Diversity, Distribution and Effects on Cassava Cultivars of Cassava Brown Streak Viruses in Malawi

ORIGINAL ARTICLE

Diversity, Distribution and Effects on Cassava Cultivars ofCassava Brown Streak Viruses in MalawiWillard Mbewe1,2*, P. Lava Kumar2, Wisdom Changadeya1, Pheneas Ntawuruhunga3† and James Legg4

1 University of Malawi, Chancellor College, P. O. Box 280, Zomba, Malawi

2 International Institute of Tropical Agriculture (IITA), Ibadan PMB 5320, Nigeria

3 IITA-Malawi, Chitedze Station, P. O. Box 30258, Lilongwe, Malawi

4 IITA-Tanzania, P.O. Box 34441, Dar es Salaam, Tanzania

Keywords

brown streak disease, cassava, Malawi, virus

diversity, whitefly

Correspondence

J. Legg, IITA-Tanzania, Dar es Salaam,

Tanzania.

E-mail: [email protected]

*Present address: Bvumbwe Agricultural

Research Station, P. O. Box 5748, Limbe,

Malawi

†Present address: IITA-Zambia, 32 Poplar

Road, Lusaka, Zambia

Received: April 22, 2014; accepted: Septem-

ber 26, 2014.

doi: 10.1111/jph.12339

Abstract

Cassava brown streak disease (CBSD) has emerged as a major threat to

cassava (Manihot esculenta) in eastern and southern Africa. CBSD was

first reported in Malawi in the 1950s, but little data on the distribution

and epidemiology of the disease are available. A diagnostic survey was

therefore conducted in Malawi to determine the distribution, incidence

and diversity of viruses causing the disease, and to characterize its effects

on local cassava cultivars. Diagnostic tests confirmed the presence of cas-

sava brown streak viruses (CBSVs) in 90% of leaf samples from symp-

tomatic plants. Average CBSD foliar severity was 2.5, although this

varied significantly between districts. Both Cassava brown streak virus

(CBSV) and Ugandan cassava brown streak virus (UCBSV) (genus Ipomovi-

rus, family Potyviridae) were detected from sampled plants. UCBSV was

widespread, whereas CBSV was detected only in the two most northerly

districts. The average abundance of the whitefly vector (Bemisia tabaci)

was 0.4 per plant, a low value that was partly attributable to the fact that

the survey was conducted during the cool part of the year known to be

unfavourable for B. tabaci whiteflies. Spearman’s correlation analyses

showed a positive correlation between CBSD foliar incidence and CBSD

severity and between CBSD severity and CBSD stem incidence. Of the

31 cassava varieties encountered, 20–20 was most severely affected,

whilst Mtutumusi was completely unaffected. Although data from this

study do not indicate a significant CBSD deterioration in Malawi,

strengthened management efforts are required to reduce the current

impact of the disease.

Introduction

Cassava in Malawi is produced on 149 400 ha with a

production of 3.42 million tons, making it the most

important root crop in Malawi (Sauti 1981; FAOSTAT

2012). The crop is the source of dietary energy for

over 30% of the population and is the second most

important staple in the country after maize (Benesi

2005; FAOSTAT 2012). However, high incidences of

cassava brown streak disease (CBSD) threaten the

sustainable production of the crop in Malawi with an

estimated yield loss of 70%, based on studies compar-

ing infected and healthy experimental plots (Shaba

et al. 2003; Benesi 2005). The other major viral dis-

ease in Africa, cassava mosaic disease (CMD) also

occurs widely in Malawi, although the threat is cur-

rently perceived to be lower than that of CBSD as

large numbers of strongly CMD-resistant varieties

have been developed in recent years (Dixon et al.

2003; Ntawuruhunga et al. 2013).

CBSD was first reported in Tanzania by Storey

(1936) and later in Malawi (Nichols 1950). The

� 2014 Blackwell Verlag GmbH 1

J Phytopathol

disease was subsequently shown to occur widely

through the low altitude areas of east and central

Africa – from southern Kenya, through Tanzania to

Mozambique (Legg and Raya 1998; Hillocks et al.

2002; Benesi 2005). Although, it was first believed

that the disease was restricted to coastal lowlands and

the lakeshore areas of Malawi, new outbreaks have

recently been reported in Uganda (Alicai et al. 2007),

western Kenya (Ntawuruhunga and Legg 2007; Obi-

ero et al., unpublished data), the Lake (Victoria) Zone

of Tanzania (Jeremiah and Legg 2008; Legg et al.

2011), Burundi (Bigirimana et al. 2011) and eastern

Democratic Republic of Congo (Mulimbi et al. 2012).

CBSD is caused by two distinct viruses: Cassava

brown streak virus (CBSV) and Ugandan cassava brown

streak virus (UCBSV) (Family Potyviridae; Genus Ipomo-

virus) (Mbanzibwa et al. 2009a,b; Monger et al. 2010;

Winter et al. 2010), collectively referred as cassava

brown streak viruses (CBSVs). The CBSVs are propa-

gated through infected stem cuttings (Storey 1936)

and they are also transmitted by the whitefly, Bemisia

tabaci (Genn.) in a semi-persistent manner (Maruthi

et al. 2005). CBSD symptoms in cassava are charac-

terized by feathery chlorosis on leaves, brown streaks

on stems as well as stem die-back in cases of severe

infection (Nichols 1950). The most economically

important effect of the disease is the dry corky necro-

tic rot in the tuberous roots of infected plants, which

typically becomes more severe as the plant matures

(Nichols 1950).

Although CBSD has been recognized as one of the

major constraints to sustainable cassava production in

Malawi, precise knowledge on disease distribution

and severity, economic losses, varietal reaction and

farmers’ knowledge is limited. After the first report of

CBSD in Malawi (Nichols 1950), the disease was

rediscovered in 1993 (J.M. Thresh and H. Rossel,

unpublished). Previous surveys showed that CBSD

was widespread in the major cassava producing

regions of the country (Gondwe et al. 2003), and that

the incidence and severity were highest along the

shores of Lake Malawi. These included parts of the

districts of Karonga, Rumphi, Nkhatabay, Nkhotakota,

Salima and Mangochi. More recently, both virus spe-

cies associated with CBSD were identified from

Malawi, and whilst CBSV was found to be localized in

northern lakeshore areas, UCBSV was shown to occur

more widely through lakeshore areas of Malawi

(Mbanzibwa et al. 2011).

Currently, there are efforts by the Department of

Agricultural Research Services (DARS) to develop sus-

tainable solutions for the management of the disease

through selection and conventional breeding for

resistance (I. Benesi, personal communication). How-

ever, it is essential to have precise and up-to-date

knowledge on the distribution of the disease and asso-

ciated viruses, and to determine the effect of the dis-

ease on the most widely grown cassava cultivars.

Therefore, this study was carried out to provide an in-

depth assessment of the current status of CBSD and

the response of local cultivars to it under epiphytotic

conditions.

Materials and Methods

Survey area, sampling procedure and data collection

Surveys were conducted in 2010 in twelve districts

that represent the most important cassava-growing

areas of the country, viz., Chitipa, Chiradzulu, Karo-

nga, Kasungu, Mulanje, Mzimba, Nkhatabay, Nkhota-

kota, Salima, Rumphi, Thyolo and Zomba. A total of

ninety fields were assessed, selected at intervals of

10 km along motorable roads. Thirty plants of the

predominant variety in each field were sampled fol-

lowing an ‘X’ transect (Sseruwagi et al. 2004). Inci-

dence of CBSD was recorded as the percentage of

symptomatic plants amongst the 30 assessed. The total

number of B. tabaci whitefly adults was recorded on

the top five leaves of one shoot per sampled plant,

and the average per plant was calculated for each

sampled field. Severity was considered as the degree

of chlorotic symptom expression on symptomatic

leaves (mainly occurring on the lower portion of the

plant) assessed using a scale of 1–5 (Table 1), where 1

represents no symptoms and 5 represents the most

severe symptoms (Rwegasira et al. 2011). Symptoms

on the stems were also assessed using the same scale.

Plants that were 3–6 months old were targeted for

symptom assessment, whitefly counts and sampling

Table 1 Severity rating scale for cassava brown streak disease in the

field

Sore Symptom description

1 No symptoms on leaves or stems

2 Mild vein yellowing; chlorotic blotches on leaves

No brown streaks; lesions on green stem or leaves

3 Mild vein yellowing; chlorotic blotches on leaves

Mild brown streaks; lesions on green stem portions

4 Sever; extensive vein yellowing; chlorotic blotches on leaves

Severe brown streaks; dark lesions on green stem portions

No defoliation; stem die-back and stunting

5 Severe/extensive vein yellowing; chlorotic blotches on leaves

Severe brown streaks; dark lesions on green stem portions

Defoliation, stem die-back and stunting

� 2014 Blackwell Verlag GmbH2

Cassava brown streak disease in Malawi W. Mbewe et al.

https://www.researchgate.net/publication/231167718_Re-emergence_of_Cassava_Brown_Streak_Disease_in_Uganda?el=1_x_8&enrichId=rgreq-4cd1eaed-c8a4-4d68-a0c8-16a20d110a2c&enrichSource=Y292ZXJQYWdlOzI2ODE1NjMxMjtBUzoxNjMwMjg5Njg0MTkzMzdAMTQxNTg4MDU0MzYwNQ==

https://www.researchgate.net/publication/51629780_Widespread_Occurrence_and_Diversity_of_Cassava_brown_streak_virus_(_Potyviridae__Ipomovirus_)_in_Tanzania?el=1_x_8&enrichId=rgreq-4cd1eaed-c8a4-4d68-a0c8-16a20d110a2c&enrichSource=Y292ZXJQYWdlOzI2ODE1NjMxMjtBUzoxNjMwMjg5Njg0MTkzMzdAMTQxNTg4MDU0MzYwNQ==

for virus testing. Plants at this growth stage typically

express CBSD symptoms if infected, host peak white-

fly populations and provide a good source of young

actively-growing leaflets for virus testing. In every

cassava field surveyed, at least one leaf sample was

collected from a CBSD symptomatic plant and a sec-

ond sample from an asymptomatic plant for virus test-

ing in the laboratory. Altogether 429 samples were

collected in this survey for virus testing, which were

pressed between paper sheets in a herbarium press

and allowed to dry. They were stored at room temper-

ature prior to laboratory testing for CBSVs.

Detection of cassava brown streak viruses

Total nucleic acids were extracted from about 50 mg

of dried leaf sample using a modified Cetyl trimethy-

lammonium bromide (CTAB) protocol as detailed in

Abarshi et al. (2010). Nucleic acids were quantified

using a NanodropTM (Wilmington, DE, USA) spectro-

photometer, and about 20 ng/lL nucleic acid was

used for virus detection by Reverse Transcription –Polymerase Chain Reaction (RT-PCR) as detailed in

Abarshi et al. (2012). Two sets of primers were used

for the amplification: CBSV-F3 (50 GGARCCRATG-

TAYAAATTTGC 30) and CBSV-R3 (50 AG-

GAGCWGCTARWGCAAA 30) (Abarshi et al. 2012)

which amplify a c. 283 bp fragment corresponding to

the 30 end of the coat protein encoding gene; and

CBSV-10 (50 ATCAGAATAGTGTGACTGCTG 30) and

CBSV-11 (50 CCACATTATTATCGTCACCAGG 30)(Monger et al. 2001) which amplify a c. 231 bp frag-

ment also from the 30 end of the coat protein encoding

region of the CBSV. RT-PCR reactions were per-

formed in a GeneAmp 9700 PCR� thermal cycler

(Applied Biosystems, Foster City, CA, USA) set with

the following conditions: 42°C for 30 min for reverse

transcription, followed by heat denaturation at 94°Cfor 5 min; and then 35 cycles of amplification com-

prising the following: denaturation at 94°C for 1 min,

annealing at 52°C for 1 min, extension at 72°C for

1 min, followed by a single cycle of final extension at

72°C for 10 min. The RT-PCR products were resolved

with a 1% agarose gel using TAE buffer and DNA

bands were visualized by ethidium bromide staining

(Abarshi et al. 2010) (Fig. 1). Samples were scored for

presence (CBSVs positive) or absence (CBSVs nega-

tive) of amplified products. Samples that failed to pro-

duce any PCR products were tested for the presence

of host nucleic acids by the amplification of a house

keeping gene, ribulose bisphosphate carboxylase oxy-

genase (RubiscoL) using the primer pair: RBCL-F535

(50 CTTTCCAAGGCCC

GCCTCA 30) and RBCL-R705 (50 CATCATCTTTGGTAAAATCAAGTCCA 30) specific to the large subunit of

RubiscoL. These primers amplify a fragment of c. 171 bp

(Alabi et al. 2008).

Nucleotide sequencing and phylogenetic analysis

The phylogenetic relationship of various isolates of

CBSVs from wide geographic regions was analysed

to determine the relationships of isolates analysed

in this study and also to compare them with other

isolates reported recently from Malawi (Mbanzibwa

et al. 2011). For this purpose, a selection of RT-

PCR products produced by the primer sets CBSV-

F3/R3 and CBSV-10/11 were sequenced. In all

cases, cloned sequences were sequenced in both

orientations and in duplicate. Nucleotide sequences

of each isolate were edited and compared with each

other using the bioinformatics software programmes

– VECTOR NTI ADVANCE (Invitrogen Corp., Carlsbad,

CA, USA) and BIOEDIT SEQUENCE ALIGNMENT EDITOR Ver.

7.0.5.3. A consensus sequence was obtained for

each isolate, and the sequences were verified by

BLASTN searches (http://blast.ncbi.nlm.nih.gov/Blast.

cgi). The ‘Translate a DNA Sequence’ option of Bio-

Edit was used to ascertain that the sequences were

in the correct translation frame prior to using them

for further analyses.

Thirty-three unique sequences were obtained

which represented isolates from 20 locations encom-

passing all the districts in which CBSD was detected in

this study (Tables S1–S3). Multiple sequence align-

ments were generated by ClustalW using nucleotides

of RT-PCR amplicons (about 230 to 283 bases) of the

33 isolates analysed in this study along with

sequences of 18 CBSVs previously reported from

Malawi, one reference sequence each of UCBSV and

CBSV and an outgroup sequence of Sweet potato mild

mottle virus (SPMMV, genus Ipomovirus, family Potyviri-

dae) available in NCBI’s GenBank (see Supplementary

Data S1 for alignments). Phylogenetic relationships

were inferred using the Neighbour-Joining method

(Tamura et al. 2007).

Data analysis

The CBSD incidence data were analysed using the

Kruskal–Wallis test for nonparametric data. Symptom

severity data from different cassava-growing regions

were compared by Chi-square tests. Associations

between variables were examined using the Spear-

man rank correlation coefficient. Statistical proce-

dures were all performed using Genstat for Windows


W. Mbewe et al. Cassava brown streak disease in Malawi

Release 7.1 (VSN International Ltd, Hemel Hemp-

stead, UK).

Results

Incidence and severity of CBSD

CBSD symptoms were observed in six of the 12 dis-

tricts surveyed: Karonga, Rumphi and Nkhatabay in

the north, Salima and Nkhotakota in the central

region, and Zomba in the south (Table 2). Symptoms

were largely restricted to lakeshore districts (Karonga,

Rumphi, Nkhotakota, Salima and Zomba) (Fig. 2).

The incidence of CBSD based on leaf symptoms varied

significantly amongst the surveyed districts (H = 60.5,

P < 0.001). The lowest average incidence per field

was 26.3% with the maximum of 96.7%. The maxi-

mum incidences per field were observed in Nkhatabay

and Nkhotakota districts (Table 2). The average foliar

incidence for districts along the lakeshore (with mini-

mum altitudes of <500 m above sea level) was 45.3%.

CBSD stem symptom incidence was lower than leaf

symptom incidence in all the fields, with an average

of 13.9%, but varied significantly from district to dis-

trict (H = 64.6, P < 0.001). The highest incidence

(83.3%) of stem symptoms was recorded in Nkhata-

bay district. There were significant differences in

CBSD severity between districts (v² = 13.91,

P < 0.05). Mean CBSD severity was 2.5. Nkhotakota

district had the highest severity score (2.9), whilst

Zomba had the lowest (2.0) of the CBSD-affected dis-

tricts (Table 2).

Of 429 samples collected for virus testing, 210 of

these were from symptomatic plants and 219 from

asymptomatic plants. In RT-PCR assays, 231 (54%) of

the 429 samples tested positive for CBSVs (Table 3).

Whilst 189 (90%) of the 210 symptomatic leaf

samples tested positive, CBSVs were also detected in

21 (9.5%) of 219 asymptomatic samples. All the

asymptomatic samples were from fields that had

infected plants. It is likely that these plants were

infected and yet to develop symptoms. The viruses

were predominantly distributed in low altitude areas

(below 500 m.a.s.l.) along the shores of Lake Malawi.

A total of 31 cassava varieties were encountered in

the surveyed fields. Thirty of these were traditional

landraces, and one (Sauti) was an improved variety

which had been released in the 1980s. CBSD symp-

Table 2 Summary of cassava brown streak disease survey data for Malawi districts, 2010

District

Altitude

range (masl)

Number

of fields

CBSD

severityaCBSD foliar

incidence (%)

CBSD stem

incidence (%)

Adult

whiteflies

Chiradzulo 745–780 2 – 0.0 0.0 0.21

Chitipa 1182–1377 10 – 0.0 0.0 0.28

Karonga 477–542 10 2.4 62.7 31.0 0.25

Kasungu 1042–1294 10 – 0.0 0.0 0.25

Mulanje 717–717 1 – 0.0 0.0 0.1

Mzimba 1120–1326 10 – 0.0 0.0 0.36

Nkhatabay 478–586 10 2.5 55.7 37.0 0.28

Nkhotakota 482–534 10 2.9 44.0 30.3 0.23

Rumphi 483–1132 10 2.3 52.7 25.0 0.71

Salima 485–606 10 2.4 11.7 2.2 0.7

Thyolo 717–735 2 – 0.0 0.0 1.35

Zomba 629–721 5 2 0.7 0.0 0.69

a

1 to 5 severity rating scale, 1 = no symptoms and 5 = most severe s.

(a) (b)

Fig. 1 Resolution of RT-PCR products of cas-

sava brown streak viruse (CBSV)s amplified

using the primer pairs, CBSV-F3/R3 (a) and

CBSV-10/11 (b) in 1% TAE-agarose gels. Lane

M, 100 kbp DNA size standards (Promega,

Madison, USA); Lane N, health cassava (no

amplification).



toms were observed on 24 of these varieties (Table 4).

CBSD incidence exceeded 80% in varieties Abiti-

Mdala, Chakuwawa, Mushombe and Unknown-2,

whilst symptoms were not observed on seven varie-

ties (Bushman, Chinsalanzo, Chithekere, Koloweka,

Masangwi, Mtutumusi and one unknown variety)

(Table 4). Eight of the ten fields planted with these

seven varieties were encountered in districts in which

CBSD was absent. Of the five most widely grown vari-

eties [Manyokola (= Mbundumali), Mtutumusi,

20–20, Sauti and Thipula], Manyokola and Mtutumu-

si had the lowest incidences of CBSD, whilst 20–20had a high CBSD incidence. There was no correlation

between CBSD incidence and severity, as some of the

varieties with low incidences had high severity scores

(var. Thundulu), and others with high incidence had

low severity (var. Matakolembwende and Nyajogwa).

Adult whitefly population

Bemisia tabaci adults were observed in all the cassava-

growing regions of the country, averaging 0.4 insects

per plant (Table 2), but their numbers did not differ

significantly between districts. The maximum number

of whiteflies was observed in Rumphi district (5.8/

plant). Karonga, Chitipa and Mzimba districts had the

fewest whiteflies (averaging 0.9/plant). Variety Nya-

jogwa had the highest number of adult whiteflies with

an average of 2.9 per plant whilst varieties Chitemb-

were and Koloweka had the least (0.03).

Correlation analyses

Spearman’s rank correlation coefficient tests showed

a positive correlation between CBSD foliar incidence

and CBSD severity (r = 0.90, P < 0.05) (Table 5).

However, there was no correlation between abun-

dance of whiteflies and CBSD incidence (r = 0.16,

P = 0.30). There was a negative correlation between

altitude and CBSD foliar incidence (r = �5.0,

P = 0.00) (Table 5).

Molecular diversity of cassava brown streak viruses

The phylogenetic analysis of the 33 sequences of

CBSVs from this study together with selected refer-

ence sequences revealed a clear partitioning into three

Table 3 Symptomatic and asymptomatic cassava leaf samples analysed

for cassava brown streak viruses by RT-PCR

District

Total samples

Symptomatic

samples

Asymptomatic

samples

Tested

Positive

to

CBSVsa Tested

Positive

to

CBSVs Tested

Positive

to

CBSVs

Chiradzulo 4 0 (0) 0 0 (0) 4 0 (0)

Chitipa 22 0 (0) 0 0 (0) 22 0 (0)

Karonga 78 65 (83) 56 55 (98) 22 9 (41)

Kasungu 20 0 (0) 0 0 (0) 20 0 (0)

Mulanje 2 0 (0) 0 0 (0) 2 0 (0)

Mzimba 21 0 (0) 0 0 (0) 21 0 (0)

Nkhatabay 85 58 (68) 52 48 (92) 33 6 (18)

Nkhotakota 79 54 (68) 53 46 (87) 26 1 (4)

Rumphi 37 23 (62) 21 19 (90) 16 2 (13)

Salima 59 24 (41) 22 15 (68) 37 2 (5)

Thyolo 3 0 (0) 0 0 (0) 3 0 (0)

Zomba 19 7 (37) 6 6 (100) 13 1 (8)

Total 429 231 (54) 210 189 (90) 219 21 (10)

a

Per cent positive samples presented in parenthesis.

Table 4 Predominant cultivars, incidence and severity of cassava

brown streak disease, and mean adult whitefly abundance in Malawi,

2010

Variety Name

Number

of fields

observed

CBSD

severity

CBSD foliar

incidence (%)

Mean adult

whiteflies

per plant

20–20 4 2.6 76.7 0.24

Abiti-Mdala 1 2.5 86.7 0.23

Bitilisi 2 2.9 46.7 0.12

Bushman 1 – 0.0 0.07

Chakuwawa 1 2.8 96.7 0.10

Chinsalanzo 1 – 0.0 0.17

Chitembwere 2 2 15.0 0.03

Chithekere 1 – 0.0 0.13

Gomani 2 3.2 36.7 0.45

Gomani Mutuwa 1 2.7 66.7 0.27

Koloweka 1 – 0.0 0.03

Manyokola 23 2.3 3.0 0.58

Masangwi 1 – 0.0 0.10

Maso’azungu 2 2 6.7 0.32

Matakolembwende 2 2.3 63.4 0.40

Mbawala 3 3.1 55.6 0.47

Mbundumali 14 2.9 4.3 0.41

Mchilingano 2 2 1.7 0.57

Mpapa 1 2.6 73.3 0.20

Mpuma 2 2.5 45.0 0.27

Mtutumusi 4 – 0.0 0.46

Mushombe 1 2.6 83.3 0.20

Nyajogwa 2 2.1 70.0 2.92

Nyakayera 1 2.5 63.3 0.13

Nyaukandawire 1 2.7 10.0 0.27

Nyautonga 1 2 30.0 0.47

Sauti 5 2.3 57.3 0.16

Thipula 5 2.5 44.0 0.09

Thundulu 1 3 10.0 0.30

Unknown 1 1 – 0.0 0.06

Unknown 2 1 2.5 83.3 0.03

Total/Mean 90 2.5 36.4 0.34



clusters (Fig. 3). This included one cluster each for

isolates of UCBSV and CBSV – in agreement with pre-

vious studies (Mbanzibwa et al. 2011). Nucleotide

sequence divergence between Malawian isolates

obtained through this study was 0.1–5.2% for the

CBSV cluster and 0.4–9.8% for the UCBSV cluster. In

addition, a group of five isolates formed an intermedi-

ate cluster not aligning with either UCBSV or CBSV

(see cluster 3 in Fig. 3). Nucleotide sequence diver-

gence between isolates in this intermediate cluster

was 3.4–11.7%, but there were much greater

differences with sequences of UCBSV (11.3–22.5%)

and CBSV (19.3–23.2%). Surprisingly, translated

amino acid sequences of these isolates were similar to

the most closely related sequences of CBSV (88%

identity) and UCBSV (95% identity). In spite of these

close relationships, this group of five isolates is novel

as it appears to be intermediate between CBSV and

UCBSV. Full genome sequences would reveal addi-

tional novel features and allow the proper classifica-

tion of these isolates to either CBSV, UCBSV or as a

unique species. However, as all five isolates have a

relatively high homology with UCBSV, the provi-

sional conclusion from this study is that they should

be considered as a strain of UCBSV.

An analysis of the geographical distribution of

sequenced isolates revealed that UCBSV was present

in all surveyed areas were CBSD was encountered. By

contrast, CBSV was only detected in the northern dis-

tricts of Karonga and Rumphi. Isolates of the distinct

strain of UCBSV were present both in the far south

(Zomba and Salima) and north (Karonga and Rum-

phi) of the sampled area.

Discussion

Understanding disease ecology and accurate pathogen

diagnosis are essential prerequisites for the develop-

ment of sound management strategies. As CBSD con-

tinues to threaten subsistence cassava production in

east, central and southern Africa, there is a need to

gather new information on the distribution of the dis-

ease, as well as the performance of cultivars being

Table 5 Correlation analysis for cassava brown streak disease inci-

dence, altitude and adult whiteflies based on data for 90 sites

Parameter 1 Parameter 2 Coefficient Significance

CBSD incidence B. tabaci 0.16 ns

CBSD incidence Altitude �0.50 **

CBSD incidence CBSD foliar severity 0.90 **

ns, not significant.

**Significant at P < 0.01 level.

Fig. 2 Incidence and distribution of cassava brown streak disease in

Malawi, 2010.

Fig. 3 Phylogenetic relationships amongst 33 isolates of cassava brown streak viruse (CBSV)s from Malawi and 20 isolates from NCBI GenBank (indi-

cated in italics) inferred from the ClustalW alignment of about 230–280 bp portion of the 30 terminus of the coat protein gene of CBSV or Ugandan

cassava brown streak virus, inferred by the Neighbour-Joining method (1000 replications) using MEGA4 software. Percentage bootstrap values are

shown at the branch points. Branches corresponding to partitions reproduced in <50% bootstrap replicates were collapsed. The evolutionary dis-

tances were computed using the Maximum Composite Likelihood method and are in the units of the number of base substitutions per site. All posi-

tions containing gaps and missing data were eliminated from the data set (Complete deletion option). There were a total of 162 positions in the final

data set. Isolate grouped together are labelled as cluster 1, 2 and 3. Sweet potato mild mottle virus (SPMMV, genus Potyvirus, family Potyviridae) was

included as an out-group. Details of isolates and sequence alignments are available in the supplementary data files.





grown by farmers. Effective surveillance of this dis-

ease is particularly important in view of the rapid new

spread that has been reported from the Great Lakes

region of East Africa (Alicai et al. 2007; Legg et al.

2011).

This study has reconfirmed the presence of CBSD in

Malawi along northern, central and southern lake-

shore areas of Lake Malawi as reported previously

(Nichols 1950; Gondwe et al. 2003; Shaba et al. 2003;

Mbanzibwa et al. 2010, 2011). Previous surveys

reported a CBSD incidence of 40% (Gondwe et al.

2003) compared to the overall average of 26.3%

reported here. However, the 40% described by Gon-

dwe et al. (2003) was the average incidence in lake-

shore districts in 2000–2001, when the surveys were

conducted. In the current study, mean foliar inci-

dence for these districts was 45.3%, suggesting that

there has in fact been a small increase in CBSD in this

most heavily affected part of the country. It is signifi-

cant, however, that the general distribution of CBSD

has not changed greatly in Malawi during the decade

that has separated these two surveys: in both cases,

Nkhatabay, Karonga, and Nkhotakota districts were

shown to be the most severely affected areas. Signifi-

cantly, these three districts account for nearly 50% of

total cassava production in Malawi (Ministry of Agri-

culture, 2009). Possible reasons for the high level of

disease in these three districts include the relatively

high density of cassava cultivation, which makes virus

spread between crops easier, and the low altitude and

associated higher average temperatures favouring

whitefly vector populations (Hillocks et al. 1999).

Although whitefly abundance was generally low in

the survey, highest populations were recorded in

lakeshore areas.

Previous survey data have demonstrated that nei-

ther farmers nor extension workers are aware of the

cause of CBSD (Gondwe et al. 2003). The farmers and

extension workers thought that CBSD symptoms

were due to heavy rainfall or water logging, whilst

others attributed this to old age. On the contrary,

farmers were fully aware of the other main cassava

virus disease in Malawi, cassava mosaic disease

(CMD) and were already using CMD-free materials

when planting (Gondwe et al. 2003). This is not alto-

gether surprising, as foliar symptoms of CMD are

much more obvious than those of CBSD.

The study showed a strong association between

CBSD incidence and severity, as well as an inverse

relationship between CBSD incidence and altitude.

Although the correlation with whitefly abundance

was not significant, these other significant associa-

tions nevertheless provide a strong indirect indication

that CBSD is most prevalent in agro-ecologies favour-

able for whitefly population increase. It is important

to note that the current survey was carried out at the

start of the dry season, a period of low temperature

that is known from experience elsewhere to be unfa-

vourable for whitefly population increase (Dengel

1981; Fargette et al. 1993).

The virtual absence of CBSD from higher altitude

parts of Malawi confirms that the disease is still

behaving in the manner established during the early

years of CBSD research, in which it was noted that

CBSD was not a problem at higher elevations (Nichols

1950). At that time, it was hypothesized that this was

due to the lack of transmission of the causal virus (es)

at higher altitudes. Studies in Tanzania linked

decreasing abundance of the whitefly vector with

increasing altitude (Legg and Raya 1998; Hillocks

et al. 1999). Recent outbreaks of CBSD in mid-alti-

tude areas of the Great Lakes region of East and Cen-

tral Africa (Alicai et al. 2007; Mbanzibwa et al. 2011)

have demonstrated that there is no intrinsic barrier to

the spread of the CBSD-causing viruses at elevations

above 1000 m.a.s.l. Moreover, it has been shown that

changes in abundance of the B. tabaci vector can read-

ily account for the change in CBSD dynamics at mid-

altitude elevations (Legg et al. 2011). Although such

vector changes seem to have occurred widely in many

parts of East and Central Africa (Legg et al. 2006),

data presented here suggest that this is not yet the

case in Malawi. The fact that neighbouring countries

have experienced such changes, however, emphasizes

the importance of regular surveillance exercises in

Malawi, particularly during periods favourable for

whitefly populations.

The detection of CBSVs in 90% of the symptomatic

samples reconfirms previous reports (Monger et al.

2001; Mbanzibwa et al. 2010) which proved RT-PCR

to be a powerful diagnostic tool for the detection of

CBSVs. Although diagnosis based on visual symptoms

seems to have missed approximately 10% of infec-

tions detected by RT-PCR, this relatively high detec-

tion rate suggests that visual assessments may be

appropriate for many routine surveillance applica-

tions. PCR-based diagnostics will be essential, how-

ever, where detection of early stage infections or

species-level determinations is required. Although the

reasons for the apparent undiagnosed infections were

not investigated in this study, the most probable rea-

sons are either that the plants were incorrectly

labelled as symptomatic (CBSD symptoms are widely

considered to be difficult to recognize) or that

sequence variability of infecting CBSVs led to primers

failing to amplify target sequences. It was notable that



primers CBSV10/11 detected a relatively small pro-

portion of symptomatic samples compared to CBSV-

F3/R3. This was as anticipated, as the CBSV10/11

primers were first developed in 2001 (Monger et al.

2001) at a time when there was little knowledge of

the diversity of CBSVs. By contrast, CBSV-F3/R3

(Abarshi et al., 2010) was produced much more

recently and was developed to be broadly reactive to a

wide diversity of CBSVs. In this respect, the Malawian

isolates reported here were highly diverse.

Both of these results highlight the variability within

and between species of CBSVs and indicate a high

likelihood that a proportion of CBSD-causing viruses

may not be detected by existing primer sets. The prim-

ers used were able, however, to detect a previously

undescribed strain of UCBSV, which could be further

resolved into two groups, one of which occurred in

the far south of the sampled zone (Salima and Zom-

ba), whilst the other occurred in the north (Karonga

and Rumphi). Although further studies will be

required incorporating full genome sequencing, this

does raise the intriguing possibility of the occurrence

of viruses that are intermediate between the two main

CBSV and UCBSV species groupings.

Sequence analysis indicated that there is greater

genetic variability amongst UCBSV than CBSV iso-

lates. This fact, coupled with the much wider distribu-

tion of UCBSV than CBSV suggests that UCBSV is

likely to be the endemic species that has been associ-

ated with cassava in Malawi since the earliest records

of CBSD in the country (Nichols 1950). Substantial

within country movements of cassava planting mate-

rials, which occur both informally from farmer to

farmer and officially through large-scale governmen-

tal or NGO operations, lead to the ready dispersal of

cassava-infecting virus species over relatively short

periods of time. CBSV would therefore seem to be a

relatively recent introduction from a neighbouring

country, most likely Tanzania where CBSV is the pre-

dominant species (Mbanzibwa et al. 2010; Rwegasira

et al. 2011). Comparisons of full genome sequences of

Malawian CBSVs with those of CBSVs obtained from

CBSD-affected areas of neighbouring countries (Tan-

zania and Mozambique) would likely clarify questions

about the origins of CBSVs currently occurring in

Malawi.

The study has documented the existing threat that

CBSD poses to sustainable cassava production in

Malawi. Both CMD and CBSD continue to be wide-

spread and negatively impact cassava yields, particu-

larly in the lowland zone along the shores of Lake

Malawi. This highlights the need for the development

and implementation of effective management

strategies. Sources of resistance to CMD are already

available that provide virtual immunity to infection,

and these have been widely deployed throughout East

and Central Africa to combat the CMD pandemic

(Dixon et al. 2003). By contrast, there has been less

success in developing resistance to CBSVs, although

farmer-grown varieties do differ considerably in their

response to CBSD, as highlighted in this study. Sev-

eral national and international research institutions

are seeking to develop novel conventional as well as

transgenic approaches to enhancing the resistance of

cassava to CBSVs (Munga 2008; Yadav et al. 2011). In

the interim, much could be achieved immediately

through the systematic promotion of phytosanitation

measures that would include the development of

‘clean’ virus-tested sources of planting material, isola-

tion of planting material multiplication sites and the

selection by farmers of disease-free stems when estab-

lishing a new crop. Of the 31 cassava varieties

encountered in this survey, only one was an

officially-released improved variety (Sauti). This

highlights a need to strengthen Malawi’s cassava

variety development and dissemination programme.

Amongst the local varieties, all being grown in

CBSD-affected districts were infected, albeit to

varying degrees. Significantly, the most widely grown

local variety [Manyokola (=Mbundumali)] had one of

the lowest incidences of CBSD, suggesting that this is

an important factor driving its popularity. Future

breeding efforts should aim to identify and utilize pos-

sible sources of resistance in this and other varieties

that are relatively less affected by CBSD. In the short

term, however, the health status of cassava planting

material in Malawi could be enhanced by incorporat-

ing this and similar varieties into the kinds of phyto-

sanitation schemes described above.

Although whitefly vector abundance was very

low at the time the study was conducted this is not

necessarily an indication that this is the case

throughout the year. Work elsewhere has high-

lighted the high degree of seasonal variability that

characterizes B. tabaci abundance (Fishpool et al.

1995), and populations are typically lowest during

the cool dry season. Cassava virus infection is sus-

tained through the activity of whitefly vector, and

the fact that the viruses causing both CBSD and

CMD are transmitted by B. tabaci makes it an obvi-

ous target for control. Future cassava disease control

efforts should therefore have a more specific focus

on managing populations of the vector.

Management of vector-borne plant pathogens has

been an enormous challenge due to the complex

dynamics and interactions of host plants, vectors and



viruses within a variable environment (Castle et al.

1998). With respect to CBSD, there is a clear need to

understand such factors thoroughly and to use this

knowledge to determine how they affect incidences

and severities of CBSD. This will certainly help in

implementing both proactive and reactive measures

to mitigate the disease in Malawi and elsewhere.

Acknowledgements

We are grateful to USAID for financial support to this

work received as part of the USAID administered WB

grant, no. Eem-g-00-04-00013-00, food security and

crisis mitigation programme, with CGIAR as trustee.

Many thanks to Mr. Chris Moyo and Mr. Kalenga–Maliro of the International Institute of Tropical

Agriculture (IITA, Malawi), for assisting with the diag-

nostic surveys.

References

Abarshi MM, Mohammed IU, Wasswa P, Hillocks RJ, Holt

J, Legg JP, Seal SE, Maruthi MN. (2010) Optimization of

diagnostic RT-PCR protocols and sampling procedures

for the reliable and cost-effective detection of Cassava

brown streak virus. J Virol Methods 163:353–359.

Abarshi MM, Mohammed IU, Jeremiah SC, Legg JP,

Kumar PL, Hillocks RJ, Maruthi MN. (2012) Multiplex

RT-PCR assays for the simultaneous detection of both

RNA and DNA viruses infecting cassava and the com-

mon occurrence of mixed infections by two cassava

brown streak viruses in East Africa. J Virol Methods

179:176–184.

Alabi OJ, Kumar PL, Naidu RA. (2008) Multiplex PCR for

the detection of African cassava mosaic virus and East

African cassava mosaic Cameroon virus in cassava. J

Virol Methods 154:111–120.

Alicai T, Omongo CA, Maruthi MN, Hillocks RJ, Baguma

Y, Kawuki R, Bua A, Otim-Nape GW, Colvin J. (2007)

Re-emergence of cassava brown streak disease in

Uganda. Plant Dis 91:24–29.

Benesi IRM. (2005) Characterisation of Malawian Cassava

germplasm for diversity, starch extraction and its native

and modified properties. PhD thesis. University of the

Free State Bloemfontein, South Africa. 199 pp.

Bigirimana S, Barumbanze P, Ndayihanzamaso P, Shirima

R, Legg JP. (2011) First report of cassava brown streak

disease and associated Ugandan cassava brown streak virus

in Burundi. New Dis Rep 24:26. [http://dx.doi.org/10.

5197/j.2044-0588.2011.024.026]

Castle SJ, Mowry TM, Berger PH. (1998) Differential set-

tling by Myzus persicae (Homoptera: Aphididae) on

various virus infected host plants. Ann Entomol Soc Am

91:661–667.

Dengel HJ. (1981) Untersuchengen €uber das Auftreten der

Imagines von Bemisia tabaci (Genn.) auf verschiedenen

Manoksorten. Z Pflanzenkr Pflanzenpathol Pflanzens-

chutz 88:355–366.

Dixon AGO, Bandyopadhyay R, Coyne D et al. (2003)

Cassava: from a poor farmer’s crop to a pacesetter of

African rural development. Chron Hort 43:8–14.

FAOSTAT. (2012) FAO database. Food and Agriculture

Organisation of the United Nations, Rome, Italy. Avail-

able at http://faostat.fao.org/site/567/default.aspx.

Accessed December 10, 2012.

Fargette D, Jeger M, Fauquet C, Fishpool LDC. (1993)

Analysis of temporal disease progress of African cassava

mosaic virus. Phytopathology 84:91–98.

Fishpool LDC, Fauquet C, Thouvenel JC, Burban C, Colvin

J. (1995) The phenology of Bemisia tabaci populations

(Homoptera: Aleyrodidae) on cassava in southern Cote

d’Ivoire. Bull Entomol Res 85:197–207.

Gondwe FMT, Mahungu NM, Hillocks RJ, Raya MD, Moyo

CC, Soko MM, Chipungu F, Benesi IRM. (2003) Eco-

nomic losses experienced by small-scale farmers in

Malawi due to cassava brown streak virus disease. In:

Legg JP, Hillocks RJ. (eds) Cassava Brown Streak Virus

Disease: Past, Present and Future. Proc. Int. Workshop,

Mombasa, Kenya, 27–30 October 2002. Aylesford, UK,

Natural Resources International Limited, pp. 28–35

Hillocks RJ, Raya MD, Thresh JM. (1999) Factors affecting

the distribution, spread and symptom expression of cas-

sava brown streak disease in Tanzania. Afr J Root Tuber

Crops 3:57–61.

Hillocks RJ, Thresh JM, Tomas J, Botao M, Macia R, Zavier

R. (2002) Cassava brown streak in northern Mozam-

bique. Int J Pest Manag 48:179–182.

Jeremiah SC, Legg JP. (2008) Cassava brown streak virus.

Available on: http://www.youtube.com/watch?

v=nCJdws9CnUw. Uploaded: October 25, 2008.

Legg JP, Raya M. (1998) Survey of cassava virus diseases

in Tanzania. Int J Pest Manag 44:17–23.

Legg JP, Owor B, Sseruwagi P, Ndunguru J. (2006) Cas-

sava mosaic virus disease in East and Central Africa: epi-

demiology and management of a regional pandemic.

Adv Virus Res 67:355–418.

Legg JP, Jeremiah SC, Obiero HM et al. (2011) Comparing

the regional epidemiology of the cassava mosaic and cas-

sava brown streak pandemics in Africa. Virus Res

159:161–170.

Maruthi MN, Hillocks RJ, Mtunda K, Raya MD, Muhanna

M, Kiozia H, Rekha AR, Colvin J, Thresh JM. (2005)

Transmission of Cassava brown streak virus by Bemisia

tabaci (Gennadius). J Phytopathol 153:307–312.

Mbanzibwa DR, Tian Y, Mukasa SB, Valkonen JPT.

(2009a) Cassava Brown Streak Virus (Potyviridae) encodes

a putative Maf/HAM1 pyrophosphatase implicated in

reduction of mutations and a P1 proteinase that sup-



presses RNA silencing but contain no HC-Pro’. J Virol

83:6934–6940.

Mbanzibwa DR, Tian YP, Tugume AK, Mukasa SB, Tairo F,

Kyamanywa S, Kullaya A, Valkonen JPT. (2009b)

Genetically distinct strains of cassava brown streak virus in

the Lake Victoria basin and the Indian Ocean coastal

area of East Africa. Arch Virol 154:353–359.

Mbanzibwa DR, Tian YP, Tugume AK, Mukasa SB, Tairo F,

Kyamanywa S, Kullaya A, Valkonen JPT. (2010) Simul-

taneous virus-specific detection of the two cassava

brown streak-associated viruses by RT-PCR reveals wide

distribution in East Africa, mixed infections and infec-

tions inManihot glaziovii. J Virol Methods 171:394–400.

Mbanzibwa DR, Tian Y, Tugume AK et al. (2011) Evolu-

tion of cassava brown streak disease – associated viruses.

J Gen Virol 92:974–987.

Ministry of Agriculture. (2009) Annual Report on crop

estimates. Lilongwe, Malawi.

Monger WA, Seal S, Isaac AM, Foster GD. (2001) Molecu-

lar characterisation of Cassava brown streak virus coat pro-

tein. Plant Pathol 50:527–534.

Monger WA, Alicai T, Ndunguru J et al. (2010) The com-

plete genome sequence of the Tanzanian strain of Cas-

sava brown streak virus and comparison with the Ugandan

strain sequence. Arch Virol 155:429–433.

Mulimbi W, Phemba X, Assumani B et al. (2012) First

report of Ugandan cassava brown streak virus on cassava

in Democratic Republic of Congo. New Dis Rep 26:11.

[http://dx.doi.org/10.5197/j.2044-0588.2012.026.011]

Munga TL. (2008) Breeding for cassava brown streak dis-

ease resistance in coastal Kenya. PhD Thesis. University

of KwaZulu-Natal, Pietermaritzburg, South Africa.

Nichols RFJ. (1950) The brown streak disease of cassava:

distribution, climatic effects and diagnostic symptoms.

East Afr Agric J 15:154–160.

Ntawuruhunga P, Legg JP. (2007) New spread of cassava

brown streak virus disease and its implications for the

movement of cassava germplasm in the East and Central

African region, pp. 1–6. Available at: http://c3project.

iita.org/Doc/A25-CBSDbriefMay6.pdf. Accessed on 24

April, 2013.

Ntawuruhunga P, Dixon AGO, Kanju E et al. (2013) Suc-

cessful innovations and lessons learnt in cassava

improvement and deployment by IITA in the Eastern

African Region. AJRTC 10:41–54.

Rwegasira GM, Momanyi G, Rey MEC, Kahwa G, Legg JP.

(2011) Widespread occurrence and diversity of cassava

brown streak virus (Potyviridae: Ipomovirus) in Tanza-

nia. J Phytopathol 101:1159–1167.

Sauti RFN. (1981) Problems of Cassava Production in

Malawi. Tropical Root Crops. Research Strategies for the

1980s. Otawa, Canada, IDRC, pp.104–106.

Shaba ER, Chipungu F, Mazuma EDL. (2003) Cassava

Brown Streak Virus Disease in Malawi. In: Legg JP, Hill-

ocks RJ. (eds) Cassava Brown Streak Virus Disease: Past,

Present and Future. Proceedings of an International

Workshop, Mombasa, Kenya, 27–30 October 2002.

Aylesford, UK, Natural Resources International Limited,

pp 18–19.

Sseruwagi P, Sserubombwe WS, Legg JP, Ndunguru J,

Thresh JM. (2004) Methods of surveying the incidence

and severity of cassava mosaic disease and whitefly vec-

tor populations on cassava in Africa: a review. Virus Res

100:129–142.

Storey HH. (1936) Virus diseases of East African plants.

VI-A progress report on studies of the disease of cassava.

East Afr Agric J 2:34–39.

Tamura K, Dudley J, Nei M, Kumar S. (2007)

MEGA4: molecular evolutionary genetics analysis

(MEGA) software version 4.0. Mol Biol Evol

24:1596–1599.

Winter S, Koerbler M, Stein B, Pietruszka A, Butgereitt A.

(2010) Analysis of cassava brown streak viruses reveals

the presence of distinct virus species causing cassava

brown streak disease in East Africa. J Gen Virol

83:6934–6940.

Yadav JS, Ogwok E, Wagaba H, Patil BL, Bagewadi B, Ali-

cai T, Gaitan-Solis E, Taylor NJ, Fauquet CM. (2011)

RNAi-mediated resistance to Cassava brown streak Uganda

virus in transgenic cassava. Mol Plant Pathol 12:677–687.

Supporting Information

Additional Supporting Information may be found in

the online version of this article:

Table S1. Locational details of samples taken for

sequencing.

Table S2. Details of CBSV and UCBSV isolates used

for phylogenetic analysis.

Table S3. Summary of CBSVs isolates sequenced

during the survey.

Data S1. ClustalW allignment of CBSV & UCBSV

sequences.



Documents

Diversity, Distribution and Effects on Cassava Cultivars of Cassava Brown Streak Viruses in Malawi