ANGPTL4 E40K and T266M: Effects on Plasma Triglyceride and HDL Levels, Postprandial Responses, and CHD Risk

ISSN: 1524-4636 Copyright © 2008 American Heart Association. All rights reserved. Print ISSN: 1079-5642. Online

7272 Greenville Avenue, Dallas, TX 72514Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association.

DOI: 10.1161/ATVBAHA.108.176917 published online Oct 30, 2008; Arterioscler Thromb Vasc Biol

behalf of the EARSII Consortium and the HIFMECH Consortium Nicholas J. Wareham, Kay-Tee Khaw, Meena Kumari, Steve E. Humphries and onNicaud, Fotios Drenos, Jutta Palmen, Michael G. Marmot, S. Matthijs Boekholdt, Philippa J. Talmud, Melissa Smart, Edward Presswood, Jackie A. Cooper, Viviane

Postprandial Responses, and CHD Risk E40K and T266M. Effects on Plasma Triglyceride and HDL Levels,ANGPTL4

http://atvb.ahajournals.org/cgi/content/full/ATVBAHA.108.176917/DC1Data Supplement (unedited) at:

http://atvb.ahajournals.org

located on the World Wide Web at: The online version of this article, along with updated information and services, is

http://www.lww.com/reprintsReprints: Information about reprints can be found online at

[email protected]. E-mail:

Fax:Kluwer Health, 351 West Camden Street, Baltimore, MD 21202-2436. Phone: 410-528-4050. Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters

http://atvb.ahajournals.org/subscriptions/Biology is online at Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular

by on May 21, 2011 atvb.ahajournals.orgDownloaded from


http://atvb.ahajournals.org/cgi/content/full/ATVBAHA.108.176917/DC1

http://atvb.ahajournals.org/subscriptions/

mailto:[email protected]

http://www.lww.com/reprints


ANGPTL4 E40K and T266MEffects on Plasma Triglyceride and HDL Levels, Postprandial Responses,

and CHD Risk

Philippa J. Talmud, Melissa Smart, Edward Presswood, Jackie A. Cooper, Viviane Nicaud,Fotios Drenos, Jutta Palmen, Michael G. Marmot, S. Matthijs Boekholdt, Nicholas J. Wareham,

Kay-Tee Khaw, Meena Kumari, Steve E. Humphries,on behalf of the EARSII Consortium and the HIFMECH Consortium

Background—Angiopoietin-like 4 is a dual-function protein: an inhibitor of LPL, influencing plasma triglycerides (TGs),with angiogenic properties. We examined the association of common ANGPTL4 variants with CHD traits and risk in5 studies (13 527 individuals).

Methods and Results—The effects on plasma lipids of 6 tagging SNPs and the recently identified E40K were examinedin a study of 2772 men. Only T266M (rs1044250, MAF�30%) and E40K (MAF�2%) were significantly associatedwith TG-lowering (�10.4%, P�0.004 and �20.4%, P�0.0001), respectively. T266M no longer showed significantassociations when K40 carriers (K40�) were excluded (P�0.2). Combining data from 5 studies confirmed theTG-lowering effect of K40� (weighted mean difference: �0.12 [95% CI �0.18, �0.05] mmol/L TG P�0.0001).Surprisingly, in the 3 prospective studies, the combined OR for CHD was 1.48 (1.11 to 1.96, P�0.007), independentof TG. In individuals with a paternal history of MI (n�332) T266M, but not E40K, showed effects on postprandial AUCTG and glucose (P�0.009 and P�0.017, respectively) compared to controls (n�370).

Conclusion—Although associated with an atheroprotective lipid profile, E40K was associated with increased CHD risk,suggesting Angptl4 influences parameters beyond lipid levels. T266M showed effects only under conditions ofpostprandial stress. The functionality of these potential “loss-of-function” variants needs validation. (ArteriosclerThromb Vasc Biol. 2008;28:2321-2327.)

Key Words: ANGPTL4 � LPL � inhibition � angiogenesis � E40K � T266M � postprandial responses

The angiopoietin-like proteins (Angptl) are a family ofsecreted proteins involved in energy metabolism which

share tertiary structural domains with angiopoietins, with anN-terminal coiled-coil domain and a fibrinogen-like C-Ter.1

Angptl4 is also known as hepatic fibrinogen angiogenic-related protein, fasting induced adipose factor, and PPARangiogenic related protein, and these names collectively giveinsight into the expression and function of the protein.Angptl4 expression under conditions of fasting increases inthe liver,2 in adipose tissue in certain mouse strains,3 and isespecially prominent in heart and skeletal muscle.4 Angptl4 isthus involved in the switch from fatty acids storage to�-oxidation and energy consumption.5 Angptl4 is cleavedproteolytically in plasma and circulates as N-Ter and C-Terfragments as well as the full length protein, with the N-Terand full length protein undergoing oligomerization.6 The

involvement in lipid metabolism was demonstrated by intra-venous injection of recombinant Angptl4 into mice, resultingin an increase in plasma TG levels attributable to lipoproteinlipase (LPL) inhibition.7 In vitro studies showed that theN-Ter domain is responsible for this, by acting as anunfolding molecular-chaperone, destabilizing the LPL activedimer to inactive monomer.8 The fibrinogen-like domain inangiopoietins bind Tie2 receptors, essential for angiogenicfunction, however Angptls do not bind Tie1 or Tie2 receptorsand as such are orphan ligands.9 Angptl4 has been suggestedto regulate angiogenesis,10 but depending on the experimentalsystem both a proangiogenic role, for example during ische-mia,11 and an antiangiogenic role, as in vascular permeability,12

have been reported. Yang et al recently showed that Angptl4C-Ter inhibits angiogenesis by inhibiting the basic FGF signal-ing cascade, thus suppressing the MAP kinase pathway.13

Original received July 8, 2008; final version accepted September 23, 2008.From the Division of Cardiovascular Genetics, Department of Medicine (P.J.T., M.S., E.P., J.A.C., F.D., J.P., S.E.H.), University College London

Medical School, UK; INSERM, UMR S 525 (V.N.), Paris, France; Universite Pierre et Marie Curie-Paris6 (V.N.), UMR S 525, Paris, France; theDepartment of Epidemiology and Public Health (M.G.M., M.K.), University College London, UK; the Department of Cardiology (S.M.B.), AcademicMedical Center, Amsterdam, The Netherlands; MRC Epidemiology Unit (M.N.W.), Institute of Metabolic Science, Cambridge, UK; and the Departmentof Public Health and Primary Care (K.-T.K.), University of Cambridge, UK.

Correspondence to Philippa J. Talmud, Division of Cardiovascular Genetics, Department of Medicine, University College London Medical School, 5University St, London WC1E 6JF, United Kingdom. E-mail [email protected]

© 2008 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.108.176917

2321 by on May 21, 2011 atvb.ahajournals.orgDownloaded from


To explore the effect of ANGPTL4 variation on lipidmetabolism we identified 6 tagging SNPs (tSNPs) thatcapture �92% of the variation at that locus and examinedtheir effects individually and as haplotypes on plasma lipidsin the prospective Northwick Park Heart Study II (NPHSII).14

A single cSNP, T266M (rs1044250), showed association withTG levels. Concurrently Romeo et al identified a singlecSNP, E40K, associated with lower TG levels, with effectsreplicated in 2 further studies.15 We have examined theassociation of T266M and E40K in a total of 13 527 individ-uals, participating in 3 prospective studies, an MI case-control study and an MI offspring study, to determine effectson plasma lipids, postprandial responses, and risk of CHD.

MethodsStudy PopulationsThe recruitment protocols and baseline characteristics of the 5studies have been extensively published before.16–20 Brief details aregiven in the supplemental Methods section (available online athttp://atvb.ahajournal.org). Tagging SNP Identification and genotyp-ing are presented in supplemental Methods. Details of tagging SNPPrimers and probes for TaqMan assays are presented in supplementalTable I.

Statistical AnalysesHardy-Weinberg equilibrium was assessed using chi-squared tests.Linkage disequilibrium (LD) as measured by D� was assessed usingHaploview (http://www.broad.mit.edu/mpg/haploview/). All analy-ses were performed on normally-distributed data after appropriatetransformation (log or square root). Results are presented as meanand standard deviation (SD) (or standard error of the mean [SEM] inTable 1). t tests and analysis of variance were used, where appro-priate, to compare the changes of the continuous variables across theSNPs categories. Haplotypes were inferred using THESIAS21 ex-cluding individuals with missing values, and differences in triglyc-eride by haplotype assessed assuming an additive model. The effectof genotype on risk in NPHSII was assessed by Cox proportionalhazards models. Age and classical CHD risk factors were included ascovariates and models were stratified by general practice. In HIFMECHconditional logistic regression models were used to take account of thematching for age and center. For EARSII because of the repeatmeasures the data were also analyzed by a repeated measuresanalysis of variance. Two-way analysis of variance for repeatedmeasures (SAS PROC GLM/repeated time) were run to test for theoverall significance of postprandial measurements over time andacross genotypes. Results were combined over studies and forestplots constructed using the “metan” command in Stata. The level of

statistical significance was taken as P�0.01. No adjustments weremade for multiple testing as this has been suggested to lead to errorsin interpretation.22

ResultsThe baseline characteristics of the 5 studies are presented inTable 1. Detailed tSNP and haplotype analysis were initiallycarried out in NPHSII alone. The baseline characteristics forNPHSII men, stratified by CHD status, are published else-where.23 Men who developed CHD during follow-up(n�273) were older, had higher plasma total cholesterollevels, triglycerides, blood pressure, and lower HDL-choles-terol levels and the prevalence of smoking was higher than inthose who remained CHD free (n�2499).

tSNP Frequencies and Association With LipidTraits and BMI in NPHSIISix tSNPs, which explained �92% of the genetic variationin ANGPTL4, were identified: rs4076317 (�207C�G),rs7255436 (3991A�C), rs1044250 (6959C�T, T266M),rs11672433 (9511A�G), rs7252574 (12574C�T), andrs1808536 (12651G�A) and genotyped in the study, togetherwith E40K.15 The genotype distributions of all SNPs did notdeviate from Hardy-Weinberg equilibrium (supplemental Ta-ble II). A map of ANGPTL4 is shown in supplemental Figure1, demonstrating strong LD across the gene.

Of the 7 SNPs examined, only T266M (rs1044250) andE40K showed significant associations with lipid traits (Table2). Results for the other tSNPs are presented in supplementalTables IIIa through IIIe. M266 showed a recessive associa-tion with plasma TG levels with MM homozygotes having10.4% lower TG levels (P�0.01) compared to men homozy-gous for the common allele. The effect of E40K was larger,showing a codominant effect with heterozygote men having20.4% lower TG levels (P�0.0001) and 10% higher HDL-Clevels (P�0.007), compared to EE homozygotes. NeitherSNP was associated with effects on body mass index (datanot shown). Seven haplotypes occurred at frequencies over2%, but only haplotype H6, with rare alleles of both T266Mand E40K (frequency 0.022), was associated with 34% lowerTG-levels (P�0.0004) and borderline significantly higherHDL-C levels (by 16% P�0.02) compared to the commonhaplotype H1 (frequency�0.30; supplemental Table IV). TG

Table 1. Baseline Characteristics (mean�SEM) of Participants in Northwick Park Heart Study II, WhitehallStudy II, Epic–Norfolk Case:Control Cohort, HIFMECH, and EARSII

NPHSII WHII EPIC HIFMECH EARSII

Study Type Prospective Prospective Cohort Case/Control Offspring

n 2772 5637 3289 1091 822

BMI, kg/m2 26.2 (3.4) 26.4 (4.1) 26.4 (3.5) 26.6 (3.3) 23.3 (0.1)

% male 100% 72.9% 63.8% 100% 100%

Age, y 56.1 (3.4) 60.9 (6.0) 64.8 (7.8) 51.6 (5.4) 22.9 (0.1)

Curr smoking 28.1% 12.4% 10.7% 23.7 (259) 26%

HDL, mmol/L 0.80 (0.24) 1.52 (0.42) 1.28 (0.36) � � � 1.19 (0.01)

LDL, mmol/L 3.99 (0.96) 3.53 (0.94) 4.07 (1.02) � � � 2.79 (0.03)

TG, mmol/L 1.79 (0.95) 1.21 (0.62) 1.75 (0.88) 1.63 (0.71) 0.97 (0.01)

Cholesterol, mmol/L 5.74 (1.01) 5.75 (1.02) 6.24 (1.15) 5.46 (1.08) 4.41 (0.03)

2322 Arterioscler Thromb Vasc Biol December 2008



levels associated with haplotype H2, which carries M266independent of K40 (frequency 0.28), did not differ signifi-cantly from the common haplotype. To examine furtherwhether T266M contributed to TG-lowering independent ofE40K, whole genotypes defined by T266M and E40K were

examined. Compared to the TG levels in EE/TT men(1.83�0.98 mmol/L), EK/TM and EK/MM men had 18.6%(1.49�0.83 mmol/L; P�0.0001) and 25% (1.38�0.66 mmol/L;P�0.0001) lower TGs. When E40K men were excluded fromthe reanalysis, there was no longer a significant associationbetween T266M and TG levels (P�0.29; Table 2). BecauseANGPTL4 expression is regulated by PPARs we examinedwhether these ANGPTL4 SNPs showed interaction withPPAR variants. Neither SNP showed significant evidence ofinteraction with PPARA SNPs L162V (rs1800206) and intron7G�C (rs4253778) or PPARG P12A (rs1801282), nor LPLS447X (rs328) on lipid levels. Nor was there evidence ofinteraction with smoking on TG levels (data not shown).E40K explained 0.8% of the variance and T266M 0.3% of thevariance in TG, and together explained 0.9% of the variancein plasma TG levels.

Frequency Distribution of E40K and T266MAcross Europe (HIFMECH and EARSII)Genotypes were in Hardy-Weinberg equilibrium by region,but with a significantly higher MAF frequency of both cSNPsin the Northern recruitment centers compared to the South inboth studies (supplemental Figure IIa and IIb).

Effects of E40K and T266M on Lipid Traits inall StudiesThe effect of both E40K and T266M on TG and HDL levelswas assessed in all studies. The association of E40K, repre-sented as a Forest plot examining the weighted mean differ-ence in TG and HDL levels in K40carriers (K40�) versusE40 homozygotes, showed a consistent effect for TG levelswith K40� having a lower weighted mean of �0.12 (95% CI�0.18,�0.05) mmol/L, P�0.0001 (Figure 1a). The effect onHDL was also consistent, with K40� having significantlyhigher weighted mean HDL levels 0.09 (95% CI 0.06 to 0.12)P�0.0001 (Figure 1b). To determine the effect of T266Mindependent of E40K, K40� were excluded from the analy-sis. In confirmation of results from NPHSII, T266M (-K40�)did not show a significant effect on TG or HDL levels overall(data not shown).

Association Between of T266M and E40K andRisk of Future CHDAs shown in Figure 2, E40K was consistently associated withCHD risk with a pooled OR of 1.48 (1.11 to 1.96) P�0.007

Weighted Mean diff.-.52 .52

Study Weighted Mean diff.(95% CI) EK vs EE

-0.10 (-0.19,-0.01)Whitehall-0.17 (-0.33,-0.01)EPIC-0.37 (-0.52,-0.22)NPHSII-0.17 (-0.43,0.09)HIFMECH N-0.03 (-0.40,0.34)HIFMECH S-0.13 (-0.27,0.01)EARSII

-0.16 (-0.22,-0.10) mmol/lOverall (95% CI)

Weighted Mean diff.-.16

Study Weighted Mean diff.(95% CI) EK vs EE

0.03 (-0.00,0.07)Whitehall

0.07 (0.00,0.13)EPIC

0.10 (0.03,0.16)NPHSII

0.09 (0.03,0.15)EARSII

0.06 (0.03,0.08) mmol/lOverall (95% CI)

.16

a

b

Figure 1. a, Forest plot of weighted mean TG level differencebetween EK carriers and EE homozygotes. Data are adjusted forage, BMI, and where appropriate center, case-control status,and gender. b, Forest plot of weighted mean HDL level differ-ence between EK carriers and EE homozygotes. Data areadjusted for age, BMI, and where appropriate center, case-control status, and gender.

Table 2. Association of T266M (rs1044250) and E40K With Lipid Levels in NPHSII Men

T266M E40K

TTn�1355

TMn�1108

MMn�262 P Value (ANOVA)

EEn�2505

EKn�107 P Value (t Test)

Cholesterol, mmol/L 5.77 (1.02) 5.72 (1.03) 5.69 (0.96) 0.31 5.75 (1.02) 5.56 (1.01) 0.06

Triglyceride,* mmol/L 1.83 (0.97) 1.81 (0.95) 1.64 (0.85) 0.01 1.81 (0.96) 1.44 (0.77) �0.0001

HDL,* mmol/L 0.80 (0.25) 0.80 (0.23) 0.82 (0.27) 0.60 0.80 (0.24) 0.88 (0.25) 0.007

LDL, mmol/L 4.04 (0.96) 3.94 (0.95) 4.00 (0.97) 0.12 4.00 (0.96) 3.91 (0.97) 0.45

After exclusion of K40 carriers TT n�1273 TM n�1273 MM n�211

Triglycerides* 1.83 (0.98) 1.82 (0.95) 1.72 (0.89) 0.29

*Geometric mean (approximate SD).

Talmud et al ANGPTL4 E40K and T266M: Effects on Lipids and CHD 2323



for K40 carriers compared to E40 homozygotes, after adjust-ment for baseline TG levels, age, BMI, SBP, smoking, HDL,LDL and where appropriate gender. The effect of E40K onCHD risk is therefore independent of these classical riskfactors. After exclusion of K40 carriers, the pooled OR forT266M showed no significant association with CHD riskwith little consistency of effect (supplemental Figure III).

Association of T226M and E40K With BaselineLipids and Postprandial Responses in EARSIIThe association of the cSNPs with postprandial levels after anoral fat tolerance test (OFTT) and an oral glucose tolerancetest (OGTT) was examined in EARSII, where young men

were defined as “cases” on the basis of their father’s prematureMI and “controls” when their father had no premature MI. In therepeated measures analysis of variance, the interaction betweentime and T266M was P�0.10 for triglyceride after the OFTTand P�0.0003 for glucose after the OGTT. However there wasan interaction time*T266M*case-control status (P�0.023)with respect to triglyceride (Figure 3a). Further analyses wererun on AUC and peak of triglyceride and glucose in cases andcontrols separately. As shown in Figure 3a, there was asignificant genotype effect in cases, with M266 homozygousshowing the lowest AUC and peak TG measures (P�0.009and P�0.004, respectively). However, after further adjust-ment on fasting level, the significances were P�0.063 andP�0.033 respectively. After the glucose challenge, MMcases showed the lowest AUC glucose and peak glucosecompared to other genotypes (P�0.017 and P�0.001, re-spectively; Figure 3b). The significances were unchangedafter adjustment on fasting glucose value.

DiscussionThe principal findings of this study are a confirmation of astrong association of the E40K variant with lower TG levelsin over 13 000 individuals. There were equally robust andconsistent associations with higher HDL levels. However,despite these beneficial lipid associations we observed aborderline association of the K40 allele with increased CHDrisk, independent of effects on TG and HDL levels and ofother classical CHD risk factors. The association with mea-sures of lipid and glucose levels of T266M, independent of

Odds Ratio.5 1 2 3 4 5 6

Combined

NPHSII

EPIC

Whitehall

1.38 (1.05-1.80) p=0.02

Figure 2. Forest plot of the OR for CHD in the 3 prospectivestudies for E40K after adjustment for age, BMI, SBP, smoking,HDL, LDL, TG, and where appropriate gender and center.

0

2

4

6

8

10

0 2 3 4 6Time (hours)

Pla

sm

a G

luco

se m

mo

l/L

TTTMMM

0

2

4

6

8

10

0 2 3 4 6Time (hours)

Pla

sm

a G

luc

os

e m

mo

l/L

TT

TM

MM

0

0.5

1

1.5

2

2.5

0 2 3 4 6

Time (hours)

Plas

ma

TG (m

mol

/L)

TT

TM

MM0

0.5

1

1.5

2

2.5

0 2 3 4 6

Time (hours)

0

0.5

1

1.5

2

2.5

0 2 3 4 6

Plas

ma

TG (m

mol

/L)

TT

TM

MM

AUC TG p=0.009AUC TG p=0.91

’sesaC‘’slortnoC‘

’sesaC‘’slortnoC‘

AUC Glu p=0.017AUC Glu p= 0.16

a

b

Figure 3. a, Area under the curve for triglycerides (SE) after the oral fat tolerance test in EARSII cases and controls by T266M geno-type. *P�0.05, **P�0.01, ***P�0.001. b, Area under curve for glucose (SE) after the oral fat tolerance test in EARSII cases and controlsby T266M genotype. *P�0.05, **P�0.01, ***P�0.001.




the K40 allele, was only seen under conditions of postpran-dial stress.

Effect of ANPTL4 E40K on Baseline Lipid LevelsE40K is a rare variant and was reported to occur in only 1.3to 3.0% of whites. Heterozygotes had 12% to 27% lower TGlevels and homozygotes up to 56% lower TG levels comparedto common allele homozygotes, and there was a significantbut modest association with HDL levels.15 In the UK-basedstudies, NPHSII, WHII, and EPIC-Norfolk, E40K occurred ata similar frequency (1.6 to 2.0%) with up to 30% lower TGlevels and 31% higher HDL levels in the K40 homozygotes.E40K, however, had no effect on mean fasting glucose inWHII where fasting glucose was measured at three recalls(P�0.89, data not shown).

This cSNP showed a significant frequency gradient acrossEurope (HIFMECH), occurring at a frequency of 4.2% in theNorth and 1.5% in the South, a difference confirmed inEARSII.

A number of other genetic variants show similar frequencygradients across Europe, for example the APOE �4 allele,recently reviewed by Lao et al.24 The higher frequency of theK40 allele in the North compared to the South of Europe, andits association with increased CHD risk suggests that thisvariant might be contributing to the CHD gradient acrossEurope.

In EARSII, in the fasting state, E40K heterozygotes hadsignificantly higher HDL levels (8.5%, P�0.01) but TGswere similar, although the size of the effect in the heterozy-gous state was of a similar magnitude as reported (12%lowering) but showed only borderline statistical significance(P�0.09).

T266M, tSNPs, and Effects on Baseline Lipids andPostprandial ResponsesOf the initial 6 ANGPTL4 tSNPs identified, only T266M(rs1044250) showed a significant effect on TG levels, with a10% TG-lowering effect in NPHSII. However, the impact ofthis variant on plasma TG levels was small (R2�0.8%). Thisis comparable to that of the APOA5 S19W and �1131T�CSNPs, which together explain only 0.9% of the TG variancein NPHSII, whereas LPL S447X explains only 0.3% (Talmudand Cooper, unpublished data). This highlights the polygenicdetermination of TG levels, whereas diet is likely to play a fargreater role. Despite the fact that the tSNPs captured morethan 92% of the genetic variation in ANGPTL4, none of themshowed association with lipid levels and haplotype analysisprovided no additional TG-lowering effects other than thoseseen with the haplotype defined by both K40 and M266.However, whole genotype analysis of the 2 cSNPs showedonly a 5% difference in TG lowering in EK/TM mencompared to EK/TT men, when K40 carriers were removedfrom the analysis T266M no longer showed a significantassociation with lower TG levels. This suggests that the effectof this SNP on baseline TG levels was minimal and reflectedthe LD with E40K (D��1.0 and an R2�0.5). Thus E40K isacting as a marker or is itself the functional variant; this latterproposal is supported by the resequencing study,15 but func-tional studies are needed to verify this.

In EARSII, under the conditions of an oral fat load and anoral glucose load, those homozygous for the M266 showedbetter clearance of both TGs and glucose in the young menclassified as “cases,” on the basis of a family history ofpremature paternal MI. No significant genotype effect wasseen in the age and region matched “controls.” A similarcase:control heterogeneity of effect in EARSII was reportedfor the USF1 variants on glucose clearance,25 and togetherthese data highlight that even in these healthy young men, thegenotypes effect are influenced and magnified in those with afamily history of early MI. For E40K although a similar trendwas seen, this did not approach statistical significance.

These results, except for the postprandial responses, con-firm the findings of Staiger et al who examined 4 ANGPTL4SNPs (3 of them studied here, including T266M) and reportedthat none of them were associated with anthropometricmeasures, fasting or postprandial lipids, or a family history ofT2D.26

Although Angptl4 is induced in the fasting state it ispossible that the 2 cSNPs behave differently under fastingand fed conditions. These potential “loss-of-function” vari-ants are analogous to the angptl4 knock-out mice modelwhich delineated the role of angplt4 to TG clearance ratherthan production, in both fed and fasted state.27 The effect onglucose metabolism is less clear. Adenoviral overexpressionof Angptl4 improved glucose tolerance but led to lowerglucose levels while inducing hepatosteatosis.28 However,Mandard et al reported no effect on fasting glucose intransgenic mice, but impaired glucose tolerance after chronicfat feeding,29 which supports the results seen in EARSII withM266 showing better clearance after the OGTT than wild-type T266. Romeo et al, reported borderline effects of E40Kon fasting insulin levels but not glucose levels suggesting thatto see the predicted modest effects on fasting levels, verylarge studies will be needed.15

Effects of E40K and T266M on CHD RiskE40K, but not T266M, was associated with an unexpectedincrease in CHD risk, independent of lipid levels, with K40�showing a pooled OR for CHD of 1.38 (1.05-.80) P�0.02even after adjustment for TG levels, suggesting that theseeffects go beyond the association with TG, implicating theangiogenic properties of Angptl4.

Potential Impact of E40K and T266M onAngptl4 FunctionAngptl4 undergoes oligomerization promoted by disulphidebonds in the coiled-coil N-Ter forming variable sized multi-mers,6 which undergo proteolytic cleavage releasing aC-terminal fibrinogen domain which circulates as a stablemonomer.30 Both cleaved and full-length Angptl4 are presentin the plasma.31 These data suggest that the N-Ter coiled-coilmultimer and the monomeric C-Ter fibrinogen-like domainmay have distinct functions. It is now clear that inhibition ofLPL is mediated through the Angptl4 coiled-coil domain,which converts the active dimer to inactive monomer, de-scribed as an “unfolding molecular chaperone.”8 Both E40and T266 are conserved across human, mouse, and rat,6

supporting a potential functional role. E40 lies in the




N-terminal coil-coil domain and may therefore participate inLPL inactivation with “loss-of –functio” K40 showing lessLPL-inhibition resulting in more TG hydrolysis and lowerTG levels. T266 is positioned in the C-Ter fibrinogendomain. Under baseline conditions the association M266 withTG-lowering appears to reflect LD with E40K. However,under conditions of stress and in the fed state, we speculatethat as part of the full-length Angptl4, it may influence LPLinhibition and might reflect differentially induced expressionin the fed compared to the fasted state.

The function of the C-terminal fibrinogen domain remainsunclear. It is stable in plasma as a monomer, and it has beensuggested that it may have angiogenic properties. It has nowbeen confirmed that Angptl4 inhibits angiogenesis by sup-pressing the Raf/MEK/extracellular signal regulated kinase(ERK) signaling cascade thus blocking bFGF-induced acti-vation of MAP kinase.13 In its full length form it is possiblethat E40K influences the angiogenic properties of the C-Ter,and as a loss of function mutation would reduce the suppres-sion of the Raf/MEK/ERK signaling pathway,13 thus promot-ing angiogenesis. Although angiogenesis may be protective,because vascular endothelial growth factor (VEGF) therapyin ischemic heart disease enhances the arterioprotectivefunctions of the endothelium,32 its antiprotective effects aredemonstrated by the fact that neovascularization promotesgrowth of the atherosclerotic lesion leading to plaque desta-bilization and rupture.33 Thus if we extrapolate this to areduction in Angptl4 inhibition, this could promote neovas-cularization and thus plaque instability.

In conclusion, the replication of the association of ANGPTL4variants with lower lipid levels, yet increased CHD risk inthese studies, places Angptl4 in an interesting position,potentially influencing parameters beyond lipid levels. How-ever, this study is not without its limitations. Although weanalyzed 4 large studies, clarification of the associations withglucose levels is necessary. The tSNP approach captures thelarge majority of genetic variation, and we can rule outcomprehensively the possibility that there are other commonamino acid variants which might be functional, although theremight be upstream variants in LD which affect the level ofgene expression. Clearly, confirmation of these results isneeded, together with in vitro studies of these 2 variants tovalidate their functionality.

AcknowledgmentsThe authors thank the participants, general practitioners, and staff inNPHSII and EPIC-NORFOLK.

Sources of FundingNPHSII was supported by MRC UK, US NIH (grant NHLBI 33014),and Du Pont Pharma, Wilmington, USA. EPIC-Norfolk is supportedby MRC UK and Cancer Research UK, with additional support fromthe EU, Stroke Association, British Heart Foundation (GrantPG2000/015), Department of Health, Food Standards Agency, andWellcome Trust. The Whitehall Study II is supported by MRC UK,BHF, Department of Health, NHLBI (Hl36310); NIA (AG13196),and John D. and Catherine T McArthur Foundation. The HIFMECHstudy was supported by the European Commission (BMH4-CT96-0272), the full list of investigators is presented in supplementalinformation. EARSII was supported by the European Community(EU-Biomed 2 BMG4-98 to 3324), the full list of participants is

presented in supplemental information. P.J.T., J.A.C., J.P., F.D., andS.E.H. are supported by BHF (PG2005/014). M.S. is supported by aUnilever/BBSRC Case studentship. M.G.M. is supported by anMRC professorship.

DisclosuresNone.

References1. Kersten S. Regulation of lipid metabolism via angiopoietin-like proteins.

Biochem Soc Trans. 2005;33:1059–1062.2. Kersten S, Mandard S, Tan NS, Escher P, Metzger D, Chambon P,

Gonzalez FJ, Desvergne B, Wahli W. Characterization of the fasting-induced adipose factor FIAF, a novel peroxisome proliferator-activatedreceptor target gene. J Biol Chem. 2000;275:28488–28493.

3. Dutton S, Trayhurn P. Regulation of angiopoietin-like protein 4/fasting-induced adipose factor (Angptl4/FIAF) expression in mouse whiteadipose tissue and 3T3–L1 adipocytes. Br J Nutr. 2008;100:18–26.

4. Lichtenstein L, Berbee JF, van Dijk SJ, van Dijk KW, Bensadoun A,Kema IP, Voshol PJ, Muller M, Rensen PC, Kersten S. Angptl4upregulates cholesterol synthesis in liver via inhibition of LPL- andHL-dependent hepatic cholesterol uptake. Arterioscler Thromb Vasc Biol.2007;27:2420–2427.

5. Yu X, Burgess SC, Ge H, Wong KK, Nassem RH, Garry DJ, Sherry AD,Malloy CR, Berger JP, Li C. Inhibition of cardiac lipoprotein utilizationby transgenic overexpression of Angptl4 in the heart. Proc Natl Acad SciU S A. 2005;102:1767–1772.

6. Ge H, Yang G, Yu X, Pourbahrami T, Li C. Oligomerization state-dependent hyperlipidemic effect of angiopoietin-like protein 4. J LipidRes. 2004;45:2071–2079.

7. Yoshida K, Shimizugawa T, Ono M, Furukawa H. Angiopoietin-likeprotein 4 is a potent hyperlipidemia-inducing factor in mice and inhibitorof lipoprotein lipase. J Lipid Res. 2002;43:1770–1772.

8. Sukonina V, Lookene A, Olivecrona T, Olivecrona G. Angiopoietin-likeprotein 4 converts lipoprotein lipase to inactive monomers and modulateslipase activity in adipose tissue. Proc Natl Acad Sci U S A. 2006;103:17450–17455.

9. Morisada T, Kubota Y, Urano T, Suda T, Oike Y. Angiopoietins andangiopoietin-like proteins in angiogenesis. Endothelium. 2006;13:71–79.

10. Li C. Genetics and regulation of angiopoietin-like proteins 3 and 4. CurrOpin Lipidol. 2006;17:152–156.

11. Le Jan S, Amy C, Cazes A, Monnot C, Lamande N, Favier J, Philippe J,Sibony M, Gasc JM, Corvol P, Germain S. Angiopoietin-like 4 is aproangiogenic factor produced during ischemia and in conventional renalcell carcinoma. Am J Pathol. 2003;162:1521–1528.

12. Galaup A, Cazes A, Le Jan S, Philippe J, Connault E, Le Coz E, Mekid H,Mir LM, Opolon P, Corvol P, Monnot C, Germain S. Angiopoietin-like 4prevents metastasis through inhibition of vascular permeability and tumorcell motility and invasiveness. Proc Natl Acad Sci U S A. 2006;103:18721–18726.

13. Yang YH, Wang Y, Lam KS, Yau MH, Cheng KK, Zhang J, Zhu W, WuD, Xu A. Suppression of the Raf/MEK/ERK signaling cascade andinhibition of angiogenesis by the carboxyl terminus of angiopoietin-likeprotein 4. Arterioscler Thromb Vasc Biol. 2008;28:835–840.

14. Miller GJ, Bauer KA, Barzegar S, Cooper JA, Rosenberg RD. Increasedactivation of the haemostatic system in men at high risk of fatal coronaryheart disease. Thromb Haemost. 1996;75:767–771.

15. Romeo S, Pennacchio LA, Fu Y, Boerwinkle E, Tybjaerg-Hansen A,Hobbs HH, Cohen JC. Population-based resequencing of ANGPTL4uncovers variations that reduce triglycerides and increase HDL. NatGenet. 2007;39:513–516.

16. Miller GJ, Bauer KA, Barzegar S, Foley AJ, Mitchell JP, Cooper JA,Rosenberg RD. The effects of quality and timing of venepuncture onmarkers of blood coagulation in healthy middle-aged men. ThrombHaemost. 1995;73:82–86.

17. Marmot MG, Smith GD, Stansfeld S, Patel C, North F, Head J, White I,Brunner E, Feeney A. Health inequalities among British civil servants:the Whitehall II study. Lancet. 1991;337:1387–1393.

18. Day N, Oakes S, Luben R, Khaw KT, Bingham S, Welch A, Wareham N.EPIC-Norfolk: study design and characteristics of the cohort. EuropeanProspective Investigation of Cancer. Br J Cancer. 1999;80 Suppl1:95–103.

19. Juhan-Vague I, Morange PE, Aubert H, Henry M, Aillaud MF, AlessiMC, Samnegard A, Hawe E, Yudkin J, Margaglione M, Di Minno G,




Hamsten A, Humphries SE. Plasma thrombin-activatable fibrinolysisinhibitor antigen concentration and genotype in relation to myocardialinfarction in the north and south of Europe. Arterioscler Thromb VascBiol. 2002;22:867–873.

20. Tiret L, de Knijff P, Menzel HJ, Ehnholm C, Nicaud V, Havekes LM.ApoE polymorphism and predisposition to coronary heart disease inyouths of different European populations. The EARS Study. EuropeanAtherosclerosis Research Study. Arterioscler Thromb. 1994;14:1617–1624.

21. Tregouet DA, Barbaux S, Escolano S, Tahri N, Golmard JL, Tiret L,Cambien F. Specific haplotypes of the P-selectin gene are associated withmyocardial infarction. Hum Mol Genet. 2002;11:2015–2023.

22. Rothman KJ. No adjustments are needed for multiple comparisons. Epid.1990;1:43–46.

23. Talmud PJ, Hawe E, Miller GJ, Humphries SE. Nonfasting apoli-poprotein B and triglyceride levels as a useful predictor of coronary heartdisease risk in middle-aged UK men. Arterioscler Thromb Vasc Biol.2002;22:1918–1923.

24. Lao O, Dupanloup I, Barbujani G, Bertranpetit J, Calafell F. The Medi-terranean paradox for susceptibility factors in coronary heart diseaseextends to genetics. Ann Hum Genet. 2008;72:48–56.

25. Putt W, Palmen J, Nicaud V, Tregouet DA, Tahri-Daizadeh N, FlavellDM, Humphries SE, Talmud PJ. Variation in USF1 shows haplotypeeffects, gene:gene and gene:environment associations with glucose andlipid parameters in the European Atherosclerosis Research Study II. HumMol Genet 2004;13:1587–1597.

26. Staiger H, Machicao F, Werner R, Guirguis A, Weisser M, Stefan N,Fritsche A, Haring HU. Genetic variation within the ANGPTL4 gene isnot associated with metabolic traits in white subjects at an increased riskfor type 2 diabetes mellitus. Metab. 2008;57:637–643.

27. Koster A, Chao YB, Mosior M, Ford A, Gonzalez-DeWhitt PA, Hale JE,Li D, Qiu Y, Fraser CC, Yang DD, Heuer JG, Jaskunas SR, Eacho P.Transgenic angiopoietin-like (angptl)4 overexpression and targeted dis-ruption of angptl4 and angptl3: regulation of triglyceride metabolism.Endocrinology. 2005;146:4943–4950.

28. Xu A, Lam MC, Chan KW, Wang Y, Zhang J, Hoo RL, Xu JY, Chen B,Chow WS, Tso AW, Lam KS. Angiopoietin-like protein 4 decreasesblood glucose and improves glucose tolerance but induces hyperlipidemiaand hepatic steatosis in mice. Proc Natl Acad Sci U S A. 2005;102:6086–6091.

29. Mandard S, Zandbergen F, van Straten E, Wahli W, Kuipers F, Muller M,Kersten S. The fasting-induced adipose factor/angiopoietin-like protein 4is physically associated with lipoproteins and governs plasma lipid levelsand adiposity. J Biol Chem. 2006;281:934–944.

30. Ge H, Cha JY, Gopal H, Harp C, Yu X, Repa JJ, Li C. Differentialregulation and properties of angiopoietin-like proteins 3 and 4. J LipidRes. 2005;46:1484–1490.

31. Mandard S, Zandbergen F, Tan NS, Escher P, Patsouris D, Koenig W,Kleemann R, Bakker A, Veenman F, Wahli W, Muller M, Kersten S. Thedirect peroxisome proliferator-activated receptor target fasting-inducedadipose factor (FIAF/PGAR/ANGPTL4) is present in blood plasma as atruncated protein that is increased by fenofibrate treatment. J Biol Chem.2004;279:34411–34420.

32. Simons M, Ware JA. Therapeutic angiogenesis in cardiovascular disease.Nat Rev Drug Discov. 2003;2:863–871.

33. Moreno PR, Purushothaman KR, Fuster V, Echeverri D, Truszczynska H,Sharma SK, Badimon JJ, O’Connor WN. Plaque neovascularization isincreased in ruptured atherosclerotic lesions of human aorta: implicationsfor plaque vulnerability. Circ. 2004;110:2032–2038.




Supplement Material HIFMECH co-investigators: Anders Hamsten, Steve E. Humphries, Irène Juhan-Vague, Maurizio Margaglione, Giovanni di Minno, John Yudkin, Elena Tremoli.

EARS II Project Leader :

D. St. J. O'Reilly, UK

EARS II Project Management Group :

F. Cambien, France

G. De Backer, Belgium

D. St. J. O'Reilly, UK

M. Rosseneu, Belgium

J. Shepherd, UK

L. Tiret, France

The EARS II Group Collaborating Centres and their Associated Investigators :

Austria : H. J. Menzel, Institute for Medical Biology and Genetics, University of

Innsbruck, laboratory.

Belgium : G. De Backer, S. De Henauw, Department of Public Health, University of

Ghent, recruitment centre.

Belgium : M. Rosseneu, Laboratorium voor Lipoproteïne Chemie/Vakgroep

Biochemie, University of Ghent, laboratory.

Denmark : O. Faergeman, C. Gerdes, Medical Department I, Aarhus Amtssygehus,

Aarhus, recruitment centre.

Estonia : M. Saava, K. Aasvee, Department of Nutrition and Metabolism, Estonian

Institute of Cardiology, Tallinn, recruitment centre.

Finland : C. Ehnholm*, R. Elovainio**, J. Peräsalo, *National Public Health Institute,

**The Finnish Student Health Service, Helsinki, recruitment centre.

Finland : Y.A. Kesäniemi*, M.J. Savolainen*, P. Palomaa**, *Department of

Internal Medicine and Biocenter, Oulu, **The Finnish Student Health Service,

University of Oulu, recruitment centre.



France : L. Tiret, V. Nicaud, O. Poirier, INSERM U525, Paris, EARS data centre,

laboratory.

France : S. Visvikis, Centre de Médecine Préventive, Nancy, laboratory.

France : J. C. Fruchart, J. Dallongeville, Service de Recherche sur les Lipoprotéines

et l'Athérosclérose (SERLIA), INSERM U325, Institut Pasteur, Lille, laboratory.

Germany : U. Beisiegel, C. Dingler, Medizinische Klinik Universitäts-Krankenhaus

Eppendorf, Hamburg, recruitment centre and laboratory.

Greece : G. Tsitouris, N. Papageorgakis, G. Kolovou, Department of Cardiology,

Evangelismos Hospital, Athens, recruitment centre.

Italy : E. Farinaro, Dept. of Medical Preventive Sciences, University "Frederico II" of

Naples,

recruitment centre.

The Netherlands : L. M. Havekes, IVVO-TNO Health Research, Gaubius Institute,

Leiden, laboratory.

Portugal : M. J. Halpern, J. Canena, Instituto Superior de Ciencas da Saude, Lisbon,

recruitment centre.

Spain : L. Masana, J. Ribalta, A. Jammoul, A. LaVille, Unitat Recerca Lipids,

University Rovira i Virgili, Reus, recruitment centre and laboratory.

Switzerland : F. Gutzwiller, B. Martin, Institute of Social and Preventive Medicine,

University of Zurich, recruitment centre and laboratory.

United Kingdom : D. St J. O'Reilly, M. Murphy, Institute of Biochemistry, Royal

Infirmary, Glasgow, recruitment centre and laboratory.

United Kingdom : S.E. Humphries, P.J. Talmud, V. Gudnason, R.M. Fisher,

University College London School of Medicine, London, laboratory.

United Kingdom : D. Stansbie, A.P. Day, M. Edgar, Department of Chemical

Pathology, Royal Infirmary, Bristol, recruitment centre and laboratory.

United Kingdom : F. Kee*, A. Evans**, *Northern Health and Social Services Board,

**Department of Epidemiology and Public Health, the Queen's University of Belfast,

Belfast, recruitment centre.



Supplementary methods Northwick Park Heart Study II (NPHSII) 1: 3052 healthy men aged 50 to 61 years,

registered with 9 general medical practices, were recruited for prospective surveillance.

The study had full ethical approval with subjects giving informed consent. Repeat plasma

lipid measures were available for the first 5 years of the study. All men were free of CHD

on entry and CHD events taken as end points were fatal (sudden or not) and non-fatal MI,

plus coronary artery surgery and silent MI on the follow-up ECG. DNA was available on

2772 Caucasian men.

Whitehall II is a longitudinal study of 10,308 male and female British civil servants aged

35-852. All participants completed a self-administered health questionnaire and attended a

health-screening clinic at the time of enrolment into the study and follow-up. At phase 7

(2002-2004), 6156 participants gave consent for genetic studies. Data are used from 5666

participants who described themselves as ‘white’. Ethical approval was granted for the

study, and all participants provided written consent.

EPIC-Norfolk 3: Briefly, 25 663 healthy men and women, aged between 45 and 79 years,

were recruited from age–sex registers of general practices in Norfolk. The participants

completed a baseline questionnaire survey between 1993 and 1997, attended a clinic visit,

and were followed-up for an average of 6 years. Case ascertainment has been described

previously. Cases were those having fatal or nonfatal CAD during follow-up. All

individuals who reported a history of heart attack or stroke at the baseline visit were

excluded. Controls were subjects who remained free of cardiovascular disease during

follow-up. 2 controls were matched to each case by sex, age (within 5 years), and time of



enrollment (within 3 months) 4. All individuals have been flagged for death certification at

the UK Office of National Statistics, with vital status ascertained for the entire cohort. In

addition, participants admitted to hospital were identified using their National Health

Service number by data linkage with the East Norfolk Health Authority database, which

identifies all hospital contacts throughout England and Wales for Norfolk residents. The

study was approved by the Norwich Health Authority Ethics Committee, and all

participants provided written informed consent.

Hypercoagulability and Impaired Fibrinolytic function MECHanisms (HIFMECH) 5:

Male, Caucasian, post-MI patients aged under 60 years (n=533) and age and region-

matched controls (n=575) were recruited from four centres representing the North and

South of Europe. Ethical approval was obtained in each centre.

European Atherosclerosis Research Study II (EARSII) 6: Participants were 18 - 28 year

old men recruited from universities in 11 European countries divided into 4 regions Baltic,

UK, Middle and South. Ethical approval was obtained from each Centre. ‘Cases’ were

classified on the basis of their father having an early myocardial infarction (MI) (pre- 55

years; cases n=407) and age-matched controls (n=415). Each participant undertook a

standard 100mg oral glucose tolerance test (OGTT) and a standardised oral fat tolerance

test (OFTT; 1493Kcal).

Tagging SNP identification and genotyping

ANGPTL4 tagging SNPs (tSNPs) were identified using the CHIP-Bioinformatics utility

(http://snpper.chip.org) with the International HapMap project database

(www.hapmap.org). Six ANGPTL4 tSNPs were identified (rs4076317, rs7255436,



rs1044250, rs11672433, rs7252574, rs1808536). Rs1808536 was determined by

polymerase chain reaction (PCR) with sense (5’- ACCCACCAGAAGGAAACG -3’) and

anti-sense (5’- GTGGCACTGTATCCGGAATTG-3’) oligonucleotides and digested with

NlaIII (New England Biolabs) generating fragment sizes of 102/57bp in common

homozygotes, and 159bp in rare homozygotes. Fragments were resolved using Microtitre

Array Diagonal Gel Electrophoresis (MADGE) 7. Two negative controls were included in

each PCR run. All other SNPs including E40K (which has not as yet been given an rs

number) were genotyped using TaqMan technology (Applied Biosciences, ABI,

Warrington UK). Oligonucleotides and MGB probes are detailed in Supplementary Table

I.

SNP identification In identifying tSNPs Staiger et al initially covered the complete ANGPTL4 gene and 5kb

5’ and 2.5kb 3’ (17.75kb in total). In contrast we aimed to cover the variation in the gene

and 5kb upstream and downstream, a total of 20.25kb. Moreover, Staiger et al8 after using

the “solid spine of LD” mode within the HaploView software reduced the area they

wanted to examine from 17.75kb to a single 9kb LD block and only chose to tag the

variation within this 9kb Block. We, however, did not use this method as we wanted to

tag the total 20.25 region. Our tagging SNPs were identified from release 21, July 2006,

HapMap. A pairwise approach was adopted, with a MAF of >4% and r2 >0.8.

5 tagging SNPs were identified.

rs4076317

rs1044250

rs11672433

rs1808536

rs2278236: tagged rs7255436 and rs725274

A suitable working assay for rs2278236 could not be designed so we chose to genotype

both rs7255436 and rs725274. This resulted in the use of 6 tagging SNPs.



A suitable working assay for rs2278236 could not be designed so we chose to genotype

both rs7255436 and rs725274. This resulted in the use of 6 tagging SNPs.

References

1. Miller GJ, Bauer KA, Barzegar S, Foley AJ, Mitchell JP, Cooper JA, Rosenberg RD.

The effects of quality and timing of venepuncture on markers of blood coagulation

in healthy middle-aged men. Thromb Haemost 1995;73:82-86.

2. Marmot MG, Smith GD, Stansfeld S, Patel C, North F, Head J, White I, Brunner E,

Feeney A. Health inequalities among British civil servants: the Whitehall II study.

Lancet 1991;337:1387-1393.

3. Day N, Oakes S, Luben R, Khaw KT, Bingham S, Welch A, Wareham N. EPIC-

Norfolk: study design and characteristics of the cohort. European Prospective

Investigation of Cancer. Br J Cancer 1999;80 Suppl 1:95-103.

4. Boekholdt SM, Kuivenhoven JA, Wareham NJ, Peters RJ, Jukema JW, Luben R,

Bingham SA, Day NE, Kastelein JJ, Khaw KT. Plasma levels of cholesteryl ester

transfer protein and the risk of future coronary artery disease in apparently healthy

men and women: the prospective EPIC (European Prospective Investigation into

Cancer and nutrition)-Norfolk population study. Circ 2004;110:1418-1423.

5. Juhan-Vague I, Morange PE, Aubert H, Henry M, Aillaud MF, Alessi MC,

Samnegard A, Hawe E, Yudkin J, Margaglione M, Di Minno G, Hamsten A,

Humphries SE. Plasma thrombin-activatable fibrinolysis inhibitor antigen

concentration and genotype in relation to myocardial infarction in the north and

south of Europe. Arterioscler Thromb Vasc Biol 2002;22:867-873.

6. Tiret L, de Knijff P, Menzel HJ, Ehnholm C, Nicaud V, Havekes LM. ApoE

polymorphism and predisposition to coronary heart disease in youths of different



European populations. The EARS Study. European Atherosclerosis Research Study.

Arterioscler Thromb 1994;14:1617-1624.

7. Day IN, Humphries SE, Richards S, Norton D, Reid M. High-throughput

genotyping using horizontal polyacrylamide gels with wells arranged for microplate

array diagonal gel electrophoresis (MADGE). Biotechniques 1995;19:830-835.

8. Staiger H, Machicao F, Werner R, Guirguis A, Weisser M, Stefan N, Fritsche A,

Haring HU. Genetic variation within the ANGPTL4 gene is not associated with

metabolic traits in white subjects at an increased risk for type 2 diabetes mellitus.

Metab 2008;57:637-643.



Supplementary Table I Tagging SNP Primers and MGB probes used in NPHSII

rs number and

chr

position

Forward Primer Reverse Primer Probe 1 (VIC) Probe 2 (FAM)

rs4076317

chr19:8334999

ACCCCGCCTCCAAGACT CGCCCGAGGACGGTTTT CCCACTCCGCACCCA CCACTCGGCACCCA

rs7255436

chr19:8339196

GCTGGATTACAGGCATGAACCA GCCCCAGCGCATAGCA CCCATTCATCAAGTCT CCATTCCTCAAGTCT

rs1044250

chr19:8342164

CTGGCTGGGTCTGGAGAAG GCCAGGCGGCTGTTG CCCCCGTGATGCTA TCCCCCATGATGCTA

rs11672433

chr19:8344716

GGCAGAAGCTTAAGAAGGGAATCT GCCATGGGCTGGATCAACAT CTACTACCCACTGCAGGC ACCCGCTGCAGGC

rs7252574

chr19:8347779

CTGAGCCAGTGAAACCATGAAC GCGGTAAGTGTTCCAGCTCTT AAGGAAGAAACGCTGAACA AGGAAGAAACGTTGAACA

E40K

Chr19:8335323

TCGCCGCGCTTTGC CCGTGCGCCAGGACAT CCTGGGACGAGATGA CCTGGGACAAGATGA

by on May 21, 2011

atvb.ahajournals.orgD

ownloaded from


Supplementary Table II. Genotype distribution and allele frequencies of ANGPTL4 tSNP in NPHSII

rs number

Chr 19 position

rs4076317

8334999

promoter

C>G

E40K[13]

8335323

Exon 1

G>A

rs7255436

8339196

intron 3

A>C

rs1044250

8342164

exon 6

C>T

rs11672433

8344716

exon 7

A>G

rs725274

8347779

3’UTR

C>T

rs1808536

8347857

3’UTR

G>A

AA change E40K T266M P389P

Genotype

distribution

MAF

(95%CI) :

CC 1326

CG 1089

GG 262

0.30

(0.29-0.31)

GG 2505

GA 107

AA 0

0.02

(0.02-0.02)

AA 711

AC 1322

CC 655

0.49

(0.48-0.50)

CC 1355

CT 1108

TT 262

0.30

(0.29-0.31)

GG 1980

GA 677

AA 56

0.15

(0.14-0.16)

CC 665

CT 1341

TT 691

0.50

(0.49-0.52)

GG 1544

GA 664

AA 87

0.18

(0.17-0.19)

by on May 21, 2011


ownloaded from


Supplementary Tables III a-e Univariate analysis of seven ANGPTL4 tSNPs with mean (+SD) lipid levels and BMI in NPHSII

a

b.

rs7252574 CC N=655

CT N=1341

TT N=691

P value (ANOVA)

P value TT vs

CT/CC

Interaction with smoking

Cholesterol 5.73 (0.98)

5.74 (1.02)

5.73 (1.01)

0.98 0.85 0.74

Triglyceride* 1.76 (0.92)

1.85 (0.98)

1.75 (0.91)

0.04 0.12 0.39

HDL* 0.81 (0.25)

0.79 (0.24)

0.81 (0.24)

0.13 0.14 0.35

LDL

4.03 (0.92)

3.97 (0.96)

3.98 (0.97)

0.58 0.87 0.87

BMI*

26.3 (3.3)

26.2 (3.5)

26.3 (3.2)

0.86 0.67 0.56

rs4076317

CC N=1326

CG N=1089

GG N=262

P value (ANOVA)

P value GG vs. CG/CC



5.70 (1.02)

5.81 (0.99)

0.23 0.24 0.69


1.79 (0.95)

1.82 (0.96)

0.89 0.63 0.39

HDL* 0.80 (0.24)

0.80 (0.25)

0.82 (0.23)

0.67 0.38 0.46

LDL

4.02 (0.98)

3.92 (0.94)

4.09 (0.89)

0.04 0.13 0.70

BMI*

26.3 (3.4)

26.1 (3.4)

26.5 (3.5)

0.28 0.28 0.97



c

d

rs1808536

GG N=1544

GA N=664

AA N=87

P value (ANOVA)

P value AA vs. GA/GG



5.77 (1.01)

5.74 (1.01)

0.62 0.93 0.07


1.83 (0.99)

1.71 (0.86)

0.37 0.42 0.37

HDL* 0.81 (0.24)

0.81 (0.24)

0.82 (0.23)

0.93 0.71 0.74

LDL

3.98 (0.94)

4.00 (0.97)

4.07 (0.94)

0.79 0.52 0.44

BMI*

26.3 (3.3)

26.2 (3.5)

26.4 (2.8)

0.83 0.70 0.27

rs11672433

CC N=1980

CT N=677

TT N=56

P value (ANOVA)

P value TT vs

CC/CT



5.75 (1.05)

5.88 (1.15)

0.56 0.31 0.26


1.85 (0.97)

2.07 (1.04)

0.03 0.04 0.55

HDL* 0.80 (0.24)

0.80 (0.24)

0.79 (0.22)

0.94 0.75 0.48

LDL

4.00 (0.94)

3.99 (0.99)

4.07 (1.09)

0.88 0.63 0.95

BMI*

26.2 (3.4)

26.4 (3.4)

26.7 (3.0)

0.34 0.33 0.82



e

rs7255436

AA N=711

AC N=1322

CC N=655

P value (ANOVA)

P value CC vs

AC/AA

Interaction with

smoking Cholesterol 5.74

(1.03) 5.74

(1.03) 5.74

(0.98) 0.999 0.96 0.76


1.84 (0.98)

1.77 (0.93)

0.14 0.27 0.38

HDL* 0.81 (0.24)

0.79 (0.24)

0.81 (0.25)

0.12 0.38 0.18

LDL

3.99 (0.98)

3.98 (0.96)

4.03 (0.92)

0.63 0.34 0.87

BMI*

26.3 (3.3)

26.2 (3.5)

26.3 (3.3)

0.86 0.93 0.53



Supplementary Table IV. Association of ANGPTL4 haplotypes with plasma triglyceride and HDL levels in NPHSII as analysed using

THESIAS

Order of SNPs: rs4076317(-207C>G), E40K (118G>A), rs7255436 (3991A>C) rs1044250 (T266M; 6959C>T) , rs11672433(9511A>G),

rs725274(12,574C>T), rs1808536 (12,651 G>A)

*geometric means for triglyceride [95% CI] for two copies of the haplotype

Haplotype Frequency (

number)

Triglyceride* P value HDL-C* P value

GGCCACG

CGATATG

CGCCACA

CGACGTG

CGACATG

CAATATG

CGCCACG

0.30 (1201) 0.28 (1137) 0.16 (671) 0.14 (590) 0.05 (218) 0.022 (87) 0.021 (83)

1.86 [1.76 – 1.95]

1.75 [1.65 – 1.85]

1.76 [1.63 – 1.90]

1.97 [1.80 – 2.15]

1.75 [1.51 – 2.03]

1.23 [0.98 – 1.53]

1.89 [1.53 – 2.33]

-

0.14

0.26

0.31

0.47

0.0004

0.89

0.81 [0.78 – 0.84]

0.81 [0.78 – 0.84]

0.83 [0.78 – 0.87]

0.79 [0.75 – 0.85]

0.75 [0.68 – 0.83]

0.94 [0.79 – 1.11]

0.69 [0.59 – 0.78]

-

0.97

0.56

0.70

0.19

0.10

0.02

Global p value

P=0.01 0.10

by on May 21, 2011


ownloaded from


Supplementary Figure ISupplementary Figure IMap of ANGPTL4 showing the position of the SNPsstudies and the HaploView map showing the LD across the region.

E40K

rs40

7631

7

rs72

5543

6

rs10

4425

0

rs11

6724

33

rs72

5257

4

rs18

0853

6

by on May 21, 2011


ownloaded from


Supplementary Figure II: Minor allele frequency (95%CI) across regions in the EARSII study for E40K (a) and T266M (b).

E40K 0 0

a

0.0

0.03

0.04

0.05

MA

F

South vs rest p=0.08 p<0.0005

0

0.01

2

Baltic South

UK Middle SouthNorth

EARSII HIFMECH

T266Mb T266M

0 40.60.8

p<0.001Across regions p=0.006

F

00.20.4

Baltic UK MiddleSouth North South

MA

F

EARSII HIFMECH

by on May 21, 2011


ownloaded from


Supplementary Figure III: Forest plot of the OR for CHD in the three prospective studies for T266M (excluding E40K carriers)prospective studies for T266M (excluding E40K carriers)

EPIC

Whitehall

NPHSII

Combined 0.98 (0.69-1.40) p=0.92

Odds Ratio.5 1 2 3 4 5 6

by on May 21, 2011


ownloaded from


Documents

ANGPTL4 E40K and T266M: Effects on Plasma Triglyceride and HDL Levels, Postprandial Responses, and CHD Risk