should be treated with smooth LPS.
5. Local strains of Brucella in native animals should be isolated for extraction of
LPS. The LPS from other strains may not be effective against local strains.
Summary
110
Chapter-6
EFFECT OF SMOOTH AND ROUGH STRAIN BRUCELLA ABORTUS LPS
(LIPOPOLYSACCHARIDES) ON IMMUNE STIMULATION OF
BOVINES
SUMMARY
Brucella lipopolysaccharide (LPS), a non-classical endotoxin and outer
membrane component, plays an important role in host–Brucella interactions. The
survival of Brucella inside the macrophages is critical for Brucella pathogenesis. The
differential effects of smooth and rough B. abortus LPSs on bovine macrophages,
neutrophils and murine macrophages were studied and compared. B. abortus LPSs
were isolated from rough (RB51) and smooth (2308) strains and were purified. Both
rough and smooth LPSs were used separately and in combination to activate bovine
macrophages, neutrophils and murine RAW264.7 macrophages. The lysozyme
release test (LRT), nitroblue tetrazolium test (NBT), nitric oxide (NO2) assay and
cytokine ELISA assay were used to measure LPS-mediated induction of lysozyme,
reactive oxygen species, nitric oxide, pro-inflammatory and anti-inflammatory
cytokines in LPS treated cells. Rough Brucella LPS from strain RB51 induced
significantly higher levels of lysozyme, oxidative stress, nitric oxide and
inflammatory cytokines in treated cells than did LPS from smooth Brucella strain
2308, or a combination of smooth and rough LPSs. These responses were found to be
dose-dependent. The colony forming unit assay verified these results by indicating
that bovine and murine macrophages stimulated with Brucella rough LPS killed
significantly more Brucella than those macrophages stimulated with Brucella smooth
Summary
111
LPS. These findings demonstrated that Brucella rough LPS could induce cell-
mediated immunity. Further in vivo experiments were performed bovines that
detected on Brucella carriers by PCR assay. These Brucella carrier animals were
injected with stimulatory doses of rough LPS (injected at the dose rate of 200 µg/mL;
10 mL dose per animal). These animals were observed for the presence of Brucella
infection again by lymph node biopsy and PCR after three days of injection. The
animals were still found to be infected for Brucella, which may reflect in vivo failure
of Brucella LPS to stimulate cells for elimination of infection. It could possibly be
explained by the factors associated with in vivo inhibition of Brucella LPS activity or
the different LPSs suppressing the effect of LPS from opposite strain (rough or
smooth). This research may provide an impetus for immunologists to incorporate
rough Brucella LPS in future Brucella vaccines.
Literature Cited
112
LITERATURE CITED
Ahmad, R. and M. A. Munir (1995). Epidemiological investigation of brucellosis in
buffaloes. Pakistan Vet J 15(4): 169-172.
Akhtar, S., M. Afzal., S. Ali., and M. I. Khan (1990). Effect of reactor retention on
the spread of brucellosis in jersey cattle and buffalo herds. Rev-Off Int
Epizoot 9(1990 ): 1179-1185.
Akhtar, R., Z. I. Chaudhary., A. R. Shakoori., M. D. Ahmad and A. Aslam (2010a).
Comparative efficacy of conventional diagnostic methods and evaluation of
polymerase chain reaction for the diagnosis of bovine brucellosis. Vet World.
3(2): 53-56.
Akhtar, R., Z. I. Chaudhary., and Y.O. He (2010b). Modified method for isolation of
peripheral blood neutrophils from bovines and humans. IJAVMS. 4(2010): 8-
14.
Akhtar, R., Z. I. Chaudhary., N. Mehmood., G. Mustafa., and M. F. Raja (2010c).
Molecular epidemiology and associated risks of bovine brucellosis in Punjab
Pakistan: An updated look. World Acad Sci, Eng Tech. 69 (2010): 1507-1531.
Alina, T., A. Novikov., M. A. Conquy., C. Werts., C. Fitting., J. Marc. Cavaillon.,
and M. Caroff (2007). Simple method for repurification of endotoxins for
biological use. Appl Environ Microbiol. 73 (6): 1803-1808.
Apuurba, K. B., L. V. De-Verg., M. J. Izadjoo., L. Yuan., T. L. Hadfield., W. D.
Zollinger., and D. L. Hoover (2002). Protection of mice against brucellosis by
intranasal immunization with Brucella melitensis lipopolysaccharides as a non
covalent complex with Neisseria meningitides Group B outer membrane
protein. Infect Immun 3324-3329.
Aragon, V., R. Diaz, E. Moreno., and I. Moriyon (1996). Characterization of Brucella
abortus and Brucella melitensis native heptans as outer membrane O
Literature Cited
113
Polysaccharide independent from the smooth lipopolysaccharide. J Bacteriol
178 (4): 1070-1079.
Ayman, A. M., A. Tibbor., P. Mertens., X. De-Bolle., P. Michel., J. Godefroid., K.
Walravens., and J. J. Letesson (2001). Protection of BALB/c mice against
Brucella abortus 544 challenge by vaccination with bacterioferritin or p39
recombinant proteins with CpG oligodeoxynucleotides as adjuvant. Infect
Immun 69(8): 4816-4822.
Babior, B. M., and J. T. Curnutte (1987). Chronic granulomatous disease in pieces of
a cellular and molecular puzzle. Blood Rev 1(4): 215-218.
Baker, P.J., and J. B. Wilson (1965). Chemical composition and biological properties
of the endotoxin of Brucella abortus J Bacteriol 90(4): 895-902.
Baldwin, C.L., and M. Parent (2002). Fundamentals of host immune response against
Brucella abortus: what the mouse model has revealed about control of
infection. Vet Microbiol 90 (1-4): 367-382.
Bandara, A. B., S. A. Poff-Reichow., M. Nikolich., D. L. Hoover., N.
Sriranganathan., G.G. Schurig., V. Dobrean., and S.M. Boyle. (2009).
Simultaneous expression of homologus and heterologus antigens in rough,
attenuated Brucella melitensis Microbes Infect 11(3): 424-428.
Barquero-Calvo, E., E. Chaves-Olarte., Weiss Ds., C. Guzman-Verri., C. Chacon-
Diaz., A. Rucavado., I. Moriyon., and E. Moreno (2007). Brucella abortus
uses a stealthy strategy to avoid activation of the innate immune system
during the onset of infection. PLoS ONE 2 (7): 631.
Becker, A.J., S. Uckert., D. Tsikas., H. Noack., G. C. Stief., J. C. Frolich., G. Wolf.,
and U. Jonas (2000). Determination of nitric oxide metabolites by means of
the Griess assay and gas chromatography-mass spectrometry in the cavernous
and systemic blood of healthy males and patients with erectile dysfunction
during different functional conditions of penis. Urol Res 28(6): 364-369.
Literature Cited
114
Benninatic, C., M. Garibaldi., C. Lo-Passo., G. Mancuso., S. Papasergi., G. Garufi., I.
Pernice., G. Teti., and F. Felichi (2009). Immunogenic mimics of Brucella
lipopolysaccharide epitopes. Peptides 30 (10): 1936-1939.
Berbaum, K., K. Shanmugam., G. Stuchbury., F. Weide., H. Korner., and G. Munich
(2008). Induction of novel cytokines and chemokines by advanced glycation
endproducts determined with a cytometric bead assay. Cytokine 41(3): 198-
203.
Bertram, T. A., P. C. Canning., and J. A. Roth (1986). Preferential inhibition of
primary granule release from bovine neutrophils by a Brucella abortus
extract. Infect Immun. 52(1986): 285-292.
Billard, E., J. Dornand., and A. Gross (2007). Interaction of Brucella suis and
Brucella abortus rough strains with human dendritic cells. Infect Immun. 75:
(12 )5916-5923.
Bobo, R. A., and J. W. Foster (1964). The effect of enzyme treatments on Brucella
abortus cell walls. J. Gen Microbiol. 34: (1964) 1-8.
Bounous, D. I., F. M. Enright., K. A. Gossett., and C. M. Berry (1993). Phagocytosis,
killing and oxidant production by bovine monocyte-derived macrophages
upon exposure to Brucella abortus strain 2308. Vet Immunol Immunopathol.
37 (3-4): 243-256.
Bovin, A., and L. M. Mesrobeanu (1935). Recherches sur les antigens somatiques et
sur les endotoxins des bacteries. 1 considerations generales et expose des
techniques utilisees. Rev Immunol 1(1935) :553-569.
Bowden, R. A., A. Clocekaert., M. S. Zygmunt., S. Bernard., and G. Durbay (1995).
Surface exposure of outer membrane protein and lipopolysaccharide epitopes
in Brucella species studied by enzyme-linked immunosorbent assay and flow
cytometry. Infect Immun. 63(10): 3945-3952.
Formatted: French (France)
Literature Cited
115
Bowser, D. V., N. W. Wheat., J. W. Foster., and D. Leong (1974). Occurrence of
quinovosamine in lipopolysaccharides of Brucella species. Infect. Immun.
9(1974): 772-774.
Brade, H., C. Galanos., and O. Luderitz (1983). Isolation of a 3-deoxy-D
mannooctulosomic acid disaccharide from Salmonella minnesota rough form
lipopolysaccharide. Eur J Biochem 131( 1983): 195-200.
Bricker B. J., and S. M. Halling (1994). Differentiation of Brucella. abortus bv 1,2,
and 4, Brucella melitensis, Brucella ovis and Brucella suis bv 1 by PCR. J.
Clin Microbiol 32 (11): 2660-2666.
Bricker, B. J (2000). Characterization of the three ribosomal RNA operons rrnA, and
rrnC from Brucella melitensis. Gene 5: 255 (1): 117-126.
Bricker, B. J., D. R. Ewalt., S. C. Olsen., and A. E. Jensen (2003). Evaluation of
Brucella abortus species-specific polymerase chain reaction assay, an
improved version of the Brucella AMOS polymerase chain reaction assay for
cattle. J Vet Dign Invest 15( 2003):374-378.
Bruce, W. J., T. H. Haris., N. Qureshi., and G. A. Splitter (2002). Rough and
Escherichia coli differentially activates the same mitogen activated protein
kinase signaling pathway for tumor necrosis factor alpha in RAW 264.7
macrophages like cells. Infect Immun 70 (12): 7165-7168.
Canning, P. C., J. A. Roth., L. B. Tabatbai., and B. L. Deyoe (1985). Isolation of
components of Brucella abortus responsible for inhibition of function in
bovine neutrophils. J Infect Dis 152(5): 913-921
Canning, P. C., J. A. Roth., and B. L. Deyoe (1986). Release of 5’ guanosine
monophosphate and adenine by Brucella abortus and their role in the
intracellular survival of the bacteria. J Infect Dis 154(3): 464-470.
Canning, P. C., B. L. Deyoe., and J. A. Roth (1988). Opsonin dependent stimulation
of bovine neutrophils oxidative metabolism by Brucella abortus. Am J Vet
Res 49 (2): 160-163.
Literature Cited
116
Capasso, L (2002). Bacteria in two-millennia-old cheese and related epizoonosis in
Roman population. J Infect 45(2002): 122-127.
Cardoso, P. G., G. C. Macedo., V. Azevedo., and S. C. Oliveira (2006). Brucella spp
noncanonical LPS: Structure, biosynthesis, and interaction with host immune
system. Microb Cell Fact 5(2006):13-24.
Caroff, M., D. R. Bundle., M. B. Perry., J. W. Cherwonogrodzkiy., and J. R. Duncan
(1984). Antigenic S-type lipopolysaccharide of Brucella abortus 1119-3
Infect Immun 46 (2):384-388.
Caron, E., T. Peyend., S. Koher., S. Cabane., J. P. Liautard., and J. Dornand (1994).
Live Brucella spp. fail to induce tumor necrosis factor alpha excretion upon
infection of U937-derived phagocytes. Infect Immun 62( 1994): 5267-5274.
Chen, F., and Y. He (2009). Caspase-2 mediated apoptotic and necrotic murine
macrophages cell death induced by rough Brucella abortus. PloS 4(8): e6830.
Cloeckaert, A., M. S. Zygmunt., and L. A. Guilloteau (2002). Brucella abortus
vaccine strain RB51 produces low levels of M-like O-antigen. Vaccine 20
(13-14): 1820-1822.
Connelly, L., A. T. Jacobs., M. Palacioscallender., S. Moncada., and A. J. Hobbs
(2003). Macrophage endothelial nitric oxide synthase autoregulates cellular
activation and pro-inf. J Biol Chem 278( 2003): 26480-26487.
Corbel, M. J (1997). Brucellosis: an overview. Emerg. Infect. Dis. 3( 2): 213-221.
Cotter, M. J., K. E. Norman., P. G. Hellewell., and V. C. Ridger (2001). A novel
method for isolation of neutrophils from murine blood using negative
immunomagenetic separation. Am J Pathol 159 (2): 473-480.
Coxon, A., T. Tang., and T. N. Mayadas (1999). Cytokine activated endothelial cells
delay neutrophils apoptosis in vitro and in vivo. A role for granulocyte
macrophage colony stimulating factor. J Exp Med 190( 7): 923-934.
Literature Cited
117
Darveau, R. P., and R. E. Hancock (1983). Procedure for isolation of bacterial
lipopolysaccharides from both smooth and rough Pseudomonas aeruginosa
and Salmonella typhimurium strains. J Bacteriol 155 (2): 831-838.
Denis, M., and E. Ghadirian (2005). Dysregulation of interleukin 8, interleukin 10
and interleukin 12 release by alveolar macrophages from HIV type 1 infected
subjects. AIDS Res Hum Retrovir 10(12): 1619-1627.
Department of the Army, US Army activity in the US biological warfare programs,
vols 1 and 2. Washington, D.C: HQ, DA; 24 February 1977. Unclassified.
Diaz, R., L. M. Tones., D. Leong., and J. B. Wilson (1968). Surface antigens of
smooth Brucellae. J Bacteriol 96(1968): 893-901.
Dodek, P. M., M. Ohgami., D. K. Minshall., and A. R. Burns (1991). One step
isolation of neutrophils using an elutriator. In Vitro Cell Dev Biol 27A: 211-
214.
Dornand, J., A. Gross., V. Lafont., J. Liautard., J. Oiaro., and J. P. Liautard (2002).
The innate immune response against Brucella in humans. Vet Microbiol.
90(1-4): 383-394.
Dubray, G., and C. Charriaut (1983). Evidence of three major polypeptide species and
two major polysaccharide species in the Brucella outer membrane. Ann Rech
Vet 14(3): 311-318.
Dubray, G., and J. Limet (1987). Evidence of heterogeity of lipopolysaccharides
among Brucella biovars in relation to A and M specificities. Ann Inst Pasteur
Microbiol 138(1): 27-37.
Duenas, A., A. Orduna., M. S. Crespo., and C. Garcia-Rodriguez (2004). Interaction
of endotoxins with toll like receptor 4 correlates with their endotoxic potential
and may explain the pro-inflammatory effect of Brucella spp. LPS. Int
Immunol 16(10): 1467-1475.
Economy survey (2008-09). Govt. of Pakistan, 2008. Islamabad: Ministry of Finance,
Islamabad, Pakistan.
Literature Cited
118
Fang, F. C (1997). Perspectives series: Host pathogens interactions. Mechanisms of
nitric oxide related antimicrobial activity. J Clin Invest 99(12): 2818-2825.
Feng, Y. H., W. L. Zhou., Q. L. Wu., W. M. Zhao., and J. P. Zou (2002). Low dose of
reveratol enhanced immune response of mice. Acta Pharmacol Sin 23(10):
893-897.
Fernandez-Parada, C. M., E. B. Zelazowska., M. Nikolich., T. L. Hadfield., R. M.
Roop., and G. L. Robertson (2003). Interactions between Brucella melitensis
and human phagocytes: Bacterial surface O-polysaccharide inhibits
phagocytosis, bacterial killing and subsequent host cell apoptosis. Infect
Immun 71( 4): 2110-2119.
Fiori, P. L., S. Mastrandrea., P. Rappelli., and P. Cappuccinelli (2000). Brucella
abortus infection acquired in microbiology laboratories. J Clin Microbiol
38(5): 2005-2006.
Forsell, J. H., J. R. Kateley., and C. W. Smith (1985). Bovine neutrophils treated with
chemoteactic agents: morphologic changes. Am J Vet Res 46(9): 1971-1974.
Freer, E., N. Rojas., A. Weintrab., A. A. Lindberg., and E. Moreno (1995).
Heterogeneity of Brucella abortus lipopolysaccharides. Res Microbiol 146(7):
569-578.
Freevert, C. W., A. E. Warner., E. Weller., and J. D. Brain (1998). The effect of
endotoxin on in vivo rat alveolar macrophage phagocytosis. Exp Lung Res
24(1998): 745-758.
Freitas, M., G. Porto., J. L. F. C. Lima., and E. Fernandes (2008). Isolation and
activation of human neutrophils in vitro. The importance of the anticoagulant
used during blood collection. ClinBiochem 41(7-8): 570-575.
Gaines, P., J. Chi., and N. Berliner (2005). Heterogeneity of functional responses in
differential myeloid cell lines reveals EPRO cells as a valid model of murine
neutrophils functional activation. J Leukocyte Biol 77(2005): 669-679.
Literature Cited
119
Galanos, C., O. Luderitz., and O. Westphal (1969). A new method for the extraction
of R lipopolysaccharides. Eur J Biochem 9: (1969) 245-249.
Gallego-Ruiz, M. C., and M. A. Lopena-Alonso (1989). Stimulation du metabolism
oxydatif des granulocytes caprines par Brucella melitensis by goat’s
polymorphnuclear phagocytes. Comp. Immunol Microbiol Infect Dis
12(1989): 9-15.
Gangtsetse, T., N. Koide., K. Takahashi., F. Hassan., S. Islam., H. Ito., I. Mori., T.
Yoshida., and T. Yokochi (2003). Characterization of Biological activities of
Brucella melitensis lipopolysaccharide. Microbiol Immunol 50(1): 421-427.
Ganz, T (1987). Extracellular release of antimicrobial defensins by human
polymorphnuclear leukocytes. Infect. Immunol. 55(3): 568-571.
Garin-Bastuji, B. B., R. A. Bowden., G. Dubray., and J. N. Limet (1990). Sodium
dodecyl sulfate polyacrylamide gel electrophoresis and immunoblotting
analysis of smooth lipopolysaccharide heterogeneity among Brucella biovars
related to A and M specificities. J Clin Microbiol 28(10): 2167-2174.
Gennaro, R., C. Schneider., G. deNicola., F. Cian., and D. Romeo (1978).
Biochemical properties of bovine granulocytes. Proc Soc Exp Biol Med
157(3): 342-347.
Gerschman, R., D. L. Gilbert., S. W. Nye., P. Dwyer., and W. O. Fenn (1954).
Oxygen poisoning and x-irradiation, A mechanism in common. Science
119(3097): 623-626.
Godfroid, J., A. Cloeeeckaert., J. P. Liautard., S. Kohler, D. Fretin., K. Walravens., B.
Garin-Bastuji., and J. J. Letesson (2005). From the discovery of the Malta
fever’s agent to the discovery of a marine mammal reservoir, brucellosis has
continuously been a re-emerging zoonosis. Vet Res 36(2005): 313-326.
Goff, W. L., W. C. Johnson., C. R. Wyatt., and C. W. Cluff (1996). Assessment of
bovine mononuclear phagocytes and neutrophils for induced L-arginine-
Literature Cited
120
dependent nitric oxide production. Vet Immunol Immunopathol 55(1-3):45–
62.
Goldstein, J., T. Hoffman., C. Frasch., E. F. Lizzio., P. R. Beinning., D. Hochstein.,
Y.L. Lee., R. D. Angus., and B. Golding (1992). Lipopolysaccharide (LPS)
from Brucella abortus is less toxic than that from Escherichia coli, suggesting
the possible use of Brucella abortus or LPS from Brucella abortus as a carrier
in vaccines. Infect Immun 60(4): 1385-1389.
Gordon, S., J. Todd., and Z. A. Cohn (1974). In vitro synthesis and secretion of
lysozyme by mononuclear phagocytes. J Exp Med 139(1974): 1228-1248.
Gorvel, J. P., and E. Moreno (2002). Brucella intracellular life: from invasion to
intracellular replication, Vet Microbiol. 90 (1-4): 281-297.
Green, S.J., C.A. Nacy., and M.S. Meltzer (1991). Cytokine induced synthesis of
nitrogen oxides in macrophages: a protective host response to Leishmania and
other intracellular pathogen. J. Leukocyte Biol. 50( ): 93-103.
Greiner, M., D. Verloo., and F. Massis (2009). Meta-analitical equivalence of studies
on diagnostic tests for bovine brucellosis allowing assessment of a test against
a group of comparative test. Prev Vet Med 92: ( 4) 373-381.
Gross, A., S. Spiesser., A. Terraza., B. Rouot., E. Caron., and J. Dornand (1998).
Expression and bactericidal activity of nitric oxide synthase in Brucella suis
infected murine macrophages. Infect Immun 66(4): 1309-1316.
Gross, A., S. Bertholet., J. Mauel., and J. Dornand (2003). Impairment of Brucella
growth in human macrophagic cells that produce nitric oxide. Microb
Pathogenesis 36(2): 75-82.
Hartt, J. K., G. Barish., P. M. Murphy., and J. L. Gao (1999). N-formylpeptides
induce two distinct concentration optima for mouse neutrophils chemotaxis by
differential interaction with two N-formylpeptide receptor (FPR) subtypes.
Molecular characterization of FPR2, Second mouse neutrophils FPR. J Exp
Med 190(5):741-747.
Literature Cited
121
He, Y., S. Reichow., S. Ramamoorthy., X. Ding., R. Lathigra., J. C. Craig., B. W. S.
Sorbel., G. G. Schurig., N. Sriranganathan., and S.M. Boyle (2006). Brucella
melitensis triggers time-dependent modulation of apoptosis and down-
regulation of mitochondrion-associated gene expression in mouse
macrophages. Infect Immun 74(9): 5035-5046.
Hinic, V., I. Brodard., A. Thomann., Z.C. Vetnic., P. V. Makaya., J. Frey., and C.
Abril (2008). Novel identification and differentiation of Brucella melitensis,
B. abortus, B. suis, B. ovis, B. canis and B. neotomae suitable for both
conventional and real time PCR systems. J Microbiol Meth 75(2): 375-378.
Hornback, M. L., and R. M. II Roop (2006). Brucella abortus xthA-1 gene product
participates in base excision repair and resistance to oxidative killing but is
not required for wild type virulence in mouse model. J Bactreriol 188(2006):
1295-1300.
Hotchkiss, R. D (1946). The nature of the bactericidal action of surface active agents.
Ann N Y Acad Sci 46( 1946) : 479-493.
Huang, L.Y., J. Aliberti., C. A. Leifer., D. M. Segal., A. Sher., D.T. Golenbock., and
B. Golding (2003). Heat Killed Brucella abortus induces TNF and IL-12p40
by distinct My88-dependent pathways: TNF, unlike IL-12p40 secretion is toll-
like receptor 2 dependent. J Immunol 171(3): 1441-1446.
Hussain, I., M. I. Arshad., M. S. Mahmood., and M. Akhtar (2008). Seroprevalence of
brucellosis in human, cattle and buffalo populations in Pakistan. Turk J Vet
Anim Sci 32(4): 315-318.
Introduction to Flow Cytometery, First paperback edition. James V. Watson.
Caambridge University Press. 2004.
Iyankan, L (1998). Studies on the mechanism of cellular host defense in brucellosis.
M.VSc. Thesis submitted to I.V.R.I. Deemed University, India.
Literature Cited
122
Iyankan, L., and D. K. Singh (2002). The effect of Brucella abortus on hydrogen
peroxide and nitric oxide production by bovine polymorphnuclear cells. Vet
Res Commun 26(2): 93-102.
Jarvis, B. W., T. H. Harris., N. Qureshi., and G. A. Splitter (2002). Rough
lipopolysacharide from Brucella abortus and Escherichia coli differentially
activates the same mitogen-activated protein kinase signalintg pathways for
tumor necrosis factor alpha in RAW 264.7 macrophage-like cells. Infect
Immun 70(12): 7165-7168.
Jean, C (2005). Surviving inside macrophages: The many ways of Brucella. Res
Microbiol 157(2006): 93-98.
Jiang, X., and C. L. Baldwin (1993a). Effects of cytokines on intracellular growth of
Brucella abortus. Infect Immun 61(1): 124-134.
Jiang, X., B. Leonard., R. Bensond., and C. L. Baldwin (1993b). Macrophages control
of Brucella abortus: Role of reactive oxygen intermediates and nitric oxide.
Cell Immunol 151(2): 309-319.
Jimenez-de-Baques, M. P., A. Tenaza., A. Gross., and J. Dornand (2003). Different
responses of macrophages to smooth and rough Brucella spp.: Relationship to
virulence. Infect Immun 72(4): 2429-2433.
Jimenez-de-Baques, M. P., S. Dudal., J. Dornand., and A. Gross (2005). Cellular
bioterrorism. How Brucella corrupts macrophages physiology to promote
invasion and proliferation. Clin Immunol 114(3): 227-238.
Jinkyung, K., and G. A. Splitter (2003). Molecular host-pathogen interaction in
brucellosis: Current understanding and future approaches to vaccine
development foor mice and humans. Clin Microbiol Rev 16(1): 65-78.
Johnson, W. D., B. Mei., and Z. A. Cohn (1977). The separation, long term
cultivation and maturation of the human monocytes. J Exp Med. 146(6):
1613-1626.
Literature Cited
123
Jones, L. M., and D. T. Berman (1976a). Studies of Brucella lipopolysaccharide. Dev
Biol Stand 31(1): 62-67.
Jones, L. M., R. Diaz., and D. T. Berman (1976b). Endotoxic activity of rough
organisms of Brucella species. Infect Immun 13(6): 1638-1641.
Kabbur, M. B., N. C. Jain., and T. B. Farver (1995). Modulation of phagocytic and
oxidative burst activities of bovine neutrophils by human recombinant TNF-α,
IL-1α, IFN-γ, G-CSF, GM-CSF. Comp Hematol Int 5 (1995): 47-55.
Kariminia, A., G. Kavoossy., S. Khatami., E. Zowghi., and S. K. Ardestani (2002).
Study of interleukin-10 and interleukin-12 productions in response to
lipopolysaccharides extracted from two different Brucella strains. Comap
Immunol Microbiol 25(2): 85-93.
Keshav, S., P. Chung., G. Milon., and S. Gordon (1991). Lysozyme is an inducible
marker of macrophages activation in murine tissues as demonstrated by in situ
hybridization. J Exp Med 174(5): 1049-1058.
Khatammi, M., and S. Ardestani (2005). Biological and biochemical study of lipid A
extracted from Brucella abortus vaccine (S19) in Brucella Melitensis
virulence and Brucella melitensis vaccine (Rev1). FEBS 1: 53.
Khatun, M. M., M. A. Islam., B. K. Baek., and S. I. Lee (2009). Cellular and Humoral
immune responses and antigen recognition in sprague-Dawley rats
experimentally infected with Brucella abortus biotype 1. Asian J Anim Vet
Adv 4(6): 267-277.
Kreutzer, D. L., C. S. Buller., and D. C. Robertson (1979a). Chemical
characterization and biological properties of lipopolysaccharides isolated from
smooth and rough strains of Brucella abortus. Infect Immun 23(3): 811-818.
Kreutzer, D. L., and D. C. Robertson (1979b). Surface macromolecules and virulence
in intracellular parasitism: Comparison of cell envelope components of
smooth and rough strains of Brucella abortus. Infect Immun. 23(3): 819-828.
Literature Cited
124
Laemmli, U. K (1970). Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature (London) 227( ): 680-685.
Latimer, E., J. Simmers., N. Sriranganathan., R.M. Roopi II., G.G. Shurig., and S.M.
Boyle (1992). Brucella abortus deficient in copper/zinc superoxide dismutase
is virulent in BAL/c mice. Microb Pathogenesis 12(1970):105-113.
Lavaroni, O., N. Aguirre., V. Vanzini., C. Lugaresi., and S. Torioni-de-Echaide
(2004). Assessment of polymerase chain reaction. (PCR) to diagnose
brucellosis in a Brucella infected herd. Rev Argent Amicrobiol 36(3): 337-
338.
Leal-Klevezas, D. S., O. I. Martinez-Vazquez., A. Lopez-Merino., and J. P. Martinez-
Soriano (1995). Single-step PCR for detection of Brucella spp. from blood
and milk of infected animals. J Clin Microbiol 33(12): 3087-3090.
Lecaroz, C., M. J. Blanco-Prieto., M. A. Burrell., and C. Gamazo (2006). Intracellular
killing of Brucella melitensis in human macrophages with microsphere
encapsulated gentamycin. J Antimicrob Chemother 58(3): 549-556.
Lee, C.H., and C. M. Tsai (1999). Quantification of bacterial lipopolysaccharides by
the purpald assay: Measuring formaldehyde generated from 2-keto-3-
deoxyoctonate and heptose at the inner core by periodate oxidation. Anal
Biochem 267(1): 161-168.
Leyva-cobian, F., I. M. Outschoorn., E. C. Marin., and C. A. Dominguez (1997). The
consequences of intracellular retention of pathogen derived T-cells
independent antigens on protein presentation to T cells. Clin Immunol
Immunol 85(1): 1-15.
Liautard, J. P., A. Gross., J. Dornand., and S. Kohler (1996). Interaction between
professional phagocytes and Brucella spp. Microbiologia. 12(2): 197-206.
Limet, J., N. Bosseray., B. Garin-Bastuji., G. Dubray., and M. Plommet (1989).
Humoral immunity in mice mediated by monoclonal antibodies against the A
and M antigens of Brucella. J Med Microbiol 30(1989): 37-43.
Literature Cited
125
Lowery, O. H., N. J. Rosebrough., A. L. Farr., and R. J. Randall (1951). Protein
measurement by the Folin phenol reagent. J Biol Chem 193( 1951): 265-275.
Lupis-Urrutia L. U., A. Alonso., M. Luisa., Nieto., Y. Bayon., A. Orunda., and M. S.
Crespo (2000). Lipopolysaccharide of Brucella abortus and Brucella
melitensis induced nitric oxide synthesis in rat peritoneal macrophages. Infect
Immun 68(3): 1740-1745.
Macher, B. A., and J. C. Klock (1981). Isolation and structural characterization of
human lymphocyte and neutrophils gangliosides. J Biochem 256(4): 1968-
1974.
Malikov, V. E., D. Vskaia., and V. V. Vysotski (1989). Immunochemical
characterization and serological properties of lipopolysaccharides isolated
from various Brucella species using various extraction methods. Zh Mikrobiol
Epidemiol Immunobiol (2):22-27.
Margaret, W., N. Qureshi., N. Soeurt., and G. Splitter (2002). High levels of nitric
oxide production decrease early but increase late survival of Brucella abortus
in macrophages. Microb Pathogenesis 31(5): 221-230.
Maria, A. B., Y. Saez., and J. Balsinde (2003). Calcium-independent phospholipase
A2 is required for lysozyme secretion in U937 promonocytes. J Immunol
170(2003): 5276-5280.
Marianelli, C., A. Martucciello., M. Tarantino., I. G. Vecchio., and G. Galiero (2008).
Evaluation of molecular methods for the detection of Brucella species in
water buffalo milk. J Dairy Sci 91(10): 3779-3786.
Matthew, J. C., K. E. Norman., P. G. Hellewell., and V. C. Ridger (2001). A novel
method for isolation of neutrophils from murine blood using negative
immunomagnetic separation. Am J Pathol 159(1): 473-481.
Maurin, V. J., R. A. Biogegrain., A. Cloeckaert., A. Gross., M. T. A. Martinez., A.
Terraza., J. Liautard., S. Kohler., B. Rouot., J. Dornand., and J. P. Liautard
(2001). Major outer membrane protein OMP 25 of Brucella suis is involved in
Literature Cited
126
inhibition of tumor necrosis factor alpha production during infection of human
macrophages. Infect Immun 69(8): 4823-4830.
McGhee, J. R., and B. A. Freeman (1970). Effect of lysosomal enzymes on Brucella.
J Reticuloendothel 8(1970): 208-219.
Mc Nicholas, P.A., M. Batley., and J. W. Redmond (1987). Synthesis of methyl
pyranosides and furanosides of 3- deoxy-D-manno oct-2-ulosonic acid (kdo)
by acid catalysed solvolysin of the actylated derivatives. Carbohdr Res
165(1987): 17-22.
MeCall, T. B., N. K. Boughton., and R. M. T. Palmer (1989). Synthesis of nitric
oxide from L-arginine by neutrophils. Biochem J 261(1989): 293-296.
Milteny, S., W. Muller., W. Weichel., and A. Redbruch (1990). High gradient
magnetic cell separation with MACS. Cytometry 11(2): 231-238.
Moncada, S., R. M. J. Palmer., and E.A. Higgs (1991). Nitric oxide: physiology,
pathophysiology and pharmacology. Pharmacol Rev 43(2): 109-142.
Moreno, E., M. W. Pitt., L. M. Jones., G. G. Schurig., and D. T. Berman (1979).
Purification and characterization of smooth and rough lipopolysaccharides
from Brucella abortus. Infect Immun 138 (2): 361-369.
Moreno, E., S. L. Septh., L. M. Jones., and D. T. Berman (1981). Immunochemical
characterization of Brucella lipopolysaccharides and polysaccharides. Infect
Immun 31(1): 214-222.
Moreno, E., L. M. Jones., and D. T. Berman (1984). Immunochemical
characterization of rough Brucella lipopolysaccharide Infect Immun 43(3):
779-782.
Moreno, E., E. M. Stackebrandt., J. Dorsch., M. Wolters., Busch and H. Mayer
(1990). Brucella abortus 16S rRNA and lipid A reveal a phylogenetic
relationship with members of the alpha-2 subdivision of the class
protobacteria. J Bacteriol 172 (7): 3569-3576.
Literature Cited
127
Moriyon, I., and M. A. Montanes (1985). In vitro interactions between
lipopolysaccharides and heterologous outer membrane porin proteins. Curr
Microbiol 12 (1985): 229-234.
Nagahata, H., H. Higuchi., H. Teraoka., K. Takahashi., O. Inanami., and M.
Kuwabara (2004). Decreased apoptosis of β2- integrin deficient bovine
neutrophils. Immunol Cell Biol 82(2004): 32-37.
Nakata, M., K. Otsubo., T. Kikuchi., T. Itou., and T. Sakai (2010). Chemotechtic
properties and absence of the formyl peptide receptor in ferret (Mustela
putorius furo) neutrophils. Res Vet Sci 88(1): 56-60.
Nasir, A. A., Z. Parveen., M. A. Shah., and M. Rashid (2004). Seroprevalence of
brucellosis in animals at government and private livestock farms in Punjab.
Pakistan Vet J 24(2004): 144-146.
Nasir, A. A., Z. Parveen., and M. Ikram-ul-Haq (2005). Comparative study of
standard and modified serum agglutination tests for the diagnosis of
brucellosis in animals. Pakistan Vet J 25(2005): 33-34.
Neta, A. V., J. P. Mol., M. N. Xavier., T. A. Paixao., A. P. Lage., and R. L. Santos
(2009). Pathogenesis of bovine brucellosis. Vet J 184(2):146-155.
Nicolas, L., F. Forquet., C. de-Chastellier., Z. Mishal., G. Jolly., E. Moreno., I.
Moriyon., J. E. Heuser., H. T. He., and J. P. Gorvel (2006). Characterization
of Brucella abortus lipopolysaccharides macrodomains as mega rafts. Cell
Microbiol 8(10): 197-206.
Oh, H., B. Siano., S. Diamond (2005). Neutrophils isolation protocol. J Vis Exp
23(17): pii: 745. doi. 103791/745.
OIE (World Organization for Animal Health) (2000). Bovine brucellosis, section 2.2.
In OIE manual of standards for diagnostic tests and vaccines, 4th Ed. OIE.
Paris. 328-345.
Literature Cited
128
O’Leary, S., M. Sheahan., and T. Sweeney (2006). Brucella abortus detection by
PCR assay in blood, milk and lymph tissue of serologically positive cows. Res
Vet Sci 81(2): 170–176.
Omar, A. S., J. I. Velasquez., J. E. Ossa., and M. T. Rugels (2003). Standardization of
bovine macrophage monolayers and isolation and culture of trypnosome.
Mem Inst Oswald Cruz 98(2): 269-271.
Ouahrani, S., J. Michaux., G. Sri-Wadada., G. Bourg., R. Tournebize., M. Ramuz.,
and J. P. Liautard (1993). Identification and sequence analysis of IS6501, an
insertion sequence in Brucella spp.: relationship between genomic structure
and the number of IS6501 copies. J Gen Microbiol 139(1993): 3265-3273.
Padgett, E. L., and S. B. Pruett (1992). Evaluation of nitrite production by human
monocytes derived macrophages. Biophys Res Commun 186(2): 775-781.
Pappas, G., and Z. A. Memish (2007). Brucellosis in the Middle East: A persistent
medical, socioeconomic and political issue. J chemother 19(2007): 243-248.
Pei, J., and T. A. Ficht (2004). Brucella abortus rough mutants are cytopathic for
macrophages in culture. Infect Immun 72(1): 440-450.
Pei, J., J. E. Turse., Q. Wu., and T. A. Ficht (2006). Brucella abortus rough mutants
induce macrophages oncosis that requires bacterial protein synthesis and
direct interaction with the macrophages. Infect Immun 74(5): 2667-2675.
Pei, J., J. E. Turse., and T. A. Ficht (2008). Evidence of Brucella abortus OPS
dictating uptake and restricting NF-KB activation in murine macrophages.
Microbes Infect 10(6): 582-590.
Petra, Z., J. Matiasovic., B. Palova., H. Kudlackova., F. Kovaru., and M. Faleyna
(2008). Quantitative nitric oxide production by rat, bovine and porcine
macrophages. Sci Direct 19(1): 36-41.
Phillip, M., G. W. Pugh., and B. L. Deyoe (1989) Chemical and protective properties
of Brucella lipopolysaccharide obtain by butanol extraction Am J Vet Res
50(3): 311-317.
Literature Cited
129
Piepers, S., S. De. Vliegher., K. Demeyere., B. N. Lambrecht., A. de Kruif., E.
Meyer., and G. Opsomer (2009). Technical note: Flow cytometric
identification of bovine milk neutrophils and simultaneous quantification of
their viability. J Dairy Sci 92(2009): 626-631.
Plommet, M., A. Serre., and R. Fensterbank (1987). Vaccines, vaccination in
brucellosis. Ann Inst Pasteur Microbiol 138(1): 117-121.
Porte, F., J. P. Liautard., and S. Kohler (1999). Early acidification of phagosomes
containing Brucella suis is essential for intracellular survival in murine
macrophages. Infect Immun. 67 (8): 4041-4047.
Porte, F., A. Naroeni., S. Ouahrani-Bettache., and J. P. Liautard (2003). Role of the
Brucella suis lipopolysaccharide O-antigen in phagosomal genesis and in
inhibition of phagosome-lysosome fusion in murine macrophages. Infect
Immun 71(3):1481–1490.
Poussin, C., M. Foti., J. L. Carpentier., and J. Pugin (1998). CD14-dependent
endotoxin internalization via a macropinocytic pathway. J Biol Chem
273(1998): 20285-20291.
Price, R. E., J. W. Templeton., and L. G. Adams (1990). Survival of smooth and
rough transposon mutant strains of Brucella abortus in bovine mammary
macrophages. Vet Immunol Immunop 26(4): 353-365.
Quesenberry, M. S., and Y. C. Lee (1996). Anal Biochem 234(1996): 50-55.
Qureshi, T., J. W. Templeton., and L. G. Adams (1996). Intracellular survival of
Brucella abortus, Mycobacterium bovis BCG, Salmonella dublin and
Salmonella typhimurium in macrophages from cattle genetically resistant to
Brucella abortus. Vet Immunol Immunopathol 50(1-2): 55-65.
Rajasingh, J., E. Bord., C. Luedemann., J. Asai., H. Hamada., T. Throne., G. Quin.,
D. Goukassian., Y. Zhu., D. W. Losordo., and R. Kishore (2006). IL-10
induced TNF-α mRNA destabilized is mediated via IL-10 suppression of P38
Literature Cited
130
MAP kinase activation and inhibition of HuR expression. FASEB 20(2006):
2112-2114.
Ralston, D. J., B. S. Baer., and S. S Elberg (1961). Lysis of Brucellae by the
combined action of glycine and a lysozyme-like agent from rabbit monocytes.
J Bacteriol 82(3): 342-353.
Ramazan, M. (1996). Incidence of brucellosis in farm animals based on serology.
M.Phil Thesis Deptt Biol Sci, Quid-e-Azam Univ, Islamabad. 52 p.
Rasool, O. E., E. Freer., E. Moreno., and Jarstrand (1992). Effect of Brucella abortus
lipopolysaccharide on oxidative metabolism and lysozyme release by human
neutrophils. Infect Immun. 60(4): 1699-1702.
Redbruch, A., and D. R. Recktenwald. (1995). Detection and Isolation of rare cells.
Curr Opin Immunol 7(1995): 270-273.
Redfearn, M. S. (1960). An immunochemical study of antigens of Brucella extracted
by the westphal technique. PhD Thesis. University of Wisconsin-Madison,
WI.
Rafiei, A., S. K. Ardestani., A. Kariminia., A. Keyhani., M. Mohraz., and A.
Amirkhani (2006). Dominant Th1 cytokine production in early onset of
human brucellosis followed by switching towards Th2 along prolongation of
disease. J Infect 53(5): 315-324
Repaske, R (1958). Lysis of Gram-negative organism and the role of versene.
Biochem Biophys Acta 30(1958): 225.
Rezapour, A., and J. Majidi (2009). An improved method of neutrophils isolation in
peripheral blood of sheep. J Anim Vet Adv 8(1): 11-15.
Riley, L. K., and D. C. Robertson (1984). Ingestion and intracellular survival of
Brucella abortus in human and bovine polymorphonulclear leukocytes. Infect
Immun 46(1): 224-230.
Rittig, G., A. Kaufmann., A. Robins., B. Shaw., H. Sprenger., D. Gemsa., V.
Foulongne., B. Rouot., and J. Dornand (2003). Smooth and rough
Literature Cited
131
lipopolysaccharide phenotypes of Brucella induce different intracellular
trafficking and cytokine/chemokine release in human monocytes. J Leukov
Biol 74(2003): 1045-105.
Robert, A. C., and W. M. Nauseef (2001). Isolation and functional analysis of
neutrophils. Curr protocol Immunol Unit Number: UNIT 7.23. DOI.
10:1002/0471142735.im 0723519.
Robert, F. P (1997). Methods in Inhalation Toxicology, Ist edition Vol 1 P.136.
Robinson, J. M., and J. A. Badwey (1994). Production of active oxygen species by
phagocytic leukocytes. Immunol Ser 60(1994): 159-178.
Rodolfo, R. Z., and A. G. Mendoza (1986) Metabolic activity of phagocytes in
experimental sporotichosis. Mycopathologia 93(1986): 109-112.
Rosenthal, A. S (1978) Determinant selection and macrophage function in genetic
control of the immune response. Immunol Rev 40(1978 ): 136.
Roussel E., and M. C. Gingras (1997). Transendothelial migration induces rapid
expression on neutrophils of granule-release VLA6 used for tissue
infilteration. J Leukoc Biol 62(1997): 356-362.
Saeed, F., and E. C. Georgina (1998). Neutrophil chemiluminescence during
phagocytosis is inhibited by abnormally elevated levels of acetoacetate:
Implications for diabetic susceptibility to infections. Clin Dign Lab Immunol.
5(5): 740-743.
Sathiyaseelan, J., R. Goenka., M. Parent., R. M. Benson., E. A. Murphy., D.
Fernandesa., A. S. Foulkes., and C. L. Baldwin (2006). Treatment of Brucella-
susceptible mice with IL-12 increases primary and secondary immunity. Cell
Immunol 243(1) :1-9.
Sauret, J. M., and N. Vilissova (2002). Human brucellosis review. JABFP 15 (2002):
401-406.
Literature Cited
132
Schneemann, M., G. Schoedon., S. Hofer., N. Blau., l. Guerrero., and A. Schaffner
(1993). Nitric oxide synthase is not a constituent of the antimicrobial armature
of human mononuclear monocytes. J Infect Dis 167(1993): 1358-1363.
Schmidt, H. H., R. Seifert., and E. Bohme (1989). Formation and release of nitric
oxide from human neutrophils and HL-60 cells induced by a chemotactic
peptide, platelet activating factor and keukotriene B4. FEBS Lett 244(1989):
357-360.
Schultz, R. M., M. A. Chirigos., N. A. Pavlidis., and J. S. Youngner (1978).
Macrophage activation and antitumor activity of Brucella abortus ether
extract, Bru-pel. Cancer Treat Rep. 62(1978): 1937-1941.
Schurig, G. G., R. M. Roop II., T. Bagchi., S. Boyle., D. Buhraman., and N.
Sriranganathan (1991). Biological properties of RB51; a stable rough strain of
Brucella abortus. Vet Micriobiol 28(1991): 171-188.
Serafino, J., S. Conde., O. Zabal., and L. Samartino (2007). Multiplication of
Brucella abortus and production of nitric oxide in two macrophage cell lines
of different origin. Rev Argent Microbiol 39(4): 193-198.
Sharon. (1967). The chemical structure of lysozyme substrates and their cleavage by
the lysozyme. Vol 167. No. 1009. A discussion on the structure and function
of lysozyme (Apr, 18, 1967). pp: 402-415. Published by The Royal Society.
Sheikh, S. A., M. A. Shah., and S.A. Khan (1967). A survey to find out the incidence
of brucellosis in Pakistan. Pak J Sci 19 (1967): 189-192.
Sowa, B. A., R. P. Crawford., F. C. Heck., J. D. Williams., K. A. Kelly., and L. G.
Adams (1986). Size, charge and structural heterogeneity of Brucella abortus
lipopolysaccharides demonstrated by two dimensional gel electrophoresis.
Electrophoresis 7(1): 283-288.
Sreevatsan, S., J. B. Bookout., F. Ringpis., V. S. Perumaulla., T. A. Ficht., L. G.
Adams., S. D. Hagius., P. H. Elza., B. J. Bricker., G. K. Kumar., M.
Literature Cited
133
Rajasekhar., S. Isloor., and R. R. Barathur (2000). A multiplex approach to
molecular detection of Brucella abortus and / or Mycobacterium bovis in
cattle. J Clin Microbial 38(7): 2602-2610.
Stabili, L., R. Schnosi., M. Licciano., and A. Giangrande (2009). The mucus of
Sabella spallanzanii (Annelida, polychaeta): Its involvement in chemical
defence and fertilization success. J Exp Mar Biol Ecol 374(2): 144-149.
Stickle, J. E (1996). The neutrophils function, disorders and testing. Vet Clin North
Am Small Anim Pract 26(5): 1013-1021.
Stie, J., and A. J. Jesaitis (2007). Reorganization of the human neutrophils plasma
membrane is associated with functional priming: implications for neutrophils
preparations. J Leukocyte Biol 81(2007): 672-685.
Styrt, B., R. D. Walker., and J. C. White (1989). Neutrophil oxidative metabolism
after exposure to bacterial phospholipase C J Lab Clin Med 114 (1): 51-57.
Suarez, C. E., G. A. Pacheco., and A. M. Vigliocco (1988). Characterization of
Brucella ovis surface antigens. Vet Microbiol 18(3-4): 349-356.
Sun., Y. H., A. B. Hartigh., R. M. Tsolis., and T. A. Ficht (2006). Laboratory
maintenance of Brucella abortus. Curr Protocol Microbiol Unit No.
UNITBB.1. DOI. 10.1002/9780471729259.
Tanyel, E., A. Y. Coban., F. N. Tasdelen., N. Tulek., and B. Durupinar (2009). In
vitro effect of reactive nitrogen and oxygen intermediates alone and in
combination with some antibiotics against Brucella melitensis clinical
isolates. Mikrobiyol Bul 43(2009): 19-26.
Tsai, C. M., and C. E. Frasch (1982). A sensitive silver stain for detecting
lipopolysaccharides in polyacrylamide gels. Anal Biochem119(1): 115-119.
Ugalde, J. E., D. J. Comerci., M. S. Leguizamon., and R. A. Ugalde (2003).
Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new
live rough-phenotype vaccine, Infect Immun 71(11): 6264-6269.
Literature Cited
134
Velacso, J. A. Bengoechea., K. Brandenburg., B. Lindner., U. Seydel., D. Gonzalez.,
U. Zahringer., E. Moreno., and I. Moriyon. (2000). Brucella abortus and its
closest phylogenetic relative, Ochrabacterium spp., Differ in outer membrane
permeability and cationic peptide resistance. Infect Immun 68(6 ): 3210-3218.
Virgilio, R., C. Gonzalez., N. Munro., and S. Mendoza (1966). Electron microscopy
of staphylococcus aureus cell wall lysis. J Bacteriol 91(5): 2018-2024.
Vitale, F., G. Capra., L. Maxia., S. Reale., G. Vesco., and S. Caracappa (1998).
Detection of mycobacterium tuberclosis complex in cattle by PCR using milk,
lymph node aspirates and nasal swabs. J Clin Microbiol 36(4): 1050-1055.
Volko, E. I (1946). Surface active agents in biology and medicine. Ann N Y Acad Sci
46(1946): 451-478.
Volpato, S., S. G. Leveille., M. C. Corti., T. B. Harris., and J. M. Guralnik (2001).
The value of serum albumin and high-density lipoprotein cholesterol in
defining mortality risk in older persons with low serum cholesterol. J Am
Geriatr Soc 49(9): 1142–1147.
Voss, J. G (1964). Lysozyme lysis of Gram-negative bacteria without production of
spheroblasts. J Gen Microbiolo 35(1964): 313-317.
Waters, W. R., M. V. Palmer., R. E. Sacco., and D. L. Whipple (2002). Nitric oxide
production as an indication of mycobacterium bovis infection in white-tailed
deer. J Wildlife Dis 38(2): 338-343.
Watson, F., E. Freer., A. Weintraub., M. Ranirez., S. Lind., and E. Moreno (1994).
Immunochemical identification of Brucella abortus epitopes. Clin Diagn Lab
Immun 1(2): 206-213.
Wen, Li., A. C. Chan., J. W. Lau., D. W. Lee., E. K. Ng., J. J. Sung., and S. S. Ching
(2004). Superoxide and nitric oxide production by kupffer cells in rats with
obstructive jaundice: Effect of internal and external drainage. J Gastroenterol
Hapatol. 19(2004): 160-165.
Literature Cited
135
Westphal, O., and K. Tann (1965). Bacterial lipopolysaccharide extraction with
phenol water and further application of the procedure. Meth Carb Chem
5(1965):83-91.
Wu, A.M., L. G. Amdams., and R. Pugh (1987).Immunochemical and partial
chemical characterization of fractions of membrane bond smooth
lipopolysaccharide in protein complex from Brucella abortus. Mol Cell
Biochem 75(2): 93-102.
Wu, A. M., N. E. Mackenzie., G. Adams., and R. Pugh (1988). Structural and
immunochemical aspects of Brucella abortus endotoxins Adv Exp Med Biol
228(1988): 551-576.
Wuorela, M., S. Jalkanen., P. Toivanen., and K. Granfors (1993). Yersinia
lipopolysaccharide is modified by human monocytes. Infect Immun 61(12):
5261-5270.
Yi, E.C and M. Hackett (2000). Rapid isolation method for lipopolysaccharide and
lipid A from gram negative bacteria. Analyst 125 (4): 651-656.
Young, E. J (1983). Human brucellosis. Rev Infect Dis 5 (1983): 821-842.
Young E. J (1996). An overview of human brucellosis. Clin Infect Dis 21(1): 283-
289.
Zahler, S., C. Kowalski., A. Brosig., C. Kupatt., B. F. Becker., and E. Gerlach (1997).
The function of neutrophils isolated by a magnetic antibody cell separation
technique is not altered in comparison to a density gradient centrifugation
method. J Immunol Methods 200(1-2):173-179.
Zaitseva, M., H. Golding., J. Manischewitz., D. Webb., and B. Golding (1996).
Brucella abortus as a potential vaccine candidate: Induction of interleukin-12
secretion and enhanced B. 1. 1 and B7.2 and interleukin adhesion molecule I
surface expression in elutriated human monocytes stimulated by heat
inactivated B. abortus. Infect Immun 64(8): 3109-3117.
Literature Cited
136
Zaki, M. H., T. Akuta., and T. Akaike (2005). Nitric oxide-induced nitrative stress
involved in microbial pathogenesis. J Pahrmacol Sci 98(2): 117-129.
Zembala, M., E. M. Lemmel., and W. Uracz (1980). Activation of human monocytes
for nitroblue tetrazolium reduction and the suppression of lymphocyte
response to mitogens. Clin Exp Immunol 41(1): 309-314.
Zhan, Y. F., E. R. Stanley., and C. Cheers (1991). Prophylaxis or treatment of
experimental brucellosis with interleukin-1. Infect Immun 59(5): 1790-1794.
Zhan, Y., and C. Cheers (1998). Control of IL-12 and IFN-gamma production in
response to live or dead bacteria by TNF and other factors. J Immunol
161(3):1447-1453.
Zhu, Y. C., M. Skold., X. Liu., H. Wang., T. Kohyama., Fu. Wen., R. F. Ertl., and S.
I. Rennard (2001). Fibroblasts and monocytes macrophages contract and
degrade three-dimensional collagen gels in extended co-culture. Resp Res
2(2001): 295-299.
Zwerdling, A., M. V. Delpino., K.A. Pasquevich., P. Barrionuevo., J. Cassataro., C.
G. Samartino., and G. H. Giambartolomei (2009). Brucella abortus activates
human neutrophils. Microb Infect 11(6-7): 689-697.
Zygmunt, M. S., G. Dubray., D. R. Bundle., and M. P. Perry (1988). Purified native
haptens of Brucella abortus B19 and B. melitensis 16M reveal the
lipopolysaccharide origin of the antigens. Ann Inst Pasteur Microbiol 139(4):
421-433.
Zygmunt, M. S., J. M. Blasco., J. J. Letesson., A. Cloeckaert., and I. Moriyon (2009).
DNA polymorphism analysis of Brucella lipopolysaccharides genes reveals
marked differences in O-polysaccharide biosynthetic genes between smooth
and rough Brucella species and novel species-specific markers. BMC
Microbiol 9(2009): 92-105.
Annexure
137
Annexure
Annex 01
Tryptic Soy Broth (TSB)
Dissolve the following in one liter H2O:
17.0 g pancreatic digest of casein
3.0 g Bacto Soytone (Difco)
5.0 g NaCl
2.5 g K2HPO4
2.5 g glucose
Aliquot into bottles that can withstand autoclaving. Autoclave for 20 min to sterilize.
Store up to one month at 4ºC.
It is easier and relatively inexpensive to order powdered TSA from a commercial
supplier such as Difco or Oxoid.
Annex 02
Tryptic soy agar (TSA)
Dissolve the following in a two liter Erlenmeyer flask containing one liter H2O:
15 g pancreatic digest of casein
5 g Bacto Soytone (Difco)
5 g NaCl
15 g agar
Leave the stir bar in the flask and autoclave 20 min at 121ºC to sterilize. Prepare and
preincubate the plates as described above for PIA (see recipe). Store up to one month
at 4ºC.
TSA is widely used in microbiology, and it may prove more economical to purchase
the powdered prepared TSA from Difco or Oxoid than to prepare this medium from
scratch.
Annexure
138
Annex 03
Crystal violet stock solution
Dissolve 0.8 g ammonium oxalate in 90 mL water. Dissolve 2 g crystal violet in
20 mL absolute ethanol. Add the ammonium oxalate solution to the crystal violet
solution and pass through a sterile filter. Store indefinitely at room temperature.
Annex 04
Urea agar
Components g/liter
Gelatine peptone 1.0
D – glucose 1.0
Potassium dihydrogen phosphate 2.0
Sodium chloride 5.0
Phenol red 0.012
Agar 12.0
Final pH 6.8 and stored below 8ºC.
Annex 05
Extraction buffer
0.05 M Tris HCl, 1% NaCl, 2% (wt/vol) phenol. Ph= 7.2.
Annex 06
Extraction Mixture
Liquid Phenol Chloroform: Petroleum ether (b.p 40-60ºC) (in volume ratio
of) 2 : 5 : 8
Liquid phenol is made by adding 90 g dry phenol in 11 mL D.W.
This mixture is monophasic system if dry phenol is used and if water in phenol the
mixture will be cloudy that can be clear by adding solid phenol
Annexure
139
Annex 07
Resolving Gel Buffer
Tris base 36.3g adjust to Ph 8.8 with HCl
D. W. up to 200 mL
Annex 08
Stacking Gel Buffer
Tris base 3.0 g adjust pH 6.8 with HCl
D.W. up to 50 mL
Annex 09
Laemmli-Sample Buffer
Sample buffer was made by mixing 50 µL of 2-mercaptoethanol and 950 µL of
Laemmli sample buffer. This is stock sample buffer.
Annex 10
Resolving gel
Resolving gel was prepared in a necked flask by adding 15% resolving gel solution
(2.4g urea, 1.25 ml resolving gel buffer, 5ml 30% acrylamide solution, and 2 ml of
distilled water). 2- The solution was de-gassed using a lypholizer’s vacuum and then
15µl of 10% ammonium persulfate (APS) and 5 µl of TEMED was added.
Annex 11
Stacking gel
Stacking gel solution 4.9% (1.25 mL of stacking gel buffer, 0.8 mL of 30%
acrylamide solution, and 2.9 mL of distilled water) was prepared and degassed in a
necked flask. 50 µL of APS solution and 5µL TEMED were added subsequently in
this mixture.
Annex 12
Tank Buffer (0.025M Tris pH 8.3, 0.192 m Glycine, 0.1% SDS)
Tris base 12 g
Glycine 57.6 g
SDS 10% 40 m solution
Annexure
140
D.W up to 4 liters
Because the pH of this solution need not be checked, it can be made up directly in
large reagent bottles marked at 4.0 liters. 12-16 liters can be made at a time.
Annx 13:
Gel fixation solution.
10% glacial acetic acid, 2.5% glycerol, 40% methanol and 47.5% distilled water were
mixed properly in a glass container.
Annex 14
Sodium Periodate
To make 32 mM sodium periodate dissolve 0.0342 g sodium periodate was dissolved
in 5 mL of distilled water. While to make 64 mM sodium periodate 0.0684 mM
sodium periodate was dissolved in 5 mL distilled water.
Annex 15
136 mM Purpald Reagent
Purpald reagent was prepared in 2N NaOH. To make 2N NaOH solution, 0.8 mL of
50% NaOH was mixed with 4.2 mL of distilled water. Dissolve 0.0994 g purpald
reagent in 2N NaOH.
Annex 16
Lymphocyte separating media (LSM)
LSM (Cat # 50494, MP Biochemicals, LSM is a sterile filtered solution which
contains 6.2 g Ficoll and 9.4 g sodium diatrizoate per 100 mL. The density is
1.07700.1-1.0800 g/mL at 20oC ).
Annex 17
Composition of One Liter ACK Lysis Buffer
NH4Cl 8.024 mg/mL
KHCO3 1.001 mg/mL
EDTA. Na2.2H2O 3.722 mg/mL
Annexure
141
Annex 18
Flow buffer
10 mL of 10% sodium azide
10 mL of FBS from Invitrogen
480 mL of 1X PBS.
The total volume of flow buffer was 500 mL.
Annex 19
Anticoagulant citrate dextrose (ACD) solution for blood collection:
Trisodium citrate 22.0 g
Citric acid 8.0 g
Dextrose 24.5 g
Water 1000 mL
Volume/ 50 mL blood 7.5 mL
Initial pH 5.0
The ACD solution is prepared and filter sterilized. Blood (50 mL) is collected in 7.5
mL sterile ACD and kept at room temperature (for less than 4 hours) until purification
procedures commence.
Annex 20
Percoll stock suspension
8 mL of sodium chloride (NaCl) with sodium phosphate (NaH2PO4) and 92 mL
sterile percoll (Pharmacia LKB). The resultant solution should have a specific gravity
of about 1.1245 g/cm, osmolality of 290 mOsm/kg H2O and a pH of about 7.45 at
25ºC.
Annexure
142
Annex 21
5 % BSA:
5 g crystallized bovine serum albumin/100 mL sterile distilled water.
Filter sterilized. (RI approx= 1.345)
Annex 22
13mM Trisodium Citrate:
It is 13 mM trisodium citrate in sterile distilled water and filter sterilized. That
is 38.23 g/liter, but usually make 500 mL so:
19.11 g trisodium citrate.
500 mL Gibco water
(RI approx= 1.3388)
1.5 M NaCl with NaH2PO4:
8.77 g NaCl
1.20 g NaH2PO4
Qs to 100 mL with Gibco water and filter sterilize.
Annex 23
One liter working percoll
1000X= mL of PBS
1000 (0.8 –X)= mL of 5% BSA
100= mL of 130 mM Citrate
1X PBS was used with no citrate for the adjustment.
Working percoll solution of specific gravity 1.0770 (RI= 1.3460) had a pH of
7.2- 7.4 and osmolality of 290 – 295 /kg H2O, which was stored at 4ºC.
Annex 24
PBS- Citrate:
(use baked cylinders)
200 mL 10X stock PBS
7.44 g trisodium citrate
Annexure
143
Qs to 2000 mL with Gibco water and adjust pH to 7.4
Final pH 7.39 Osm 315 (should be 285-305)
Refractive index should be about 1.3349
Annex 25
Complete RPMI
Bottle of RPMI (about 500 mL)
5.5 mL of L glutamine
5.5 mL of MEM nonessential aminoacids
5.5 mL of sodium pyruvate
12 mL of 7.5% sodium bicarbonate (7.5 g/ 100 mL)
Filter sterilize
Annex 26
DMEM
D-glucose 4500 mg/mL
Sodium Pyruvate 110 mg/mL
No L-glutamine
Annex 27
1% Agarose gel
To make 1% agarose gel, dissolve one gram of agarose in 100 mL of distilled water.
It ias heated at low temperature for five minutes to dissolve the agarose particles
properly.
Annex 28
0.1 M Phosphate citrate Buffer
To prepare 0.1M phosphate citrate buffer mix 0.1M sodium citrate 294.12g/litre
(MW: 294.120) with 0.1M citric acid 21.01g/litre (MW: 210.14).
Annexure
144
Annex 29
0.1% NBT solution
Dissolve 0.1g NBT in 100 mL 0.15M NaCl. To make 0.1M NaCl dissolve 0.0877g
NaCl in 100 mL distilled water.
Annex 30
0.1N HCl
We usually use 36-38% HCl as stock. 36% HCl shows a density of 1.19g/ml. Hence
1000 mL weights 1190 g or contains 0.38 x 1190= 452.2 g HCl (12.39 moles/liter).
As we know, the equation M1V1=M2V2
0.1x1000/12.39= 8.1 mL (for 36% HCl).
=V1= 8.6 mL.
Hence, to make, 0.1N HCl, take 8.6 mL HCl and take the volume up to one liter by
adding distilled water
Annex 31 Griess reagent
One part 0.1% naphthylethylenediamine dihydrochloride and one part 1%
sulfanilamide contained in 5% phosphoric acid)
Annex 32
Coating Buffer
Composition of Coating Buffer
8.4 g NAHCO3
3.56 g Na2CO3
Add ddH2O up to one liter and adjust pH at 9.5
Annex 33
PBS/Tween 20 0.5% Tween-20 in PBS
Put 0.5 mL Tween 20 in 99.5 mL PBS.
Filter Sterilize.
Annexure
145
Annex 34
Blocking Solution 10% fetal bovine serum or 1% BSAin PBS. Filter before use to remove particulates.
Annex 35
DNA Lysis buffer 25 μL of proteinase K (20 mg/mL)
Annex 36 Reaction mixture for PCR The PCR reaction was performed in a 50 μL reaction mixture with following
composition:
10X Taq Polymerase buffer 5 µL, 50 mM MgCl2 5 µL, 2mM DNTPs 5 µL, 100 pm
Forward primer 2 µL, 100 pm Reverse primer 2 µL, 0.2-0.5 µg/µl DNA 4 µL,
Autoclaved deionized dH2O 27 µL.
Annex 37
1X TAE buffer
Tris base 242 g/L
Glacial Acetic Acid 57.1 mL/L
0.5M EDTA 100 mL/L
The pH of solution was adjusted up to 8.0 and stored at 4C
Annex 38
6X Gel Loading Dye
Bromophenol blue 0.25%
Xylene Cyanol FF 0.25%
Sucrose 40.0% (w/v)